Study the effect of various extracellular matrix proteins on...
Transcript of Study the effect of various extracellular matrix proteins on...
-
58
CHAPTER 5
Study the effect of various extracellular matrix proteins on adhesion,
proliferation and osteoblast differentiation of bone marrow derived
human mesenchymal stem cells
5.1 Introduction
Mesenchymal stem cells (MSCs) are widely used in bone tissue engineering
(BTE) applications (Marot et al., 2010; Mauney et al., 2005; Fibbe et al., 2002). The
scaffold materials used for the BTE are reported to influence the differentiation of the
MSCs to osteoblasts (Prichard et al., 2007; Roach et al., 2007; Meinel et al., 2004).
MSCs adhere to a biomaterial by an indirect mechanism mediated through specific
proteins from the serum containing media adsorbed on the material surface (Clegg et al.,
2005; Sawyer et al., 2005). Therefore, the type of cell and the nature of the biomaterial
are the two major factors that regulate the cell adhesion and proliferation. Biomimetic or
bio-inspired approach of MSC based bone tissue engineering suggests the potential use of
extracellular matrix (ECM) based scaffolds for enhancing differentiation and thereby
improving bone regeneration (Zhang et al., 2007; Hattar et al., 2005; Vagaska et al.,
2010; Semino, 2008). During the osteogenesis of MSC in vivo, the ECM is dynamically
remodelled to modulate intracellular signalling during stem cell differentiation (Hoshiba
et al., 2011; Nakamura et al., 2005; Sasano et al., 2000; Kamiya et al., 2001). Application
of ECM components or equivalents in scaffold fabrication and implant modification has
shown promising results (Garcia and Reyes, 2005; Badylak et al., 2009). Previous studies
-
59
showed enhancement of cell adhesion and differentiation on biomimetic ECM based
scaffolds or coating (Chen et al., 2008; Datta et al., 2005).
ECM is an important part of the cellular microenvironment, which along with
various growth factors play a significant role in regulating the differentiation and
development (Adams and Watt, 1993; Allori et al., 2008). ECM have a major role in
deciphering the cell behaviour and function by regulating cell adhesion, differentiation,
migration, apoptosis, proliferation, phenotype and growth (Hidalgo-Bastida and Cartmell,
2010). Collagen type I, elastin, laminin, fibronectin and vitronectin are the major proteins
present in the ECM. Collagen type I is the major protein present in the ECM of bone and
it is known to play a significant role in mineralization (Mizuno and Kuboki, 2001). It is
widely used in bone tissue engineering applications (Keogh et al., 2010; Chevallay and
Herbage, 2000). Collagen coating on various biomaterials has shown to improve cell
adhesion (Munisamy et al., 2008). Laminin is present in basal laminae and they assist in
cell adhesion (Carlsson et al., 1981; Mochizuki et al., 2003). Fibronectin and vitronectin
are present in ECM as well as in serum and they promote cell adhesion and spreading
(Underwood and Bennett, 1989; Wittmer et al., 2007).
With the development in the field of cell based tissue engineering, the focus of the
research is now in identifying novel scaffolds and/ or modifying the existing in order to
achieve the best performance for faster and effective tissue regeneration. A thorough
understanding of the cell-biomaterial interaction is essential in manipulating the material
performance and cell behaviour. Since the cell-biomaterial interactions are adsorbed
protein mediated, surface modification of the biomaterial to improve the specific protein
adsorption is an option to improve the biomaterial performance. Another approach to
improve the cell-biomaterial interaction is to coat the biomaterial surface with desired
-
60
proteins, which will increase the cell adhesion and / or enhance the specific
differentiation
In this study, we have selected collagen type I, fibronectin, laminin, and
vitronectin, the four major ECM proteins, to evaluate their effect on the adhesion and
osteoblast differentiation of adult bone marrow derived human MSCs (hMSCs). This
study was aimed at understanding the role of specific ECM proteins at different phases of
osteoblast differentiation in terms of osteoblast differentiation associated gene expression
and their correlation with alkaline phosphatase expression and mineralization. The data
obtained is of significance in developing a biomimetic microenvironment for directing
hMSCs to achieve a functional bone construct for orthopaedic applications.
5.2 Materials and methods
5.2.1 Preparation of ECM protein treated plates
Protein Recommended
concentration
Experimental
concentration
Collagen type I 6-10µg/cm2 6 µg/cm
2
Fibronectin 1-5 µg/cm2 1µg/cm
2
Laminin 1-10 µg/cm2 1 µg/cm
2
Vitronectin 0.1 µg/cm2 0.1 µg/cm
2
Table 5.1 Coating density of the ECM treated plates.
