The EMBO Journal vol.9 no.2 pp.551 - 558, 1990

A novel type of + 1 frameshift suppressor: a basesubstitution in the anticodon stem of a yeastmitochondrial serine-tRNA causes frameshift suppression

Alexander Huttenhofer'1,Brigitte Weiss-Brummer2, Guy Dirheimer'and Robert P.Martin1

'Institut de Biologie Mol6culaire et Cellulaire du CNRS, Laboratoirede Biochimie, and Universite Louis Pasteur, 15 rue R. Descartes,67084 Strasbourg, France and 2lnstitut fur Genetik und Mikrobiologie,Universitat Munchen, Maria-Ward-Strasse la, D-8000 Munchen 19,FRG

Communicated by J.F.Atkins

We have identified a spontaneous mitochondrial mutation,mfs-1 (mitochondrial frameshift suppressor-1), whichsuppresses a +1 frameshift mutation localized in theyeast mitochondrial oxil gene. The suppressor strainexhibits a single base change (C to U) at position 42of the mitochondrial serine-tRNA (UCN). To ourknowledge, this is the first reported case showingthat a mutation in the anticodon stem of a tRNA cancause frameshift suppression. The expression and amino-acylation of the mutant tRNASer(UCN are not signi-ficantly affected. However, the base change at position42 has two effects: first, residue U27 of the mutant tRNAis not modified to pseudouridine as observed in wild-typetRNAser(UcN. Second, the base change and/or the lackof modification of U27 leads to an alteration in thesecondary/tertiary structure of the mutant tRNA. It ispossible that there are such structural changes in theanticodon loop that enable the tRNA to read a four basecodon, UCCA, thus restoring the wild-type readingframe.Key words: + 1 frameshift suppressor/anticodon stem alter-ation/tRNAserUCN/yeast mitochondria

IntroductionThe roles of translational macromolecules in maintaining theaccuracy of the reading frame can be studied by externalsuppressors of frameshift mutations. The accuracy of readingframe maintenance is mostly affected by mutations in tRNAs(for a review, see Roth, 1981) but there are also someinstances in which mutant forms of elongation factors-Tu(EF-Tu) in Escherichia coli and Salmonella typhimuriumcause suppression of frameshift mutations (Hughes et al.,1987).Recently, we have isolated the suppressor mutation mfs-J

(mitochondrial frameshift suppressor-1), which is capableof suppressing the mitochondrial frameshift mutation M563 1in Saccharomyces cerevisiae strain HS2-563 1 (Weiss-Brummer et al., 1989). The M5631 mutation has beenshown previously to be a + 1T insertion in the mitochondrialgene oxil, which codes for subunit II of cytochrome coxidase (Fox and Weiss-Brummer, 1980).The suppressor mutation mfs-J was isolated in a strain,

HS2-563 1, carrying the parr-454 mutation to quieten abackground of natural frameshifting (- 20%) in the originalmutant M5631 (Weiss-Brummer et al., 1989). Thepar"-454 mutation within the mitochondrial 15S rRNA genewas shown to reduce the level of natural frameshifting from20 to - 10%, thereby facilitating isolation of suppressors(Weiss-Brummer and Huttenhofer, 1989). As the presenceof the par-454 mutation would make it difficult to evaluatesuppression under conditions of normal ribosome function,we have also tested the suppressor ability of mfs-J in a par'(wild-type allele of parr454) background. It could be shownthat the mfs-J suppressor acts in both pars and pa'-454backgrounds with equal efficiency and is allele specific forthe M563 1 mutation. No other known mitochondrialframeshift, missense or nonsense mutations are suppressedby mfs-J (Weiss-Brummer et al., 1989).The suppressor mutation mfs-J is mitochondrially inherited

(Weiss-Brummer et al., 1989). While nuclear genes codefor most of the components of the mitochondrial proteinsynthesizing system, the mitochondrial DNA codes for tworRNAs (21S RNA and 15S RNA), 24 tRNAs, a 9S RNAinvolved in tRNA processing, ribosomal protein (varl) andsome polypeptide components of the respiratory chain (fora review, see Dujon, 1983). The mutation mfs-I was mappedby genetic and molecular analyses to the tRNAS'r-varlregion of the mitochondrial genome (Weiss-Brummer et al.,1989).This paper shows that an alteration in the mitochondrial

tRNAser(UCN) causes suppression of the mitochondrial +1frameshift mutation M563 1. Many suppressors of +1frameshift mutations have been identified as tRNAs withincreased anticodon loop size (Bossi and Smith, 1984; Curranand Yarus, 1987). The data presented here show thatframeshift suppression can also be caused by a tRNA withnormal anticodon loop size, but with an alteration in theanticodon stem.

ResultsSequence analysis of the mfs- 1 suppressor mutationThe mfs-J suppressor mutation has been mapped to a 2 kbfragment containing the tRNASer-varl region (Weiss-Brummer et al., 1989). This region codes for the UCNreading tRNAser and for the varl protein, the onlymitochondrially encoded ribosomal protein. The 2 kb HaeHIfragments of the suppressor strain SEG15 (carrying the mfs-Jmutation) and of the original strain HS2-563 1 (for genotypes,see Table I) were cloned into M13mp8 and sequenced overtheir entire lengths (see Materials and methods). Comparisonof the nucleotide sequences obtained from each strainrevealed only one difference: a base alteration from C toT at position 124 of the region coding for the tRNAser (cN)in the suppressor strain SEG15 (Figure 1; Figure 2). TheC to T base alteration of the tRNA er(UCN) gene is located

551© Oxford University Press

A.Huttenhofer et al.

