Studies of P-glycoprotein intracellular domains by ... · Studies of P-glycoprotein intracellular...
Transcript of Studies of P-glycoprotein intracellular domains by ... · Studies of P-glycoprotein intracellular...
Studies of P-glycoprotein intracellular domains by cysteine
scanning mutagenesis
Marc-Etienne Rousseau
Department of Biochemistry
McGill University
Montréal, QC, Canada
August 1999
A thesis submitted to the Faculty of Graduate Studies and Research in partial fulfillment
of the requirements of the degree of Master of Science
O Marc-Etieme Rousseau, August 1999
National Library 1*1 ofCanada B i u e nationale du Canada
uisitions and "1. Acquisitions et Bib iographic Services seruiceç bibliographiques
The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, 10- distriilbute or sell copies of this thesis in microform, paper or electronic formats.
The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the author's permission.
L'auteur a accordé une licence non exclusive pennethnt a la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique.
L'auteur comme la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.
Interactions between the various intracellular loops and nucleotide binding
domains (NBDs) of P-glycoprotein (P-gp), and the extent to which they contribute to
protein structure and transport mechanism are widely unknown. Analogy to bacterid
members of the ABC transporter farnily suggests that the nucleotide binding domains
interact with a specific site on an intmcellular loop and with each other, as a cooperative
dimer, in order to energize the transport fimctions. To investigate this hypothesis, we
have used a cysteine scanning mutagenesis strategy on four potentially interacting regions
of P-gp. We have analyzed the biological activity of the different mouse P-gp cysteine
mutants in a yeast heterologous system. We established that the biological activity of the
human MDRl and MDR1-cysteine-less proteins can also be monitored by the yeast
system. We also engineered and tested a MDRl cysteine-less protein containing a factor
Xa protease recognition site located in the third extmcellular loop as a tool for future
studies. Finally, analysis of the biological activity of the substitution mutants reveals key
residues in regions that may be involved in drug binding and/or intrarnolecular domain
interactions.
Résumé
Très peu de choses sont connues au sujet des interactions structurales et
fonctionnelles entre les divers domaines intracellulaires de la P-glycoprotéine (P-gp). Par
analogie a des protéines bactériennes, aussi membres de la famille des transporteurs de
"type ABC", on peut supposer que les "nucleotide binding domains" forment un dimère
qui est recruté par une des boucles cytoplasmiques afin d'activer les fonctions de
transport. Pour étudier cette hypothèse, nous avons utilisé une stratégie de scan
mutagénique par cystéines dans quatre régions candidates de la P-gp. Nous avons analysé
l'activité biologique des différents mutants de la P-gp murine exprimés par des levures à
l'aide d'un système génétique hétérogène. Nous avons confirmé que l'activité biologique
des protéines humaines, MDRI et MDRI -CL, peut-être aussi évaluée à l'aide de ce
système. Nous avons aussi inséré et testé un site de clivage protéolytique dans la
troisième boucle extracellulaire d'une P-gp dénudée ce ses cystéines, visant comme
objectif de se procurer un outil de travail pour des études ultérieures. Finalement,
l'anaiyse de l'activité biologique des differents mutants révèle que certaine acides aminés
sont essentiels à la fonction de régions possiblement impliquées dans la reconnaissance de
substrats et/ou dans des interactions intramoléculaires.
The work presented is essentially my own. Romain Cayrol, an undergrad student
under my supervision, provided help to for the mutagenesis manipulations and yeast
works in the P4 strands mutants project (figure 12). Dr. Michel Julien provided the factor
Xa Western seen in figure 8, panel D, and Dr. Kalle Gerhing provived help and expert
advice for the interpretation of the crystal structure data. Finally, Dr. P. Gros provided
expert advice and supervision throughout the course of these studies.
Table of Contents
Abstract
Résumé
Preface
Table of Contents
List of Figures
List of Tables
Acknowledgernents
Chapter I
1.1
1.2
1.3
1.4
1.5
1.6
1.7
1.8
1.9
Introduction
The MDR phenotype
The mdr genes family
Structure of P-glycoprotein
The ATP binding cassette transporter family
Interaction of P-gp with ATP and d m g molecules
The MalK model: interaction between intracellular
loop 2 and NBDs
The ATPase activity of P-gp
The HisP model: interaction between the two NBDs
An alternative strategy to study protein topology
Page
. . 11
. . . 111
iv
v
viii
X
xi
Chapter II
II. 1
11.2
11.3
II .4
11.5
11.6
11.7
11.8
Chaprer III
III. 1
111.2
111.3
Material and Methods
Basic molecular biology and sequencing
Restriction cassettes
Site-directed mutagenesis in mdr3 and MDRI-CL cDNAs
Saccharomyces cerevisiae yeast culture
11.4.1 Transformation of JPY20 1 and screening by
mini-membrane preparation
11.4.2 F U 0 6 drug resistance assay
11.4.3 Mating assay
Pichia pastoris yeast culture
11.5.1 Transformation of mdr genes, induction and screening
11.5 -2 Large preparation of membranes
P-gp purification from Pichia pastoris membranes
11.6.1 Nickel-chromatography purification
11.6.2 ATPase activity assay
Proteolytic cleavage with factor Xa
Cornputer analysis
Results
Conserved protein motifs in ABC transporters
Screen of the conserved motifs for important residues
Production of the MDRI - c L - x ~ ~ protein
111.4 Characterization of P4 strands MDRI -CL mutants
Chapter I V Discussion
IV. I Analysis of conserved protein motifs in ABC transporters
IV.2 C l e a v a g e o f t h e p u r i f i e d ~ ~ ~ l - C L - X ~ ) protein
IV.3 MDRl -CL 84 strands mutants
IV.5 General conclusions and hture perspectives
References
vii
Lîkf of Figures
Page
Chapter 1 Introduction
Figure 1 Proposed membrane topology of P-gly coprotein
Figure 2 Crystal structure of the hisP dimer
Chupter 3 Result
Figure 3 Alignrnent of the EAA-like motif and T578 region of
eukaryotic and prokaryotic ABC transporters
Figure 4 Growth of yeast transformants expressing either
wild-type or EAA-like motif mutant mdd cDNAs
in rich medium containing FK506
Figure 5 Growth of yeast transformants expressing either
wild-type or T578 region mutant mdr3 cDNAs in
rich medium containing FK506
Figure 6 Ability of wild-type or mutant mdr3 cDNAs to restore
mating phenotype in a nuli yeast mutant at the
endogenous sre6 locus
Figure 7 Histidine-tagged P-glycoprotein purification fiom
yeast membranes analyzed by coomassie gel staining
and immunoblotting 55
Figure 8 Digestion triais of the MDRI-CL-X~~ protein with
the factor Xa protease
Figure 9 Alignment of the hisP P4 strand sequence with both
NBDs of MDRl and crystal structure of hisP 84
strand dirner
Figure 10 Cornparison of the structural features of hisP P4 strand
dimer with the homologous region of MDRl
Figure 1 1 Growth of yeast transformants expressing either
MDR I , MDRI -CL or mdr3 cDNAs in rich medium
containing FK506
Figure 12 Growth of yeast transformants expressing either wild-type
or 64 strand mutant MDRl cDNAs in rich medium
containhg FK506 69
Likî of Tables
Page
Chapter 2 Material and Methods
Table 1 Oligonucleotides used with the pALTER
mutagenesis kit
Table 2 Oligonucleotides used for recombinant
PCR mutagenesis
Acknowledgemenîs
1 would like to express my gratitude to my supervisor, Dr. Philippe Gros, for his
mentorship, guidance and understanding during my short time in his lab. 1 would also
like to thank ail the members of the MDR tearn, Tony Kwan, Dr. Christina Kast, Dr.
Michel Julien, Dr. Ina Urbastch, Isabelle Carrier and Martine Brault for sharing their
knowledge, ideas, fiiendship and reagents. 1 am very grateful to Dr. Kalle Gehring who
helped me with the crystal structure data. A very special thanks to Samantha Gruenheid
and Dr. Michel Julien for their generous help and comments on this manuscript and to
Tony Kwan for vaiuable cornputer advice. Thanks also to al1 the other members of the
lab for help and encouragement concerning my project and for making these two and a
half last years an enjoyable learning experience. Je désire aussi souligner l'inestimable
soutient moral et financier provenant de ma famille qui m'appuie dans toutes mes
démarches. This work has been supported by a studentship from FCAR-FRSQ.
CHAPTER 1
INTRODUCTION
1.1 The MDR phenotype
In many human malignant turnors, the development of multidrug resistance
(MDR) phenomenon is a major limitation to successful chemotherapeutic treatment **.
n i e MDR phenotype is characterized by acquired or natural cross-resistance to
structurally and hctionally unrelated cytotoxic agents 273. While some solid tumors
such as those derived from lung, kidney and pancreas intrksically respond poorly to drug
treatment, others, like leukemias and lymphomas, only become resistant upon relapse
after a positive but incomplete response to the treatment 1. These last tumors no longer
respond to a wide variety of anticancer dnigs, apparently unrelated to the dmg used in the
first therapeutic eflort. Many factors such as turnor accessibility, heterogeneity and low
cellular level of resistance in patients make the study of multidmg resistance phenotype
difficult to carry out from in vivo sarnples. The advent of in vitro tissue culture models
495 has allowed M e r insight into the genetic, biochemical and pharmacological essence
of the MDR phenomenon.
In viîro, the MDR phenotype can be easily obtained in many cell lines of different
tissue origin by stepwise selection. This technique consists of exposing the cells for
several weeks to low concentrations of a specific cytotoxic agent 6-8. The drug-resistant
colonies are then expanded under a higher drug concentration, and this exercise is
repeated several times until the appearance of highly resistant clones. These surviving
clones can be isolated and subsequently show resistance to cytotoxic compounds to which
they have never been exposed. A large number of highly resistant human and rodent ce11
Iines have been created fkom difierent tissues 495. In h g selected cell-lines, very high
levels of resistance tend to be unstable and are oflen associated with chromosomal
abnormaiities 9-13 suggesting gene amplification. Overexpression of a protein is
required to achieve high level of resistance 14. MDR was found to be associated with the
overexpression of plasma membrane phosphoglycoproteins 14 called P-glycoproteins (P-
gp) that function as energy-dependent efflux purnps to reduce intracellular drug
accumulation 15. This group of proteins shows a molecular weight ranging fiom 160
kDa to 210 kDa, most probably depending on the glycosylation level. P-gps have been
detected in almost al1 MDR ce11 lines 495, with some exceptions such as the resistance
cases linked with the multidrug resistance-related protein (MW) 6, a distant relative of
P-gp (see the section on the ABC transporters family).
There are only few common structural or hctional characteristics shared by the
dmgs implicated as substrates of P-gp. Most of these compounds contain at least two
planar rings and a basic nitrogen atom bearing a positive charge at neutral pH, they are
lipophilic and can dif ise passively across the membrane lipid bilayer 791*. These dmgs
(often called MDR dmgs) include Vinca aikaloids (vinblastine, vincristine),
anthracyclines (adriamycin), colchicine, actinomycin D, etoposides (VP-16, VM-2 I) ,
taxol, srnail peptides such as valinomycin and gramicidin D and many others 19-22.
Most of them have very different cellular targets and mechanisms of action against
proliferating cells. A few examples: Vinca alkaloids and colchicine induce mitotic arrest
by binding to microtubules 23.24, anthracyclines are DNA intercalating agents 25,
actinornycin D blocks the RNA elongation process 26 while epipodophyllotoxins
(etoposides) block DNA replication by interacting with the topoisomerase 27. The MDR
phenotype was found to be linked with a sustained decrease in intracellular dmg
accumulation 297915328, due to an increase in h g emwc that behaved in an ATP and
temperature-dependant fashion 2 9 ~ 3 ~ .
1.2 The mdr gene family
The cDNAs corresponding to mRNAs encoding overexpressed P-gp in highly
multidmg-resistant ce11 lines have been isolated by different approaches, leading to the
characterization of the mdr gene family. Two groups used a similar experimental
approach 31932 based on an in-gel renaturation technique 33 allowing the detection of
large genomic DNA fragments commonly amplified in independently derived highly
dmg-resistant hamster and hurnan ce11 lines 34935. Such fiagments were cloned and used
for the creation of DNA probes in order to isolate full-length cDNA clones encoding P-gp
l936937. Ling et al. raised a monoclonal antibody against the overexpressed protein
(C2 19 against the hamster P-gp) and used it to screen bacteriophage cDNA expression
libraries conshvcted fiom highly resistant hamster cells 38939. Comparison of the results
fiom independent cloning experiments revealed that P-gps are encoded by a small family
of closely related genes, with two members in human (MDRI , MDR2) and three members
in rodents (mouse mdr 1 , mdr2, m d ' and hamster pgp 1, pgp2, pgp3) 1 940. High amino
acid sequence homology is found throughout al1 family members. The mouse proteins
share between 73 and 83% of sequence identity resulting in a total homology varying
between 85 and 92% 41. Transfection experiments permitted functional classification of
mdr genes according to their ability to confer the MDR phenotype 1-42. The Class I
genes (human MDR I , mouse rndrllmdr-3 and hamster pgp llpgp2) convey a normal MDR
phenotype while the Class 11 genes (human MDRZ, mouse mdri and hamsterpgp-1) do
not convey MDR phenotype to any level in transfected ce11 lines.
In normal tissues, P-gp expression has been found to be tightly regulated in an
organ and cell-specific manner 43-47. High levels of MDRI mRNA expression were
detected in the adrenal gland, kidney, spleen, jejunum, colon, and endothelial cells of the
blood-brain barrier 43744. MDR2 rnRNA expression was detected mostly in the liver, but
also in the kidney, adrenal gland and spleen 48. In the liver, the MDR2 protein is found
only at the apical pole of epithelial cells lining the lumen of the bile canaliculi and biliary
ductules. As demonstrated with knockout mice (mdd ' ' and m d d ) 49 and fluorescent
lipid translocation in yeast secretos. vesicles 50-5 1, mdr2 is involved in the transport of
phosphatidylcholine (PC), which is a normal constituent of bile, across the canalicular
membrane. This transporter is a lipid flipase showing a strict Mg-ATP dependent activity
that is blocked by P-gp inhibitors but insensitive to the presence of MDR dmgs 50. The
Class 1 genes seern to be also involved in lipid transport '*' and they could be as well
involved in cellular protection against various cytotoxic agents. The very hi& degree of
homology shared by the three protein membes of the family (around 90%) strongly
suggests a common mechanism of action 1. This hypothesis is supported by the
observation that MDR drugs interact with P-gp within the membrane lipid-bilayer 52-55.
1.3 Structure of the P-glycoprotein
Stnictwal features of P-gp were first revealed by the predicted amino acid
sequence 3 1 ~3795~-58. P-pg polypeptides are composed of approximately 1276- 1280
amino acids, depending on the specific gene isoform. Secondary structure prediction and
hydropathy profilhg suggest that P-gp is fomed by two homologous halves (see figure
l), each composed of six very hydrophobie trammembrane domains (TM) and a
hydmphilic nucleotide binding domain (NBD), containing the Walker A and Waker B
consensus sequences forming the ATP binding pocket S9. The two symmetrical halves
show 38% identity and 62% total homoIogy, suggesting that they arose fiom a duplication
event of a common ancestor 1. The highest homology is seen in the region of the
predicted ATP-binding sites (within the NBDs) 3 1 9 3 7 v 4 l. The two putative nucleotide-
binding folds are defmed by the presence of the consensus Walker A (G-&-G-K-S/T)
and Walker B (RK-X3-G-X3-L-hydrophobicr-D), motifs previously described in many
nucleotide-binding proteins and ATPases 59. Crystallography studies on other ATPases
have shown that the Walker A amino acids provide tight binding for the phosphates of the
Mg-ATP, keeping the y-phosphate in position for an in-line nucleophilic attack by the
catalytic carboxylate residue through a water molecule 60,61. Furthemore, the
extracellular loop between TM 1 and TM2 contains a cluster of N-linked glycosylation
signals. This loop has been shown to be the only putative glycosylated sub-domain in the
normaily folded protein 62.
Figure 1: Proposed membrane topology of P-glycoprotein. Note the main features of
the protein: 12 transmembrane helices (TM), 2 cytoplasmic nucleotide binding domains
(NBD) containhg the consensus Walker A (A) and Walker B (6) motifs and N-linked
glycosylation on the fust extracellular loop. The ATP binding sites in each NBD are
formed by the association o f the two Walker motifs. Relevant to the present study, other
regions have been identitied: the EAA-hke region on the intracellular loop between TM4
and TM5, the T578 region. Empty circles indicate the very hydrophobic TM helices.
Modified from Gottesman and Pastan 63.
Phosphorylation bas also k e n detected on serine residues, but their role remains unclear
64,6S
In absence of high-resolution three-dimensional structural information on P-gp,
the analysis of the structure and structure/function relationship widely relied on immuno-
biochemical and genetic studies. Epitope insertion and mapping experirnents 66967 on
full-length P-gp and studies on a cysteine-less MDRl protein 68 strongly support the 12-
TM domain topology, confirming the intracellular location of the amino and carboxyl-
termini and of the two NBDs as well as the intracellular or extracellular location of the
different loops. Other studies on synthetic P-gp peptides and fusion proteins had
previously defended the original mode1 69-71. Higgins and al. have critically reviewed
the considerable body of structural data 72, particularly in relation to the low-resolution
structure of P-gp which has recently been determined by electron rnicroscopy 73.
Limited trypsin digestion has also been used to demonstrate that P-gp has a dynarnic
structure; nucleotide and/or drug binding would induce conformational changes in the
protein 74975.