The ECM proteins such as collagen type I from human placenta, fibronectin from
human plasma, laminin from Engelbreth-Holm-Swarm murine sarcoma basement
membrane and vitronectin from human plasma were purchased from BD Bioscience
(Franklin Lakes, NJ, USA). Tissue culture plates were coated with the ECM proteins
according to the manufacturer’s instructions. The coating density of each protein used in
-
61
this experiment is given in table 5.1 and it was within the range of the recommended
concentration. The protein stock solutions were prepared by dissolving the sterile
lyophilized powder in appropriate sterile solvents solutions in a laminar flow hood under
sterile conditions. Filter sterilized acetic acid (0.1M) was used as solvent and diluent for
Collagen type I. Sterile DPBS was used as solvent and diluent for fibronectin. Sterile
basal media was used as solvent and diluent for laminin. Sterile distilled water was used
as solvent and diluent for vitronectin. Working solutions of the proteins were made
according to the surface area of the culture plates used. The final volume was sufficiently
diluted so that the volume added covered the surface of the plate evenly. For coating a
35mm culture plate having approximately 10cm2 surface areas, 1ml of the protein
solution was used. Preparation of the working solutions of the selected ECM proteins for
coating a 35mm culture plate is given in Table 5.2. The plates were covered with the
respective protein solutions in a laminar flow hood under sterile conditions and incubated
at room temperature (RT) for 1h. After 1h, the solutions were removed and the plates
were washed once with 1ml of distilled water before seeding the cells. These plates were
referred to as ECM protein treated plates henceforth.
Protein Stock
concentration
Required
concentration for
10 cm2 area
Volume of
protein for
1ml
Diluent
Volume
of diluent
for 1ml
Collagen type I 1mg/ml 60µg /ml 60µl 0.1M acetic
acid 940µl
Fibronectin 1mg/ml 10µg /ml 10µl DPBS 990µl
Laminin 1mg/ml 10µg /ml 10µl Basal media 990µl
Vitronectin 10µg/ml 1µg /ml 100µl Distilled water 900µl
Table 5.2 Preparation ECM protein working solutions.
-
62
5.2.2 Human MSC adhesion and proliferation on ECM protein treated plates
Human MSCs were isolated and characterized from the bone marrow of adult
human volunteers by the method mentioned under Section 4.2.5. The cells were isolated
and propagated in hMSC culture media (Table 4.2).Human MSCs were seeded at a
density of 5000 cells per sq. cm on each of the ECM protein treated plates. Untreated
tissue culture plates were used as the control for these experiments. The plates were
placed in a humidified incubator maintained at 370C with 5% CO2 in the air. After 24h of
incubation, they were observed under an inverted phase contrast microscope (Nikon
Eclipse TE2000-S, Nikon Instruments Inc, Melville, NY, USA) for cell morphology and
adherence.
5.2.2.1 Doubling time
For doubling time calculations, cells were trypsinized at specific time points and
viable cell number was determined by trypan blue exclusion test (Section 4.2.7).
Doubling time (DT) was calculated by the formula:
DT = t log 2 / (log Nt- log N0),
Where, t is the time, Nt is the number of cells harvested at time t and N0 is the initial
number of seeded cells.
5.2.3 Osteoblast differentiation studies on the ECM protein treated plates
The hMSCs grown on ECM protein treated plates were induced to osteoblast
differentiation by growing them in osteogenic induction media (Table 4.3). The plates
were observed under an inverted phase contrast microscope at regular intervals for
morphological changes and mineral deposition. Osteoblast differentiation was evaluated
-
63
at different time points by methods such as alkaline phosphate (ALP) staining, ALP
assay, histochemical staining for secreted mineral matrix, calcium assay and osteoblast
differentiation associated gene expression.
5.2.3.1 Alkaline phosphatase staining
Staining to demonstrate ALP was done after 7days of osteogenic induction by 5-
bromo-4-chloro-3-indolyl phosphate (BCIP) / nitro blue tetrazolium (NBT) method. The
reagent BCIP/NBT was purchased from Sigma-Aldrich (St. Louis, MO, USA). The
media was aspirated completely and the plates were washed thrice with DPBS. The
BCIP/NBT premixed solution was added to the plates and incubated at 37 ºC in the same
culture conditions for 30min. The plates were then observed under an inverted phase
contrast microscope (Nikon Eclipse TE2000-S, Nikon Instruments Inc, Melville, NY,
USA) for cells stained as bluish black or brownish black. The images were captured using
QCapture Pro 6 software.
5.2.3.2 ALP assay
For the ALP assay, the total protein extract was collected on day 0, 7, 14
and 21 of osteogenic induction. Cells were harvested using 0.25% trypsin-EDTA
(GIBCO, Invitrogen, NY, USA) and the cell pellet was washed thrice with DPBS. Total
protein was extracted with the help of a 1ml homogenizer using 200ul of 1% Triton X in
DPBS containing 1X protease inhibitor and 1mM PMSF (Phenylmethanesulfonyl
fluoride), (Sigma-Aldrich, St. Louis, MO, USA). The cell lysate was then centrifuged at
3000 rpm for 15 min. The supernatant containing the protein extract was then transferred
to a fresh 1.5ml microcentrifuge tube (Eppendorf AG, Germany) tube and stored at -80
ºC
until use.
