St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ...

12
St. Titus Parish 3000 KEENWOOD ROAD, EAST NORRITON, PA 19403 PARISH PHONE: 610-279-4990 FAX: 610-279-8640 WWW.STTITUS.ORG EMAIL: STTITUS@STTITUS. ORG PASTOR: REVEREND LEONARD A. LEWANDOWSKI DEACON: CLAUDE GRANESE June 21, 2020 PUBLIC MASS SCHEDULE Daily Mass Mon, Tues, Fri, Sat 8:45am Wednesday No Mass Thurs 6:30pm NO 4:30pm Saturday Vigil Sunday Mass 10:00am SACRAMENT OF RECONCILIATION Saturday afternoons 3:30-4:00pm or by appointment. SACRAMENT OF BAPTISM Second Sunday of each month at 12:15pm. Fourth Sunday of month during 11:00am Mass. Baptisms are not performed on holidays. Parents presenting their first child for baptism are required to attend Pre-Jordan class. SACRAMENT OF MARRIAGE Couples must make arrangements at least six months in advance of the requested date. Pre Cana participation is required. ANOINTING OF THE SICK Catholics who are seriously ill or weakened by old age are encouraged to request this Sacrament. Those entering the hospital for surgery are invited to receive this sacrament prior to admission. PARISH OFFICE HOURS Monday Friday, 9:00am4:00pm Evening hours suspended until further notice PARISH STAFF BUSINESS MANAGER Mrs. Maureen Lewis: 610-279-4990 [email protected] COORDINATORS OF RELIGIOUS EDUCATION Mrs. Maureen Lewis & Mrs. Georgeanna Kratz 610-279-4990 [email protected]; [email protected] CHOIR & MUSIC DIRECTOR Mr. Bob Leso: 856-478-4137 [email protected] BULLETIN EDITOR Mrs. Maureen Lewis 610-279-4990 [email protected] HOLY ROSARY REGIONAL SCHOOL PRINCIPAL Mrs. Mary Ann Gilman 610-825-0160

Transcript of St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ...

Page 1: St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ P«ÊÄ : 610-279-4990 F ø: 610-279-8640 óóó.Ýãã®ãçÝ.ÊÙ Eà ®½: Ýãã®ãçÝ

St. Titus Parish 3000 KEENWOOD ROAD, EAST NORRITON, PA 19403 PARISH PHONE: 610-279-4990 FAX: 610-279-8640 WWW.STTITUS.ORG EMAIL: [email protected] PASTOR: REVEREND LEONARD A. LEWANDOWSKI DEACON: CLAUDE GRANESE

June 21, 2020

PUBLIC MASS SCHEDULE Daily Mass Mon, Tues, Fri, Sat 8:45am Wednesday No Mass Thurs 6:30pm NO 4:30pm Saturday Vigil Sunday Mass 10:00am SACRAMENT OF RECONCILIATION Saturday afternoons 3:30-4:00pm or by appointment. SACRAMENT OF BAPTISM Second Sunday of each month at 12:15pm. Fourth Sunday of month during 11:00am Mass. Baptisms are not performed on holidays.

Parents presenting their first child for baptism are required to attend

Pre-Jordan class. SACRAMENT OF MARRIAGE Couples must make arrangements at least six months in advance of the requested date.

Pre Cana participation is required. ANOINTING OF THE SICK Catholics who are seriously ill or weakened by old age are encouraged to request this Sacrament. Those entering the hospital for surgery are invited to receive this sacrament prior to admission.

PARISH OFFICE HOURS Monday – Friday, 9:00am—4:00pm

Evening hours suspended until further notice

PARISH STAFF BUSINESS MANAGER

Mrs. Maureen Lewis: 610-279-4990 [email protected]

COORDINATORS OF RELIGIOUS EDUCATION Mrs. Maureen Lewis & Mrs. Georgeanna Kratz

610-279-4990 [email protected]; [email protected]

CHOIR & MUSIC DIRECTOR Mr. Bob Leso: 856-478-4137

[email protected]

BULLETIN EDITOR Mrs. Maureen Lewis

610-279-4990 [email protected]

HOLY ROSARY REGIONAL SCHOOL PRINCIPAL

Mrs. Mary Ann Gilman 610-825-0160

Page 2: St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ P«ÊÄ : 610-279-4990 F ø: 610-279-8640 óóó.Ýãã®ãçÝ.ÊÙ Eà ®½: Ýãã®ãçÝ

2 12th Sunday in Ordinary Time

LITURGICAL NOTES: ALL PUBLIC MASSES RESUME AS FOLLOWS:

NO 4:30pm Saturday Vigil Sunday 10:00am, Beginning June 14 Daily Masses, Beginning , June 8th: Mon, Tues, Fri, Sat., 8:45am Thurs, 6:30pm

#095

From the Pen of Father Len

Dear Parishioners and Friends of St. Titus Parish,

Praised be Jesus Christ—now and Forever!