Table I. Genetic markers and origin of yeast strains

Strain Genotype Remarks Reference

Nuclear Mitochondrial

HS2-5631 ahisl, trp2 rho+, mit- Weiss-Brummer et al. (1987)capr-321, par-454

SEG15 ahisl, trp2 rho+, mit- derived from Weiss-Brummer et al. (1989)cap'-321, pad'-454 HS2-5631

Origin of markers: capr-321, Coen et al. (1970); par-454, Kutzleb et al. (1973).

1 CCGGAACCCCGAAAGGAGTTTATTTAATATTTATATTTATATTAATATTTATATTTATATTTATATTTATATTCC

76 TCTTAAGGATGGTTGACTGAGTGGTTTAAAGTGTGATATTTGAGCTAITTAGTCTTTATTGGCTACGTAGGTT

151 CAAATCCTACATCATCCGTAATAATACATATATATAATAATAATTTTAATATTATTCCTATAAAAATAAAATAAA

226 TAAATAAATAATAATAATTAATTAATTAATTAATTTTAATAAATATAAAATATATAAAAATAATAATAATAATAA

301 TTATTATTTTAATAATATTATTTATATAATAGTCCGG

Fig. 1. Nucleotide sequence of the tRNASer(ucN) gene region of original strain HS2-5631. The sequence of the varl gene region [downstream fromthe tRNASer(UCN) gene] is not shown in the figure because it is identical to previously published sequences (Hudspeth et al., 1982; Zassenhaus et al.,1983). The tRNA gene sequence is underlined. The base substitution from C to T in the tRNASer gene of suppressor strain SEG15 is boxed. Themutation is localized at position 124 of the shown sequence. The mutational site corresponds to position 42 in the generalized tRNA cloverleafstructure.

within the anticodon stem of the tRNA (position 42 in thenumbering of the generalized cloverleaf structure; Sprinzlet al., 1985) and leads to the alteration of a G-C base pairto the thermodynamically weaker G-U pair within this stem(Figure 3).

Frameshift suppression site in suppressor strain SEG15The mfs-J suppressor was shown to suppress specifically theM5631 frameshift mutation in the mitochondrial oxil geneof the yeast S. cerevisiae (Weiss-Brummer et al., 1989). Todetermine whether a mutated tRNASr(UCN) could act as aframeshift suppressor of the M5631 mutation, the altered oxilreading frame was analysed with respect to the presence ofUCN codons. As can be seen in Figure 4, the first codonafter the mutational site of the mutant M5631 oxil readingframe (which differs from the wild-type reading frame by theinsertion of a T base) is a codon UCC, which is decoded bythe tRNAserCN).

If the frameshift suppression in strain SEG15 is purely theresult of the base exchange within the tRNAser(UCN) gene,either the expression or the biological function of this tRNAshould be affected. To test this, we analysed the transcrip-tion, processing, structure and aminoacylation of mutant andwild-type tRNASer(UCN).

Analysis of tRNASOr(UCN) transcriptsTo determine whether the base alteration from C to U atposition 42 within the anticodon stem has an effect ontranscription, processing or stability of the tRNA, weanalysed the tRNASer(UCN) transcripts in the original strainHS2-5631 and in suppressor strain SEG15. Northern analysisshowed that both strains contain the tRNAserCN) transcriptat about the same level and with the same size as determinedby separation on a 10% polyacrylamide- 8 M urea gel (datanot shown). S 1 nuclease mapping revealed that both 5' and3' termini of the suppressor tRNA are the same as in themature tRNA of the original strain HS2-5631 (data notshown). These results indicate that the mutation within the

AU

_S._

Fig. 2. Sequencing gel demonstrating the point mutation in thetRNAser(UcN) gene. The autoradiogram represents part of the non-coding strand of the tRNASer(ucN) gene in strain HS2-5631 (left panel)and SEG15 (right panel). The products from four enzymaticsequencing reactions (C, T, A, G) are indicated at the top of eachlane. The mutational site (C in HS2-5631 and T in SEG15) isindicated by an arrow.

anticodon stem of the tRNA affects neither transcription ofthe gene nor processing of the transcript.

Two-dimensional PAGE of tRNAs from suppressorand original strainIt has been shown by two-dimensional polyacrylamide gelelectrophoresis (2D-PAGE) and subsequent sequencing ofthe respective tRNA spots that two UCN-reading tRNASerspecies are present in wild-type strains of S.cerevisiae(Martin et al., 1982). These species-tRNASer2 andtRNASer -are transcribed from a single gene in the varlregion corresponding to the mutated tRNASer(UCN) gene insuppressor strain SEG15. The two isoacceptors differ bya single nucleoside modification at position 27: tRNASercontains a modified uridine (i.e. pseudouridine) whiletRNASer3 lacks this modification at position 27 (Martinet al., 1982; Figure 3).2D-PAGE analysis of the tRNAs showed that the two spots

of wild-type tRNASer2 and tRNASSer3 in strain HS2-5631(Figure 5A) are absent in the suppressor strain SEG15 and

552

._. A "..,

E -1

"4,-"-, 1-1Is--

Mitochondrial + 1 frameshift suppressor tRNA

AC

PGCpG-CA-UU- Aa-ca-UU- A UA

G A U CAUcUCCAAGD GA A IgIggIg Aa UCA GUAGG

A a CA TIcuuAAA AaAC27 GU~ U

A- ~U U

U a A

Fig. 3. Cloverleaf structure of the tRNAser(UCN) deduced from its genesequence and base modifications accordinE to Martin et al. (1982).Two tRNA species-tRNAse2 and tRNA r -which are transcribedfrom a single gene-are observed in wild-type cells. tRNAer2 differsfrom tRNASer in that it contains pseudouridine (*I) at position 27instead of uridine (Martin et al., 1982). This modification site and thebase exchange (C -. U at position 42) in suppressor strain SEG15 areindicated by an arrow.