-
64
5.2.3.2.1 Bradford assay
Total protein in the protein extract was estimated by Bradford Assay (Sigma-
Aldrich, St. Louis, MO, USA). Protein standards of 0, 0.25, 0.5, 0.75, 1 and 1.4mg/ml of
bovine serum albumin (BSA, Sigma-Aldrich, St. Louis, MO, USA) were prepared in
DPBS buffer. The Bradford reagent was mixed gently and brought to RT before use. 5ul
each of standards and protein test samples were added to separate wells of a 96 well
microtitre plate. To each well 250μl of the Bradford reagent was added and mixed well
on a shaker for 30sec. The plate was incubated at room temperature for 30min. The
absorbance was measured at 595nm in a spectrophotometric plate reader (VICTOR 3TM
Multilabel Counter, model 1420–032, Perkin Elmer, Waltham, MA, USA). The amount
of protein present in the test sample was determined from the standard curve by the
following formula.
Test protein (mg/ml) = (Test absorbance / Standard absorbance) ×
Concentration of the standard (mg/ml)
5.2.3.2.2 AMP (2-amino-2-methyl-l-propanol) substrate buffer
The AMP-substrate buffer was prepared by making a 0.5M AMP solution in
distilled water at pH 10. The buffer was supplemented with 2mM MgCI2 and 9mM p-
nitrophenyl phosphate (p-NPP).
5.2.3.2.3 p-Nitrophenol (p-NP) standards
Standard concentrations were prepared using p-NP in appropriate volumes of
0.5M AMP buffer (pH 10) and were stored in the dark at 4 ºC until use. The standards
ranged from 0 - 0.5mM.
-
65
5.2.3.2.4 ALP assay
The assay was performed by adding 100µl of each p-nitrophenol (p-NP) standard
and 50 µl of the thawed test sample to separate wells of a 96-well microtiter plate. 50µl of
AMP-substrate buffer containing p-nitrophenyl phosphate (p-NPP) was then added to
each of the test samples. After incubation at 37ºC, the absorbance was measured at 405nm
at 5min intervals for 30min using a spectrophotometric plate reader (VICTOR 3TM
Multilabel Counter, model 1420–032, Perkin Elmer). A standard curve of absorbance
versus p-NP concentration was generated and used to determine the concentration of p-
NP formed in the test sample. The amount of ALP present was then normalized to the
amount of total protein present. The change in the level of ALP activity at different time
points of differentiation when compared to the level in the starting undifferentiated (day
0) cells were calculated and graphs were generated. All the ALP assay reagents were
purchased from Sigma-Aldrich (St. Louis, MO, USA)
5.2.3.3 Histochemical staining for calcium
Alizarin Red S and von Kossa staining for calcium were used for the
demonstration of calcium in the secreted mineral matrix of osteoblasts. Alizarin Red S
staining (Section 4.2.9.3.1) was performed on day 14 and Von Kossa staining (Section
4.2.9.3.2). The macroscopic view photographs were taken using Nikon D3000 digital
camera.
5.2.3.4 Quantification of calcium
The plates were removed for calcium quantification on day 21 of osteogenic
induction. After the media was removed completely, the plates were washed thrice with
DPBS. The cells were decalcified with 0.6N HCl (Merck) for 24h, in a shaker at RT. The
-
66
calcium content was determined by measuring the concentrations of calcium in the HCl
supernatant by the O-cresolphthalein complexone method (Sigma-Aldrich, St. Louis,
MO, USA). After decalcification, the plates were washed three times with PBS and the
cells were solubilised with 0.1N NaOH / 0.1% SDS containing 1X protease inhibitor and
1mM PMSF in a homogenizer. The cell lysate was then centrifuged at 3000rpm for
15min. The supernatant containing the protein extract was then transferred to a fresh
1.5ml centrifuge tube (Eppendorf AG, Germany) and stored at -80
ºC until use. The
protein content was measured by Bradford assay (Section 5.2.3.2.1). The calcium content
on the cell layer was normalized to the total protein content.
5.2.3.5 Gene expression analysis
5.2.3.5.1 RNA isolation
Plates were removed on day 0, 7, 14 and 21 of osteogenic induction for RNA
isolation. After completely removing the media, the plates were washed thrice with
DPBS. 1ml of TRI reagent (Sigma-Aldrich, St. Louis, MO, USA) was added to the 35mm
culture plate and the cells were lysed well with repeated pipetting. The cell lysate was
collected and stored in 1.5ml centrifuge tubes (Eppendorf, AG, Germany) at -80
ºC until
further processing. For isolating the RNA, first, the tubes were thawed and the contents
were mixed well. 0.2 ml of chloroform per 1ml TRI reagent was added and shaken
vigorously for 15- 30sec by hand. The tubes were incubated at RT for 5-15min. The tubes
were then centrifuged at 11,000 rpm for 15min at 4 ºC. The upper aqueous phase
containing the total RNA was removed carefully to a fresh 1.5ml centrifuge tube. 0.5ml
IPA was added per 1ml of TRI reagent used and incubated at RT 10min. The tubes were
then centrifuged at 11000 rpm for 10min at 4 ºC. The supernatant was removed carefully
without disturbing the loose RNA pellet. The pellet was washed by adding 1ml of 75%
-
67
ethanol per ml of TRI reagent used and centrifuging at 11000 rpm for 5 min at 4ºC. The
pellet was dried at RT and re-suspended in 200μl of DEPC treated water. The isolated
RNA was quantified using NanoDrop spectrophotometer (NanoDrop Technologies Inc.