Thank you to all who attended our 1st public Sunday Mass last week. It was great to see everyone and gratifying that the number who attended was as robust as it was - we had around 100 in attendance. Most attendees seemed comfortable with the restrictions/accommodations that are in place to insure safety and we hope that word spreads and we get even more people this Sunday. We realize that many of our parishioners may not be ready to return as they may be in at-risk groups. Please remember that the dispensation of the requirement to attend Sunday and Holyday Mass continues. We are also continuing to record Sunday Mass and posting the video on the parish website www.sttitus.org. To stir your spirit, here’s a reprint of a piece that I hope you will find as thought-provoking as I did:

What Is Sin? ~ John Piper

Sin is the glory of God not honored, The holiness of God not reverenced, The greatness of God not admired, The power of God not praised, The truth of God not sought, The wisdom of God not treasured, The goodness of God not savored, The faithfulness of God not trusted, The promises of God not believed, The commandments of God not obeyed, The justice of God not respected, The wrath of God not feared, The grace of God not cherished, The presence of God not prized, The person of God not loved.

That is sin. Peace, Fr. Len

VIEW ST. TITUS MASSES ONLINE View Sunday Masses celebrated at St. Titus Church, recorded and posted to the parish website www.sttitus.org, by clicking on the Mass Times button on the home page. Locate the desired Mass video under the Links label on the right side of the page.

PLEASE REMEMBER IN YOUR PRAYERS… OUR SICK: Jackie Angelucci, Mark Dillon, Kyle Dolga, Zachary Eddinger, Anthony & Antoinette Fusco, Mary Gavanus, Margaret Heid, Catherine Imms, Joan Interrante, Monte Jambourin, Eleanor Kovach, Vinny Lass, Harper McGrier, David & Roberta Martin family, Heddy Martorelli, Joan McCormick, Gina McGrath, Sophie Maciocha, Pat Meier, Frank Murray, Joel Rivera, Kathy Shaw, Lisa Smith, Albert Sommar, James Tancredi, Jason Robert Taylor, John Therres, Theodor B. Trecroce, Angie Turkowski, John & Pat Varano, Ailing Friend, Dooner Family, David D., Baby Ezra, Tina Palladino, Jane McCann, Dolores Trecroce, Donna Van Buren, Druanna Barzeski, Jim McCarthy, Makayla, Mary Krygiel, Sarah Paquette, Peggy Schmied, Patty Cutillo, Nino Gulotta, Theresa Smith, Sheneza Hartman, Dolores Salamone

BE SURE TO READ THE LETTER ON PAGES 6 & 7 FOR FULL

DETAILS ON RESUMING MASSES!

Please follow this process for receiving Holy Communion: 1) proceed to designated Communion station with mask in place; 2) at station, remove mask from mouth by unhooking elastic from one ear or pull mask down; 3) extend hands for placement of host; 4) step to the side; 5) put host into mouth from your hand; 6) replace mask and return to pew.

Page 3: St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ P«ÊÄ : 610-279-4990 F ø: 610-279-8640 óóó.Ýãã®ãçÝ.ÊÙ Eà ®½: Ýãã®ãçÝ

3 June 21, 2020

MASS INTENTIONS FOR THE WEEK

Election of Godparents: One Godparent is required. Two Godparents – one male, one female may be appointed. Godparents must be practicing Catholics, 16 years of age or older, fully initiated into the Church (Baptized and Confirmed) at least 6 months before baptism. A non-Catholic may stand as a Christian Witness. Former Catholics are ineligible. Godparents must obtain a Certificate of Eligibility from their pastor; Christian Witnesses must provide a copy of their baptismal record. These documents and baptismal stipend must be received by the parish office one week before the day of Baptism.

Welcome To all who are tired and need rest;

To all who mourn and need comfort; To all who are friendless and need friendship;

To all who are discouraged and need hope; To all who are homeless and need sheltering love;

To all who sin and need a Savior; And to whomsoever will.

The Parish of St. Titus opens wide its doors In the name of the Lord Jesus Christ!

NEW TO ST. TITUS? Come in and get registered! The welcome mat is out at the Parish Office. Moving? Change of address or

status? New family members? Please notify the Parish Office of any changes. Thank you!