27LU-A

A-UU-A

M5631 3'... UCGA

WT

mlG

"'A C C U UUU UUA...5'

S F~~~~~~~~~~

3'...UCG A C C UUU UUA...5'

A P F I

Fig. 4. Section of the oxil mRNA sequence (in 3' -5' orientation) ofwild-type (WT) and mutant M5631, according to Fox and Weiss-Brummer (1980); the section shows the site of the M5631 mutation, a+I1U insertion in a consecutive series of 5U residues (underlined);below the respective mRNA sequences the deduced amino acidsequences are indicated. A model of suppression of the frameshiftmutation M5631 by the mfs-J tRNAS" is shown above (seeDiscussion).

are re~ 1aced by a single new spot in close vicinity of thetRNA u spot (2' in Figure SB).

RNA sequence analysis of suppressor and wild-typetRNASer(UCN,To confirm that the new spot (2' in Figure SB) in theSuppesor strain does indeed represent the mutatedtRA r~C we performed limited digestion of this tRNA

and of wild-type tRNASr2, tRNA r3, and tRNAL2eu withribonuclease Ti. As shown in Figure 6A, the TI pattern

of the new tRNA spot in suppressor strain SEG15 is identicalto the TI pattern of wild-type tRNA,r2 and tRNASr3,which demonstrates that this spot represents the mutatedtRNA&r. Thus, while in the original strain HS2-563 1, twoisoacceptors are present-tRNAser2 and tRNAser -~thesuppressor strain contains only a single tRNAsr(UCN)species, with an altered mobility compared to the respectivewild-type tRNAs. This implies that the C to U mutationseems to have an influence on the conformation of thesuppressor tRNA, here referred to as mfs-J tRNAser.As wild-type tRNASe and tRNAse3 of the original strain

HS2-563 1 can be separated on a 2D gel due to themodification or non-modification of the uridine at position27, we analysed the mfs-J tRNASr with respect to thismodification site. Since the nucleoside which is modifiedat position 27 is a uridine, only the U reaction of the chemicalsequencing was performed. According to Peattie (1987), theabsence of an expected band in the lane of a chemicallygenerated sequence pattern indicates that a modified baseis present. In the sequence pattern of the U-sequencingreaction of the mfs-J tRNAser the band at position 27 ispresent, indicating that this residue is not modified (Figure6B). Control experiment with tRNASe and tRNAse' fromthe original strain HS2-563 1 were performed as describedabove, confirming temdfcioofRNs2 at position27 and the lack of modification of tRNASr3 at this position(Figure 6B; Martin et al., 1982).These data show that in suppressor strain SEG15 only one

UCN reading tRNAser species (the mfs-J tRNAse) ispresent, compared to two in the wild type. The mfs-JtRNASr harbours a C to U base transition at position 42within the anticodon stem; in addition, this alteration preventsthe uridine at position 27 of the suppressor tRNA from beingmodified to pseudouridine, as occurs in the wild-type strain(see Figure 3).

Analysis of mfs- 1 tRNAsr on a non-denaturing gelTo determine the structural differences between wild-typeand suppressor tRNASr total mitohonra N(UCN), o nra Nfrom strains HS2-5631 and SEG15 was separated on a 10%polyacrylamide gel without urea. In this gel electrophoresissystem, separation of tRNAs is expected to occur mainlyon the basis of their conformational stability. Afterseparation, tRNAs were transferred to a nylon membrane(Zeta Probe, Bio-Rad) and hybridized with a nick-translatedDNA probe containing the tRNAser(uN gene (seeMaterials and methods). As can be seen in Figure 7A, twotRNA bands are present in the original strain HS2-563 1,representing tRNASr2 and tRNASr3 respectively (Martinet aL., 1982). In suppressor strain SEG 15, two closelymigrating bands are visible (Figure 7B, 2a' and 2b').Nevertheless, as shown by 2D gel electrophoresis and sub-sequent sequence analysis (Figures 5 and 6), only onetRNA Ser(UCN) species is present in strain SEGi5, the mfs-JtRNASr. The existence of two mfs-J tRNA Sr bands on anon-denaturing gel could be explained by differentialnucleoside modification of the tRNA in a way not detectableby sequencing, e.g. because the alterations were covered bythe contaminant tRNAILu (see Figure 6). Altemnatively, thetwo closely migrating tRNA bands (Figure 7B) could reflecttwo different conformations of the mfs-J tRNAsr, whichmight have different decoding abilities (see Discussion).

553

A.Huttenhofer et al.

Fig. 5. 2D polyacrylamnide gel separation of 3'-end-labelled mitochondrial tRNAs from original strain HS2-5631 (A) and suppressor strain SEG15(B). 20 yg of bulk mitochondrial tRNA from each strain was labelled with [a-32P]ATP, in the presence of yeast cytoplasmic tRNAnucleotidyltransferase (Sibler et al., 1983) and separated on a 10% polyacrylamide-4 M urea gel in the first dimension, and on a 20%polyacrylamide gel-4 M urea in the second dimension (Martin et al., 1977). The different tRNASer(ucN) spots and the tRNALeU spot are indicatedby arrows: (1) tRNAser2; (2) tRNAser3; (3) tRNALeu; (2') suppressor tRNASer.