USA) and the samples were stored at -80
ºC until further processing.
5.2.3.5.2 Preparation of cDNA
cDNA was prepared from 1µg of RNA. Before preparing the cDNA, the RNA was
treated with DNAse (Fermentas Life Sciences, EU). The reagents given in table 5.3 were
added in the same order to a nuclease free PCR tube and kept at 37 ºC for 30min in a
thermo cycler (Veriti, Applied Biosystems, UK).
Reagent Quantity
RNA 1µg
10X Reaction buffer with MgCl2 1µl
DEPC treated water To make 9µl
DNAse 1, RNAse free(1 u / µl) 1µl
Table 5.3 Reagent compositions for DNAse treatment.
The reaction was stopped by adding 1µl of 25mM EDTA that was kept for 65 ºC for
10min in a thermo cycler. The DNAse treated RNA was used as the template for reverse
transcriptase for cDNA synthesis.
cDNA was prepared with the DNA first strand synthesis kit (Fermentas Life
Sciences, EU) and the reactions were set on ice. 11µl of DNAse treated RNA and 1µl of
random hexamers were added to a nuclease free PCR tube, mixed gently, centrifuged
briefly, incubated at 65 ºC for 5min in a thermo cycler and chilled. The following reagents
given in table 5.4 was added in the same order to the tube and incubated at 25 ºC for 5min
-
68
followed by 60min at 37 ºC. The reaction was terminated by heating at 70
ºC for 5min.
The prepared cDNA was stored at -80
ºC until further processing.
Reagent Quantity
5X Reaction buffer 4ml
Ribolock RNAse inhibitor (20U / µl) 1µl (20U)
10mM dNTP mix 2µl (1mM)
M-MuLV reverse transcriptase (20U / µl) 2µl (40U)
Table 5.4 Master Mix compositions.
5.2.3.5.3 Quantitative real time polymerase chain reaction
The expression level of osteoblasts differentiation associated genes like Runt
related-transcription factor 2 (RUNX2), alkaline phosphatase for liver/bone/kidney
(ALPL), collagen, type I, alpha I (COL1A1), secreted phosphoprotein 1 (SPP1) /
osteopontin(OPN), secreted protein, acidic, cysteine-rich (SPARC )/ Osteonectin (ON),
Sp7 transcription factor (SP7) / Osterix (OSX), integrin-binding sialoprotein (IBSP) and
bone gamma-carboxyglutamate (gla) protein (BGLAP) / Osteocalcin (OCN) were done.
All the primers were obtained from Bioneer (Daejeon, South Korea). The accession
number and sequences of all the primers used in this experiment are given in table 5.5.
Quantitative Real time PCR was performed in a 7500 Real Time PCR system
(Applied Biosystems, UK) using 7500 system SDS (Sequence detecting software)
software for the specific primers with Power SYBR Green real time PCR kit (Applied
Biosystems, Warrington, UK) according to the manufacturer’s instructions. A reaction
volume of 10µl was set up in triplicate for each template cDNA sample (Table 5.6). The
reactions were carried out in the wells of a MicroAmp® optical 96-well reaction plate
(Applied Biosystems, Warrington, UK). The plate was sealed with MicroAmp® optical
-
69
adhesive films. The plate was centrifuged to spin down the contents and eliminate air
bubbles from the solutions. The plate was loaded into the plate holder of the Real Time
PCR machine.
GenBank
Accession. No. Gene Forward Primer Sequence, 5’ -3’ Reverse Primer Sequence, 5’ -3’
Product
size, bp
NM_199173.3 BGLAP GACTGTGACGAGTTGGCTGA GAAGAGGAAAGAAGGGTGCC 138
NM_001127501.1 ALPL GAGGTGGCATGAAGCTCAGT ACCTGCTTTATCCCTGGAGC 162
NM_004348.3 RUNX2 ATTTCTCACCTCCTCAGCCC CAACAGCCACAAGTTAGCGA 135
NM_001040058.1 SPP1 TCTCCTAGCCCCACAGAATG GTCAATGGAGTCCTGGCTGT 154
NM_000088.3 COL1A1 CATCTCCCCTTCGTTTTTGA CCAAATCCGATGTTTCTGCT 109
NM_003118.2 SPARC GTGCAGAGGAAACCGAAGAG TCATTGCTGCACACCTTCTC 172
NM_004967.3 IBSP AACCTACAACCCCACCACAA AGGTTCCCCGTTCTCACTTT 149
NM_152860.1 SP7 GCCAGAAGCTGTGAAACCTC GCTGCAAGCTCTCCATAACC 161
NR_003286.2 RN18S1 CGGCTACCACATCCAAGGAAG AGCTGGAATTACCGCGGCT 188
Table 5.5 The sequences and accession number of the primers used for the real time PCR.
Sl. No. Component Volume
1 2X SYBR Green PCR master mix 5µl
2 Forward primer 0.25µl
3 Reverse primer 0.25µl
4 Template cDNA 0.5µl
5 DEPC water 4µl
Table 5.6 Real time PCR reaction mix (10µl) composition.