THIS WEEK AT ST. TITUS SUNDAY, JUNE 21 PUBLIC SUNDAY MASSES RESUME, 10am only Sunday Mass video available at www.sttitus.org MONDAY, JUNE 22 Daily Mass, 8:45am Church open for private prayer following Mass till 4pm TUESDAY, JUNE 23 Daily Mass, 8:45am Church open for private prayer following Mass till 4pm NO FLAME OF LOVE MEETING TILL FURTHER NOTICE 6:30pm, Legion of Mary Meeting, Rectory Mtg. Room WEDNESDAY, JUNE 24 NO MASS—CHURCH OPEN FOR PRIVATE PRAYER 10AM-4PM

THURSDAY, JUNE 25 CHURCH OPEN FOR PRIVATE PRAYER 10AM-4PM Mass, 6:30pm Pray the Rosary following 6:30pm Mass FRIDAY, JUNE 26 Daily Mass, 8:45am Mass Church open for private prayer following Mass till 4pm SATURDAY, JUNE 27 Daily Mass, 8:45am Church open for Confessions only 3:15-4:15pm NO 4:30pm Vigil Mass SUNDAY, JUNE 28 Sunday Mass, 10am only

Sunday, June 21 Father’s Day 10:00am † Albert McCracken Father’s Day Intentions Monday, June 22 8:45am † Anne Picard Tuesday, June 23 8:45am † Eleanor O’Reilly Wednesday, June 24 NO MASS Thursday, June 25 6:30pm † Deceased members of Consorto Family Friday, June 26 8:45am † George Ditty Saturday, June 27 8:45am † David DeColli † Claudio Granese Sunday, June 28 10:00am † Antoinette Granese † Ronald Domaini

Fiscal Year: July 1st, 2019 to June 30th, 2020 Total Sunday Collection for

Weekend of June 13-14, 2020..$9,628.00* *Includes $1,352. given online

Thank You for Your Generosity!

OUR FINANCIAL PICTURE

CANDLE INTENTIONS June 21st-27th

BLESSED MOTHER: Bruce Gibson

ST. JOSEPH: Frank Migliarese

MAIN ALTAR: Salvatore Romano

Page 4: St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ P«ÊÄ : 610-279-4990 F ø: 610-279-8640 óóó.Ýãã®ãçÝ.ÊÙ Eà ®½: Ýãã®ãçÝ

4 12th Sunday in Ordinary Time

PREP NEWS The video of the 2019-2020 PREP Closing can be viewed at www.sttitus.org under Faith Formation->PREP>Links. IMPORTANT NOTICE: The process for closing is:

1) Beginning June 8th, a parent must bring their child’s PREP textbook (you keep Activity books) to the PREP/Parish Office Mon-Fri, between the hours of 10am & 4pm. All returns should be made by June 19th.

2) In return for book, a Progress Report will be issued for each child along with a registration form for the 2020-2021 program year. This form is available at www.sttitus.org under

Faith Formation->PREP. CONFIRMATION has been rescheduled to Thursday, October 22, 2020, 6pm. New date for First Holy Communion is June 27th. Please pray for our children preparing.

Registration form for the 2020-2021 PREP year is available at www.sttitus.org under Faith Formation->PREP. All registration forms are due back by Monday, August 3, in order to avoid late fee, but you are encouraged to register as soon as possible to we can better plan for how classes will be conducted in the fall. Please note there is a new section on the form for immunization information required for school/program registration.

Anyone in need of further information, please contact Maureen Lewis at [email protected] or the Parish Office at 610-279-4990. #095

ST. TITUS PARISH needs your support now more than ever! Here are some options for continuing to contribute:

Thank you in advance for your continued support!

1. Consider moving your contribution online

ONLINE GIVING

2. Consider giving via Bill Pay through your bank

If you pay other bills online, you can add St. Titus Parish as a vendor and the bank will send a payment. You can note your envelope number on the payment to ensure proper credit. This payment can arrive either elec-tronically or by physical check, the bank does it all for you.

3. If you do not have Internet access, mail your envelopes in or drop them off at the Parish Office. The office is still open during this crisis, Monday-Friday, 9am-4pm.

Page 5: St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ P«ÊÄ : 610-279-4990 F ø: 610-279-8640 óóó.Ýãã®ãçÝ.ÊÙ Eà ®½: Ýãã®ãçÝ

5 June 21, 2020

St. Titus Summer Lottery Is Back!

(Social distancing version!)

3 Ticket purchase options: 1) Purchase in-person at the Parish Office during the week, M-F, 9am-4pm now thru June 29th (tickets will be available after July 1st for the remaining dates) 2) Call the office for tickets 610-279-4990 and request your special numbers. Then, mail payment along with name, address, phone and selected numbers. 3) Mail your ticket request to the office and include name, address, phone and selected numbers along with your payment.