1.4 The ATP binding cassette transporter family
P-gps belong to the superfamily of ATP-binding cassette (ABC) transporters
whose structural and fùnctional features have been conserved through evolution fiom
prokaryotes to higher eukaryotes 76. ABC transporter proteins, also called traffic
ATPases in Gram negative bacteria 77, are responsible for translocation of a wide variety
of compounds across eukaryotic and prokaryotic membranes. In prokaryotes, these
transporters can import or export, at the expense of ATP, a wide variety of substrates such
as sugars, ions, amino acids, peptides and others 76-g0. ABC transporters were found to
represent the largest family of paralogous proteins in the recently completed Escherichia
cd i genome sequence 8 1.
In addition to P-gp, many other eukaryotic proteins of medical significance belong
to this farnily, such as the cystic fibrosis trammembrane regulator (CFTR) 82,83, the
multidrug resistance related protein (MW) 84, the heterodimeric half-transporter
186 associated with antigen processing (TAP I/TAPZ) and the pfmdr- 1 protein of
Plasmodium falciparurn which is associated with resistance to antirnalarial dmgs
Also, two proteins are found as homodimeric half-transporters that may transport
coenzyme A-modified fatty acids in the peroxisomal membrane: ADLP and PMP7O 86.
In humans, the ADLP locus seems to be involved in chromosome X-linked
adrenoleukodystrophy 87. These proteins display an almost identical hydropathy profile
and consequently, a very similar predicted secondary structure 1.76. In lower eukaryotes,
members of this family also include the yeast Saccharomyces cerevisiae ste6 proteh 88
that transports the farnesylated dodecapeptide mating pheromone, the a-factor 89,90.
Structural homology between P-gp and ste6 transporters (around 57% total homology)
translates into fùnctional similarity, as the mouse mdr3 gene can complement the yeast
sre6 gene and partially restore the mating phenotype in an otherwise stenle ste6A yeast
mutant 91. Moreover, P-gp (fiom mdr3) can confer resistance to certain fimgostatic
drugs like valinomycin and FK506 in Saccharomyces cerevisiae 92. Therefore, mdr3
activity in yeast is providing a powerful tool for biochemical studies on P-gp structure
and mechanism 93794. Characterization of mdr3 mutants in this heterologous yeast
system has been achieved several tirnes 93-95- Similarly, the human multidnig
resistance-associated protein (MRP), which normally transports glutathione S-conjugates
across membranes, can complement a yeast mutant for the ycfl transporter 96. ycfl is a
protein related to MRP (63% amino acid similarity) which is a glutathione S- conjugate
transporter in Saccharomyces cerevisiae. Also, pxal p is a yeast ortholog of the human
ALDP that was used as a simple system for biochemical cornparison studies 97.
In prokaryotes, the different domains of the ABC transporters ofien consist of
separate subunits found assembled in a membrane-bound complex whereas in eukaryotes,
al1 the domains are generally expressed as a single polypeptide chain 76. The early
analysis of the mdr nucleotide sequence 36937 revealed homology between the two NBDs
of P-gp and the bactenal transport related proteins malK and hisP, also of oppD and pstB
(Salmonella typhimurium), hlyB (Escherichia Coli) and chvA (Agrobacterium
tumefaciens). More relevant to the present work, malK and hisP encode imer membrane
bound components of the maltose/maltodextrin transport system of Escherichia coli and
of the high affinity histidine permease of Salmonella typhimurium, respectively 78979.
These bactenal genes are part of multicomponent periplasmic transport systems that
usually comprise five components: two integral membrane proteins, two cytoplasmic
nucleotide binding membrane-associated proteins and a penplasmic high affinity
substrate binding protein 76. The nucleotide binding proteins are the components that
share the highest penientage of homology with P-gp (fiom 40% to 50% total homology)
and the other ABC transporters 36. Within the other components of these systems, only
weak homology c m be found in small portions of the two integral membrane proteins and
P-gp 97-9? The modular features of these bacterial proteins facilitates the exploration of
interactions between the different domains, providing working models for eukaryotic
ABC transporters.
1.5 Interaction of P-gp with ATP and drug mo1ecules
Even though the MDR cDNAs have been cloned and studied for more than 10
years, the capacity of P-gp to act on a wide range of structurally unrelated cytotoxic dmgs
remains an obscure aspect of the protein. In order to design new cytotoxic dmgs and
modulatoa capable of by-passing or inhibiting the activity of P-gp in tumors, a
considerable amount of work has been done to identifi residues and domains implicated
in dmg binding and transport. Energy transfer experiments with doxorubicin indicated
that the h g molecules are probably recognized within a hydrophobic context, in the
membrane bilayer 55 . Epitope mapping studies of proteolytic fragments labeled with
photoactivatable h g analogues identified some membrane-associated regions as
important sites for drug binding 54. A minor and a major binding site have been found in
P-gp as two labelled GkDa proteolytic fragments that are symmetrically located near the
transmembrane domains 6 and 12, respectively. Symetrical regions in each half of P-gp
may thus be involved in drug binding. Biochemical analyses of P-gp mutants and
chimeras with altered substrate speci ficity have s h o w that transmembrane domains are
important sites for h g binding 1°0-104. In sorne cases, a single amino acid substitution
will strongly modulate the activity and substrate specificity of P-gp 1°33105w107. Near to
the major binding site, in transmembrane domain 1 1 (TM1 1), a single serine for
phenylalanine substitution was found to strongly decrease the levels of colchicine and
adriamycin resistance (10-30 folds) while no significant effect was observed on
vinblastine resistance 1°5. TM1 1 was M e r analyzed by alanine scanning revealing
deleterious mutations (1 3 out of 21) clustered on the more hydrophilic face of the TM1 1
a-helix, a clear suggestion that this face may play an important role in h g recognition
and transport 94. Certain compounds stimulate ATP hydrolysis (verapamil, vinblastine)
while others, like cyclosporin A, do not stimulate ATP hydrolysis but inhibit stimulation
by verapamil 1089109. These observations led to the concept that signal transduction may
couple dmg binding by the transmembrane domains and ATP hydrolysis by the NBDs. It
also has been proposed that intracellular loops may play an important role in transport and
in signal transduction between the transmembrane dornains and the NBDs
93,106, 1079 1 1091 1 1. Mutations in the first intracellular loop can alter both substrate
specificity lo6,1 07,1 and drug-induced ATPase activity 9 l 2 of the MDRl protein.
In addition, some reports show that the malfunction of other ABC transporters is
associated with mutations in the second intracellular loop 97998.
1.6 The MalK model: interaction between intracellular loop 2 and NBDs
As explained earlier, bacterial high f i n i t y uptake of nutrients is achieved by
complex transport systerns belonging to the ABC transporter superfamily 77. These
multicomponent active permeases consist of a periplasmic substrate binding protein
which bind the substrate in the micromolar range, two integral membrane proteins and
two subunits of a cytoplasmic penpheral membrane protein that display ATP-binding
motifs 99. The membrane-associated proteins form a complex with a stoichiometry of
two integral membrane subunits that mediate ATP-dependant translocation of the
substrae into the cytoplasm through two ATP-binding subunits. This complex shows a
similar organization to P-gp with two multispanning transmembrane regions and two
NBDs.
The maltose transport system of Escherichia coli is one of the most studied
bacteriai ABC transporters 98. Its modular organization permitted to gain sorne insight
into the physicai interactions between hydrophobic membrane domains (malG and malF)
and cytoplasmic ATP-binding subunits (malK). By random linker insertion in malG, two
regions essentiai for maltose transport have k e n identified g9. One of these is a 20
amino acid hydrophilic sequence that lies in the loop between transmembrane domains 4
and 5, facing the cytosol. This region, called the EAA region, is well conserved in most
of the bacterial binding-protein dependent transporters (E-A-A-X3-G-X9-1-X-L-P) and has
some conserved equivalent in eukaryotic ABC transporters 97,999 3. Substitution
mutations were generated in the EAA region of malG and malF and resulted in many
transport impaired mutants where the cellular location of malK was drarnatically affected,
as no specific recognition of the membrane embedded complex by malK occurred.
Second site mutations in malK restored normal cellular location and transport showing
that EAA region constitutes a major recognition site for the malK ATPase 98. Upon
alignrnent of malK with P-gp, it appears that one of the second site mutations that
restored cellular localization of malK (Ml 871) falls on mdr3 residue T578, which was
previously identified as essential for NBD 1 proper function 93. This leads to the
hypothesis that T578, in mdr3, may be interacting with the trammembrane domains,
possibly linking the ATP hydrolysis with drug binding and transport.
Certain eukaryotic ABC transporters possess a 15 amino acid motif resembling
the central core of the prokaryotic EAA region 977 1 14-1 l 6. It is designated the EAA-like
motif. Mutations in this motif are known to be present in the gene encoding the
adenoleukodystrophy protein (ALDP) in adenoleukodystrophic patients l 7-1 19. X-
linked adenoleukodystrophy is an inbom defect in peroxisomal P-oxidation of very long
chah fatty acids. Studies on this EAA-like motif have been made on the yeast ortholog
of ALDP, pxapl, revealing some functional similarity with the prokaryotic EAA box 97.
In S. cerevisiae, pxapl mutants have impaired growth on oleic medium and reduced
ability to oxidize oleate 1 14, allowing a simple and efficient screening technique to
characterize the activity of substitution mutants in pxapl. As it was reported for bacterial
ABC transporters, mutation of the central glycine causes dysfùnction of yeast pxapl .
Also, deletions in that region cause instability of the CFTR protein 12*. We wish to
examine if the EAA-like motif is conserved in the intracellular loop 2 throughout the
MDR family and if it is of functional importance. We will also plan a strategy to
investigate if the T578 region is a good candidate to interact with the EAA-like motif.
1.7 The ATPase activity of P-gp
Early on, the predicted amino acid sequence suggested that P-gp might be an
ATPase 36937. More evidence came h m direct ATP hydrolysis measurements in
partially purified P-gp fractions and fiom experiments showing that ATP-driven dnig
transport is ineffective with non-hydrolyzable ATP analogs 1% 121 7 122. The tnie
demonstration and characterization of the ATPase activity came with the solubilization
and purification of P-gp 123,124. The pure reconstituted P-gp showed substantial drug-
stimulated ATPase activity and low but significant basal ATPase activity in absence of
dmg. The ATPase activity increases drarnatically in presence of transported drugs such
as vinblastine, FK506 or non-transported inhibitors like the ion channel-blocker,
verapamil. The maximal, drug-stimulated Mg-ATP hydrolysis has a Km for Mg-ATP of
0.3 to 1 rnM and a V, around 3.5 pmol/min/mg of protein 125. This induction fiom the
basal ATPase level(z0.3 pmol/min/mg) by P-gp substrates and inhibitors is a unique
feature allowing an easier detection of the P-gp specific ATPase activity. With
verapamil, which elicits the maximal turnover, the degree of stimulation above basal level
ranges fiom 2.5 to 11 fold. The presence and composition of the lipidic environment was
also shown to influence the ATPase activity of P-gp 1239126-128.
Mg-ATP binds to both NBD 1 and NBD2 with approximately equal affinity and
both have the capability to hydrolyze it 29-13 The two NBDs of P-gp work in
concert. In a P-gp mutant containing a single cysteine located in the Walker A of NBDl
or NBD2, the reaction of either cysteine with an oxidizing agent (NEM) was seen to
eliminate al1 ATPase activity 1247 132, 33. Also. vanadate trapping of radioactive Mg-8-
azido-ATP showed clearly that trapping ADP in either NBD was suficient to block al1
ATPase activity 1239 309134. Evidence that the inactivation of NBD 1 blocked hydrolysis
of Mg-ATP in NBD2 or vice-versa strongly suggests that the two NBDs interact together,
and that they cannot hydrolyze Mg-ATP independently. Moreover, mutations in either
nucleotide-binding site prevent vanadate trapping of nucleotide at both sites 13 1. It is
now well accepted that the NBDs have to work in a cooperative manner to energize P-gp
functions. In order to cooperate, it can be reasonably hypothesized that the two NBDs
physically interact together.
Over the past decades, there has been a tremendous scientific debate about the
enzyrnatic requirements for ATP hydrolysis 597 1 35. Works on Escherichia coli recA
protein and on the bovine Fi-ATPase P subunit shed some light on what could be a
common rnechanism for this critical enzymatic reaction 609619136,137- During a study
on essential residues of the F ,-ATPase B subunit, which possesses a typicai set of Walker
A and B motifs, a consewed glutamate located 26 residues after the lysine in Walker A
was found to be essential for ATPase activity 136, 37. The elimination of the carboxyl
group from this glutamate by specific chemical modification or by mutational substitution
resulted in almost cornplete loss of ATPase activity. The modified or mutated proteins
retained the ability to bind ATP but were unable to catalyze even a single turnover.
Another study based on the crystal structure of the Escherichia coli recA protein 60,
which also has a typical set of Walker A and B motifs, suggested that a glutamate residue,
located 24 residues f i e r the lysine in Walker A, is in position to serve as a general base
to activate a water molecule for an in-line attack of the y-phosphate during ATP
hydrolysis. The later crystal structure of the mitochodrial Fi-ATPase 61 clearly showed
that, despite the lack of amino acid similarity between Fi-ATPase and recA, the folding
topology is aimost the same, positioning the essential glutamate at the right position to act
as a general base. The alignment of several protein farnilies which have a typical set of
Walker A and Walker B revealed that a well conserved glutamate or aspartate at position
2412 after the lysine in Walker A was a common feature 135. It has therefore k e n
proposed that these conserved residues should have the same functional role, the
activation of a water molecule to attack the y-phosphate of ATP.
In the ABC transporter family, the situation may be somehow different. The
distance between the two Walker motifs in the primary structure is usually longer than in
the other ATPases studied 135,138. Although a glutamate or an aspartate can generally
be found in the 24-12 region, higher conservation was observed for these residues at other
positions. Yoshida et al. proposed two candidates for the catalytic carboxylate in ABC
transporters 135. In malK, non-conservative substitutions of these two candidates had no
deleterious effect on the function of the protein 139, suggesting that they may not be
common catdytic residues in ABC transporters and disproving the hypothesis formulated
by Yoshida et al..
1.8 The HisP modei: interaction between the NBDs
Shilarly to the maltose/maltodextrh transporter, this histidine permease of Salmonella
ryphimurium consists of a membrane-bound complex, hisQMP2, composed of two
integral membrane subunits, hisQ and hisM, and two copies of hisP, the ATP-binding
subunit 14*. Chernical crosslinking and the necessity of both subunits being present for
activity strongly suggest that hisP forms a cooperative dimer l4 l9l4*. The hisP protein
has been purified and characterized in an active soluble fonn that can be reconstituted
into a fully active membrane bound cornplex 143 and the three dimensional crystal
structure of the hisP dimer at a resolution of 1.5 A has recently been reported 14'? This is
the £kt crystal structure of an ABC transporter to be reported. The fact that it may
represent a paradigm for al1 ABC transporters NBDs is an important point to hvestigate
as it could also provide insight on the mechanism of ATP hydrolysis in these enzymes.
As seen in figure 2, the overall shape of the crystal structure of a hisP monomer is that of
an L with two thick arms (1 and II). The ami II is mostly an a-helices domain, while the
atm 1 is a mixed P-sheets and a-helices domain. A six-stranded B-sheet spans both arms
of the L and the ATP-binding pocket is located near the end of the arm 1. This overall
fold structure is different fiom any known protein. Limited siznilarity was found in the
ATP-binding pocket with the crystal structures of recA and of the a and P subunits of
bovine F iATPase 60.61. The crystal structure also reveals that the monomers form a
dimer contacting each other through hydrophobic interactions at the antiparallel bsheet
on the outer side of arm 1 via p 1, P4, and P5 strands (see figure 2, panel B). The size of
the dirner is 60 A thick, 40 A ta11 and 90 A wide. It is difficult to relate these dimensions
to those of the putative NBDs of P-gp from a low-resolution electron micrograph 73,144.
Note that the P4 strand of each monomer sit face to face and that these strands are the
closest syrnmetrical parts of the dimer. This crystal structure is the first hi&-resolution
scheme of ABC transporter ATPase domains, the degree to which it may reflect a general
mode1 for the family is unknown. Similarity of predicted structure is the designation of
ABC transporter family 76; it is Unportant to find out if it extends to the tertiary and
quatemary structures and whether there are also functional similarities. In the present
study, a search has been made for homologous sequence to P4 strand in both NBDs of
Figure 2: Crystal structure of the hisP dimer. (A) View of the dirner dong an axis
perpendicular to the two-fold syrnmetry axis. The "Lw shape molded by the arm I and the
arm II is apparent. The ATP binding pocket is located at the end of arm 1 (the ATP
molecuie is shown). The top of ami II has been demonstrated to be in contact with the
plasma membrane components, while the arm 1 is facing the cytosol to perform its
ATPase funftion. A P-sheet is located at the interface of the two HisP monomers. The
amino acid T205 is related, by sequence aiignment, to the T578 region studied M e r in
this report. (B) View of the dimer dong the two-fold symmetry axis showing the p-sheet
interface and the relative displacement of the monomen. These P-strands, at the dimer
interface, are labeled and clearly show that the P4 strands are the closest symmetrical
feature in the dirner. Modified from Hung er ai. 144.
- ARM 1
MDRl and a cysteine scanning strategy (see "Alternative strategy to study protein
topology") was established in order to examine the possible interaction of the two NBDs
at this interface.