The program was set for an initial activation at 95 ºC for 5min. This was followed by 40
cycles of two-step cycling, consisting of a denaturation step at 60 ºC for 10sec and a
combined annealing/extension step at 60 ºC for 35sec. Data was analysed using 7500
system SDS software and the cycle threshold or the Ct value, which correlated with the
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=158517828http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=188595717http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=66934968http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=91206461http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=110349771http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=48675809http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=167466186http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=22902135http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=225637497
-
70
starting quantity of the target mRNA was used for further calculations and analysis of the
gene expression levels. The Ct value for the interested genes were normalised to the 18S
rRNA expression levels. ΔCt was calculated as the difference in the Ct value between the
differentiated and undifferentiated (Day 0) cells. ΔΔCt was calculated as the difference in
the Ct values between the ECM treated and untreated plates at different stages of
osteoblast differentiation. The fold difference in the gene expression level of cells when
differentiated on ECM protein treated plates with respect to the untreated plates was
calculated by the formula:
Fold change = 2-ΔΔCt
5.2.3.6 Statistical analysis
The experiments were repeated with three different donor samples. The graphs
depicted a representative experiment done in duplicates. The measure for each sample
was performed in triplicates and the results were expressed as mean ± standard deviation
(SD). The statistical analysis was done by the two tailed, paired Student’s t test. In all the
analysis a p-value less than 0.05 was considered significant and asterisks were given
accordingly to indicate the level of significance as *p
-
71
(Table 5.7). Similarly, hMSCs grown on laminin and fibronectin treated plates showed
marked reduction in doubling time (41.5 ± 11.1h and 48.7 ± 19.1h respectively).
However, hMSC grown on vitronectin treated plate showed similar proliferation rate and
doubling time as that on the untreated plate (57.7 ± 19.7h vs. 65.7 ± 23.4h).
Figure 5.1 Human MSCs on ECM protein treated plates. Phase contrast microscopy showed adherent
spindle shaped fibroblast like cells on all the tested plates after 24h of incubation. Scale bar-50µm.
Plate Doubling time (DT) in h (Mean ± SD)
Untreated 65.7 ± 23.4
Collagen type I 39.7 ± 6.9
Fibronectin 48.7 ± 19.1
Laminin 41.5 ± 11.1
Vitronectin 57.7 ± 19.7
Table 5.7 Doubling time (DT) of hMSCs on ECM protein treated plates (n=5).
-
72
5.3.2 Osteoblast differentiation studies on the ECM protein treated plates
Human MSCs grown on ECM treated plates were subjected to osteoblast
differentiation. Here, we observed that cells grown on untreated and ECM treated plates
showed initiation of mineralization in the second week of differentiation (Fig. 5.2K-O).
However, early onset of mineralization was observed in the cells grown on collagen type
I (Fig. 5.2G) treated plate when compared to the cells grown on other ECM treated and
untreated plates. The phase contrast micrographs showed visible mineral deposition in all
the plates except on laminin treated plate (Fig. 5.2N) on day 14 of osteogenic induction.
Among the group, large amount of secreted bone matrix was observed in the cells grown
on collagen type I treated plate. As the differentiation progressed, there was marked
increase in the mineral deposition, which was evident from the phase contrast
micrographs on day 21 of osteogenic induction.
Figure 5.2 Phase contrast microscopy of the hMSCs undergoing osteoblast differentiation on ECM
protein treated plates. Onset of mineralization is visible on collagen type I treated plate on day 7 of
osteogenic induction (G, yellow arrow, inset shows the area marked within the red squire at higher
magnification). High mineralization was seen on this plate on day 14 (L) and 21(Q) of differentiation also.
Fibronectin (M, R) and vitronectin (O, P) treated plates also showed good mineralization (day 14 and 21).
Laminin treated plate (S) showed lower mineral deposits even after 21 days of osteogenic induction. Scale
bar - 10µm.
-
73
5.3.2.1 ALP staining and assay
Alkaline phosphatase staining performed after 7days of osteogenic induction was
very helpful in assessing the osteogenic potential of the cells grown on ECM treated
plates at the initial stages of differentiation. High ALP positive cells were observed in the
cells grown on collagen type I, fibronectin and vitronectin as compared to that of laminin
treated plate and untreated plate (Fig. 5.3).
Figure 5.3 ALP staining by NBT/ BCIP method. Representative figures showing cells stained positive
for ALP on different ECM protein treated plates. More ALP positive cells were observed on collagen type I
(B), fibronectin (C) and vitronectin (E) treated plates when compared to the untreated (A) and laminin (D)
treated plates. Scale bar - 10µm.
