Henrik Hasman hhas@food.dtu.dk +45 35 88 63 47

Senior scientist Henrik Hasman, National Food Institute-DTU

Staphylococcus aureus Protein A (spa) Typing

Typing method for S. aureus• Gold standard - Phage typing and PFGE

– Phage and Band based – Labourious: 2-6 days– Analysis is subjective and can give non-typable results– Communication of data is problematic

• DNA sequence-based methods– Standardized protocol: 1-2 days– Analysis is unambiguous– Sequence data can easily be transferred – Eg. MLST, coa, spa successfully used for S. aureus

• MLST is not suitable for routine surveillance of MRSA– High cost and access to a high-throughput DNA sequencing

facility

The discriminative power of PFGE is generally higher than most DThe discriminative power of PFGE is generally higher than most DNANA--based methodsbased methods

Protein A (spa) in S. aureus

• 2150bp • Surface protein

– Virulence factor• Binds to IgG via Fc-binding domain

– Reduce phagocytosis– X-region-variable number of repeats

– Highly polymorphic» Deletion and duplication of repeats, and point mutations

What is a repeat?

• Multiple copies of the same nucleotide sequence– Tandem vs. interspersed– Tandem:

•• -------------------- HENRIKHeNRIKHEnRIKHeNRIK---------------

– Interspersed

spontaneous point mutations, loss and/or gain of repeats

Variations in the number of repeatsDNA polymerase slippage and various recombination events

Variations in individual repeats are a result of mutagenesis

298 repeats known today (April 19. 2009) 21-30nt (encode triplet codon)Repeats are assigned an numerical code (in Ridom/Bionummerics)

spa type is deduced from the sequence and order of specific repeats

Region X

SpaSpa--typingtyping of of S. aureusS. aureus

GAGGAAGACAATAACAAGCCTGGTGAGGAAGACAATAACAAGCCTGGT

r04r04

AAAGAAGACAACAACAAACCTGGCAAAGAAGACAACAACAAACCTGGC

r04r04

r20r20

r20r20 r17r17 r20r20 r34r34SLSL SRSR

PCR and PCR and sequencingsequencing

24 24 ntnt repeatsrepeats (21 to 30 (21 to 30 ntnt))

r04r20r17r20r34 = t2906r04r20r17r20r34 = t2906

TAYATGTCGTTAYATGTCGTRCAMCAAAARCAMCAAAA

The SPA principle

How to translate sequence into SPA type?• Manually (NOT recomended)

– Identify SL and SR – Identify repeats– Compare to list of all known repeat sequences

• Computer-based assignment– At least two software solutions exists (Ridom and Bionumerics) – Both are quiet expensive (3000+ Euros), but you might already have

Bionumerics installed. Then the spa module is a free add-on.

• Or you might find a collaborating institute or hospital who has one of these programs installed. Otherwise contact your CRL (me) for help.

Bionumerics v4.61Bionumerics v4.61

Examples of related SPA types

t034 r08r16r02r25r02r25r34 r24r25t571 r08r16r02r25r02r25r34 r25t011 r08r16r02r25 r34 r24r25t108 r08r16r02r25 r24r25t1255 r08r16 r34 r24r25t1793 r08r16r02r25r02r25r34r24r24r25t2876 r08r16r02r25r02r25r 24r25

t1333 r15r12r16r34 r02r25r17r24 >8

121211

Geneticevents

t899 r07r16 r23r02r34 >5

MLST

Examples of pittfalls in relating SPA types

t528 r04

t524 r04r17

t529 r04r34

6,72,12,43,49,67,59 ST151 CC151

18,1,1,1,1,5,3 ST71 CC97

6,72,12,43,49,67,59 ST151 CC151

SPA typing vs MLST typing

• SPA typing has in general higher discriminative power than MLST and lower discriminative power than PFGE!

t011t011t034t034t108t108t571t571t1255t1255t1793t1793t2876t2876

ST398ST398ST804ST1067ST752ST1232ST621

CC398CC398

- This means that many SPA types can belong to the same MLST type (also called Sequence Type – ST).

- Furthermore, closely related Sequence Types can be organized into so-called Clonal Complexes (CC’s).

SPA typing vs MLST typing

• In far the most cases, a SPA type will always belong to a certain Sequence Type.