1.9 An alternative strategy to study protein topology
As is the case for most polytopic membrane proteins, the difficulties encountered
to obtain successfùl crystallization account for the availability of only a few high-
resolution structures of some domains for the ABC-transporters, such as the hisP dimer
crystal 144- Nevertheless, molecular biology in conjunction with biochemical and
biophysical techniques can be used to provide detailed information about the structure
and the function of integral membrane proteins 145. In s cysteine-less version of the
lactose permease, a cysteine-scanning mutagenesis strategy has been used to elucidate
membrane topology and accessibility of residues to the aqueous or lipid environment 146-
150, as well as spatial proximity and dynamics between trammembrane domains
1457151-156. The use of cysteine, which is of average bulk and amenable to highly
specific modification by oxidizing agents. seems to be the tool of choice to perform
accessibility and sulfydryl cross-linking studies 145. A number of membrane proteins
including the bacteriorhodopsin 157, the acetylcholine receptor 158, the bacterial and
yeast FiFoATP synthases 59,1 60, the caZC ATPase of skeletal muscle sarcoplasmic
reticulum 161, and many others have been investigated using this approach. A human
MDRl cysteine-less (MDRI-CL cDNA) protein has previously been created and studied
by Loo and Clarke 68,132. This cysteine-less protein retained the ability to confer
resistame to MDR drugs in transfected NIH3T3 cells with only a small decrease in
efficiency relative to the wild-type enzyme. The relative half-life of the cysteine-less
mutant is shorter than that of wild-type enzyme. Cysteines appear to contribute to folding
and stability of P-gp. Nevertheless, this construct is active and can be used as a powemil
tool to elucidate some aspects of P-gp smicture/function. In the present study, a strategy
to confïnn interactions between the NBDl and the second intracellular loop and between
both NBDs is created.
Pnmarily, we wished to study the interaction of the T578 region, located on
NBD 1, with the EAA-like motif, located on cytoplasmic loop2 (see "The malK model"
for more details), by a cysteine scanning method. The systematic substitution of residues
in these regions allows the characterization of individual mutants for fûnctional
impainnent. The fust analysis was done in a mdr3 WT template, in order to monitor
effect of the substitutions on a fûlly active P-gp backbone. Also, the yeast heterologous
system is well established with the mdv3 gene, allowing the evaluation of functional
conservation in the studied motif by analogy with homologous regions of other studied
ABC transporters. The yeast heterologous system has not been studied with MDRI or
MDRI-CL. Small restriction cassettes have been created on mdr3 and MDRI-CL cDNAs
to permit the subcloning of single or double cysteine substitutions fiom mdr3 to MDRI-
CL. Because of the high degree of conservation within the P-pg family, the behavior of
this chimenc construct should be affected only by the nature of the cysteine substitution.
Detailed analysis of the single or double cysteine mutants in the cysteine-less template
would include different applications of sulfhydryl reactive molecules such as accessibility
of the cysteine side-chahs, inactivation of ATPase activity by addition of bulky
molecules (maleamides), cross-linking of double cysteine mutants and, possibly, studies
of the cysteine side chah environment with fluorescent thiol reagent 145. These
expenments are different ways to investigate the environment and the proxirnity of
regions containing engineered cysteines. To examine the possible interaction between
both NBDs, a similar strategy is used, but the mutations are made directly in the MDR 1 - CL cDNA. Particularly, considering the fact that restriction cassettes have to be created
in both cDNAs in order to perform sub-cloning in MDRI-CL and that al1 yeast
manipulations have to be repeated twice. Moreover, the present study demonstrates that
characterization of MDR l or MDRI-CL and their mutants is possible in the yeast
heterologous system, allowing the evaluation of their relative activity in order to select
candidate mutants for subsequent analysis.
CHAPTER II
MATERIAL AND METHODS
II.1 Basic molecular biology and sequencing
Al1 DNA manipulations, including restriction enzyme digestions, agarose gel
electrophoresis, DNA ligations, mini and large plasmid purifications and bacterial
transformations were done with standard methods as previously described 16* 9 63.
DNA sequencing was perforrned with the Amersham-Pharmacia DNA sequencing kit.
Al1 enzymes were bought fiom New Englmd Biolabs or Amersham-Pharmacia. The
Escherichia coli strains XL- 1 blue (recA 1, end4 1, gyrA96, thi-1, hrdRl7, supE44, relA 1,
lac FéproAB lacFZDMl5 Tnl O (Tetr)]) and JM 109 (en& 1, recA 1, gyrA96, thi, hsdR 17
(ri-,mk+), relA 1, supE44, A-, A(lac-proAB), F', traD36, proA' B' , ZacPZAMI SI) were
used to propagate the plasmids.
II.2 Restriction cassettes
Short restriction enzyme cassettes were created by silent mutagenesis to facilitate
construction and sequencing of the mdr3 mutants. Xn the mouse mdr3 cDNA, a MscI - Mu1 (nucleotide positions 794 and 1069, respectively) cassette was created using the
natural MscI site to permit cloning of the EAA-like motif mutants. Also, a Sfl - San
(positions 18 10 and 1908, respectively) cassette has been created with the natural SUA site
to permit the cloning of the T578 region mutants. These two cassettes have also been
made in the human MDRI-CL cDNA (creation of MluI at position 1354, SfiI at position
2098, Sali at position 2195 and deletion of the second MscI at position 3958) to allow the
cloning of short mdr3 fragments devoid of endogenous cysteines in the cysteine-less
template for M e r studies. The previously descnbed 6% 13 1,132 S'el - SpeI (positions
1698 and 2298) and KpnI - XhoI (positions 3 199 and 4298) cassettes have been used for
the creation and cloning of the 84 strand mutant for each NBD of the MDRl-CL cDNA.
The mdr3 and MDRI -CL mutant cassettes were subsequently cloned in the pVT 10 1 -U
and pHILD-2 yeasthacteria shuttle vectors.
11.3 Site-directed mutagenesis in mdr3 and iiMDRI-CL cDNAs
The following strategy was used to generate the silent restriction sites and most of
the EEA-like motif, T578 region (both in mdr3) and P4 strand mutants (in MDRI-CL)
fkom their respective cDNA templates. Large fragments containing the restriction
cassettes to be used for mutagenesis subcloning were cloned in the pALTER1
mutagenesis vector polylinker (Promega, Altered Sites II in vitro Mutagenesis Systems).
For mdr3, a 2.2 kb KpnI - EcoRI fragment of the N-terminal half was cloned in the
corresponding sites of pALTER1. For MDR 1-CL, a 2.1 kb Sac1 - HindII fragment of the
N-terminal half and a 1.1 kb KpnI - KpnI fragment (the second KpnI originates from
pBluescript polycloning site) of the C-terminal half were also cloned in the corresponding
site of their own pALTERl mutagenesis vector. These pALTER1 constructs served as
templates for oligonucleotide site-directed mutagenesis using a commercially available
kit (Promega, Altered Sites 11 in vitro Mutagenesis Systems). The mutagenesis reactions
have been performed according to the instructions furnished by Prornega. The advantage
of this method is the possibility of using more than one mutagenic primer in the same
mutagenesis reaction (up to 3 were used successfully to create silent restriction sites). Al1
the oligonucleotidic primers used with this kit are shown in Table 1. However, was
Oligonucleotides used with the PALTER mutagenesis kit -- -
Template Name orientation a
gttgccattgctgcaggcatcgtggtg gccgggcctcttgcgggcgtccattcc
agct tcttcqcagttgttattgt cttttagcttcqcacaagttgttattg gccttttagcqcattccaagttg c a g c c t t t t a ~ t t c t t c c a a g t t g ccccagcct~agcttcttc ttatccccagqcgtttagcttc ctttctttatqc=cagccttttag gatagctttctt~ccccagcc gtgatagctttacaaatccccag ccgtgatagcacactt~atccccagc
ggtccggcgttctctag caatggtggtgc~ccttctctag gctatcacaat~gtg~ccggccttc gctatcacaatg~ggtccggcc gagctatcacqcaggtggtccg gcgatgagcacatacaatggtgg
gcatctta~gcqÇtggccttctgg gccacgtcqgccttggac catcgtttgtcqacagttcg ctggtggLcagaaacaacgc
gctctatgacçqcacagagg gaccccacatqtqggatggtc cacagagggqtqtgtcagtgttga gggatggtctgtgttgatgga ggtcagtgttxtggacagga
ctacgacccct&gcagggaaagtg cccttggca&g&aaagtgct ggcagggaaatqtctgcttgatgg gaaagtgctgatgatggcaaag ctgcttgatxcaaagaaataaag
a For the orientation, (f) refers to foward or sense oligonucleotide and (r) refers to reverse or antisense oligonucleotide.
Al1 oligonucleotides are written from 5' end to 3' end. The modified nucleotides are underlined.
observed that, for unknown reason, some primers were unable to produce the desired
mutants using this commercial kit. These few missing mutants were generated by PCR as
described below.
The EAA-like motif mutant L283C and the T578 region mutant V580C were
created by site-directed mutagenesis using a standard recombinant PCR method as
previously described 163. The oligonucleotidic primers used for PCR are presented in
Table II. The PCR conditions were optimized for each primer set, the annealing
temperature was usually between 52°C and 56°C with MgClz concentration within the
range of 0.5 to 2.5mM. The general cycles parameters were: denaturation (94°C) for 1
min, annealing for 1 min and DNA synthesis (72°C) for 2 min. The nurnber of cycles
was kept at 20 to prevent the accumulation of miss-processed subspecies. Al1 PCR
reactions were performed with the Taq enzyme. The creation of a triple factor Xa
recognition site in human MDRI-CL was done using a similar recombinant PCR method
163, see Table II for the oligonucleotidic prirners. The nucleotide sequence integrity of
al1 restriction cassettes containing mutations was verified pnor to their first subcloning in
pVT-mdr3 or pVT-MDRl-CL for both mutagenesis techniques.
11.4 Saccharomyces cerevisioe yeast culture
Drug resistance and mating assays were done using the Saccharomyces cerevisiae
strain JPY2O 1 (UA Ta ste6A::HIS3 gaz2 his3A200 leu2-3, I 12 Iys2-801 trpl Ura3-52) in
which mutant and wild-type P-gp cDNAs fiom mdr3 and MDRI-CL were tramformed
and expressed. The other Saccharomyces cerevisiae strain, DC17 (MiTa hisl), was used
Oligonucleotides used for recombinant PCR mutagenesis
Temdate Name orientationa Sequence b
mdr3 TK5 L283C MER- 1 L283C
m R f - C L MER-2 Xasite
MER- 3 Xasite
gtgctcatagttgcctac ctttctttatccc~ccttttagc cctcagatacctcacattg gctaaaaggsgggataaagaaag
gacaacatacaagga cgatgagctateaatggtggtc tcatgacaagtttgaa gaccaccatttqtatagctcatcg
atttacacgtggttggaag qcqaccttcqattcttccttc~- tcttccttcqatccctgagaggac- caaggtgg ctgtccatcaacactgacc atcqaaqqaaqaatcgaaqgaaqa- atcuaaautcqcgaatattctatt- ggacaagtactc
a For the orientation, ( f ) refers to foward or sense oligonucleotide and (r) refers to reverse or antisense oligonucleotide.
Al1 oligonucleotides are wntten €rom 5' end to 3 ' end. The modified nucleotides are underlined.
as the tester strain in the mathg assays. These two strains have been previously described
91,164. The media used for the growth of Saccharomyces cerevisiae were the following:
YPD rich medium (1% w/v yeast extract, 2% wlv peptone. and 2% w/v dextrose), a
synthetic medium lacking uracil, the S.D.üra medium (0.67% wlv yeast nitrogen base
without amino acids, 2% w/v dextrose and a cornplex mixture of selected amino acids,
see reference) and minimal medium (0,67% w/v yeast nitrogen without arnino acids and
2% W/V dextrose), prepared as described l65. The cultures were grown at 30°C, with
agitation (250 rpm).
11.4.1 Transformation in jPY2Ol and screening by mini-membrane preparation
JPY201 were transformed with the various mdr3 or MDRl-CL constructs
subcloned in the pVT IO1 -U shuttle vector by the lithium acetate method as previously
described 166. Transformants growing on S.D.ura selective medium (urac transformants
received the pVT vector) were then pooled in mass-populations, expanded in S.D.*ura
liquid cultures and kept fiozen at -80°C as glycerol stocks. More detailed analysis of
JPY20 1 transformed mass populations (or transformed Pichia pastoris clones) was
necessary to assess the presence and relative amount of P-gp expressed at the plasma
membrane. Membrane fractions were isolated by a simple small-scale procedure 167.
For JPY201 transformants, 5 ml ovemight cultures grown in S.D.-ura medium at 30°C
that had reached the stationary growth phase were pelleted (3000 rpm, 5 min in a clinical
centrifuge), washed once with 500 pl of cold mPIB buffer (0.33 M sucrose, 40 mM
TRIS-HCl p H 7.4,1 mM EGTA, 1 rnM EDTA, 2 mM DTT, 100 mM E-aminocaproic
acid), transferred in microfuge tubes and resuspended in 300 pl cold mPIB containhg
protease inhibitors (1 m M PMSF, 1 0 W m l leupeptin and pepstatin A). For clones
transformed in the Pichia pastoris strains GS 1 1 5 and KM7 1, cultures were first grown in
minimal glycerol liquid medium until stationary growth phase and then induced in
minimal methanol medium (see the Pichiapastoris section) for two days at 30°C,
replenishing the methanol each day. The cells were washed in mPIB as described above
for JPY201 transformants. Then, after pelletting the cells, a small volume of acid-washed
g l a s beads was added (300-400 pl) and the cells were disrupted by vortexing (four times
one minute, with one minute on ice between each cycle). Beads, ce11 debris and nuclei
were removed by centrifugation (2000 rpm, 5 min increased to 12000 rpm for another 5
min, at 4°C). The supernatant was recuperated and the membranes pelleted by
centrifugation in a tabletop ultracentrifuge (Beckman, rotor TL-100) at 100 OOOg for 30
min at 4OC. Pellets were resuspended in 25 pl mPIB containhg protease inhibitors and
stored at -80°C. Determination of the protein concentration was done by the Bradford
method using Bio-Rad commercial reagents. Then, 15 pg of total membrane proteins
were loaded on a 7.5% acrylamide SDS-PAGE gel 168 and Western blotting analysis was
performed using the mouse anti-P-gp monoclonal antibody C2 19 (Signet Laboratones
Inc.) and revealed by horseradish peroxidase (ECL). Coomassie staining of a gel was
systematically done in parallel to verifi that al1 lanes contained a similar amount of total
membrane proteins.
11.4.2 FU06 drug resistance assay
The mdr3 WT, MDRl WT and MDRI -CL proteins and al1 their respective
mutants were tested in JPY201 yeast for their ability to convey cellular resistance to the
antifungal peptide macrolite FK506, previously shown to be a P-gp substrate in these
yeast 92. The resistance was estimated by growth inhibition assays, carried out
essentiaily as described 92. FK506 stock solutions were prepared at the concentration of
10 mghl in DMSO and kept at -20°C until use. Briefly, overnight cultures of pVT-md3
or pVT-MDRI-CL transformants grown in S.D.-ura were diluted to the optical density of
0.0 1 (at 600 nm) in YPD medium. To have a better appreciation of the h g resistance
phenotype coderred by MDRI -CL genes, these transformants were diluted to the optical
density of 0.02. An aliquot of 50 p1 of these dilutions were added to an equal volume of
YPD containing 100 pg/ml of FIS506 in 96 well titer plates, for a final h g concentration
of 50 pg/rnl. The plates were wrapped with parafilmTM to prevent evaporation and
incubated at 30°C without agitation. The measurement of growth was monitored over a
period of approximately 28 hours by optical density at 595 nm using an ELISA plate
reader (BioRad, mode1 450).
11.4.3 Mating assay
The capacity of mdr3 contructs to restore mating in JPY201 (a ste6A sterile yeast
strain) was tested. The strain DC17 was used as the tester strain in the assay. This strain
is an a-mate that requires a restored mating phenotype of the a-mate, JPY20 1, in order to
produce diploid yeast 89.90. The mating phenotype consists of the exportation of the a-
factor, a famesylated dodecapeptide required for mating, in the extracellular environment.
This pheromone production triggers mating between haploid cells of opposite mating
type, leading to the formation of diploid cells 169. Diploid formation provides a sensitive
measure of the extracellular production of biologically active a-factor 89. The two strains
were described previously 91,939 164. The same pools of ura4 transfomants as for the
FK506 resistance assay were used for the mating. The mating efficiency of pVT-mdr3
transformants was quantified by the filter assay, using the procedure described previously
919170. Briefly, a known number of transfomed JPY201 cells and DC17 cells are mixed
together and incubated on a filter membrane on YPD rich medium for 4 hours, dlowing
mating events to take place. The yeasts are then resuspended and dilutions are plated on
minimal medium and S.D.'ura medium. Only the diploid cells can grow on minimal
medium while the S.D.üra medium does not restrict the growth of JPY201 transformants,
DC 1 7 or diploid cells. The mating fiequency is expressed as the ratio of diploid colonies
grown on selective minimal medium plates to the nurnber of haploid JPY201
transformants introduced in the assay. The mating efficiency of mdr3 mutants is
expressed as a percentage of the mdr3 WT transformants mating efficiency.
11.5 Pkhiapastorisyeastculture
Overproduction of wild-type and modified mdr3 and MDRl -CL proteins was
ac hieved in the Pichia pastoris expression s y stem commercial1 y available through
InVitrogen. This system is based on the utilization of the strong alcohol oxydase (AOXI)
promoter of Pichia pustoris by a homologous recombination event of the transfomed
plasrnid at this locus in Pichiapastoris genome. The AOXl enzyme normally converts
methanol to formaldehyde and is strongly induced by the presence of methanol. The
Pichia pastoris strains GS 1 15 (hid) and KM7 1 were used to transform mdr3, and MDRI-
CL constnicts, respectively. The media used to grow Pichiapastoris were the MGY
(minimal glycerol medium: 1.34% wlv yeast nitrogen base without arnino acid, 1% v/v
glycerol, 0.4 mg/l biotin), the MM (minimal methanol medium: sanie as MGY, but with
0.5% v/v of methanol replacing the glycerol), prepared as described by InVitrogen.