ALP assay revealed that ALP activity was more in the cells grown on collagen
type I treated plates at day 7 of osteogenic induction (Fig. 5.4). ALP activity was lower
on day 7 of induction in the cells grown on fibronectin, laminin and vitronectin treated
-
74
plate. ALP activity significantly (p< 0.01) increased from day 7 to day 14 of osteogenic
induction on all the tested plates. Vitronectin treated plate showed the highest ALP
activity (p
-
75
5.3.2.2 Alizarin Red S and von Kossa staining for calcium
Alizarin Red S staining performed on day 14 of osteogenic induction showed a
positive staining for calcium on all the tested plates (Fig. 5.5). Collagen type I treated
plate showed the highest calcium deposition when compared to all other ECM protein
treated and untreated plates. The staining revealed high calcium deposits on fibronectin as
well as vitronectin treated plates also. Laminin treated plate however; showed very
marginal amount of calcium deposits. Macroscopic view showed visible areas of positive
staining on collagen type I, fibronectin and vitronectin treated plates. The higher
mineralization on collagen type I treated plates was clearly visible in the macroscopic
view photograph.
von Kossa staining performed on day 21 of osteogenic induction showed secreted
mineral matrix on all the tested plates (Fig. 5.6). Collagen type I and vitronectin treated
plate showed remarkably high amount of mineral deposits as evidenced by the phase
contrast micrographs and macroscopic view photographs. Fibronectin treated plates also
showed good amount of mineral deposits. Among the tested plates, laminin treated plates
showed the lowest calcium deposits.
5.3.2.3 Calcium assay
Quantification of calcium in the secreted mineral matrix showed two fold higher
amount of calcium on vitronectin treated plate than the untreated plate (Fig. 5.7).
However, plates treated with collagen type I and fibronectin showed similar amount of
calcium as that on the untreated plate. The amount of calcium was found to be
significantly lower in the cells grown on laminin treated plates.
-
76
Figure 5.5 Alizarin Red S staining for calcium. The plates stained with Alizarin Red S stain on day 14 of
osteogenic induction. Collagen type I plate showed the highest mineralization, which is evident from the
more stained area (G) with highest intensity of staining (B). Fibronectin (C, H) and vitronectin (E, J) treated
plates also showed better staining than the untreated plate. Laminin treated plate (D, I) showed the lowest
staining. Scale bar - 10µm.
Figure 5.6 Von Kossa staining for calcium. The plates stained by von Kossa method on day 21 of
osteogenic induction. Collagen type I (B, G) and vitronectin (E, J) treated plate showed the highest staining
followed by fibronectin (C, H). The degree of staining was minimal on laminin treated plate (D, I). Phase
contrast micrographs, Scale bar - 10µm.
-
77
Figure 5.7 Calcium assay on day 21 of osteogenic induction. Vitronectin treated plate showed the highest
amount of calcium. Significant two fold higher calcium was seen on vitronectin treated plate when
compared to collagen type I, fibronectin and untreated plates. Collagen type I treated plate had similar
calcium level as that of the untreated plate, whereas, fibronectin treated plate showed slightly higher
calcium level. The amount of calcium in the secreted matrix of laminin was very low compared to all the
other plates. (*p
-
78
Among the tested ECM proteins, collagen type I treated plates showed the
maximum up-regulation of osteoblast differentiation associated genes. Early stage of
differentiation on these plates showed the highest expression of ALPL (47 fold, p< 0.01)
and a relatively high expression of RUNX2 (two fold). The ALPL expression level
decreased to three fold (p< 0.01) at the mid stage (day 14) which was further down
regulated towards the late stage of differentiation. The mid stage of differentiation also
showed the up-regulation of OPN (14 fold, p< 0.01), OCN (six fold, p
-
79
Figure 5.8 Osteoblast differentiation associated gene expression profile. Collagen type I treated plate
showed significantly high expression of OPN, ALPL IBSP and OCN. Fibronectin treated plate showed
significant increase in the expression of ALPL, OSX and OCN. Laminin treated plate showed significant
increase in COL1A1, IBSP, OSX and OCN expression. Vitronectin treated plate showed significant
increase in ALPL, IBSP and OCN expression. There was marked increase in OPN expression also.
(*p
-
80
the osteoblast differentiation associated genes such as COL1A1, OPN, ALPL, ON and
OCN remained unchanged throughout the differentiation process. Only genes that
showed higher gene expression were RUNX2 (six fold) and OSX (6 fold, p< 0.01) at
early stage, and IBSP (14 fold, p< 0.01) and ON at mid stage of osteoblast differentiation.
None of the genes was shown up-regulated at late stage of differentiation (Fig 5.8).
5.4 Discussion
The role of ECM in regulating cell adhesion and differentiation is well established
(Reilly and Angler, 2010). This is the first detailed study showing the effect of ECM
proteins on proliferation of hMSCs and their differentiation into osteoblast in terms of
ALP activity, bone matrix secretion, calcium deposits and osteoblast differentiation
associated gene expression. ECM protein mediated enhancement of proliferation,
osteoblast differentiation and mineralization of hMSCs were evidenced from our studies.
The gene expression profile showed that collagen type I, fibronectin, and vitronectin
played important role in enhancing differentiation and thereby improving bone
regeneration. Among the ECMs that were used in the current experiment, collagen type-I
showed maximum up-regulation of osteoblast differentiation associated genes and was
proved to be most important protein and known to play significant role in mineralization
and osteogenic differentiation.