All requests/purchases received will be confirmed by the office. All stubs will be retained at the office, so be sure to record your selected numbers at time of purchase/confirmation Tickets are $20.00 each or 3 for $50 Tickets are good for July & August

Calendar with winning numbers will be produced weekly and posted to website, www.sttitus.org. Winners will be notified by phone and winnings distributed by mail.

GOOD LUCK! Thank you for Supporting St. Titus! Any questions contact Parish Office 610-279-4990

Winning numbers are based on the PA Lottery PICK 3 Daily Number, straight only

Prizes: $50 each day and special date prizes of $100 on July 4th, July 21st, August 5th & August 18th

We’re looking for volunteers…. Do you want to deepen your spirituality? Do you want to provide help to your neighbors in need? Join the St. Vincent de Paul Society of St. Titus today!

Contact us at 484-704-7153 or [email protected] All are welcome! All ages welcome!

Page 6: St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ P«ÊÄ : 610-279-4990 F ø: 610-279-8640 óóó.Ýãã®ãçÝ.ÊÙ Eà ®½: Ýãã®ãçÝ

6 12th Sunday in Ordinary Time

#095

BE SURE TO WATCH ST. TITUS’S SUNDAY MASS ON THE PARISH WEBSITE IF YOU DO NOT RETURN TO CHURCH!

ANNOUNCEMENT OF RESUMPTION OF PUBLIC MASSES AT ST. TITUS CHURCH May 28, 2020

Great news! Archbishop Pérez has announced that parishes of the Archdiocese of Philadelphia will be able to resume public Masses beginning the weekend of June 6 and 7, if properly prepared per directives. We at St. Titus Parish look forward to welcoming you back and anticipate celebrating our first public Mass on Monday, June 8th! Please join us for our first public Sunday Mass on June 14th. Let us keep our eyes fixed on Jesus as we make our way back to the in person celebration of the Mass.

While our county remains in the Yellow Phase of statewide reopening, all of us need to do our part to make sure that our return to Mass is a peaceful and safe experience for all. Please take the time to read the instructions below. We ask everyone to follow these guidelines when attending Mass during this period:

GENERAL POINTS

The obligation to attend Mass on Sundays and holy days of obligation continues to be lifted during the Yellow Phase. You are not required to attend Mass at this time. Please stay home if you are sick. Please stay home if you are at higher risk of severe illness with COVID19. If you are uncertain about your risk status, please consult your doctor and also the CDC Guidelines at the link below.

Visit the following to read the CDC Guidelines for those at higher risk: https://www.cdc.gov/coronavirus/2019-ncov/need-extra-precautions/people-at-higher-risk.html

Sunday Mass will continue to be available via recording on our parish website. Go to www.sttitus.org. Select the Mass Times button on the home page. On the Mass Times page, select the desired Mass video under the Links label at the lower right of the page.

MASS SCHEDULE

Our Mass Schedule during the Yellow Phase will be: Sunday: 10:00am

Daily Mass: Monday, Tuesday, Friday, Saturday, 8:45am Thursday, 6:30pm Wednesday: NO MASS NO SATURDAY 4:30pm VIGIL MASS This schedule will remain in force until we move to the Green Phase.

BEFORE COMING TO MASS

Please wash your hands for 20 seconds using soap and water. Before entering the Church, you must put on a face mask or cloth covering. Exceptions to this are “children younger than 2 years old, anyone who has trouble breathing or is unconscious, and anyone who is incapacitated or otherwise unable to remove the cloth face covering without assistance” (CDC Guidelines). Please do not come to Mass if you are sick or are at higher risk for severe illness with COVID19 (see above). Missalettes and hymnals will not be in the pews during this period. You are welcome to bring your own missal/readings with you.

ENTERING THE CHURCH

Please enter the Church through the double wooden doors or the door at the top of the inside ramp. All of these doors will be open at all times. Hand sanitizers will be available at the Church entrances. Please use the hand sanitizer upon entering and exiting the Church.

SEATING

When taking your seat, please honor all posted signs about where you may sit. Every other pew will be open to ensure proper social distancing. Members of the same household may sit together as normal. Please place 6 feet between your household and members of a different household.