Aminoacylation of tRNASr(UCN) in wild-type andsuppressor strainTo analyse whether the changes in structure (caused by theC to U mutation at position 42) and in base modification(lack of pseudouridine at position 27) affect the amino-acylation parameters of the mfs-J tRNASer, acylationkinetics with [3H]serine were performed using a preparationof E. coli aminoacyl-tRNA synthetases. E. coli enzymes wereused instead of yeast mitochondrial enzymes since it has beenshown that bacterial enzymes specifically aminoacylate theyeast mitochondrial tRNAser(ucN) isoacceptors (Baldacciet al., 1976). Neither the mitochondrial tRNA r(AGY)isoacceptor nor the cytoplasmic tRNASer are aminoacylatedby the E. coli enzyme. As an internal standard for comparingmutant and wild-type tRNAs, parallel reactions were carriedout using [3H]tyrosine. The results of these experimentsshowed that under conditions where both tRNAs charged[3H]tyrosine with equal efficiency, the mutant accepted

- 80% of the amount of [3H]serine accepted by the wild-type (data not shown). Thus, aminoacylation of thesuppressor tRNASer is not drastically affected.

DiscussionThe results presented here document the discovery of a noveltype of +1 frameshift suppressor tRNA. In addition, thisis the first reported case of a mitochondrial suppressor tRNA.The suppressor mutation mfs-J in S. cerevisiae strain SEG15is located on the mitochondrial genome in the gene codingfor tRNASer(ucN. The mfs-J mutation was shown tosuppress specifically a frameshift mutation (M563 1) withinthe mitochondrial oxil gene coding for subunit II ofcytochrome c oxidase (Weiss-Brummer et al., 1989).Preliminary analyses of in vivo labelled mitochondrialtranslation products indicate that the suppressor strainproduces -20% more subunit II protein than the originalstrain (Hiittenhofer et al., unpublished results). This suggeststhat the mfs-J tRNASer is a rather strong suppressor.The mutational change within the tRNASer(ucN) gene is

a transition from C to T at position 42. This change affectsthe secondary structure of the tRNA by converting a stablebase pair (G28 -C42) in the anticodon stem to a weaker pair

554

-ie~~~~~~~~~~1

t~~ ~ ~ ~ ~ ~~* 2 2 .......

Fig. 6. RNA sequence analysis of suppressor and wild-type tRNAs.(A) Sequencing gel of partial Ti RNase digests. Lane 1, sequencingladder; lane 2, mfs-I tRNASer of strain SEG15; lane 3, tRNAse:3 Ofstrain HS25631; lane 4, tRNALe' of strain HS2-563 1; lane 5,tRNALeu of strain SEG 15. (B) Chemical sequencing (U reaction).Lane 1, sequencing ladder; Lane 2, tRNAser3 of strain HS2-5631;lane 3, mfs-J tRNASer of strain SEG15; lane34, tRNASr2 of strainHS2-5631; lane 5, tRNAILu of strain HS2-5631; lane 6, tRNALeu ofstrain SEG15. Arrowhead (a) indicates a band corresponding to theunmodified U residue at position 27 in tRNASer3 and in mfs-J tRNASer(lanes 2 and 3 respectively). This band is absent in tRNAser2 (lane 4)due to the presence of pseudouridine ('1) which is not cleaved by thechemical U reaction. Arrowhead (b) indicates the mutational siteC - U at position 42 in mfs-J tRNAsr

(G28 -U42). Until recently, all + I frameshift suppressortRNAs in prokaryotes and eukaryotes were found to containan additional nucleotide within the anticodon region thusleading to an 8 nucleotide anticodon loop instead of the 7nucleotide loop observed in wild-type tRNAs (Riddle andCarbon 1973; Roth, 1981; Bossi and Roth, 1981; Cummins

iii:- 401

Mitochondrial + 1 frameshift suppressor tRNA

B

+2

Fig. 7. RNA gel transfer (Northern) hybridization analysis ofmitochondrial tRNAs from strain HS2-5631 (A) and suppressor strainSEG15 (B). Equal amounts of RNA were loaded on a polyacrylamidegel (9.6% acrylamide, 0.4% bisacrylamide) without urea andelectrophoresed in the cold room at 10 V/cm. After separation, RNAwas transferred on a nylon membrane and hybridized with a nick-translated tRNAser(ucN) gene probe (337 bp HpaII fragment). (A)arrows (1) and (2) indicate the tRNASer2 and tRNASr3 bands of strainHS2-5631 respectively; (B) arrows (2a') and (2b') indicate the twoclosely migrating bands of mfs-J tRNASer in strain SEG15.