Cultures were incubated at 30°C with agitation (250 rpm).
IIS.1 Transformation of ndr genes, induction and screeniag
The Pichia pastoris yeast strain GS 1 1 5 and the shuttle vector pHILD-2 were
obtained fiom InVitrogen. Al1 the wild-type and mutant genes for MDRI, MDRI-CL and
mdr3 are full-length cDNA cloned in the EcoRi site of pHILD-2 repaired with the T4
DNA polyrnerase 162,163. The resulting plasmids were named pHILD-MDRI, pHILD-
MDRI-CL and pHILD-mdr3. These constructs already contain a histidine tag located at
the carboxy-terminus end of the proteins, allowing their purification by nickel-
chromatography. Al1 the pHILD-2 constructs were first digested with NotI and then
transformed into Pichia pastoris using the lithium chloride method, according to the
manufacturer instructions. The his' transformants were streaked on MM plates and MGY
plates to identify clones impaired in methanol utilization (methano1 uilizing slow: muf).
These clones have lost the endogenous alcohol oxidaze gene (AOXI) after a successful
homologous recombination event with the transformed gene. To access the presence of
the transformed proteins at the plasma membrane, these mur' clones were M e r screened
by the mini-membrane preparation and Western blotting analysis procedures, described
under the Sacchmyces cerevisiae yeast culture section.
11.5.2 Large pnpantion of membranes
This procedure has been described for the mouse mdr3 P-gp 13 1,171 917*. One-
liter cultures of transformed Pichia pastoris clones were obtained d e r consecutive
growth and induction in MGY and MM media as described by InVitrogen, with the
following modifications. One liter cultures were grown in MGY medium at 30°C, (500
ml per 2 liter baffled flasks) to an optical density of 2 (at 600 nm), and then induced in the
same volume of MM medium for 3 days, replenishing the methanol to 0.5% each day .
After 2-3 days of methanol induction, cells were pelleted (1 500 g) and resuspended in a
final volume of 35 ml of homogenization buffer (0.33 M sucrose, 250 mM Tris-HCI pH
7.4, 1 m M EDTA, 1 mM EGTA, 1 mM DTT, 100 mM E-arninocaproic acid) and fiozen
at -80°C. Cells were disrupted by one cycle of French Press at 20,000 p.s.i., in presence
of protease inhibitors (1 mM PMSF, 10 p g h l of leupeptin and pepstatin A). Unbroken
cells and large debris were rernoved by centrifugation (2,00Og, 5 min, and then 10,00Og, 5
min, at 4°C during the same spin) and crude membrane fractions were harvested fÎom the
supernatant by ultracentrifugation (200,00Og, 90 min at 4OC). Cnide membranes were
resuspended in a Dounce homogenizer with a tight fitting potter in membrane buffer (10
mM Tris-HC1 pH 7.4, 1 mM EDTA, 10% v/v glycerol, and the protease inhibitors) and
reconcentrated by centrifugation (as above). The washed crude membrane pellets were
resuspended in less than 8 ml of membrane buffer and layered on top of a discontinuous
sucrose density gradient consisting of 1 6%, 3 1 % and 43.5% (w/v) sucrose solutions
(containhg also 10 mM Tris-HCl pH 7.4, and 1 mM EDTA), followed by centrifugation
until equilibrium (53,00Og, 18 h at 4OC). Membranes were then harvested fiom the
different interfaces of the gradient and stored at -80°C. The protein concentration in each
sample was detennined by the bicinchoninic acid protein assay, using bovine serum
albumin as reference standard. Protein ftom the different fractions were loaded on a 7.5%
SDS-PAGE gels and immunodetection of P-gp was perfomed as previously described
using the anti-P-gp monoclonal antibody C219 (Signet Laboratones Inc.).
II.6 P-gp purification from Pichia pastoris membranes
Membranes fiom the 16/3 1 sucrose interface were precipitated with 10 m M
MgCl2 by centrifugation (l4,000g, 30 min) to remove DTT and EDTA. The pellet was
resuspended in equilibration buffer (50 m M Tris-HCl pH 7.4,50 mM NaCl, 30% v/v
glycerol, 5 mM imidatole and 0.5 mM b-2-mercaptoethanol) and solubilized with lyso-
phosphatidylcholine (LPC) at the final concentration of 0.3% in presence of protease
inhibitors l3 l. The suspension was allowed to sit until it becarne clear and was then
centrifùged at 60,000g for 30 min to remove non-solubilized particles.
11.6.1 Nickel-chromatograpby purification
The Ni-NTA agarose resin (Qiagen) was pre-equilibrated with the equilibration
buffer and added to the solubilized membranes. In order to maximize the binding of the
histidine tag to the resin, the mixture was incubated at 4OC with slow rotation and
protease inhibitors, for 16-20 hours 1 3 1 9 1 71. The resin was then collected on a column
and washed with equilibration buffer of increasing imidazole concentration. The washes
usually consisted of 10 ml of a 5 mM imidazole solution, followed by 10 ml of a 20 mM
imidazole solution and, only for the 10 histidine-tagged MDRl -CL protein, 5 ml of a 80
rnM irnidazole solution. Elution was done using less than 3 ml of an 80 mM or 300 mM
imidazole solutions, depending on the number of histidines present in the histidine tails (6
or 10, respectively). Ail the elution fractions were kept at -80°C and protein content was
evaluated as described earlier.
II.6.2 ATPase activity assay
ATPase activity on reconstihited fractions was estimated by measuring inorganic
phosphate (Pi) release by colorirnetric phosphate determination method 73. In brief, the
purified protein eluate fiom the Ni-NTA resin (80 mM imidazole for mdr3 and 300 mM
imidazole for MDRl-CL) was incubated with 1% Escherichia coli lipids (Avanti) and 1
mM DTT for 30 min at RT. Aliquots containing 0.1 pg of protein were added into 50 pl
of ATP cocktail (40 mM Tris-HCI pH 7.4,O. 1 mM EGTA, 10 mM Na2ATP and 10 mM
MgC12) and incubated at 37°C for 0, 30 and 60 min. P-gps substrates or modulators
(verapamil and vinblastine) were added fiom stocks in dimethylsulfoxide (DMSO). The
reactions were stopped by addition of 1 ml of 20 mM cold HzS04, and kept on ice until Pi
development. The development consisted of a 10 min incubation of the reactions at RT
with 200 pl of reagent A (1.75% w/v ammonium heptarnolybdate, 6.3 N HzS04) and a 20
min incubation with 200 pl of reagent C (0.35% v/v polyvinylalcohol II (PVA), 0.035%
malachite green) followed by the reading at 6 1 0 nm.
11.7 Proteolytic cleavage with factor Xa
Factor Xa cleavage trials were done as suggested by the enzyme supplier
(Boehringer Mannheim, 163). Stock solutions of factor Xa were made in distiiled water
and stored at 4°C for one week maximum. As recornrnended, purification of the
engineered protein was done prior to the cleavage to minimize degradation by non-
specifk cellular proteases. n i e MDRI-CL-X~~ purified protein was incubated with the
factor Xa in a b a e r containing 100 mM NaCl, 50 mM Tns-HCl pH 8.0 and 1 mM of
CaCi2. Incubations were carried out at 4°C or 25°C for times ranging fiom 2 hours to 20
hours 174-176. The recomrnended ratio of enzyme/substrate is 0.5% to 5% by weight,
but some authors report the use of higher ratios 15 1. Different concentrations of
dedocylmaltoside (DM) and deoxycholate (DOC) were tested to increase the accessibility
of the engineered cleavage site 15 1,177-1 79. The cleavage reaction was stopped by
addition of loading buffer (SDS, P-mercaptoethanol, DDT) and run on a 7.5% SDS-
PAGE acrylamide gel and analyzed by Western blotting as described earlier.
11.8 Computer analysis
Protein alignrnents were made using the software ClustalW, available on the
World Wide Web ( h t t p : / / b i o w e b . p a s t e u r . f r / s e q a n a U i n t e r f a ) . Structural
3-D models of the B4 strands were performed with the software InsightlI from the
coordinates generously communicated by Hung er al. 144.
CHAPTER III
RESULTS
111.1 Conserved protein motifs in ABC transporters
Within the ABC transporter family, the highest level of similarity is found in the
region surroundhg the NBDs 36976. The EAA region (or EAA-like motif for
eukaryotes), is located on the intracellular loop between the TM4 and TM5, and exhibits
the next highest similarity level within the family (see introduction, The maIK model, 97).
The figure 3, panel A, shows the alignment of EAA-like motifs of several eukaryotic
ABC transporters, part of the bacterial EAA box consensus is shown below. The EAA-
like motif is shorter than its bacterial homologue. the EAA box, which is defined in full
length by the arnino acid sequence EAAX3GX9LP. As in prokaryotes, the most
conserved amino acids are the central alanine and glycine separated by three less
conserved residues 9 8 ~ 9 ~ 9 î8°. These two residues seem to be the central core of the
motif; they are perfectly conserved in al1 ABC transporters aligned in figure 3.
Substitutions of the central glycine were shown to cause transporter dysfunction in
bacteria and inpxulp, the yeast homologue of ALDP 97. Most of the other residues show
a poor degree of conservation between the different sub-families of eukaryotic ABC
transporters. The first glutamate of the motif (position O on figure 3) seems to be
conserved in the peroxisomal transporter family and the MDR family. Through al1 the
families, there is a preference for a polar residue at position -2, and for a hydrophobic
residue at position 11. The MDR family, the yeast ste6 and human CFTR share a
preference for a hydrophobic side chain at position 7. Finally, a positive charge is often
found at position 9 within al1 studied families.
Figure 3: Alignment of the EAA-like motif and T578 region of eukaryotic and
prokaryotic ABC transporters. Amino acids present in a plurality of these sequences
are boxed in black, and conservative arnino acid substitutions are boxed in gray. The
origin of the sequences is indicated on the lefi and the first and last amino acid positions
of the sequence fragments are indicated on the right. The alignrnent was performed with
the public software ClustalW (see Material and Methods).
A) EAA-like motif
L yeast Pxalp ~ x a 2 p icmaa:
r human PMP7O human M D R l human MDR2 mouse mdr l mouse mdr2 mouse mdr3 hamster pgpl hamster pgp2 d-melanogaster mdr49 p. falciparum pfmdrl s x e r e v i s i a e ste6 human CFTR
Position - - 2 0 2 4 6 8
Bacter ia l EAA box core: EAA---G
Position - 0 2 4 6 8
human M D R ~ human M D R ~ mouse mdr l mouse mdr2 mousemdr3 d . me1 anogaster md 1-49 p. fa1 c i rarum pfrndrl s .cerev is iae ste6 human C-R human ADLP ~ . c o ï i m a 1 ~ S.thiph murium h i s P E . c d i L y e E . C O ~ ~ pbst ~ . c o l i o p p ~
As seen on the alignment of figure 3, panel B, the T578 region, being a part of the
NBD1, is a much more conserved region than the EAA-like region. Hypothetically, this
region is the interacting counterpart of the EAA-like motif. Within the MDR protein
family, the sequence is highly conserved. Extensive similarity could be found behueen
the MDR family, ste6, CFTR, ADLP and some bacterial transporters. A high homology
degree was detected, in particular for the hlyB protein of Escherichia coli and less
surprisingly, for ste6. In other eukaryotic peroxisomal transporters and bacterial
transporters, convincing similarity has k e n found, but the motif spreads on a much
longer region, as stretches of extra residues seem to occur in variable number and
positions, depending on the protein (data not shown). This region has been proven to be
an essential region for NBD 1 activity and potentially important for malK recruitrnent and
activation by the malFG membrane complex. Recent studies on hisP showed that
substitution of T2O5 and E202, a region equivalent to T578 in mdr3, caused the
disengagement of the ATP-binding subunit fiom the membrane complex *
111.2 Screen of the consewed motifs for important residues.
To study the EAA-like motif and the T578 region in mouse mdr3, we
independently mutated to a cysteine each residue fiom L277C to K287C in the EAA-like
motif and from GS75C to 158 1C in T578 region (see figure 3). In addition to restoring
the mating ability , expression of mdr3 WT in Saccharomyces cerevisiae confers cellular
resistance to the antifbngal peptide macrolite FK506, providing two functional screens to
measure the loss of function in mdr3 mutants. Consequently, to monitor mdr3 activity
these mutants were expressed in Saccharomyces cerevisiae, and mass-populations of
transformants were tested for their ability to confer dnig resistance and restore the mating
phenotype in this yeast heterologuous expression system.
For the drug resistance assay, ce11 growth in presence of 50 pghl of F U 0 6 was
monitored (595nm) for 28 hours. In drug fiee medium, ail mutant and control
transformants showed identical growth profiles, reaching the stationary growth phase
simultaneously around the 2 1 hours timepoint (data not shown). In the presence of
FK506, the mdr3 WT transformants showed a strong growth rate, white the pVT vector
transformants (negative control) still showed no growth after 28 hours (see figures 4 and
5). The different mutants showed considerable variations in growth rate when incubated
with the drug. A first group of mutants have a similar growth rate than that of the mdr3
WT. This group contains the mutants E278C, E279C. K281C, R282C, L283C, I285C,
K286C for the EAA-like motif and G575C, R576C, T577C, I579C, V580C for the T578
region. L277C and 158 1 C showed an intermediate growth rate, they were also more
variable throughout the different experiments. The mutants G284C, ABOC, K287C and
T578C clearly have a lower level of resistance. To assess the presence and the expression
level of P-gp mutants at the plasma membrane. screening of mini membrane preparations
by Western blotting analysis using the anti-P-gp monoclonal antibody C2 19 was
performed. Al1 mutants show a similar expression level, with the exception of R576C
exhibiting a lower, but detectable expression, and 158 lC, showing the highest expression
level. The R576C mutant shows a drug resistance level comparable to the mdr3 WT,
while 158 1C conferred an intermediate phenotype. This FK506 resistance experiment has
Figure 4: Growth of yeast transformants expressing either wild-type or EAA-like
motif mutant mdr3 cDNAs in rich medium containing FK506. Yeast Saccharomyces
cerevisiae transformants were grown in 96-well plates for 27 hours at 30°C in YPD
medium containhg FK506 (50 pg/ml), as described in "Material and Methods". The
growth was determined between 13 and 27 hours by measuring optical density ( A 4 . For
each clone, the initial optical density was adjusted to 0.0 1 fiom an overnight pre-culture.
(A) Growth curves of tmn~formants expressing wild-type and EAA-like motif mutants of
mdr3. (B) Immunodetection of wild-type and mutant mdr3 proteins in yeast membrane
preparations by Western-blotting analysis with the anti-P-glycoprotein monoclonal
antibody C219, as descnbed previously 92. The molecular weight markers (in kDa) are
shown at the right of the figure.
FK506 Growth Resistance Assay: EAA-Like Motif
Figure 5: Growth of yeast transformants expressing either wild-type or T578 region
mutant d . 3 cDNAs in rich medium containing FK506. Similarly to the previous
figure, yeast Saccharomyces cerevisiae transformants were gro1.m in 96-well plates for 27
hours at 30°C in YPD medium containing FK506 (50 pg/rnl), as described in "Material
and Methods". The growth was determined between 13 and 27 hours by rneasuring
optical density (A5s5). For each clone, the initial optical density was adjusted to 0.01 fiom
an overnight pre-culture. (A) Growth curves of transformants expressing wild-type and
T578 region mutants of mdr3. (B) Immunodetection of wild-type and mutant mdr3
proteins in yeast membrane preparations by Western-blotting andysis with the anti-P-
glycoprotein monoclonal antibody C2 19, as described previously 92. The molecular
weight markers (in kDa) are shown at the right of the figure.
been repeated three times, with many different mass populations for both mutants, always
leading to similar results. The T578C mutant is the only one that has been previously
studied in yeast for FK506 resistance, the results presented here for this clone are
comparable 93.
The capacity of the various mutants to restore mating in the same steA6 yeast
strain (Saccharomyces cerevisiae JPY20 1) was next measured. The mating fiequency is
expressed as the ratio of diploid colonies grown on minimal plates to the number of
haploid JPY2O 1 transformants introduced in the mating reaction 92. The results
presented in figure 6 were calculated fiom three independent experiments and are
presented for each mutant as the percentage of mdr3 WT mating fiequency. The different
mutants in both motifs showed a wide range of mating activity that can be divided in four
sub-groups. The first group contains two mutants (G575C and T577C), both belonging to
the T578 region, that are significantly more active than the mdr3 WT with a close to 10-
fold increase in mating. This phenornenon has been observed previously with mutants
and chimeras of mdr3 93,95. A second group has similar or less than 2-fold increase
when compared with mdr3 WT mating fiequency. These were seen in both regions; they
are A280C, Kî8 lC, R576C, I579C and 158 1C. The third group contains the intennediate
mating phenotype, ranging between 25% and 70%, k ing L277C, E278C, E279C, R282C,
I285C and K287C. Finally, the fourth group of mutants, L283C, G284C, K286C, T578C
and V580C, al1 have a 5-fold or more decrease in mating. Noticeably, the fiequency of
G284C and T578C is reduced to 2% or less of the mdr3 WT activity, which could be
considered as a fifth group with a 50 to 100-fold decrease in activity. It is difficult to
Figure 6: Ability of wild-type or mutant mdr3 cDNAs to restore mating phenoîype
in a nuU yeast mutant at the endogenous ste6 locus. The results are expressed in
percentage of the mdr3 wild-type mating frequency. The figure shows both EAA-like
motif and TS78 region mutants. The mating frequency represents the proportion of a-type
transformed haploid cells that formed colonies of diploid cells on minimal medium upon
mating with a-type tester cells (see Material and Methods for more details). Al1 the
results and the standard deviations were calculated fiom three independent experiments.