Page 7: St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ P«ÊÄ : 610-279-4990 F ø: 610-279-8640 óóó.Ýãã®ãçÝ.ÊÙ Eà ®½: Ýãã®ãçÝ

7 June 21, 2020

ANNOUNCEMENT OF RESUMPTION OF PUBLIC MASSES AT ST. TITUS CHURCH (CONTINUED) DURING MASS

There will be NO SINGING during Mass in this phase of re-opening. There will be no collection taken up during the Offertory. You may leave your envelope/gift in the basket at the back of the center aisle in church. There will be no Presentation of Gifts (Offertory Procession) during the Yellow Phase. There should be no holding of hands during the Our Father. There will be no Sign of Peace during Mass during the Yellow Phase. The Precious Blood will not be distributed during Mass during the Yellow Phase.

RECEPTION OF HOLY COMMUNION

FOR CENTER SECTIONS: Please exit your pew into the center aisle and move toward the top of the aisle where you will then move toward the Communion station (on SUNDAYS, on the side on which you are seated). There will be 2 Communion stations for SUNDAY MASS: one to the left (Blessed Mother side) and one to the right (St. Joseph side) midway toward the side aisle. Continue on to the side aisle to return to your pew after receiving Communion.

FOR SIDE SECTIONS: Please wait until center sections have received. Exit your pew into the side aisle and move toward the top of the aisle where the Communion stations have moved. Return to your pew via the aisle by the windows on your side.

Please maintain social distancing in the Communion line. Please keep several pews between yourself and the person in front of you while in line and when returning to your pew. During the Yellow Phase, the faithful are asked to receive Holy Communion in the hand. Please follow this process for receiving Holy Communion: 1) proceed to designated Communion station with mask in place; 2) at station, remove mask from mouth by unhooking elastic from one ear or pull mask down; 3) extend hands for placement of host; 4) step to the side; 5) put host into mouth from your hand; 6) replace mask and return to pew.

EXITING THE CHURCH

At the conclusion of Mass, please exit the Church (remembering to social distance) and proceed directly to your car. Please do not congregate for any reason. Please take a parish Bulletin home with you. Bulletins will be available for you to pick up at the back of church and at the entrance. Please leave your mask on until you exit the Church.

OUR COMMITMENT TO YOU St. Titus Parish will follow the guidelines from the CDC for sanitation as we resume public Masses.

To view the CDC guidelines, visit: https://www.cdc.gov/coronavirus/2019-ncov/php/faith-based.html Our parish sanitation procedures include cleaning/sanitizing the Church after each service/gathering, the re-moval of all hymnals and Missals and prayer intentions book, sanitizing of all door knobs/handles after every service/gathering and providing hand sanitizer.

This notice is posted on the parish website, www.sttitus.org on the COVID-19 page. Please share this notice with other parishioners or friends of St. Titus that may not be Internet users.

We are excited to get you back to Church and the celebration of the Mass and Holy Eucharist. However, we pray that you will prayerfully consider and ponder your decision to return at this time and will be totally adherent to these directives should you come to church.

God bless you and we hope to see you soon! Fr. Len

Page 8: St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ P«ÊÄ : 610-279-4990 F ø: 610-279-8640 óóó.Ýãã®ãçÝ.ÊÙ Eà ®½: Ýãã®ãçÝ

8 12th Sunday in Ordinary Time

ST. TITUS OUTREACH PROGRAM MINISTRIES

#095

DON’T FORGET YOUR REGULAR IN-STOCK CARDS—ALWAYS AVAILABLE ACME, WHOLE FOODS, SHOPRITE, GIANT, WAWA, KOHL’S, WEIS, ETC!

Scrip is sold in the Church Lobby before and after the

weekend Masses and at the Parish Office

Monday-Friday,9:00am-4:00pm, and Monday-Thursday evenings,6-9:00pm

BUY IN-STOCK SCRIP & PLACE SPECIAL ORDERS!

Make it a weekly habit to BUY SCRIP!

Special order from hundreds of retailers!

Altar Servers Pat Klampfer 267-257-1675 Bell Choir Parish Office 610-279-4990 Bethany Music Ken Yoder 610-272-6660 Bible Study Deacon Claude Granese 215-292-6479 Catechists Maureen Lewis 610-279-4990 Church Cleaning Pat Orner 610-279-8575 Church Decorating Pat Klampfer 610-630-6901 CYO Parish Office 610-279-4990 Eucharistic Ministers Deacon Claude Granese 215-292-6479 Finance Council Mike Sexton 215-480-5866 Flame of Love Mary Jo Szczur 610-539-7476 Fundraising Comm. Anthony Saldutti 610-313-9063 Gabriel’s /Gardening Parish Office 610-279-4990 Knights of Columbus Matt Faust 610-277-4250 Lectors Denise Hoisington 484-432-5871 Legion of Mary Richard Wieda 215-699-5151 Liturgy Committee Martha Heid 610-272-2309 Maximilian Ministry Mary Jo Szczur 610-539-7476 Music Ministry Bob Leso 856-478-4137 Outreach Parish Office 610-279-2990 Pre-Jordan Lina & Tom McCracken 610-279-7891 Respect Life Comm. John Harris 610-631-0532 Sacristans Jack Fessler 610-476-6316 Senior Group Don McAvoy 610-539-7881 Sodality Nancy Kolenda 610-716-5617 STAC Bill Munro 610-277-6926 Stewardship Council Kevin Tickner 610-292-7193 St. Vincent DePaul Betty Ann Hilwig 484-704-7153 2 Hearts/2K Hail Marys/ Bella Kampmeyer 215-820-1995 Night of Reparation Ushers Parish Office 610-279-4990