Osteoblasts synthesize the macromolecules of the bone matrix including collagen
type I; osteocalcin; osteonectin; osteopontin; proteoglycan I and II; bone sialoprotein;
matrix gla-protein; bone glycoprotein 75; several other proteins (Rodin and Noda, 1991).
Osteoblasts also have high levels of the membrane-bound enzyme, alkaline phosphatase
(ALP), which plays a role in matrix mineralization, and receptors for tissue-specific
hormones, such as parathyroid hormone, as well as many other hormones, cytokines and
-
81
growth factors, which regulate bone growth, differentiation and metabolism. The
expression of these various proteins, most of which are not unique to bone but which
together characterize the bone phenotype, is induced during osteoblastic differentiation in
a stepwise fashion, suggestive of multiple regulatory factors. ALP is a multifunctional
enzyme which hydrolyses phosphate substrate releasing inorganic phosphate which binds
with calcium forming hydroxyapatite which constitute the bone mineral (Oromo and
Shimada, 2008; Balcerzak et al., 2003). The peak in ALP activity is generally coincides
with the initiation of mineralization (Lian and Stein, 1995). We observed a rapid increase
in the ALP activity from day 7 to 14 of osteogenic induction and apparent mineralization
on all the ECM treated as well as the untreated plates. The significant role of the ALP
gene (ALPL) in initiating and enhancing mineralization was also evident from our
studies. Relative ALPL gene expression at early stage of differentiation was highest on
collagen type I, fibronectin and vitronectin treated plates, which showed early onset of
mineralization and increased bone matrix secretion. High ALP expression on collagen
type I, fibronectin and vitronectin treated plate was evident from early phase staining for
ALP. On the contrary, laminin treated plate did not enhance mineralization and bone
matrix secretion which was also evidently shown by unaltered ALPL gene expression.
This underscores the ALPL associated enhancement of mineralization by the ECM
proteins. It appears that collagen type I and alkaline phosphatase are expressed early
during the commitment to the osteoblastic phenotype (Rodan and Noda, 1991). Our
results also showed that increase in ALPL gene expression at early stage of
differentiation is critical in mineralization and bone matrix secretion, whereas osteopontin
and osteocalcin appears late during osteoblast differentiation and that could be enhanced
with the support of appropriate ECM microenvironment. In our study, we have shown
that collagen type 1, Fibronectin and vitronectin may provide appropriate ECM
-
82
microenvironment for osteoblast differentiation. However, the significant fold differences
observed in the ALPL gene expression on the ECM treated plates with respect to the
untreated plate, were not reflected in the ALP activity on these plates. Studies by Gong
and Wezeman (2004) also supported this discrepancy observed in the ALP expression at
the gene and protein level.
Among the ECM proteins that we have tested in this experiment, collagen type-I
was found to be the most appropriate ECM that regulated maximum gene expressions at
different stages of maturation of osteogenic differentiation. The gene expression profile
on collagen type I treated plate showed significantly high expression of RUNX2,
COL1A1, OPN, ALPL, IBSP and OCN at different stages of osteoblast maturation.
Recently, several critical transcription factors involved in the process of differentiation in
MSC derived lineages have been identified. Osteogenesis of MSC involves RUNX2,
which enhance expression of osteogenic genes (Ducy et al., 1997; Nakashima et al.,
2002).
There are two types of proteins in bone extracellular matrix: the collagens, mostly
type I collagen, which account for 90% of the bone matrix proteins and the non-
collagenous proteins, including osteocalcin and bone sialoprotein (Gehron-Robey, 1996).
OCN is the major non-collagenous protein component of bone extracellular matrix,
synthesized and secreted exclusively by osteoblastic cells in the late stage of maturation,
and is considered as the late stage indicator of osteoblasts differentiation; whereas, IBSP
and OPN are considered as early markers of bone matrix synthesis (Denhardt et al., 1993;
Bianco et al., 1991; Hauschka, et al., 1989). IBSP acts as a nucleation point for
hydroxyapatite and thereby initiating mineral deposition (Ganss et al., 1999). OPN is also
associated with initiation of mineralization (Roach, 1994). RUNX2 is the first
transcription factor required for commitment of the MSCs to osteoblast lineage (Komori,
-
83
2010). Therefore, it is evident that a relatively higher expression of these genes and high
ALP activity in the early phase of osteoblast differentiation contributed to the early onset
of mineralization on collagen type I treated plate. Significant increase in the expression of
OCN and OSX in the later phase of osteoblast differentiation enhanced the bone matrix
deposition on these plates. So, enhanced hMSC proliferation and osteoblast
differentiation by collagen type I implies faster and better bone healing. Although most of
the osteoblast differentiation associated genes got up-regulated on collagen type I plate
with respect to the untreated plate, no significant change was observed for calcium in the
secreted mineral matrix.
The quality of the bone is very important in bone replacement or regenerative
therapies as it is the main determinant of the bone strength. Bone matrix is composed of
organic phase consisting of mainly collagen type I providing the toughness and inorganic
phase consisting of calcium giving the stiffness to bone (Viguet-Carrin et al., 2006).