The percentage values are indicated above the columns for extreme data. Percentage
values lower than 0.2% c m be considerate as background level (pVT vector negative
control).
Percentage of mdr3 WT mating frequency (96)
classifi the high or intemediary activity phenotypes due to their large variation. Taken
together with the dnig resistance (FK506) assay, these data cleariy confirm that G284 and
T578 substitutions in their respective motifs greatly affect the activity of mdr3 protein.
Moreover, the G284C mutant was expressed in Pichiapastoris and purified by histidine-
tagged chromatography in parallel with mdr3 WT protein (see figure 7). In ATPase
activity measurements, it exhibited only 2 to 4-fold veraparnil induced stimulation,
compared to 12-fold stimulation for the mdr3 WT purified protein (see ATPase activity in
the human MDR1-CL section).
111.3 Production of the MDRI-CL-xaJ protein
The production of a hurnan MDRl cysteine-less protein containing a factor Xa
cleavage site between the two regions described above is mandatory for cross-linking
studies on purified protein. Since these studies are conformational studies, it has to be
demonstrated that this new constmct can be correctly expressed in yeast membranes and
that it can conserve fiil1 human MDRl -CL functionality after purification. Loo and al.
68, who engineered the hurnan MDRI-CL template, have previously shown that the
purified protein has about 60% of the human MDRl WT protein ATPase activity 132. In
the present study, we reproduced this result with an MDR1-CL protein purified fiom
yeast membranes with the techniques routinely used in Our laboratory (data not shown).
A triple factor Xa ([IEGR]~) site was introduced in MDR-CL by recombinant PCR
mutagenesis between the amino acid positions G324 and E3 25, and the integrity of the
modified PCR constnict was verified by sequencing. This positions the factor Xa
cleavage site within the third predicted extracellular loop (see figure 1). This new MDRI-
CL-xP' template was transferred in pHILD-2 shuttle vector and expressed in the Pichia
pasforis KM7 1 yeast strain. Compared to the GS 1 15 straïn, the KM7 1 strain does not
permit to screen for the muf phenotype because the AOXl gene is already disrupted (see
Material and Methods). The screening has to be done on a larger number of individual
clones by mini membrane preparation and analyzed by SDS-PAGEIWestem blotting.
The advantage of this strain is the higher rate of transformation than GSl15 observed
with MDR cDNAs. Four high expressing clones were found in a screen of 20 and two of
them were grown in larger scale for purification. For these two MDRI-CL-xa3 clones
oniy, the purification was made according to the updated protocol of Senior and al. 182,
using dodecylmaltoside (DM) 1% for solubilization of the complete membrane pellet, as
opposed to fust doing a sucrose gradient fractionation followed by a solubilization with
lyso-phosphatidylcholine (LPC). It was found in two independent purification
experhents that the solubilization with DM 1 % was very poor for this protein, leading to
a low yield of purified protein afier the nickel exchange chromatography (heavy pellets
were still found d e r solubilization). Also, for the chromatography, no protease
inhibitors were added to the washes and elution buffers. Although some factor Xa
digestion experiments were made, the protein could only be analyzed by Western blotting
analysis, as the available quantity was too low to be observed accurately with Coomasie
staining. The figure 7 shows the purification of MDR-CL, M D R ~ C L - X ~ ~ , mdr3 WT and
mdr3 G284C. The elution fraction has a lower imidazole concentration for mdr3 proteins
(80 mM imidazole compared to 300 mM for the MDRI-CL proteins) because of their
shorter histidine tail (6 instead of 10). Only a third of the elution volume was used for
Figure 7: Histidine-tagged P-glycoprotein purification from yeast membranes
analyzed by Coomassie gel stainhg and immunoblotting. The molar ratios correspond
to concentrations of imidazole used for the diftèrent washes and elutions.
Immunoblottings were revealed with the anti-P-gp monoclonal antibody C219. The resin
lane represents P-gp remaining on the nickel-resin after the elution. Refer to Matenal and
Methods for a complete description of each step. Each lane contains 40 pl fiom different
volumes of the purification steps. (A) Typical coomassie blue staining of an acrylamide
gel showing the fractions taken at different stages of mdr3 WT purification. The nickel-
chromatography starts with the 5 mM wash and the elution was done in 3 ml final of 80
m M imidazole buffer. (B) Imrnunoblotting analysis of mdr3, mdr3-G284C, MDR1 -CL
and MDRI -cL-x~) nickel-chromatography sample fractions. The elutions were done in a
total of 3ml of 80 mM imidazole buffer for mdr3 and mdr3-G284 proteins or a total of 3
ml of 300 m M imidazole buffer for MDRI-CL or a total of 1 ml of 300 m M imidazole
buffet for MDRI-CL-xa3. The first steps of the purification were cut off to simplify the
figure.
c c -0 .O 3 -
3 a, a,,
MIDRI-CL
MDRI-CL-X~~ purification, due to the inadequate solubilization of the membranes in
DM, resulting in a relatively low yield of purified protein. Moreover, no significant
ATPase activity was detected in these MDR 1 - cL-x~~ purifications (data not shown).
The blood coagulation factor Xa is a senne protease which cleaves its natural
substrate, the pro-thrombin, on the carboxy-terminal side of the tetrapeptide IEGR 77.
This protease has been widely used to liberate authentic eukaryotic proteins fiom fusion
protein partners expressed in Escherichia coli 75. However, some problems of
specificity have been reported concerning the use of this protease on engineered IEGR
sequences 175, 1 77-179. Attempts to effciently cut the purifiecl MDRI -cL-x~~ protein
with the factor Xa digestion protease were unhitful. As suggested in the literature
163,1779178, optimization tests were done using different concentrations of factor Xa for
short or long incubations (2 to 1 8 hours) either at 4OC or 2S°C. Some authors have also
used detergent at fairly high concentration (DM up to 2%) to increase the protease
sensible site accessibility without impainng the factor Xa activity. The figure 8, panels A
and B, present the cutting results while using different concentrations of DM or
deoxycholate @OC) and a high concentration of factor Xa. It is clear that none of the
conditions lead to the complete digestion of the fùll-length protein. Since the C219
epitopes are located in the NBDs and the factor Xa site is in the loop located before the
NBDl, the expected result would be a single 120 kDa band representing the protein
without the first 324 amino acids. The expected band is sometimes seen with MDRL-CL-
xa3, but surprisingly, always accompanied by lower molecular weight bands. By
increasing the incubation time, the full-length protein completely disappears so as al1 the
Figure 8: Digestion trials of the MDRI-CL-X~~ protein with the factor Xa protease.
hunodetect ion of purified wild-type or modified MDRl and mdr3 proteins digested
with the factor Xa protease. Western-blot analysis was carried out with the monoclonal
antibody C2 19. The epitope of this antibody is located in the NBDs. The molecular
weight markers (in kDa) are shown at the left of each panel. (A and B) Immunoblots of
digestion reactions containing approximately 1 pg of purified protein, 0.1 pg of factor Xa
and various concentrations of detergent, dodecy lmaltoside (DM) or deoxycholate (DOC).
Incubations were done for 2 hours at room temperature. (C) Immunoblot of digestion
reactions of MDRl , MDRl -CL, MDRI-CL-xa3 or mdr3 proteins with different arnount
of factor Xa. The reactions did not contain detergents. 0.3 to 1 pg of protein were
digested in each reaction according to the available stocks and concentrations of the
different purifications. Incubations were done at room temperature for 2.5 hours. (D)
Immunoblot of diflerent quantities of the factor Xa alone.
B IC!
DM concentration (%) O
O 0.5 1.0 1.5 2.0 205 -+
0œ.œ-
DOC concentration (96) 3 O
O 0.5 1.0 1.5 2.0
Factor Xa (erg)
other products except for a low molecular weight band that has k e n demonstrated to be
the factor Xa polypeptide (figure 8, panel D). Long incubations with lower
concentrations of protease gave the same results: the target protein is not completely
cleaved and shows non-specific degradation. Note in figure 8 that incubation of the
purified proteins in the same conditions but in absence of factor Xa never results in
degradation. Both MDRI and the cysteine-less protein seemed to be degraded by the
factor Xa, while mdr3 shows only a small amount of non-specific cleavage in the
presence of high concentrations of factor Xa. Cornputer search revealed no other factor
Xa recognition sequences (IEGR) in the MDRl or MDRl -CL proteins.
iIL4 Characterization of P4 strands MDRl-CL mutants
In the crystal structure of hisP, the P4 strands are the closest symrnetric part of the
contact patch between the monomers (see introduction). Amino acid alignment of the
two mouse mdrl NBDs (NBD 1 position 384-63 1, NBDS position 1026- 1275) with hisP
indicates that they share 26% identity and 49% similarity 36. The Walker A and the
Walker B motifs share the highest homology level. The 84 strand itself shows some
similarity but is not fully conserved. According to the crystal structure of hisP-dimer P4
strands, the closest point should be the A63 side chains with a distance of 4.54 A between
the two side chains (see figure 9, panel B). The alignment of hisP 84 strand with both
hurnan MDRl 84 strands (NBD1 and NBDZ) shows an intermediate level of identity and
homology (figure 9, panel A). However, as seen in a cornputer 3D model (figure IO), the
MDRl 84 strand sequences have the inherent capacity to form the proper p-strand
structure to match the correspondent hisP-dimer crystal structure. This model does not
Figure 9: Alignment of the hisP P4 strand sequence with both NBDs of MDRl and
crystal structure of hisP P4 strand dimer. (A) Amino acids present in a pluralily of
these sequences are boxed in black, and conservative amino acid substitutions are boxed
in gray. The ongin of the sequences is indicated on the left and the first and 1st amino
acid positions of the sequence fragments are indicated on the right. The alignment was
performed with the public software ClustalW (see Material and Methods). (B) Crystal
structure of the P4 strand dimer of hisP, showing physical distances (A) between selected
side chahs. The position of the residues is indicated on one of the strands. This mode1
was generated with the soflware Insight II from the coordinates generously
cornmunicated by Hung et al. 144.
84 strand $5 - - h i SP RCINFLEK~EFIIVNF~LVR 51-75 MDRI ( N B D ~ ) QLMQRLYD' E VSVD D R T I N 438-462 MDRl ( N B D ~ ) QLLERFYD'LA KVLLD KE KRLN 1081-110s
hisP beta 4 strand dimer
Figure 10: Cornparison of the structural features of hisP 84 strand dimer with the
homologous region of MDR1. (A) Crystal structure of the P4 strand dimer of hisP as
described in figure 9. The position of the residues is indicated on one of the strands. (B)
Mode1 of the hypothetical MDRl P4 strand interaction. The amino acids indicated on
both strands are the candidates for the cysteine scanning strategy. This mode1 has been
generated with the sohare Insight II with MDRl P4 strand sequences and the hisP diner
coordinates.
prove in any way that the MDRl behaves so, but it only suggests that a similar
conformation to hisP is possible. The distances shown on the crystal structure are in good
agreement with the possibility of covalent cross-linking between the two strands (up to 7
A without a molecular linker). We wish to investigate M e r this possibility.
Initidly, without the hisP-dimer P4 strands 3D coordinates, the cysteine scanning
strategy had been established over the gross drafi of the dimer, using the knowledge that
the 84 strands were the closest symmetrical point. The strategy was established as
follows: a cysteine scan was first to be made in the p4 strand of both MDRl-CL NBDs at
every other residue starting at P446C and ending at D454C in NBD 1 and starting at
L1090C and ending at G1098C in NBD2, which makes the two scans complementary.
Amino acids to be substituted in this strategy are shown in figure 10. Most (7110) of the
mutants were made, transferred in the pVT-MDRI-CL shuttle vector and expressed in the
yeast Saccharomyces cerevisiae JPY 20 1 for drug resistance analy sis. Three mutants are
still under construction because, for unknown reasons, they could not be obtained with
the Promega pALTER mutagenesis kit. They are P446C, M450C and D454C.
Additionally K1093C is under construction, it was added to the strategy afier receiving
the hisP 3D coordinates since according to the model, the set of M4SO and K1093 may be
the closest side chains of the P4 strands.
Pnor to this study, the capacity of the human MDRl and the MDRl -CL proteins
to confer drug resistance phenotype in yeast has never been exarnined. This system
would be appropriate to directly access the functionality of the different MDRl -CL
mutants in yeast by a rapid screen. It is important to find which mutants are functionaf in
order to perform other studies like the blockage of their activity with a maleamide
molecule or cross-linking with pairs of mutants. The human MDRl and MDRl-CL were
found to confer FK506 resistance in yeast (figure 11). The level of resistance,
particularly for MDRI -CL is lower than with murine mdr3, but the effect of the human
proteins is still clearly seen long before any growth can be observed for the negative
control. To permit a better appreciation of the growth, al1 yeast transformants mass
populations were diluted at an optical density of 0.2 instead of 0.1 pnor to the initial
setting of the assay plate (see Material and Methods). Most of the 84 mutants show
FK506 resistance at a close to MDRI -CL wild-type level (figure 12). Only G1098C has a
dramatic decrease in resistance, showing almost no growth at 27 hours, and V1094C
seems to have a 2 fold decrease in growth rate. Western-blotting analysis shows that al1
the mutants are expressed at the plasma membrane to a similar level.
Figure 11: Growth of yeast transformants expressing either MDRI, MDRI-CL or
mdr3 cDNAs in rich medium containing FK506. Yeast Saccharomyces cerevisiae
transformants were grown in 96-well plates for 27 hours at 30°C in YPD medium
containing FU06 (50 pg/ml), as described in "Material and Methods". The growth was
determined between 16 and 27 hours by measuring optical density (Alrs5). For each clone,
the initial optical density was adjusted to 0.02 fiom an overnight pre-culture. (A) Growth
curves of transformants expressing the different templates. (B) Immunodetection of wild-
type or modified MDRl and mdr3 proteins in yeast membrane preparations by Westem-
blotting analysis with the anti-P-glycoprotein monoclonal antibody C2 19, as descnbed
previously 92. The molecular weight markers (in kDa) are show at the lefi of the figure.
FK5û6 Growth Inhibition Auay:mdr3, MDR1 and MDR1 -CL
0.9 1 1
Figure 12: Growth of yeast transformants expressing either wild-type or P4 strand
mutant lMDRl cDNAs in rich medium containing FKS06. Yeast Saccharomyces
cerevisiae transformants were grown in 96-well plates for 27 hours at 30°C in YPD
medium conraining FM06 (50 pg/ml), as described in "Matenal and Methods". The
growth was determined between 16 and 27 hou6 by measuring optical density (A595). For
each clone, the initial optical density was adjusted to 0.02 fiom an ovemight pre-culture.
(A) Growth curves of transformants expressing MDRI. MDRI -CL or the P4 mutants of
MDRI-CL. (B) Immunodetection of wild-type or modified MDRl proteins in yeast
membrane preparations by Western-blotting analysis with the anti-P-glycoprotein
monoclonal antibody C2 19, as described previously 92. The molecular weight markers
(in kDa) are shown at the left of the figure.
FKS06 Growth Inhibition Assay: Betad Strands Mutants
CHAPTER IV
DISCUSSION
W.1 Analysis of conserved protein motifs in ABC transporters
The EAA region, located on the intracellular loop between transmembrane
domains 4 and 5, is a well conserved motif in bacterial ABC transporters 99.1 13918O.
The core of the region (EAAX3G) seems to be conserved to a certain extent in many
eukaryotic ABC transporters 97.1 14-1 16. As seen on the figure 3, the cenaal alanine and
glycine separated by three less conserved residues are the most conserved amino acids.
Establishing whether or not there is fùnctional conservation associated with that motif
could lead to a deeper understanding of the ABC transporter mechanism. Since the
bacterial EAA region has been associated with recognition and anchorage of the
nucleotide binding subunit 98.181, it has to be considered that evolution of both
interacting regions in a given protein can cause sequence divergence throughout the
different transporters. Substitutions of the central glycine were s h o w to cause
transporter dysfünction both in bacterial transporters 98- 183 and in Pxal p, the yeast
homologue of the human ALDP 97. In Pxal p. severe (G3Ol P) and conservative (G3O 1A)
substitutions of the central glycine led to a complete loss of function and an intermediary
phenotype, respectively. Also, conservative substitution E294D of the first residue in the
motif, which is corresponding to a site of recurrent mutations causing
adrenoleukodystrophy in ALDP, was found to completely abrogate the function of the
yeast pxa 1 p protein. Deletions in the corresponding intracellular loop of CFTR were
shown to cause instability of the ion channel 120. No other stuàies of this motif have yet
been reported for eukaryotic proteins.
Substitution mutations in mdr3 clearly confirmed the importance of the central
glycine for the transporter function in yeast (see figure 4 and 6). No other substitution in
this motif caused such a drastic decrease of activity in both FK506 drug resistance and
mating assays. Many glycine mutations in intracellular loops have been found to be
important for MDRl proper targeting in transfected cells 1 10, leading to loss of MDR
phenotype. In the present study, it is clear that the protein is expressed at the plasma
membrane (see figure 4, panel B), therefore the observed outcome can be directly
associated with the specific mutation. For the conserved alanine ABOC, a negative effect
on function was ody obsewed in the FK506 resistance assay, while the mating abiIity
seemed vigorous. Moreover, R282C, L283C. I285C and K286C show a significant
negative effect only in the mating assay. These phenotypes could be attrïbuted to an
altered specificity of the transporter for certain substrates. If that is the case, the function
of the studied motif could be more related with substrate binding than ATPase
activity/drug transport signal transduction. It has been proposed that intracellular loop
regions may be implicated in h g binding 1 073 Another interesting mutant is
K287C, showing approximately 50% of wild-type activity in both assays. A positive
charge is seen at this amino acid position in 1 1 of the 15 eukaryotic ABC transporters
aligned in figure 3, suggesting functional importance. Finally, L227C in mdr3, which
corresponds to substitution E294D in pxalp, as well as substitution of the two glutamates
(E278C and E279C) were found to give a near to wild-type phenotype in both assays.