TV SUNDAY MASS FOR THE HOMEBOUND WDPN channel 2 at 7 am

WMCN channel 44 at 8:30am

Spiritual Support for Addiction: Hope in Christ. The Hope in Christ: Spiritual Support for Addiction webpage provides a central location for resources, ongoing support, events, and testimonies that are happening throughout the Archdiocese. Visit archphila.org/hope for new postings for Catholic resources available to you or a loved one .

ST. JOHN’S HOSPICE CASSEROLE PROGRAM St. Titus Parish has been making casseroles for St. John’s Hospice in Center City Philadelphia for over 35 years. The casseroles are the “Main Course” of a complete, hot meal that is served to hundreds of God’s poor and homeless who come to St. John’s for their daily bread. Please do not feel restricted to the recipes which can be found on the recipe sheets near the casserole pan in the vestibule. Your favorite recipe is most welcome! So are store bought casseroles such as Stouffers or Oncor. St. John’s provides us with pans and lids for your dishes. If you provide your own, please use a standard “half tray”. Each casserole serves 6-8 men. Each month, St. John’s picks up the dishes from our freezer. Here are some useful hints:

Please bring your casseroles frozen to church and put them in the freezer located in the vestibule of the Social Hall. If the door to the Social Hall is locked, please leave the casserole with a sacristan or maintenance. Prepare your recipe so that it can be eaten with a plastic “spork” (a combination spoon and fork). Please mark the lid with the main ingredients and date you prepared your casserole.

Keep those casseroles coming! St. John’s Hospice has notified us that they will continue to make pickups during the COVID-19 crisis. The need is great especially now.

Page 9: St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ P«ÊÄ : 610-279-4990 F ø: 610-279-8640 óóó.Ýãã®ãçÝ.ÊÙ Eà ®½: Ýãã®ãçÝ

9 June 21, 2020

HOLY ROSARY REGIONAL CATHOLIC SCHOOL REGISTRATION FOR NEW STUDENTS 2020—2021 Registrations for the 2020 – 2021 school year are now being accepted. Age Requirements are as follows:

Pre-Kindergarten 4: Age 4 by September 1, 2020 Kindergarten: Age 5 by September 1, 2020

First Grade: Age 6 by September 1, 2020

As we are not touring right now, we invite you to view out website: www.holyrosaryregional.com to see all that we have to offer. Registration information is a tab on the website. If you are interested in financial aide, you can apply at: www.factsmgt.com/aid to create an account and complete your application.

Please email Mrs. Gilman, Principal, at [email protected] if you are interested in our school. Once we are back to school, we can schedule a tour.

Class of 2020 On a recent, beautiful Tuesday afternoon, graduation was held at Epiphany of Our Lord Church to

honor Holy Rosary’s 8th grade. The excited students processed into church in either light blue or dark blue gowns. Mass was celebrated by the Governing Board of Holy Rosary Regional, Monsignor Charles

Sangermano of Holy Saviour, Rev. Leonard Lewandowski of St. Titus, Rev. Harry McCreedy of St. Paul’s, and Rev. Joseph Quindlen of Epiphany. Keeping in mind the guidelines issued by the Archdiocese and the CDC,

everyone interacted safely. Our students wore masks that were sewn by Mrs. Sharon Rupprecht that featured “HR Class of 2020” on the front, and the name of the high school the graduate will be attending on the reverse

side. Mrs. Cathie Toth and Ms. Allie McCrea provided their musical talents to make Mass even more special for us. Following Mass, diplomas were presented, honors were awarded, and scholarship recipients were announced.

This year’s class received over $242,000 in scholarships. Congratulations to our Holy Rosary Class of 2020 who we will keep in our prayers!!!