et al., 1982; Gaber and Culbertson, 1982; Bossi and Smith,1984). The presence of an extra anticodon base is sufficientto cause a detectable level of frameshift suppression due toa four base translocation of the mRNA on the ribosome(Gaber and Culbertson, 1984). This indicates that the tRNAanticodon loop size plays an important role in maintenanceof the proper reading frame in mRNA. An apparentexception was a yeast proline frameshift suppressor tRNA(SUF7) reported by Winey et al. (1986), which contains abase alteration in the anticodon stem at position 39. However,as this suppressor mutation disrupts the bottom base pair ofthe anticodon stem and leads to a 9 nucleotide anticodon loop,this finding does not contradict the previously observedcorrelation between + 1 frameshift suppression andexpansion of the anticodon loop size of a frameshiftsuppressor tRNA. In contrast, very recent studies havedemonstrated that frameshift suppression can beaccomplished by mutant tRNAs with normal anticodon loopsize. First, several missense and nonsense suppressors werefound by Tucker et al. (1989) to correct +1 frameshift muta-tions. Particularly notable in that study was a lysine tRNAwhose only alteration was a C to U70 base substitutionin the amino acid acceptor stem. Second, certain mutantderivatives of tRNAGIY2 of Salmonella were selected assuppressors of a -1 frameshift mutation. These includeda insertion in the TIC loop, two different base substitutionsin the TIC stem and a G to A base change at the 5' end(O'Mahony et al., 1989). Finally, in this paper we havedescribed a novel mitochondrial frameshift suppressor tRNA,mfs-J tRNAser, which has a 7 nucleotide anticodon loop butharbours a mutation affecting the second base pairing of theanticodon stem. The results of all three of these recent studies

demonstrate that shifting of the reading frame can be inducedby mutant tRNAs with normal anticodon loop size but witha structural alteration in another region of the tRNAmolecule, even in one far from the anticodon.To obtain more detailed information about the mechanism

of frameshift by the mfs-J tRNASr, we investigated itstranscription, processing, structure and aminoacylationproperties. Although there is ample evidence that basesubstitutions can affect the transcription of tRNA genes (e.g.De Franco et al., 1980; Koski et al., 1980) and theprocessing of tRNA transcripts (Altman, 1971; McClainet al., 1975), the C to U change in tRNASer(UcN) does notappear to affect transcription of the gene or processing ofthe transcripts, since comparable levels of tRNAser(UcN)transcripts are present in the suppressor strain SEG15 andin the original strain HS2-563 1; furthermore, the extremitiesof the mfs-J tRNA transcripts are processed normally (asin wild-type). Nevertheless, the mutation in the tRNAanticodon stem does affect the post-transcriptional modifica-tion, secondary/tertiary structure and aminoacylation of themfs-J tRNA.

Post-transcriptional modification alteration of mfs-1tRNAserThe wild-type allele of the tRNAs"(UCN) gene was shownto be special in yeast mitochondria in so far as it encodestwo isoaccepting tRNA species, i.e. tRNAser and tRNAsr,which differ by only a nucleoside modification at position27 in the anticodon stem (Martin et al., 1982). At thisposition, the tRNAsre contains pseudouridine while thetRNASer3 carries a non-modified uridine. These two iso-acceptors can be separated by chromatography on a RPC5column and by 2D-PAGE, suggesting that they are likelyto adopt different conformations (Martin et al., 1982). Inthis context, it is interesting that we could show that in thesuppressor strain SEG 15, only the non-modified form of thetRNA is present. Thus the mutation C42 to U42 in theanticodon stem of mfs-J tRNASer prevents the modificationof the spatially close residue U27. This result agrees withearlier data of Curran and Yarus (1986) showing thatmutations in the anticodon stem of an amber suppressortRNATTrp (Su7) alter or eliminate post-transcriptionalmodifications in the anticodon arm.

Changes in structure and stability of the mfs- 1tRNASerThe C to U mutation within the anticodon stem of the mfs-JtRNAser appears to influence the structure andconformational stability of the tRNA molecule. This wasdeduced from 2D-PAGE analysis of suppressor and wild-type tRNAser. In fact, the mfs-J tRNA revealed asecondary/tertiary structure different from both tRNASer2and tRNAser3. This can be concluded from a localization ofthe spot of mfs-J tRNA on the 2D gel different from thoseof both tRNASer2 and tRNASer3 of the original strainHS2-5631. With respect to the two wild-type serine iso-acceptors, the suppressor tRNA lacks two structural elementswhich may stabilize the spatial structure of a tRNA molecule.Firstly, the only G-C base pairing in the anticodon stemis replaced by a weaker G - U pairing due to the primarychange C to U at position 42; this is expected to destabilizethe conformation of the mfs-J tRNA r. Secondly, com-pared to tRNASr2, the suppressor tRNA is unmodified at

555

-t:: ::: s:,-e-- :.;: "frk !14-7-

1 ---w-

A.Huttenhofer et al.

position 27; this should further decrease the stability of thespatial structure of the mfs-J tRNA, especially sincehypomodification is also known to destabilize tRNAconformation (Bjork et al., 1987). Thus compared to the twowild-type isoacceptors, the suppressor tRNA should exhibita lower stability, the decreasing order of stability beingtRNAser2 > tRNA 3 > mfs-J tRNAser

Acylation properties of the mfs- 1 tRNASerBesides the changes in post-transcriptional modificationand conformation of the mfs-J tRNASer, its charging abilityseems to be slightly affected, since the efficiency of in vitroaminoacylation of SEG15 tRNASer(UCN) is reduced to

80% of the HS2-563 1 tRNAser(UCN) aminoacylationefficiency. Bjork and Kjellin-Straby (1977) showed that thelack of modification of a G residue at position 26 in yeastcytoplasmic tRNAser reduces the in vitro charging abilityby - 20%. In that context, the lack of modification of U27in the mfs-J tRNA could directly affect the efficiency ofaminoacylation of this tRNA. However, we do not think thata reduction by 20% in aminoacylation leads to a severeshortage of acylated tRNASer(UCN) in mitochondria ofsuppressor strain SEG15. Although Weiss and Gallant (1983)showed that frameshifting is increased due to limitation ofa tRNA species, it seems less plausible to us that thesuppressor effect of the mfs-J tRNA results from thatmechanism. We favour the idea that a structural change inthe suppressor tRNA caused by the alteration of a G-C basepairing and the lack of U27 modification in the anticodonstem is much more important for the suppressor function(see below).