The phenotypes observed suggest that these regions may have an important conserved
role in P-gp mechanism.
It is also important to mention that by its own nature, the cysteine scanning
strategy does not impute the same consequentiai weight to each substitution. Each
substitution has to be regarded as a chernical, fûnctional, polar andor structurai change.
More detailed analysis of the loss of fùnction or the absence of effect attributed to the
substitutions would consist of creating conservative and non-conservative modifications
according to the nature of each amino acid side chain.
The T578 region is located approximately 24 arnino acids afier the Waker B
motif in the NBD1. It is part of the most conserved domains of the protein 36937, and
within the MDR family, it is almost perfectly conserved (see figure 3, panel B). In a
study focussed in deterrnining if the two NBDs of mdr3 are functionaily equivalent and
interchangeable, the amino acid position T578 was found to be essential for the proper
fûnction of NBD 1 in the context of the amino-terminal half of P-gp 93. The substitution
T578C was shown to be responsible for decreased FK506 resistance and mating in yeast
and altered d m g resistance profile in transfected LR73 cells. Also, it has been suggested
that this residue could participate directly or indirectly in substrate interactions and could
possibly be implicated in signal transduction fiom NBDs to transmembrane domains,
where the primary dmg binding sites are located. This region (amino acid M437 in malK,
see figure 3 B) has been proven to be potentially important for malK recruitrnent and
activation by the malFG membrane complex 98. Recent studies on hisP showed that
substitution of T205 and E202, located in a region equivalent to T578 in mdr3 (see figure
1 and 3, panel B), caused the disengagement of the ATP-binding subunit fiom the
membrane complex 181. As the upper side of arm II on the hisP crystal structure was
demonstrated to be in close contact with the plasma membrane, the position of T2O5 is in
good agreement with its proposed anchorage role on the integral membrane subunits (see
figure 2, panel A).
The hct ional analysis of the cysteine mutants in the T578 region reveals that
only T578C is negatively afEected in both FK506 resistance and mating assays.
Practically al1 the other substitutions have a strong activity in both assays (see figures 5
and 6). Strikingly, the two substitutions G575C and T577C were significantly more
active than the mdr3 WT with a 10-fold increase in mating. This phenomenon has been
observed previously with mutants and chimeras of mdr3 93995. The mating assay could
be prone to detect increases in mdr3 a-factor transport activity since the activity conferred
by mdr3 WT is low compared to the natural ste6 a-factor transporter. V580C has a 4-5
fold decrease in mating activity, but a wild-type FKSO6 resistance, while 158 1C has an
intermediate phenotype in FU06 resistance assay, but shows a strong mating efficiency.
Here again, these modulations of substrate profile suggest that the TS78 region could
have a potential role in substrate interactions. Characterization of the drug resistance
profiles in transfected cells would be the next step to investigate this hypothesis. Taken
together, the FK506 resistance assay and mating assay data clearly confirm that the
conserved residues G284 and T578 are essential in their respective motifs, and that these
regions could be involved in substrate or domaiddomain interactions.
IV3 Cleavage of the purified MDRI-CL-xa3 protein
The initial strategy designed to study possible interactions between the EAA-like
motif and the T578 region included the insertion of a triple factor Xa protease recognition
site in the third extracellular bop. A precedent epitope mapping study on mdr3 revealed
that a hemagglutinin epitope inserted at this position resulted in a functional P-gp and was
accessible by the antibody for irnmunofluorescence rnapping 66967. The hemagglutinin
epitope and the triple factor Xa site are of similar length, being 9 and 12 amino acids
long, respectively. In MDRI-CL-xa3, this factor Xa site would be used to monitor
eventuai cross-linking between the two studied regions in double cysteine-mutants.
Attempts to efficiently cut the purified MDR 1 -CL-xa3 protein with the factor Xa
protease were unsuccessfid. Under normal digestion conditions, most of the MDRl -CL-
xa3 protein could be found in its full length form. while after extended digestion or with
higher concentrations of factor Xa, the protein seemed to be non-specifically cut and/or
degraded (figure 8). The expected band could be detected in some conditions, but it
seemed sensitive to further degradation as it completely disappeared if the incubation was
prolonged or performed in the presence of a higher factor Xa. The lower molecular band
that is seen in almost al1 the factor Xa digestions has been shown to be the factor Xa
itself, non-specifically detected by our antibody. However, it is not clear whether the
primary antibody (C219) or the secondary antibody (anti-mouseIgG) is responsible for
this cross-reaction. As suggested in the literature, optimization tests were done using
different concentrations of factor Xa for short or long incubation times (2 to 18 hours)
either at 4OC or 2S°C 174-176. Some authors have also used detergent at fairly high
concentration (DM 2%) to increase the protease sensible site accessibility without
impairkg the factor Xa activity 1 5 9 1 77- 79. The use of high amounts of factor Xa (up
to 3 pg of factor Xa per reaction) is also reported in order to obtain efficient cleavage
184. None of these standard conditions led to efficient and specific cleavage. Two
detergents, DM and DOC, were tried at different concentrations without any major
improvement (see figure 8, panels A and B). Furthemore, the MDRl-CL purified
protein without an engineered factor Xa site, the MDRl WT and, to a lesser extend, the
mdr3 purified protein are sensitive to the factor Xa. No other consensus Xa cleavage site
sequences were f o n d in MDRI, MDRl -CL or mdr3 proteins. These results suggest that
1) the factor Xa does not efliciently cut at the engineered site and 2) the MDRl protein is
sensible to non-specific cleavage by the factor Xa. it has been previously reported that
the factor Xa cleaves proteins at non-IEGR sequences, but the precise sequence has yet to
be deterrnined (possibly VLGR), while the cleavage at the IEGR recognition site may
sometimes be slow and incomplete 17% 1 77-1 79. No VLGR sequences were found in
MDRl proteins, although many XXGR were found (X being an arbitrary amino acid).
Also, cleavage will not occur if a proline immediately follows the arginine 16391 77; it is
not the case here. Finally, the cleavage can be influenced by the adjacent amino acid
sequences at the cleavage site, the size of the two halves of the protein, and the
accessibility of the cleavage site 177. The use of different anti-P-gp monoclonal
antibodies and Coomassie staining analysis of the protein fiom a more concentrated
purification could help to get a better idea of where on the protein and to which extent the
non-specific cleavage occurs.
The absence of a functional protease cleavage site between the two engineered
cysteines complicates the analysis of the cross-linking interactions. Perhaps different
proteases will have to be tested for the absence of non-specific cleavage of the wild-type
protein, and the corresponding protease sites introduced into the MDR I -CL cDNA. Also,
it could be possible to monitor cross-linking of the uncut protein by a shift in the
electrophoretic mobility of the covalently linked forms. SDS-PAGE under non-reducing
conditions followed by standard Western analysis was performed to monitor the shih.
Such shifis in mobility have been observed with the human MDR 1 protein d e r
incubation with an oxidizing agent (Dr. Ina Urbastch persona1 communications).
IV.3 MDRI-CL 84 strands mutants
The recent high-resolution crystal structure of a bacterial ABC transporter
nucleotide binding dimer 144 stimulates the idea of investigating NBD cross-interactions
in P-gp. The hisP crystal structure shows very clearly that the $4 strands are the closest
syrnmetric features of the dimer. The distances at the P4 strands interface (figure 9) are
suitable for accessibility and cross-linking studies. For cross-linking, a covalent link can
be formed by oxidation between two cysteines, without any linker molecule, to a distance
up to 7 A. With the use of linker molecules of various length, covalent bridges can be
fonned to distances up to 16 A 155. The structural mode1 seen in figure 10 shows that
MDRl 84 strand sequences intrinsically have the possibility of forming a similar
structure than the one of hisP P4 strands. With these data, we created a cysteine scanning
strategy in order to study the functional importance and the possible interactions of
MDR1 -CL strands. According to the 3 D models, M450 and KlOW may be, as their
hisP homologue A63, the closest residues in the 84 strand interface. To date, seven of the
ten planned mutants have been completed, and another one was added to the List
(KI O93C) to optirnize the experimental possibil ities of the study .
In order to perform further analysis, like the blockage of ATPase activity with a
sdfhydryl reactive molecule (e.g. maleamides), a relatively rapid screen used to pinpoint
functional substitutions is a necessity. It is obvious that blockage of the ATPase activity
is pointless in inactive mutants and that direct screening of al1 mutants by protein
purification and ATPase assays would be a laborious and time consuming procedure. The
first inquiry was to evaluate whether or not the heterologous yeast system used for mdr3
is suitable for MDRl and MDRI-CL studies. These templates had never been tested in
transformed JPYSO 1 yeast strain for FK506 resistance or mating assays.
It was demonstrated that MDRl and MDRI-CL genes are able to convey FKS06
resistance in transformed JPY20 1 cells of Saccharomyces cerevisiae (see figure 1 1). The
kinetics of growth conferred by mdr3 and MDRl are quite similar, mdr3 transformants
leading MDRl transformants by approximately one hour al1 along the assays. On the
other hand, MDRl-CL shows a significantly slower growth in presence of the dmg. Its
growth rate is 50% less than for the wild-type MDRl protein. This difference in FU06
resistance seems to be in good agreement with ATPase assays, MDRl-CL having only
60% of the MDRl WT purified protein ATPase activity 689132. In conclusion, it is
possible to monitor the activity of MDRl and MDRl-CL proteins in FK506 resistance
assays with some minor modifications. These modifications refers to a higher nurnber of
cells at the beginning and an extended time fiame for the readings in order to monitor
more accurately the exponential growth phase of MDR 1 -CL transformants.
Using these techniques, we showed that from the seven completed P4 strands
mutants in MDR1-CL, only two show a 50% or more reduction of growth in FK506
assays (see figure 12). The most severely affected one, G 1 O98C, is a substitution of the
glycine located immediately after the P4 strand in NBD2 on MDR1 -CL 3D model. This
glycine is perfectly conserved in both mdr3 NBDs and in hisP (figure 3), and may be
necessary to form the tight tum between the P4 and PS strands. The other impaired
substitution, V1094C, would be the last residue of this P4 strand before the tum. A
hydrophobic residue is found at this position in both NBDs and hisP. The only other
conserved residue inciuded in this report is G 1092C, which does not show any major
impairment in FK506 tesistance assay. It is difficult to precisely access the eventual role
of these residues since no other studies have been reported on these particular regions.
Also, the completion and the analysis of the missing mutants would be a prerequisite to
conclude the characterization and proceed to further studies.
IV.4 Final conclusions and future prospects
Even though P-gps have been extensively studied, and numerous mutations
impairing their function or specificity have been discovered, very little is known about
their mechanism of action. The enzymatic, kinetic and the exact contribution of each
domain for transport are still obscure. The most enigrnatic feature of the mechanism of
these enzymes is probably the communication between the different domains. Extending
our knowledge on the structure/fÜnction relations of P-gps is not only important in order
to facilitate the treatrnent of certain human tumors, but it is also of considerable interest as
they are part of the ABC transporter famil y, a major and ubiquitous class of proteins. In
this report, we most particularly aimed at finding regions implicated in domain/domain
interactions. It should be clear that the three projects presented here are not completed,
but provide interesting data and extensive (001s to pursue the original investigations. By
inference to previous work, the implication of the studied regions in intra-molecular
communications or/and in substrate binding seems highly possible. Answers codd corne
from two different experimental directions: physical interactions studies of oxidizing
agents on purified single or double cysteine mutants and h g resistance profile of the
mutants in mammalian cells.
1. Shustik C, Dalton W. Gros P: P-glycoprotein-mediated multidrug resistance in
tumor celis: biochemistry , c linical relevance and modulation. Mol. Aspects Med. 16: 1 -78,
1995
2. Gottesman MM, Pastan 1: Biochemistry of multidrug resistance mediated by the
multidrug transporter. Annu. Rev. Biochem. 62:385-427, 1993
3. Chan HS, DeBoer G, Thorner PS, Haddad G, Gallie BL, Ling V: Multidrug
resistance. Clhical opportunities in diagnosis and circumvention. Hematol. Oncol. Clin.
North Am. 8:383-4 10, 1994
4. Beck WT, Danks MK: Characteristics of multidrug resistance in human tumor
cells.: Molecular and Ce1 fular Biology of Mri ftidrrig Resistance in Tumor Ce Ils. New
York, Plenum, 199 1
5. Sugirnoto Y, Tsumo T: Development of multidrug resistance in rodent cell lines.:
Molecular and Cellular Bioogy of Multidrrig Resistance in Tumor Ce Ils. New York,
Plenum, 1991
6. Lemontt JF, A d a M, Gros P: Increased mdr gene expression and decreased
drug accumulation in multidnig-resistant human melanoma cells. Cancer Res. 48:6348-
53, 1988
7. Fojo A, Akiyama S, Gottesman MM, Pastan 1: Reduced drug accumulation in
multiply dmg-resistant human Ki3 carcinoma ce11 lines. Cancer Res. 453002-7, 1985
8. Biedler JL, Riehm H: Cellular resistance to actinomycin D in Chinese hamster
cells in vitro: cross-resistance, radioautographic, and cytogenetic studies. Cancer Res.
30: 1 1 74-84, 1970
9. Slovak ML, Hoeltge GA, Ganapathi R: Abnormally banded chromosomal regions
in doxombicin-resistant B 16-BL6 murine melanoma cells. Cancer Res. 46:4 1 7 1 -7, 1986
10. Grund SH, Patil SR, Shah HO, Pauw PG, Stadler JK: Correlation of unstable
multidrug cross resistance in Chinese hamster ovaq cells with a homogeneously staining
region on chromosome 1. Moi. Cell Biol. 3: 1634-47, 1983
1 1. Howell N, Belli TA, Zaczkiewicz LT, Belli JA: High-level, unstable adriamycin
resistance in a Chinese hamster mutant celi line with double minute chromosomes.
Cancer Res. 44:4023-9, I 984
12. Meyers MB, Spengler BA, Chang TD. Melera PW, Biedler JL: Gene
amplification-associated cytogenetic aberrations and protein changes in vincristine-
resistant Chinese hamster, mouse, and human cells. J. Cell Bioi. 100:588-97, 1985
13. Teeter LD, Atsumi S, Sen S, Kuo T: DNA amplification in muitidrug, cross-
resistant Chinese hamster ovary cells: molecular characterization and cytogenetic
localization of the amplified DNA. J Ceii Bioi 103: 1 159-66, 1986
14. Juliano RL, Ling V: A surface giycoprotein modulating h g permeability in
C hinese hamster ovary ce11 mutants. Biochim. Biophys. Acta 455: 1 52-62, 1 976
15. Ruetz S, Gros P: Functional expression of P-glycoproteins in secretory vesicles. J.
Biol. Chem. 269: 12277-84, 1994
16. Zaman GJ, Versantvoort CH, Smit JJ, Eijdems EW, de Haas M, Smith AJ,
Broxteman HJ, Mulder NH, de Vries EG, Baas F, et al.: Analysis of the expression of
MRP, the gene for a new putative transmembrane dmg transporter, in human multidrug
resistant h g cancer ce11 lines. Cancer Res. 53: 1 747-50, 1993
1 7. Pearce HL, Safa AR, Bach NJ, Winter MA, Cirtain MC, Beck WT: Essential
features of the P-glycoprotein pharmacophore as defined by a series of reserpine analogs
that modulate multidrug resistance. Proc. Nafl. Acad. Sci. U.S.A. 86:s 1 28-32, 1 989
18. Zamora JM, Pearce HL, Beck WT: Physical-chernical properties shared by
compounds that rnodulate multidmg resistance in human leukemic cells. Mol. Pharmacol.
33:454-62, 1988
19. Roninson 1 .B. Molecular undCellzrlar Biology of Multidrug Resistance in Tumor
Cells. New York, Plenum Press, 1991
20. Gupta RS: Genetic, biochemical, and cross-resistance studies with mutants of
Chinese hamster ovary cells resistant to the anticancer dmgs, VM-26 and VP16-2 13.
Cancer Res. 43: 1568-74, 1983
21. Tsuruo T, Iida H, Ohkochi E, Tsukagoshi S, Sakurai Y: Establishment and
properties of vincristine-resistant hurnan myelogenous leukemia K562. Gann. 74:75 1-8,
1983
22. Conter V, Beck WT: Acquisition of multiple drug resistance by CCRF-CEM cells
selected for different degrees of resistance to vincristine. Cancer Treat. Rep. 68:83 1-9,
1984
23. Borisy GG, Taylor EW: The mechanism of action of colchicine. Colchicine
binding to sea urchin eggs and the mitotic apparatus. J Cell Biol. 34535-48, 1967
24. Olmsted SB, Borisy GG: Microtubules. Annu. Rev. Biochem. 42:507-40, 1973
25. Gabbay EJ, Gner D, Fingerle RE, Reimer R, Levy R, Pearce SW, Wilson WD:
Interaction specificity of the anthracyclines with deoxyribonucleic acid. Biochenistry
152062-70, 1976
26. Di Marco A: Mechanism of action and mechanism of resistance to antineoplastic
agents that bind to DNA. Anfibiot. Chemother. 23:2 16-27, 1978
27. Yang L, Rowe TC, Liu LF: Identification of DNA topoisornerase II as an
intracellular target of antitumor epipodophyllotoxins in simian virus 40-infected monkey
cells. Cancer Res. 45:5872-6, 1985
28. Ling V, Thompson LH: Reduced penneability in CHO cells as a mechanism of
resistance to colchicine. J. Cell Physiol. 83: 1 03 - 1 6, 1 974
29. Skovsgaard T: Mechanism of cross-resistance between vincnstine and
daunorubicin in Ehrlich ascites hmor cells. Cancer Res. 38:4722-7, 1978
30. Dano K: Active outward transport of daunomycin in resistant Ehrlich ascites
tumor cells. Biochim. Biophys. Acta 323:466-83, 1973
3 1. Gros P, Croop J, Roninson 1, Varshavsky A, Housman DE: Isolation and
characterization of DNA sequences amplified in multidrug-resistant hamster cells. Proc.