FR. LEN ’S LAUGHING CORNER

Fishing & Sisters A boy was taking care of his baby sister while his parents went shopping. He decided to go fishing and he had to take her along. “I’ll never do that again!” he told his mother that evening. “I didn’t catch a thing!” “Oh, next time I’m sure she’ll be quiet and not scare the fish away,” his mother said. The boy said, “It wasn’t that. She ate all the bait.”

LAUGH OUT LOUD TODAY - IT’S GOOD FOR YOU!

Page 10: St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ P«ÊÄ : 610-279-4990 F ø: 610-279-8640 óóó.Ýãã®ãçÝ.ÊÙ Eà ®½: Ýãã®ãçÝ

10 12th Sunday in Ordinary Time

St. Titus / St. Francis KNIGHTS OF COLUMBUS

All Catholic men age 18 and over are invited to join The Knights of Columbus! We meet on the first Wednesday of each month at 7:30pm in the St. Titus Parish Center. MEETINGS currently canceled until further notice due to COVID-19 concerns/restrictions. New prospective members are welcome to attend. For more info, call: Don McAvoy 610-539-7881.

WHAT’S HAPPENING OUT AND ABOUT

ST. TITUS SENIOR ACTIVITIES CLUB is open to anyone age 55 or older. Meetings are held the first Tuesday of the month. Our meetings are currently suspended for the summer and due to COVID-19 concerns/restrictions. Hope to see you back in the fall!

St. Titus / St. Francis KNIGHTS OF COLUMBUS

Hear Ye, Hear Ye CHANCE OF A LIFETIME sweepstakes is closed!

Featuring a 2020 Chevy Spark and including vacation packages to exciting places

around the world as well as cash prizes! Drawing planned for July!

Thank you for helping others by our fundraisers!

#095

Access Formed for Free for 40 Days Our friends at the Augustine Institute have graciously made available to all of us in the Archdiocese of Philadelphia FREE access to their online platform Formed.org for 40 days. This is an excellent way for anyone in the Archdiocese to access free Catholic videos, books, movies and more. Content is available in English and in Spanish. Here how to access Formed for free for 40 days: 1. Visit formed.org/signup... 2. Type "Faith at Home Philadelphia" in the search box and click that title when it comes up 3. Enter your info and click SignUp

4. Enjoy! A link has been placed on the homepage of the St. Titus Parish website, www.sttitus.org in the event you don’t want to sign up yourself!

LIVE STREAM OF SUNDAY MASS: The 11:00am Mass celebrated at the Cathedral Basilica of Saints Peter and Paul is streamed live weekly on the Archdiocese of Philadelphia’s website as well as the Facebook pages for the Archdiocese and Archbishop Nelson J. Pérez. These live streams will be provided on an ongoing basis and as a mode for individuals to participate in Sunday Mass remotely during the COVID-19 pandemic. The faithful are encouraged to participate via live stream. Links to the live stream sites are: www.archphila.org OR https://www.facebook.com/ArchbishopPerez/

Are You Looking for a Job or Career Change? Ascension Press, an Exton-based Catholic publishing and media company, has several positions now available. Some of our available positions include: General Manager, Podcast Coordinator, and other future opportunities. Ascension Press has been providing quality Catholic faith formation resources to parishes, faith-sharing groups, schools, families, and individuals since 1998. We are recognized by Catholic leaders, educators and laity for our producing ground-breaking and award-winning Catholic study programs, videos, books, audio talks, blog articles, and live events. We are a company of passionate, mission-driven professionals who love what we do. If you would like to bring your talents and skills into our team, please go to: https://study.ascensionpress.com/pages/about_us/careers

Intentions for June 2020 Pope's Prayer Intention: The Way of the Heart We pray that all those who suffer may find their way in life, allowing themselves to be touched by the Heart of Jesus.

Page 11: St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ P«ÊÄ : 610-279-4990 F ø: 610-279-8640 óóó.Ýãã®ãçÝ.ÊÙ Eà ®½: Ýãã®ãçÝ

095 St. Titus, Norristown (i) John Patrick Publishing Company 1-800-333-3166 • www.jppc.net

www.center.smmrehab.org www.villa.smmrehab.org701 Lansdale Avenue, Lansdale • 215-368-0900

Physical Th erapyOccupational Th erapy

Speech Th erapy Short & Long Term Care

Independent CareContinuing Care

Memory CarePersonal Care

We Care and It Shows

We AcknowledgeWe Appreciate

Beautiful On-Site Chapel with Daily Mass • Respite Stay Available

EASY PASS$99 A DAY

NO MINIMUM STAY

GUTTER DOCTO855-322-7400855-322-7400

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle to make sure it is the car they

are supposed to enter.