Models for frameshift suppression by the mfs- 1tRNASerThe base substitution C42 to U42 in the mitochondrialframeshift suppressor tRNA has a destabilizing effect on theanticodon stem structure; this might lead to a conformationalchange in the anticodon loop. That some structuralconnection exists between anticodon stem and loop has beendemonstrated by Seong and RajBhandary (1987) in the caseof E. coli tRNA Met2: base substitutions within the anticodonstem of this tRNA alter the accessibility of anticodon loopresidues. Therefore, the alteration in the anticodon stem ofthe mfs-J tRNA may affect translocation by altering somestructural feature of the anticodon region such as basestacking (Curran and Yarus, 1987).Based on these considerations, we propose the following

model for the mechanism of frameshift suppression by themfs-J tRNA. The perturbed anticodon stem structure mightinfluence the stacking of bases in the anticodon loop so asto allow the residue U33 to form a Watson-Crick pairingwith the A residue 3' adjacent to the serine codon UCC atthe mutational site in the oxil mRNA (Figure 4). This wouldfavour translocation of a four base codon UCCA on theribosome thus restoring the wild-type reading frame. Thus,the +1 frameshift mutation M563 1 could be suppressed bya 'four base reading' of mfs-J tRNASer. However, such afour base reading in a 7 nucleotide anticodon loop has beenfound to be improbable or non-existent in E.coli (Ayerand Yarus, 1986), but it remains possible that the yeastmitochondrial decoding mechanism is different from that ofE. coli. Alternatively, the structural changes in the anticodon

stem of the mfs-J tRNASer (C42 to U42 mutation and lackof modification of residue U27) might destablilise the bot-tom base pair (A-+) of this stem in some fraction of themolecules. This would lead to a 9 nucleotide anticodon loopable to read a four base codon, as is the case of the yeastSUF7 frameshift suppressor tRNA (Winey et al., 1986).A Watson-Crick pairing of anticodon loop residue U33

with position four of a codon quadruplet is, however, nota prerequisite for a four base translocation mechanism tooccur. Indeed, Gaber and Culbertson (1984) showed thatcodon recognition by a +1 frameshift suppressor tRNA doesnot necessarily require position four base pair, although thestability of position four codon-anticodon interactioninfluences the efficiency of suppression. Therefore, just asterical protection of the A base of the four base codonUCCA by the mfs-J tRNASer anticodon region could sufficeto prevent this base from being read by another tRNA.

Frameshift suppression due to a mutation within the tRNAanticodon stem is a feature that up to now seems unique tothe mfs-J tRNA. Curran and Yarus (1986) performed anextensive study of mutations within the anticodon stem ofthe amber suppressor tRNATTrp (Su7) and searched forevidence that such mutations could induce frameshifting.Surprisingly, none of the base alterations studied within thistRNA anticodon stem decreased the accuracy of readingframe maintenance. The authors concluded that the sequenceand conformation of the anticodon stem are not critical indetermining the length of translocation. Although our mutantstands in contrast to their conclusion, the data do notnecessarily conflict. Firstly, the Su7 and mfs-J tRNA havetotally different anticodon stem structures. While in the Su7tRNA this stem comprises four G-C and one A-U pair,it contains four A-U and one G-U pair in the mito-chondrial suppressor tRNA. This indicates a reduced stabilityof the mfs-J tRNA anticodon stem compared to that of theSu7 tRNA. Thus, alteration of a base pairing in the Su7anticodon stem might have a less dramatic effect on theconformation of anticodon loop residues than in themitochondrial suppressor tRNA. Secondly, if one assumesthat a 'four base reading' mechanism accounts for the sup-pressor effect of the mfs-J tRNASer, a stable pairing maybe formed between anticodon loop residue U33 and the Abase of the UCCA quadruplet. In the case of the Su7tRNAmutants, the same would demand a U33-C non-standardpairing which might be less conducive to frameshifting.Finally, Curran and Yarus (1986) opted not to examine theeffect of G-U base pairs in the anticodon stem of theSu7 tRNA.An alternative model for frameshift suppression by the

mfs-J tRNASer is the following. The mfs-J mutation mightbe a Hirsh suppressor-like alteration, which has recentlybeen shown to act quite generally, enhancing coding by atRNA with virtually any other defect (Smith and Yarus,1989). The changes within the anticodon stem of the mfs-JtRNA are in spatial proximity to the Hirsh (D-arm) mutation,being localized in the same stacked unit of the tRNA tertiarystructure. The effect of the changes would be to allow codingby the suppressor tRNA in a conformation that blocked thenext codon, and therefore forced reading in the +1 frame.This model, however, implies that mfs-J should also suppressother mitochondrial mutations, a conclusion whichcontradicts previously published results (Weiss-Brummeret al., 1989).