Therefore, it is important to quantify the calcium content of the secreted mineral matrix
for evaluating the osteogenic potential of a chemical or polymer. The highest amount of
calcium was present in the mineral matrix on vitronectin treated plate. Though vitronectin
treated plate showed significant ALPL and IBSP gene expression, it was remarkably
lower than the up-regulation of these genes observed on collagen type I treated plate.
OCN and OSX that showed significant expression on collagen type I and fibronectin
treated plates also did not show much change on these plates. These findings suggest that
vitronectin enhanced bone matrix synthesis and calcium deposition by a different
mechanism.
Previous studies showed an integrin mediated regulation of osteoblast
differentiation by osteoblast-committed cells (Gronthos et al., 1997). Difference in the
integrin binding and subsequent signal transduction could be responsible for the observed
-
84
difference in the mineralization on different ECM protein treated plate. ECM proteins
regulate osteoblast differentiation mainly through integrin mediated signal transduction
by ERK/ MAPK pathway. Osteoblasts express the integrins like α1β1, α2β1, α3β1, α4β1,
α5β1, αvβ3 and αvβ5 (Gronthos et al., 1997). ECM proteins like collagen type I can
interacts with α1β1, α2β1, α3β1 and αvβ3; fibronectin interacts with α2β1, α3β1, α4β1
and α5β1; laminin interacts with α1β1, α2β1, α3β1 and αvβ5 and vitronectin interacts
with αvβ3 and αvβ5 (Kim et al., 2008). The integrin expression on the cell can vary
depending on the culture conditions and contacting surfaces (Sinha and Tuan, 1996).
Studies by Gronthos et al. (2001) showed that monoclonal antibody against β1 affected
the cell binding to collagen type I, fibronectin and laminin but not vitronectin. In contrast,
inhibition of αvβ3 did not affect binding to collagen type I, fibronectin and laminin but
vitronectin was affected. In addition, Kundu and Putnam (2006) reported that vitronectin
and collagen type I regulated osteoblast differentiation of hMSCs by two different
mechanisms. They suggested that vitronectin stimulated FAK (focal adhesion kinase)
activation, which induced osteogenesis possibly by influencing the activity of RhoA. By
contrast cells on collagen type I reduced the activation of FAK and increased the
activation of ERK and P13K. ERK induced osteogenesis by the activation of RUNX2.
There was significantly higher expression level of the collagen type I receptor α2β1 than
vitronectin receptor αvβ3 by hMSCs. This finding supports the enhanced cell adhesion
and proliferation and subsequent early mineralization observed on collagen type I treated
plate. In a similar study, Salasznyk et al. (2004) also reported that adhesion of hMSCs to
collagen type I and vitronectin promoted osteoblast differentiation better than other ECM
proteins. They also found higher mineral to matrix ratio and calcium deposition on
vitronectin treated plate than collagen type I treated plates.
-
85
Laminin promoted hMSC adhesion and proliferation, but it failed to improve
osteoblast differentiation. Although there was normal ALP activity, high IBSP and OSX
gene expression, there was significantly reduced levels other osteoblast differentiation
associated genes on laminin treated plate. This resulted in remarkably low mineral matrix
deposition and significantly low calcium content on these plates. Klees et al. (2005) also
reported similar observations on laminin treated plates. In their study, laminin enhanced
MSC adhesion and on osteogenic induction showed high ALP activity, OCN, IBSP, and
RUNX2 but did not improve the levels of calcium. One possible reason for the low
osteogenesis on laminin may be due the diminished expression of α6β1 and absence of
α3β1, the two important laminin binding integrins, on osteoblasts (Kundu and Putnam,
2006). The consequential low ALPL expression could be responsible for the low
mineralization on laminin treated plates. The osteoblast differentiation profile of laminin
also states that enhanced cell adhesion and proliferation need not improve differentiation
always.
We identified Alizarin Red S staining a good indicator for detecting early onset
and comparison of mineralization. Since, von Kossa gave a positive staining only towards
the final phase of mineralization, it served as a confirmatory test for matrix maturation.
We also noted that though both these staining methods are used for detecting calcium in
the mineral matrix, they did not give a real picture of calcium. The calcium quantification
data showed significantly different amount of calcium on plates, which showed similar
intensity of staining and vice versa. Based on these findings we emphasise the importance
of quantifying calcium in the secreted mineral matrix, which indicates the quality and
strength of the newly formed bone.
In conclusion, we demonstrated improved hMSC adhesion and proliferation on
collagen type I treated plates. We have successfully demonstrated the enhancement of
-
86
osteoblast differentiation and mineralization on ECM protein treated plates like collagen
type I, vitronectin and fibronectin. Relative up-regulation of ALPL gene expression was
observed on these plates, which thus suggested an ALPL mediated enhancement of
mineralization. Our results underscore the relevance of quantifying calcium in the
secreted matrix, which indicated the bone strength. We recommend, collagen type I for
faster and effective bone healing. Vitronectin, which can form ideal bone, could be
employed for the surface modification of biomaterials or implants to enhance
mineralization. Our findings could be helpful in designing biomimetic ECM protein
based biomaterial for bone tissue engineering applications.