In Remembrance of Samantha Josephson

#WHATSMYNAME

BASEMENTWATERPROOFING

FOUNDATIONREPAIRMOLD

REMEDIATION

1-888-5DRY-TECHwww.DryTechCorp.com

Neighboring Parishioner

MorganExteriors, LLC

Stucco Remediation Specialist

Roofi ng

Hardie Siding Specialist

484.568.4457Best Prices & Warranties in the Business

www.morganexteriorsllc.com

Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.

This describes the power of...

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!

Call 1.800.333.3166 TODAY!

B U I L D Y O U R B U I L D Y O U R C O M M U N I T YC O M M U N I T Y

- Shop Local -- Shop Small -

P L E A S E P A T R O N I Z E T H E A D V E R T I S E R SP L E A S E P A T R O N I Z E T H E A D V E R T I S E R SW H O M A K E T H I S B U L L E T I N P O S S I B L E !W H O M A K E T H I S B U L L E T I N P O S S I B L E !

Page 12: St. Titus ParishSt. Titus Parish 3000 K ÄóÊÊ RÊ , E Ýã NÊÙÙ®ãÊÄ, PA 19403 P ٮݫ P«ÊÄ : 610-279-4990 F ø: 610-279-8640 óóó.Ýãã®ãçÝ.ÊÙ Eà ®½: Ýãã®ãçÝ

095 St. Titus, Norristown (b) R John Patrick Publishing Company 1-800-333-3166 • www.jppc.net

J Fryer J Fryer LandscapingLandscaping

Landscaping &Hardscaping

Lawn MaintenanceMulching

Patios • Walks Spring Clean-ups

Parishioner • 610-277-1777

CorropoleseBakery & Deli

Home of freshly baked bread... Daily!Mon-Fri 8am-7pm

Sat 8am-6pm • Sun 8am-4pm2014 Old Arch Rd., NorristownReds Barbone Shopping Center

610-275-6664610-272-8957

Look no further!

Rick GamboneREALTOR® ~ Parishioner

Offi ce: Offi ce: 215.641.9500215.641.9500Cell: Cell: [email protected]@LNF.comwww.LongandFoster.comwww.LongandFoster.com

Blue Bell (Lenmar) Offi ce

Penn SquarePenn SquareDental Associates, P.C.Dental Associates, P.C.

Thomas M. CheckThomas M. CheckThomas C. CheckThomas C. Check

228 Bryans Rd.Norristown, PA 19401-1306

(Entrance on Germantown Pike)

(610) 272-5765

BASEMENT WATERPROOFINGMOLD REMEDIATIONFOUNDATION REPAIR

215-427-1727www.RightwayWaterproofi ng.com

RIGHTWAY WATERPROOFING CO.

FREE INSPECTIONLicensed & Insured

Family Owned and Operated Since 1987

Church

Member

Discounts

John DiRosatoPlumbing & Heating Co., Inc.

Residential Commercial Industrial

Hot Water & Steam Heating • Water Heaters • Bathrooms

2130 Carol Lane (610)277-2140 Parishioner of Visitation

John F. Givnish (3rd Generation) John F.X. Givnish, III (4th Generation)

1-800-GIVNISHAff ordable Funeral

and Cremation ServicesBOYD-HORROX-GIVNISH

INDEPENDENT LIVING

PERSONAL CARE

DEMENTIA CARE

610.239.7700300 East Germantown Pike

East Norriton, PA 19401

www.BrightviewEastNorriton.com

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send

your email address by text message: Text MALLORYSARMY to 22828 to get started.

Message and data rates may apply.

St. Augustine Catholic Cemetery175 W. DeKalb Pike, King of Prussia, PA 19406

610-272-4088 | Email: [email protected]

Mention this ad & receive a 15% discount on any new pre-purchase of a grave, crypt or niche. Interest free financing available.

Offer good through December 31, 2020.St. Augustine Catholic Cemetery is operated by Sacred Heart Church, Swedesburg.

St. AugustineROMAN CATHOLICCemetery

Donald E. Moore, Supervisorwww.msrfh .com

In Our 4th Decade of Quality Service

French DrainsFoundation RepairMold Remediation

610-696-0100www.morganbasementwaterproofing.com

All Work Guaranteed

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis

cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm o

echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n

acturing - Chemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens

dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans

ortation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker

CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforcforcforcforcforceement, Public Safety - O

To all those nforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keeping echnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finanaterials Finan

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar

ment, Public Safety - OSafety - Othan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tetttttttttteee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCoCCoCCoCCCoooCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicatcaticaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim

echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community

Wedding Wedding Invitations & Invitations & Holiday CardsHoliday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from conveniently from your home or offi ce.your home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted

FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!