556

Mitochondrial + 1 frameshift suppressor tRNA

'To shift or not to shift . . '

Wild-type tRNASer2 and tRNASr3 both encoded by thesame single copy gene, are the only UCN reading serine-tRNAs in mitochondria and hence are indispensable formitochondrial protein synthesis (Martin et al., 1982). As thesuppressor strain SEG15 seems to contain only one UCNreading tRNASer (i.e. mfs-J tRNA), this highlights aninteresting feature of the mfs-J tRNASer: besidessuppressing a + 1 frameshift, the mutant tRNA must stillbe able to read UCN codons-without causing aframeshift-sufficiently well for the cell to grow. A similarsituation, recently described by O'Mahony et al. (1989), isencountered in the case of several -1 frameshift suppressorsderived from tRNAGly2 of S. typhimurium. Besides causing-1 frameshifting, these mutant tRNAs must still be able todecode their normal codon GGA. The authors proposed thatthese two decoding abilities could be achieved by twoconformations of each tRNA. Likewise, two interconvertibletRNA conformations of the mfs-J mutant could exist, onefor preferentially inducing frameshift and one for readingUCN codons without causing a frameshift. In fact, there arehints that two conformations of tRNAser(ucN) may exist insuppressor strain SEG15, because two mutant tRNAertranscripts can be separated on a non-denaturingpolyacrylamide gel. Although extensive structural investi-gations of the mfs-J tRNA need to be performed, it isplausible that these two transcripts resemble two con-formations of different decoding abilities.

Materials and methodsStrainsGenotypes and origin of strains used in this study are given in Table I. Culturemedia and growth conditions of the yeast strains have been describedpreviously (Weiss-Brummer et al., 1989).

Isolation of mitochondrial DNAYeast cells were grown at 30°C to early stationary phase in a mediumcontaining 4% (w/v) glucose and 1% (w/v) yeast extract. Mitochondria wereprepared from protoplasts obtained by treatment of the cells with 0.3 mg/gcells of zymolyase 20 000 (Seikagaku Kogyo Co., Ltd., Tokyo, Japan).Mitochondrial DNA was extracted with 0.5% SDS and purified bycentrifugation in CsCI gradients (Hudspeth et al., 1980).

DNA sequencingA 2000 bp HaelH restriction fragment was cloned into the SmaI site ofMl3mp8 (Messing et al., 1981). The fragments of the original strainHS2-5631 and of suppressor strain SEG 15 were sequenced on both strandsby the dideoxy chain termination method using synthetic oligonucleotidesas primers (Sanger et al., 1977, 1980).

Mitochondrial RNA isolation and analysisMitochondria were prepared as described above. Mitochondrial RNA wasextracted by the method of Locker (1979) and was electrophoresed eitheron a 10% polyacrylamide-8 M urea gel or on a 10% polyacrylamide gelwithout urea. The RNA was transferred to Zeta probe membrane (Bio-Rad)by electroblotting (Alwine et al., 1977) and hybridized with a nick-translatedtRNAser(UcN) gene probe (337 bp HpaII fragment). Bulk mitochondriatRNA was prepared by DEAE-cellulose column chromatography, 3'-end-labelled with tRNA nucleotidyltransferase and separated by 2D-PAGE(Martin et al., 1977).

Si nuclease mapping of both 5' and 3' termini of tRNASer(UCN)transcripts in the original mutant and in suppressor strain SEG15 was

performed as previoulsy described (Bordonne et al., 1987). The protectedfragments were electrophoresed on an 8% polyacrylamide sequencing gelalong with four enzymatic sequencing reactions of M13 ssDNA fordetermination of the exact length of the protected fragments.

Aminoacylation of tRNAMitochondrial tRNA (0.05-1 mg/mi) was acylated in vitro with [3H]serineand [3H]tyrosine (CEA, Saclay, France) using a 3.5 tsg E.coli aminoacyl-tRNA synthetases (Muench and Berg, 1966). Acylations were performedin 100 mM Tris-HCI pH 8, 10 mM ATP, 25 mM MgCl2, 0.1 mg/mibovine serum albuimin, 0.6 mg/ml glutathione, 50 ZtM [3H]amino acid. Afterincubation at 37°C, trichloroacetic acid precipitable counts were determined.

RNA sequencingChemical sequencing of tRNA isolated by 2D-PAGE was performed asdescribed by Peattie (1987). Enzymatic sequencing by limited TI RNasedigestion was performed according to Donis-Keller et al. (1977).

AcknowledgementsWe thank Drs E.J.Murgola, E.Westhof, M.Pankratz, and G.Sawers forhelpful discussions and Dr E.J.Murgola for making results available priorto publication. This work was supported by the Deutsche Forschung-sgemeineschaft and the Centre National de la Recherche Scientifique.A.Huttenhofer was supported in part by stipends from EMBO and FEBS.

ReferencesAltman,S. (1971) Nature, 229, 19-20.Alwine,J.C., Kemp,D.J. and Stark,G.R. (1977) Proc. Natl. Acad. Sci. USA,

74, 5350-5354.Ayer,D. and Yarus,M. (1986) Science,231, 393-395.Baldacci,G., Falcone,C., Frontali,L., Macino,G. and Palleschi,C. (1976)

In Bucher,T., Neupert,W., Sebald,W. and Werner,S. (eds), Geneticsand Biogenesis of Chloroplasts and Mitochondria. North-HollandPublishing Co., Amsterdam, pp. 759-762.

Bjork,G.R. and Kjellin-Straby,K. (1977) In Salvatore,F., Borek,E.,Zappia,V., William-Asham,H.G. and Schlenk,F. (eds), 7he Biochemistryof Adenosylmethionine. Columbia University Press, New York, pp.216-230.

Bjork,G.R., Ericson,J.U., Gustafsson,C.E.D., Hagervall,T.G.,Jonsson,Y.H. and Wikstrom,P.M. (1987) Annu. Rev. Biochem., 56,263 -287.