• However, a few deviations from this rule exists! The SPA type t899 has been shown to belong to both ST9 and ST398.

QUESTIONS???AFTER THE BREAK

The magical world of MLST typing….

Henrik Hasman hhas@food.dtu.dk +45 35 88 63 47

Senior scientist Henrik Hasman, National Food Institute-DTU

Multi Locus Sequence Typing

(MLST)

CC398CC398

S. aureusS. aureus isolates can in most cases be allocated isolates can in most cases be allocated into Clonal Complexes based on their Sequence type into Clonal Complexes based on their Sequence type (at least human isolates(at least human isolates……).).

MLST….S(equence) T(ype)….C(lonal) C(omplex)????

• MLST is performed to obtain the Sequence Type (ST)

• The ST can often be associated with certain CC’s

• If not, they are called “Singletons”

• S. aureus has 10-15 major (human) CC’s

• Each CC has a ST as founder and many ST’s as members

• MLST is performed by sequencing 7 “household genes”

• These are selected based on their “molecular clock”

• MLST can not substitute PFGE as they have different molecular clocks.

Genes which are sequenced in the MLST

• arc (Carbamate kinase) • aro (Shikimate dehydrogenase) • glp (Glycerol kinase) • gmk (Guanylate kinase) • pta (Phosphate acetyltransferase) • tpi (Triosephosphate isomerase) • yqi (Acetyle coenzyme A acetyltransferase)

The MLST principle

S. aureus MRSA252 BX5718562902619 bp

Primer 1797 (100.0%)

Primer 1798 (100.0%)

Primer 1799 (100.0%)

Primer 1800 (95.7%)

Primer 1801 (100.0%)

Primer 1802 (95.7%)

Primer 1803 (95.0%)

Primer 1804 (100.0%)

Primer 1805 (100.0%)

Primer 1806 (100.0%)

Primer 1807 (95.7%)

Primer 1808 (100.0%)

Primer 1809 (100.0%)

Primer 1810 (100.0%)

arcCarcC

aroEaroE

glpFglpF

gmkgmk

ptapta

tpitpi

yqiLyqiL

Primers and PCR conditions

http://http://saureus.mlst.net/misc/info.aspsaureus.mlst.net/misc/info.asp

The MLST principleMLST allele sizes:

Gene SizearcC: 456 bparoE: 456 bpglpF: 465 bpgmk: 429 bppta: 474 bptpi: 402 bpyqiL: 516 bp

How many different alleles?

• Gene Number of Alleles• arcC: 109• aroE: 151• glpF: 118• gmk: 84• pta: 112• tpi: 117• yqiL: 108

The MLST principleA A T C A A T C G C A T T T T A A C T G A A A T G A A T A G T G A T A G A A C T G T A G G C A C A A T C G T T A C A C G T G T

A A T C A A T C G C A T T T T A A C T G A A A T G A A T A G T G A T A G A A C T G T A G G C A C A A T C G T T A C A C G T G T127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189

3833

0

FragmentMRSA- 9B-1797_1798- 1797

The MLST principle

The MLST principle Fragment with required length!Fragment with required length!

Delete/trimDelete/trim

MLST Databases

http://http://saureus.mlst.netsaureus.mlst.net//

MLST Databases

MLST Databases

MLST Databases

MLST Databases

MLST Databases

MLST profile:

Gene AllellearcC: 108aroE: 13glpF: 1gmk: 1pta: 12tpi: 11yqiL: 13

Finding the Sequence Type (ST):

Finding the Sequence Type (ST):

Finding the Sequence Type (ST):

MLST – the fast version….

CLCbioCLCbio DNA workbench + MLST moduleDNA workbench + MLST module

DragDrag’’nn Drop sequencesDrop sequences

ResultsResults

Costs: 1500Costs: 1500--3000 Euros

3000 Euros

http://http://eburst.mlst.neteburst.mlst.net//

Requires Java running on the computerRequires Java running on the computer

arcC

aroE

CC5CC5CC8CC8

CC398CC398

Known members of Clonal Complex 398

• ST398 (founder)• ST804• ST1067• ST752• ST1232• ST621• ST753• ST291• ST813• ST1066• ST1277• ST1112

Thank you for your attention

Questions and remarks?