Natl. Acad Sci.U.S.A. 83:337-41, 1986
32. Fojo AT, Whang-Peng J, Gottesman MM, Pastan 1: Amplification of DNA
sequences in human multidmg-resistant Ki3 carcinoma cells. Proc. Nd. Acad. Sci. U.S.A.
82:7661-5, 1985
33. Roninson IB: Detection and mapping of homologous, repeated and amplified
DNA sequences by DNA renaturation in agarose gels. Nucleic Acids Res. 115413-3 1,
1983
34. Roninson IB, Chin JE, Choi KG, Gros P, Housman DE, Fojo A, Shen DW,
Gottesman MM, Pastan 1: Isolation of human mdr DNA sequences amplified in
multidnig-resistant KB carcinoma cells. Proc. Nat!. Acad. Sci. (I. S. A. 83:4538-42, 1986
35. Roninson IB, Abelson HT, Housman DE, Howell N, Varshavsky A:
Amplification of specific DNA sequences correlates with multi-drug resistance in
Chinese hamster cells. Nature 309:626-8, 1984
36. Gros P, Croop J, Housman D: Mammalian multidmg resistance gene: complete
cDNA sequence indicates strong homology to bacterial transport proteins. Cell47:371-
80, 1986
37. Chen CJ, Chin JE, Ueda K, Clark DP, Pastan I, Gottesman MM, Roninson IB:
Intemal duplication and homology with bacterial transport proteins in the mdr 1 (P-
glycoprotein) gene from multidrug-resistant human cells. Ceil 47:38 1-9, 1986
38. Riordan JR, Deuchars K, Kartner N, Alon N, Trent J, Ling V: Amplification of P-
glycoprotein genes in multidrug-resistant mammaiian ce11 lines. Nature 3168 17-9, 1985
39. Kartner N, Evernden-Porelle D, Bradley G, Ling V: Detection of P-glycoprotein
in multidrug-resistant ce11 lines by monoclonal antibodies. Nature 316:820-3, 1985
40. Juranka PF, Zastawny RL, Ling V: P-glycoprotein: multidrug-resistance and a
superfamily of membrane- associated transport proteins. Faseb. J 3:2583-92, 1989
41. Devault A, Gros P: Two members of the mouse mdr gene farnily confer multidmg
resistance with overlapping but distinct drug specificities. Mol. Ceif Bioi. 10: 1 652-63,
1990
42. Hama M, Gros P: Cloning and structure: function analysis of the mouse mdr gene
farnily , in Gupta S, Tsuruo T (eds) : Muftidrug Resistance in Cancer Celis: Molecular,
Biochemical, Physidogical and Biological Aspects, John Wiley and Sons, 1996
43. Chin JE, Soffir Ft, Noonan KE, Choi K, Roninson 18: Structure and expression of
the human MDR (P-glycoprotein) gene farnily. Mol. Cell Biol. 9:3808-20, 1989
44. Thiebaut F, Tsuruo T, Hamada H, Gottesman MM, Pastan 1, Willingham MC:
CeHular localization of the multidrug-resistance gene product P- glycoprotein in normal
human tissues. Proc. Nutl. Acad- Sci. U.S.A. 84:7735-8, 1987
45. Croop JM, Raymond M, Haber D, Devault A, Arceci RJ, Gros P, Housman DE:
The three mouse multidrug resistance (mdr) genes are expressed in a tissue-specific
manner in nomal mouse tissues. Mol. Cell Biol. 9: 1 346-50, 1989
46. Arceci Ri, Croop JM, Horwitz SB, Housman D: The gene encoding multidrug
resistance is induced and expressed at high levels during pregnancy in the secretory
epithelium of the uterus. Proc. Nutl. Acad Sci U S A .85:4350-4, 1988
47. Georges E, Bradley G, Gariepy J, Ling V: Detection of P-glycoprotein isoforms
by gene-specific monoclonal antibodies. Proc. NatL Acad Sci. U S . A. 87: 1 52-6, 1990
48. Buschman E, Arceci RJ, Croop JM, Che M, Arias IM, Housman DE, Gros P:
mdr2 encodes P-glycoprotein expressed in the bile canalicular membrane as determined
by isoform-specific antibodies. J. Biol. Chem. 267: 18093-9, 1992
49. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter
L, Mol CA, Ottenhoff R, van der Lugt NM, van Roon MA, et al.: Homoygous disruption
of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid
Erom bile and to liver disease. Cell 7545 1-62, 1993
50. Ruetz S, Gros P: Phosphatidylcholine translocase: a physiological role for the
mdr2 gene. CeZZ 77:1071-81, 1994
5 1 . Ruetz S, Gros P: Enhancement of Mdr2-mediated phosphatidylcholine
translocation by the bile salt taurocholate. Implications for hepatic bile formation. J. Biol.
Chem. 270~25388-95, 1995
52. Safa AR, Glover CJ, Meyers MB, Biedler JL, Felsted RL: Vinblastine
photoaffinity labeling of a high molecular weight surface membrane glycoprotein specific
for multidrug-resistant cells. J. Bial. Chem. 261 :6 1 3 7-40, 1986
53. Cornwell MM, Gottesman MM, Pastan IH: Increased vinblastine binding to
membrane vesicles fiom multidrug- resistant KB cells. J Biol. Chern. 26l:792 1-8, 1986
54. Greenberger LM: Major p h o t ~ ~ n i t y drug labeling sites for iodoaryl
azidoprazosin in P-glycoprotein are within, or immediately C-terminal to, transmembrane
domains 6 and 12. J. Biol. Chern. 268: 1 14 17-25, 1993
55. Raviv Y, Potlard HB, Bmggemann EP, Pastan 1, Gottesman MM: Photosensitized
labeling of a functional multidrug transporter in living drug-resistant hunor cells. 1 Biol.
Chern. 2653975-80,1990
56. Ng WF, Sarangi F, Zastawny RL, Veinot-Drebot L, Ling V: Identification of
members of the P-glycoprotein multigene family. Mol. Cell Biol. 9: 1224-32, 1989
57. van der Bliek AM, Kooiman PM, Schneider C, Borst P: Sequence of mdr3 cDNA
encoding a human P-glycoprotein. Gene 71 :40 1 - 1 1, 1988
58. Gros P, Raymond M, Bell J, Housman D: Cloning and characterization of a
second member of the mouse mdr gene family. Mol. Cell Biol. 8:2770-8, 1988
59. Walker JE, Saraste M, Runswick MJ, Gay NJ: Distantly related sequences in the
alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requinng
enzymes and a common nucleotide binding fold. EMBO J. 1 :945-5 1, 1982
60. Story RM, Steitz TA: Structure of the recA protein-ADP complex. Nature
355:374-6, 1 992
61. Abrahams JP, Leslie AG, Lutter R., Walker JE: Structure at 2.8 A resolution of FI-
ATPase fiom bovine heart mi toc hondria. Nature 370:62 1 -8, 1 994
62. Schinkel AH, Kemp S, Dolle M, Rudenko G, Wagenaar E: N-glycosylation and
deletion mutants of the human MDRl P-glycoprotein. J Biol. Chem. 268:7474-81, 1993
63. Gottesman MM, Pastan 1: The multidnig transporter, a double-edged sword. J.
Biol. Chem. 263: 12163-6, 1988
64. Schurr E, Raymond M, Beli JC, Gros P: Characterization of the multidrug
resistance protein expressed in ce11 clones stably transfected with the mouse mdrl cDNA.
Cancer Res. 49:2729-33, 1989
65. Sharom FJ, Yu X, Chu JW, Doige CA: Characterization of the ATPase activity of
P-glycoprotein fiom multidrug-resistant Chinese hamster ovary cells. Biochem. J.
308:381-90, 1995
66. Kast C, Canfield V, Levenson R, Gros P: Transmembrane Organization Of Mouse
P-Glycoprotein Determined By Epitope Insertion and Immunofluorescence. J. Biol.
Chem. 271:9240-8, 1996
67. Kast C, Canfield V, Levenson R Gros P: Membrane topology of P-glycoprotein
as determined by epitope insertion: transmembrane organization of the N-terminal
domain of mdr3. Biochemistry 34:4402- 1 1, 1995
68. Loo TW, Clarke DM: Membrane topology of a cysteine-less mutant of human P-
glycoprotein. J. Biol. Chem. 270:843-8, 1995
69. Bibi E, Beja O: Membrane topology of multidnig resistance protein expressed in
Escherichia coli. N-terminal domain. J. Biol. Chem. 269: 199 1 0-5, 1994
70. Bruggemann EP, Germann UA, Gottesrnan MM, Pastan 1: Two different regions
of P-glycoprotein are photoaffinity- labeled by azidopine J. Biol. Chem. 264: 15483-8,
1989
71. Yoshimura A, Kuwazuru Y, Sumizawa T, Ichikawa M, Ikeda S, Uda T, Akiyama
S: Cytoplasmic orientation and two-dornain structure of the multidrug transporter, P-
glycoprotein, demonstrated with sequence-specific anti bodies. J. Biol. Chem. 264: 16282-
91,1989
72. Higgins CF, Callaghan R, Linton KJ, Rosenberg MF. Ford RC: Structure of the
multidnig resistance P-glycoprotein. Semin. Cancer Biol. 8: 1 3 5-42, 1 997
73. Rosenberg MF, Callaghan R Ford RC, Higgins CF: Structure of the multidrug
resistance P-glycoprotein to 2.5 nm resolution determined by electron microscopy and
image analy sis. J. Biol. Chem. 272: 1 0685-94, 1 997
74. Wang G, Pincheira R., Zhang JT: Dissection of drug-binding-induced
conformational changes in P- glycoprotein. Errr. J. Biochem. 255:383-90, 1998
75. Wang G, Pincheira R, Zhang M, Zhang JT: Conformational changes of P-
glycoprotein by nucleotide binding. Biochem. J. 328:897-904, 1997
76. Higgins CF: ABC transporters: from microorganisms to man. Annu. Rev. Cell
Biol. 8:67- 1 1 3, 1992
77. Ames GF: Bacterial penplasmic transport systems: structure, mechanisrn, and
evolution. Annu. Rev. Biochern. 55397-425, 1986
78. Gilson E, Higgins CF, Hofnung M, Ferro-Luui Ames G, Nikaido H: Extensive
homology between membrane-associated components of histidine and maltose transport
systems of Salmonella typhimurium and Escherichia coli. J Biol. Chem. 2Sï:W 15-8,
1982
79. Higgins CF, Haag PD, Nikaido K, Ardeshir F, Garcia G, Ames GF: Complete
nucleotide sequence and identification of membrane components of the histidine transport
operon of S. typhimwium. Nature 298:733-7, 1982
80. Surin BP, Rosenberg H, Cox GB: Phosphate-specific transport system of
Eschenchia coli: nucleotide sequence and gene-polypeptide relationships. J Bacteriol.
161: 189-98, 1985
8 1. Blattner FR Plunkett G, 3rd, Bloch CA, Pema NT, Burland V, Riley M, Collado-
Vides J, Glasner JD, Rode CK, Mayhew GF, Gregor J, Davis NW, Kirkpatrick HA,
Goeden MA, Rose DJ, Mau B, Shao Y: The complete genome sequence of Escherichia
coli K- 1 2 .Science 277: 1453-74, 1 997
82. Ames GF, Lecar H: ATP-dependent bacterial transporters and cystic fibrosis:
analogy between channels and transporters. FASEB J. 6:2660-6, 1992
83. Riordan JR, Romens JM, Kerem B, Alon N, Romahel R, Grzelczak 2,
Zielenski J, Lok S, Plavsic N, Chou JL, et al.: Identification of the cystic fibrosis gene:
cloning and characterization of complementary DNA. Science 245: 1066-73, 1989
84. Cole SP, Bhardwaj G, Gerlach .JH. Mackie JE, Grant CE, Almquist KC, Stewart
AJ, Kurz EU. Duncan AM, Deeley RG: Overexpression of a transporter gene in a
multidrug-resistant human lung cancer ce11 line. Science 258: 1 650-4, 1992
85. Foote SJ, Thompson JK, Cowman AF, Kemp DJ: Amplification of the multidrug
resistance gene in some chloroquine-resistant isolates of P. falcipmm. Cell57:92 1-30,
1989
86. Kamijo K, Taketani S, Yokota S, Osumi T, Hashimoto T: The 70-kDa
peroxisomal membrane protein is a member of the Mdr (P- g1ycoprotein)-related ATP-
binding protein superfamil y. J. Biol. Chem. 26S:4S 34-40, 1 990
87. Mosser J, Douar AM, Sarde CO, Kioschis P, Fei1 R, Moser H, Poustka AM,
Mandel JL, Aubourg P: Putative X-linked adrenoleukodystrophy gene shares unexpected
homology with ABC transporters. Nature 361 :726-30. 1993
88. Kuchler K, Sterne RE, Thomer J: Saccharomyces cerevisiae STE6 gene product: a
novel pathway for protein export in eukaryotic cells. EMBO J. 8:3973-84, 1989
89. Michaelis S, Herskowitz 1: The a-factor pheromone of Saccharomyces cerevisiae
is essential for mating. Mol. Cell Biol. 8: 1309- 18, 1988
90. Anderegg RJ, Betz R, Carr SA, Crabb JW, Duntze W: Structure of
Saccharomyces cerevisiae mating hormone a-factor. Identification of S-farnesyl cysteine
as a structural component. J. Biol. Chem. 263: 1 8236.40, 1988
91. Raymond M, Gros P, Whiteway M. Thomas DY: Functional complementation of
yeast ste6 by a mammalian multidrug resistance mdr gene. Science 256:232-4, 1992
92. Raymond M, Ruetz S, Thomas DY, Gros P: Functional expression of P-
glycoprotein in Saccharomyces cerevisiae confers cellular resistance to the
irnmunosuppressive and antifungal agent FK5 20. Mol. Cell. Biol. 14:277-86, 1 994
93. Beaudet L, Gros P: Functional dissection of P-glycoprotein nucleotide-binding
domains in chimenc and mutant proteins. Modulation of drug resistance profiles. J. Biol.
Chem. 270: 17 159-70, 1995
94. Hanna M, Brault M, Kwan T, Kast C. Gros P: Mutagenesis of trammembrane
domain 1 1 of P-glycoprotein by alanine scanning. Biochernistry 353625-35, 1996
95. Kwan T, Gros P: Mutational analysis of the P-glycoprotein first intracellular loop
aod flanking transmembrane domains. Biochernistry 37:33 37-50, 1998
96. Tommasini R, Evers R, Vogt E, Mornet C, Zaman GJ, Schinkel AH, Borst P,
Martinoia E: The human rnultidrug resistance-associated protein fûnctionally
complements the yeast cadmium resistance factor 1. Proc. Natf. Acad Sci US-A.
93:6743-8, 1996
97. Shani N, Sapag A, Valle D: Characterization and analysis of conserved motifs in a
peroxisomal ATP- binding cassette transporter. J. Biol. Chem. 271:8725-30, 1996
98. Mourez M, Hofhung M, Dassa E: Subunit interactions in ABC transporters: a
conserved sequence in hydrophobie membrane proteins of periplasmic permeases defines
an important site of interaction with the ATPase subunits. EMBO J. 16:3066-77, 1997
99. Dassa E: Sequence-function relationships in MalG, an inner membrane protein
fiom the maltose transport system in Escherichia coli. Mol. Microbiol. 7:3947, 1 993
100. Buschman E, Gros P: Functional analysis ofchimeric genes obtained by
exchanging homologous domains of the mouse mdrl and mdr2 genes. Moi. CeII Biof.