Bordonne,R., Dirheimer,G. and Martin,R.P. (1987) Nucleic Acids Res.,15, 7381-7394.

Bossi,L. and Roth.J.R. (1981) Cell, 25, 489-496.Bossi,L. and Smith,D.M. (1984) Proc. Natl. Acad. Sci. USA, 81,6105-6109.

Coen,D., Deutsch,J., Netter,P., Petrochilo,E. and Slonimski,P.P. (1970)In Miller,P.L. (ed), Mitochondrial Genetics-Methodology andPhenomenology. University Press, Cambridge, pp. 449-496.

Cummins,C.M.. Donahue,T.F. and Culbertson,M.R. (1982) Proc. Natl.Acad. Sci. USA, 79, 3565-3569.

Curran,J.F. and Yarus,M. (1986) Proc. Natl. Acad. Sci., 83, 6538-6542.Curran,J.F. and Yarus,M. (1987) Science, 238, 1545-1550.De Franco,D., Schmidt,O. and Soll,D. (1980) Proc. Natl. Acad. Sci. USA,

77, 3365-3568.Donis-Keller,H., Maxam,A. and Gilbert,W. (1977) Nucleic Acids Res.,

4, 2527-2538.Dujon,B. (1983) In Schweyen,R.J., Wolf,K. and Kaudewitz,F. (eds),

Mitochondria 83. De Gruyter, Berlin, pp. 1-24.Fox,T.D. and Weiss-Brummer,B. (1980) Nature, 288, 60-63.Gaber,R.F. and Culbertson,M.R. (1982) Gene, 19, 163-172.Gaber,R.F. and Culbertson,M.R. (1984) Mol. Cell. Biol., 4, 2052-2061.Hudspeth,M.E.S., Shumard,D.S. Tatti,K.M. and Grossman,L.I. (1980)

Biochim. Biophys. Acta, 610, 221-228.Hudspeth,M.E.S., Ainley,W.M., Shumard,D.S., Butow,R.A. and

Grossman,L.I. (1982) Cell, 30, 617-626.Hughes,D., Atkins,J.F. and Thompson,S. (1987) EMBO J., 6, 4235 -4239.Koski,R.A., Clarkson,S.G., Kurjan,J., Hall,B.D. and Smith,M. (1980) Cell,

22, 415-425.Kutzleb,R., Schweyen,R.J. and Kaudewitz,F. (1973) Mol. Gen. Genet.,

125, 91-98.Locker,J. (1979) Anal. Biochem., 98, 358-367.Martin,R.P., Schneller,J-M., Stahl,A.J.C. and Dirheimer,G. (1977) Nucleic

Acids Res.,4, 3497-3510.Martin,R.P., Sibler,A.-P. and Dirheimer,G. (1982) Biochimie, 64,

1073-1079.McClain,W.A., Barrell,B.G. and Seidman,J.G. (1975) J. Mol. Biol., 99,717-732.

557

A.Huttenhofer et al.

Messing,J. Crea,R. and Seeburg,P.H. (1981) Nucleic Acids Res., 9,309-321.

Muench,K.H. and Berg,P. (1966) In Cantoni,G.L. and Davis,D.R. (eds),Procedures in Nucleic Acid Research. Harper and Row, NY, pp.375 -383.

O'Mahony,D.J., Mims,B.H., Thompson,S., Murgola,E.J. and Atkins,J.F.(1989) Proc. Natl. Acad. Sci. USA, 86, 7979-7983.

Peattie,D.A. (1987) In Narang,S.A. (ed.), Synthesis and Application ofDNAand RNA. Academic Press, Inc., NY, pp. 163-180.

Riddle,D. and Carbon,J. (1973) Nature, 242, 230-234.Roth,J.R. (1981) Cell, 24, 601-602.Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl. Acad. Sci. USA,

74, 5463-5467.Sanger,F., Coulson,A.R., Barell,B.F., Smith,A.Z.H. and Roe,B. (1980)

J. Mol. Biol., 143, 161-178.Seong,B.L. and RajBhandary,U.L. (1987) Proc. Natl. Acad. Sci. USA, 84,

334-338.Smith,D. and Yarus,M. (1989) J. Mol. Biol., 206, 489-501.Sibler,A.-P., Dirheimer,G. and Martin,R.P. (1983) FEBS Lett., 152,

153-156.Sprinzl,M., Moll,J., Meissner,F. and Hartmann,T. (1985) Nucleic Acids

Res.,13, rl-r49.Tucker,S.D., Murgola,E.J. and Pagel,F.T. (1989) Biochimie, 71, 729-739.Weiss,R.B. and Gallant,J.A. (1983) Nature, 302, 389-393.Weiss-Brummer,B. and Huttenhofer,A. (1989) Mol. Gen. Genet., 217,

362-369.Weiss-Brummer,B., Sakai,H. and Kaudewitz,F. (1987) Curr. Genet., 11,

295 -301.Weiss-Brummer,B., Sakai,H. and Huttenhofer,A. (1989) Curr. Genet., 15,

239-246.Winey,M., Mendenhall,M.D., Cummins,C.M. and Culbertson,M.R. (1986)

J. Mol. Biol., 192, 49-63.Zassenhaus,H.P., Farrelly,F., Hudspeth,M.E.S., Grossman,L.I. and

Butow,R.A. (1983) Mol. Cell. Biol., 3, 1615-1624.

Received on August 22, 1989; revised on November 16, 1989

558