1 l:S95-603, 199 1
101. Dhir R, Gros P: Functional anaIysis of chimeric proteins constructed by
exchanging homologous domains of two P-glycoproteins confemng distinct drug
resistance profiles. Biochemistry 31:6 103- 10, 1992
102. Zhang X, Collins KI, Greenberger LM: Functional evidence that transmembrane
12 and the loop between transmembrane 1 1 and 12 form part of the drug-binding domain
in P-glycoprotein encoded by MDR 1. J . Bioi. Chem. 2703544 1-8, 1995
103. Devine SE, Ling V, Melera PW: Arnino acid substitutions in the sixth
transmembrane domain of P-glycoprotein alter multidrug resistance. Proc. Natl. Acad
Sei U S A . 89:4564-8, 1992
104. Loo TW, Clarke DM: Mutations to amino acids located in predicted
transmembrane segment 6 (TM6) modulate the activity and substrate specificity of human
P-glycoprotein. Biochemistry 33: 14049-57, 1994
105. Gros P, Dhir R, Croop J, Talbot F: A single amino acid substitution strongly
modulates the activity and substrate specificity of the mouse mdrl and mdr3 dmg efflux
pumps. Proc. Natl. Acad Sci U.S.A. 88:7289-93, 1991
106. Choi KH, Chen CJ, Kriegler M, Roninson IB: An altered pattern of cross-
resistance in multidmg-resistant human cells results fiom spontaneous mutations in the
mdr 1 (P-glycoprotein) gene. Cell53:5 1 9-29, 1 988
107. Safa AR, Stem RK, Choi K, Agresti M, Tamai 1, Mehta ND, Roninson IB:
Molecular basis of preferential resistance to colchicine in multidmg-resistant human cells
conferred by Gly- 1 85----Val- 1 85 substitution in P-glycoprotein. Proc. NutZ. Acad Sci
U.S.A. 87:7225-9, t 990
1 08. Pascaud C, Garrigos M, Orlowski S: Multidrug resistance transporter P-
glycoprotein has distinct but interacting binding sites for cytotoxic dnigs and reversing
agents. Biochem. J. 333:3 5 1-8, 1998
109. Hafkemeyer P, Dey S, Ambudkar SV, Hrycyna CA, Pastan 1, Gottesman MM:
Contribution to substrate specificity and transport of nonconserved residues in
transmembrane domain 1 2 of human P-glycoprotein. Biochemistry 37: 1 6400-9, 1998
1 10. Loo TW, Clarke DM: Functional consequences of glycine mutations in the
predicted cytoplasrnic loops of P-glycoprotein. J Biol. Chem. 269:7243-8, 1994
1 1 1. Rao US: Mutation of glycine 185 to valine alters the ATPase function of the
human P-glycoprotein expressed in Sf9 cells. J. Biol. Chem. 270:6686-90, 1995
112. Muller M, Bakos E, Welker E, Varadi A, Gennann UA, Gottesman MM, Morse
BS, Roninson IB, Sarkadi B: Altered drug-stimulated ATPase activity in mutants of the
human multidmg resistance protein. J. Biol. Chem. 271: 1877-83, 1996
113. Dassa E, Muir S: Membrane topology of MalG, an imer membrane protein fiom
the maltose transport system of Escherichia coli. MOI. Microbiol. 7:29-3 8, 1 993
1 14. Shani N, Watkins PA, Valle D: PXA 1, a possible Saccharomyces cerevisiae
ortholog of the human adrenoleukodystrophy gene. Proc. N d Acad Sci. (I.S.A.
92:6O 12-6, 1995
1 15. Shani N, Valle D: A Saccharomyces cerevisiae homolog of the human
adrenoleukodystrophy transporter is a heterodimer of two half ATP-binding cassette
transporters. Proc. Nat!. Acnd Sci U.S.A. 93: 1 190 1 -6, 1996
116. Shani N, Valle D: Peroxisomal ABC transporters. Methods Enrymol. 292:753-76,
1998
117. Cartier N, Sarde CO, Douar AM. Mosser J, Mandel JL, Aubourg P: Abnormal
messenger RNA expression and a missense mutation in patients with X-linked
adrenoleukodystrophy. Hum. Mol. Genet. 2: 1949-5 1, 1993
118. Watkins PA, Gould SJ, Smith MA, Braiterman LT, Wei HM, Kok F, Moser AB,
Moser HW, Smith KD: Altered expression of ALDP in X-linked adrenoleukodystrophy.
Am. J. Hum. Genet. 57:292-30 1, 1995
119. Ligtenkrg MJ, Kemp S, Sarde CO, van Geel BM, Kleijer WJ, Barth PG, Mandel
JL, van Oost BA, Bolhuis PA: Spectrum of mutations in the gene encoding the
adrenoleukodystrophy protein. Am. J. Hum. Genet. 56:44-50, 1 995
120. Xie J, D m ML, Ma J, Davis PB: Intracellular loop between transmembrane
segments N and V of cystic fibrosis transmembrane conductance regulator is involved in
regdation of chloride channel conductance state. J. Biol. Chem. 270:28084-9 1 , 1 995
121. Doige CA, Yu X, Sharom FJ: ATPase activity of partially purified P-glycoprotein
from multidnig- resistant Chinese hamster ovary cells. Biochim. i3iophy.s. Acta 1109: 149-
60,1992
122. Sharom FJ, Yu X, Doige CA: Functional reconstitution of dmg transport and
ATPase activity in proteoliposomes containing partially purified P-glycoprotein. J. Biol.
Chem. 268:24 197-202, 1993
123. Shapiro AB, Ling V: ATPase activity of purified and reconstituted P-glycoprotein
fiom Chinese hamster ovary cells. J. Biol. Chem. 269:3745-54, 1994
124. Urbatsch IL, al-Shawi MK, Senior AE: Characterization of the ATPase activity of
puri fied Chinese hamster P- gl y coprotein. Biochemistry 33: 7069.76, 1 994
125. Senior AE, al-Shawi MK, Urbatsch IL: The catalytic cycle of P-glycoprotein.
FEBS Lett. 377:285-9, 1995
126. Doige CA, Yu X, Sharom FJ: The effects of lipids and detergents on ATPase-
active P-glycoprotein. Biochim. Biophys. Acta 1146:65-72, 1993
127. Romsicki Y, Sharom FJ: The ATPase and ATP-binding fùnctions of P-
glycoprotein--modulation by interaction with defined phospholipids. Eur. J. Biochem.
256: 1 70-8, 1998
128. Urbatsch IL, Senior AE: Effects of lipids on ATPase activity of purified Chinese
hamster P- glycoprotein. Ar& Biochem. Biophys. 3 16: 1 3 5-40, 1995
129. Senior AE: Catalytic mechanism of P-glycoprotein. Acta Physiol. Scand Suppl.
643:2 13-8, 1998
130. Urbatsch IL, Sankaran B, Bhagat S, Senior AE: Both P-glycoprotein nucleotide-
binding sites are catalytically active. J. Biol. Chem. 27O:26956-6 1 , 1995
13 1. Urbatsch IL, Beaudet L, Camer 1, Gros P: Mutations in either nucleotide-binding
site of P-glycoprotein (Mdr3) prevent vanadate trapping of nucleotide at both sites.
Biochemistry 37:4592-602, 1998
132. Loo TW, Clarke DM: Covalent modification of human P-glycoprotein mutants
containing a single cysteine in either nucleotide-binding fold abolishes drug-stimulated
ATPase activity . J . Biol. Chem. 270:22957-6 1, 1 995
13 3. al-Shawi MK, Urbatsch IL, Senior AE: Covalent inhibitors of P-glycoprotein
ATPase activity . J. Biol. Chem. 269: 8986-92, 1 994
134. Urbatsch IL, Sankaran B, Weber J, Senior AE: P-glycoprotein is stably inhibited
by vanadate-induced trapping of nucleotide at a single catalytic site. J. Biol. Chem.
270: 19383-90, 1995
135. Yoshida M, Amano T: A common topology of proteins catalyzing ATP-triggered
reactions. FEBS Lett. 359: 1-5, 1 995
136. Arnano T, Tozawa K, Yoshida M, Murakami H: Spatial precision of a catalytic
carboxylate of F 1-ATPase beta subunit probed by introducing different carboxylate-
containing side chahs. FEBS Lett. 348:93-8, 1 994
137. Ohtsubo My Yoshida M, Ohta S, Kagawa Y, Yohda M, Date T: In vitro mutated
beta subunits nom the F 1 -ATPase of the thermophilic bacterium, PS3, containhg
glutamine in place of glutamic acid in positions 190 or 20 1 assembles with the alpha and
gamma subunits to produce inactive complexes. Biochem. Biophys. Res. Commun.
146:705-10, 1987
138. Hyde SC, Emsley P. Hartshom MJ, Mimmack MM, Gileadi U, Pearce SR,
Gallagher MP, Gill DR, Hubbard RE, Higgins CF: Structural mode1 of ATP-binding
proteins associated with cystic fibrosis, multidrug resistance and bacterid transport.
Nature 346:362-5, 1990
139. Stein A, Hunke S, Schneider E: Mutational analysis eliminates Glu64 and Glu94
as candidates for 'catalytic carboxylate' in the bactenal ATP-binding-cassette protein
MaiK. F E N Lett. 413:2 1 1-4, 1997
140. Kerppola RE, Shyamala VK, Klebba P, Ames GF: The membrane-bound proteins
of periplasmic permeases forrn a complex. Identification of the histidine permease
HisQMP complex. J Biol. Chem. 266:9857-65, 199 1
14 1. Liu PQ, Ames GF: In vitro disassembly and reassembly of an ABC transporter,
the histidine permease. Proc. Natl. Acad. Sci U. S A. 953495-500, 1998
142. Liu CE, Liu PQ, Ames GFL: Characterization of the adenosine triphosphatase
activity of the penplasmic histidine permease, a trafic ATPase (ABC transporter). J.
Biol. Chem. 272:S 1883-9 1, 1997
143. Nikaido K, Liu PQ, Arnes GF: Purification and characterization of HisP, the ATP-
binding subunit of a t r a c ATPase (ABC transporter), the histidine permease of
Salmonella typhimurium. Solubility, dimerization, and ATPase activity. J. Bioi. Chem.
272:27745-52, 1997
144. Hung LW, Wang IX, Nikaido K, Liu PQ, Ames GF, Kim SH: Crystal structure of
the ATP-binding subunit of an ABC transporter. M u r e 396:703-7, 1998
145. Frillingos S, Sahin-Toth M, Wu J, Kaback HR: Cys-scanning mutagenesis: a
novel approach to structure function relationships in polytopic membrane proteins.
FASEB J. 12: 1281-99, 1998
146. Frillingos S, Sun J, Gonzalez A. Kaback HR: Cysteine-scanning mutagenesis of
helix II and flanking hydrophilic domains in the lactose permease of Eschenchia coli.
Biochemistry 36:269-73, 1997
147. Fnllingos S, Gonzalez A, Kaback HR: Cysteine-scanning mutagenesis of helix IV
and the adjoining ioops in the lactose permease of Escherichia coli: Glu126 and Arg144
are essential. off. Biochernistry 36: 14284-90, 1997
148. Frillingos S, Kaback HR: Cysteine-scaming mutagenesis of helix VI and the
flanking hydrophilic domains on the lactose permease of Escherichia coli. Biochernisny
355333-8, 1996
149. He MM, Sun J, Kaback HR: Cysteine-scanning mutagenesis of transmembrane
domain XII and the flanking periplasmic loop in the lactose permease of Escherichia coli.
Biochemistry 35: 1 2909- 14, 1 996
150. Voss J, Sun J, Venkatesan P, Kaback HR: Suifhydryl oxidation of mutants with
cysteine in place of acidic residues in the lactose permease. Biochemistry 37:8 191-6, 1998
15 1. Sun J, Kaback HR: Proximity of periplasmic loops in the lactose permease of
Escherichia coli detennined by site-directed cross-linking. Biochemishy 36: 1 1959-65,
1997
152. Wu J, Hardy D, Kaback HR: Site-directed chemical cross-linking demonstrates
that helix IV is close to helices VI1 and XI in the lactose permease. Biochemistry
38: 17 15-20, 1999
1 53. Wu J, Hardy D, Kaback HR: Tilting of helix I and ligand-induced changes in the
lactose pemease determined by site-directed chemical cross-linking in situ. Biochemishy
37: 15785-90, 1998
1 54. W u J, Hardy D, Kabac k HR: Transmembrane helix tilting and ligand-induced
conformational changes in the lactose permease determined by site-directed chemical
crosslinking in situ. J. Mol. Biol. 282:959-67, 1 998
155. W u J, Kaback HR: Helix proxirnity and ligand-induced conformational changes in
the lactose permease of Eschenchia coli determined by site-directed chemical
crosslinking. J. Mol. Biof. 270:285-93, 1997
156. Sun J, Kemp CR, Kaback HR: Ligand-induced changes in periplasmic loops in the
lactose permease of Escherichia coli. Biochemistry 37: 8020-6, 1 998
157. Altenbach C, Marti T, Khorana HG, Hubbell WL: Transmembrane protein
structure: spin labeling of bacteriorhodopsin mutants. Science 248: 1088-92, 1990
158. Akabas MH, Stauffer DA, Xu M, Karlin A: Acetylcholine receptor channel
structure probed in cysteine- substitution mutants. Science 258:307- 10, 1992
159. Ogilvie 1, Aggeler R, Capaldi RA: Cross-linking of the delta subunit to one of the
three alpha subunits has no effect on functioning, as expected if delta is a part of the stator
that links the F1 and FO parts of the Escherichia coli ATP synthase. J. Biol. Chem.
272: 16652-6, 1997
160. Spannagel C, Vaillier J, Chaignepain S, Velours J: Topography of the yeast ATP
synthase FO sector by using cysteine substitution mutants. Cross-linkings between
subunits 4,6, and f. Biochemistry 37:6 1 5-2 1. 1998
16 1. Rice WJ, Green NM, Mademan DH: Site-directed disulfide mapping of helices
M4 and M6 in the Cd+ binding domain of SERCAla, the Ca2+ ATPase of fast twitch
skeletal muscle sarcoplasmic reticulum. J. Biol. Chem. 272:3 141 2-9, 1997
1 62. Maniatis T, Fritsch EF. Sambrook J: Molecular cloning, a laboratory manual
(second edition), Cold Spring Harbor Laboratory Press, 1989
163. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Stnihl K:
Current Protocois in Mobcular Biology,(Greene). Cambridge, MA, Wiley, 1990
164. McGrath JP, Varshavsky A: The yeast STE6 gene encodes a homologue of the
mammalian multidrug resistance P-glyco protein. Nature 340:400-4, 1 989
165. Sherman F, Fink GR, Hicks JB: Methods in Yeast Genefics. New York, Cold
S p k g Harbor Laboratory, 1982
166. Ito H, Fukuda Y, Murata K, Kimura A: Transformation of intact yeast cells treated
with alkali cations. J. Bacteriol. 153: 163-8, 1983
167. Beaudet L, Gros P: Mutational analysis of P-glycoprotein in yeast Saccharomyces
cerevisiae. Methods Enzymol. 292:4 1 4-27, 1 998
168. Laemmli UK: Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Narure 227:680-5, 1 970
169. Cross F, Hartwell LH, Jackson C, Konopka IB: Conjugation in Saccharomyces
cerevisiae. Annu Rev. Cefl Biol. 41429-57, 1988
170. Sprague GF, Jr.: Assay of yeast mating reaction. Methodr Emymol. 194~77-93,
1991
17 1. Beaudet L, Urbatsch IL, Gros P: High-level expression of mouse Mùr3 P-
glycoprotein in yeast Pichia pastoris and characterization of ATPase activity. Methods
Enqmol. 292:397-413, 1998
172. Perlin DS, Harris SL, Seto-Young D, Haber JE: Defective H(+)-ATPase of
hygromycin B-resistant pma 1 mutants fromSaccharomyces cerevisiae. J. Biol. Chem.
264:2 1857-64, 1989
173. Van Veldhoven PP, Mannaerts GP: Inorganic and organic phosphate
measurements in the nanomolar range. Anal. Biochem. 161 :45-8, 1987
174. Sieg K, Kun J, PohlI, Scherf A, Muller-Hill B: A versatile phage lambda
expression vector system for cloning in Escherichia coli. Gene %:26 1-70, 1989
175. Nagai K, Thogenen HC: Synthesis and sequence-specific proteolysis of hybrid
proteins produced in Escherichia coli. Merhods EnzymoZ. l S : 4 6 1-8 1, 1987
176. Nagai K, Thogersen HC: Generation of beta-globin by sequence-specific
proteolysis of a hybnd protein produced in Escherichia coli. Nature 309:8 10-2, 1984
177. He M, Jin L, Austen B: Specificity of factor Xa in the cleavage of fusion proteins.
J. Protein Chem. 129-5, 1993
178. Holland IB, K ~ M Y B, Steipe B, Pluckthun A: Secretion of heterologous proteins
in Escherichia coli. Methods Enzymol. 182: 132-43, 1990
1 79. Wearne S J: Factor Xa cleavage of fusion protehs. Elimination of non-specific
cleavage by reversible acylation- FEBS Left. 263:23-6, 1990
180. Dassa E, Hofhung M: Sequence of gene malG in E. coli K12: homologies
between integral membrane components from binding protein-dependent transport
systems. EMBO J. 4:2287-93, 1985
18 1. Liu PQ, Liu CE, Ames GF: Modulation of ATPase activity by physical
disengagement of the ATP- binding domains of an ABC transporter, the histidine
permease. J. Bioi. Chem. 274: 183 10-8, 1999
1 82. Lemer-Mamiarosh N, Khursheed G, Urbatsch IL, Gros P, Senior AE: Large-scale
purification of detergent-soluble P-glycoprotein from Pichia pastoris cells and
charactensation of nucleotide-binding properties of wild-type, Walker A, and Waiker B
mutant proteins. In press , 1999
183. Koster W, Bohm B: Point mutations in two conserved glycine residues within the
integral membrane protein FhuB affect iron(II1) hydroxarnate transport. Mol. Gen. Genet.
232:399-407, 1 992
184. Sahin-Toth M, Dunten RL, Kaback HR: Design of a membrane protein for site-
specific proteolysis: properties of engineered factor Xa protease sites in the lactose
permease of Eschenchia coli. Biochemistry 34: 1 107- 12, 1 995
185. van Helvoort A, Smith A J, Sprong H, Fritzsche 1, Schinkel A H, Borst P, van
Meer G: MDRl P-glycoprotein is a lipid translocase of broad specificity, while MDR3 P-
glycoprotein specifically translocates phosphatidy lcholine. Cell87507- 17, 1996
186. Reiser H, Coligan J, Palmer E. Benacerraf B. Rock K L: Cloning and expression
of a cDNA for the T-cell-activating protein TAP. Proc. Natl. Acad Sci. W. S.A. 85:2255-9,
1988