SPAK Differentially Mediates Vasopressin Effects on...

BASIC RESEARCH www.jasn.org

SPAK Differentially Mediates VasopressinEffects on Sodium Cotransporters

Turgay Saritas,* Aljona Borschewski,* James A. McCormick,† Alexander Paliege,*Christin Dathe,* Shinichi Uchida,‡ Andrew Terker,† Nina Himmerkus,§ Markus Bleich,§

Sylvie Demaretz,| Kamel Laghmani,| Eric Delpire,¶ David H. Ellison,† Sebastian Bachmann,*and Kerim Mutig*

*Department of Anatomy, Charité Universitätsmedizin, Berlin, Germany; †Division of Nephrology and Hypertension,Oregon Health & Science University, Portland, Oregon; ‡Department of Nephrology, Medical and Dental University,Tokyo, Japan; §Institute of Physiology, Christian-Albrechts-University, Kiel, Germany; |INSERM, UMRS872, Paris,France; and ¶Department of Anesthesiology, Vanderbilt University, Nashville, Tennessee

ABSTRACTActivation of the Na+-K+-2Cl2-cotransporter (NKCC2) and the Na+-Cl2-cotransporter (NCC) by vasopres-sin includes their phosphorylation at defined, conservedN-terminal threonine and serine residues, but thekinase pathways that mediate this action of vasopressin are not well understood. Two homologous Ste20-like kinases, SPS-related proline/alanine-rich kinase (SPAK) and oxidative stress responsive kinase (OSR1),can phosphorylate the cotransporters directly. In this process, a full-length SPAK variant andOSR1 interactwith a truncated SPAK variant, which has inhibitory effects. Here, we tested whether SPAK is an essentialcomponent of the vasopressin stimulatory pathway. We administered desmopressin, a V2 receptor–specific agonist, to wild-type mice, SPAK-deficient mice, and vasopressin-deficient rats. Desmopressininduced regulatory changes in SPAK variants, but not in OSR1 to the same degree, and activated NKCC2and NCC. Furthermore, desmopressin modulated both the full-length and truncated SPAK variants tointeract with and phosphorylate NKCC2, whereas only full-length SPAK promoted the activation of NCC.In summary, these results suggest that SPAK mediates the effect of vasopressin on sodium reabsorptionalong the distal nephron.

J Am Soc Nephrol 24: 407–418, 2013. doi: 10.1681/ASN.2012040404

Thefurosemide-sensitiveNa+-K+-2Cl2-cotransporter(NKCC2) of the thick ascending limb (TAL) and thethiazide-sensitive Na+-Cl2-cotransporter (NCC) ofthe distal convoluted tubule (DCT) are key regulatorsof renal salt handling and therefore participate impor-tantly in BP and extracellular fluid volume homeosta-sis.1 Loss-of-function mutants in the SLC12A1/ A3genes encoding NKCC2 and NCC cause salt-losinghypotension and hypokalemic alkalosis in Bartter’sand Gitelman’s syndromes,2,3 whereas their overactiv-ity may contribute to essential hypertension.4,5 Re-cently, attention has been focused on the two closelyrelated STE20-like kinases, SPS-related proline/alanine-rich kinase (SPAK) and oxidative stress re-sponsive kinase 1 (OSR1), which can phosphorylateNKCC2 andNCC at their N-terminal conserved thre-onine or serine residues (T96, T101, and T114 of

mouse NKCC2 and T53, T58, and S71 of mouseNCC) and thereby activate the transporters.6–8 De-spite the high homology between SPAK and OSR1and their overlapping renal expression patterns, dis-tinct roles along the nephron have been suggestedbased on data from SPAK-deficient and kidney-specific OSR1-deficient mice: deletion of SPAK

Received April 23, 2012. Accepted November 20, 2012.

Published online ahead of print. Publication date available atwww.jasn.org.

Correspondence: Dr. Kerim Mutig or Dr. Sebastian Bachmann,Department of Anatomie, Charité–Universitätsmedizin Berlin,Philippstraße 12, 10115 Berlin, Germany. Email: [email protected] or [email protected]

Copyright © 2013 by the American Society of Nephrology

J Am Soc Nephrol 24: 407–418, 2013 ISSN : 1046-6673/2403-407 407

http://www.jasn.org

mailto:[email protected]



primarily impairs the function ofNCC,whereas deletion ofOSR1negatively affects NKCC2.9–11 The complex functional propertiesof a WNK-SPAK/OSR1-N(K)CC interaction cascade are cur-rently being defined.12 Recently, arginine vasopressin (AVP), sig-naling via the V2 receptor (V2R), has been identified as an effi-cient activator of both cotransporters, affecting their luminaltrafficking and phosphorylation.13–18 Because plasma AVP levelsmay vary not only with the sleep-wake cycle or long-term phys-iologic challenges, but also with pulsatile changes over the shortterm, distinct, time-dependent responses may occur.19 SPAK andOSR1 are well placed to regulate distal NaCl reabsorption in re-sponse to AVP. Here we tested the role of SPAK in AVP-induced

activation of NKCC2 and NCC, acutely and during long-termtreatment. The results suggest that SPAK is an essential kinasethat modulates distal nephron function in response to AVP stim-ulation.

RESULTS

Steady State Distribution of SPAK and OSR1 inWild-Type and SPAK2/2 MiceWe first characterized the abundance and distribution of SPAKand OSR1 in wild-type (WT) and SPAK2/2 mice, extending

previous work.9 To characterize SPAK, wefirst used an anti-C-terminal SPAK (C-SPAK) antibody that recognized both thefull-length and the inhibitory forms.9 Im-munohistochemistry with anti-C-SPAK an-tibody revealed strong apical signal in theTAL, whereas in the DCT, a particulate cyto-plasmic signal was dominant, along withweaker subapical staining in WT (Figure 1,A, B, E, and F); the signal was absent inSPAK2/2 kidneys (Figure 1, C, D, G, andH). Anti-OSR1 antibody signal was apicallystrong in TAL but weak in DCTof WT (Fig-ure 1, I and J), whereas in SPAK2/2, theinverse distribution, with diminished TALbut enhanced cytoplasmic and apical DCTsignals, was evident (Figure 1, K and L).These patterns, suggesting compensatory re-distribution of OSR1 in SPAK deficiency, areschematized in Figure 1M.

Steady State Phosphorylation ofSPAK and OSR1 in WT and SPAK2/2MiceNext, we studied the phosphorylation ofSPAK and OSR1 within their catalytic do-mains (T243 in SPAK and T185 in OSR1) asan indicator of their activity.6 The antibodiesdirected against phosphorylated forms ofSPAK and OSR1 cannot distinguish betweenthe two, because the phosphorylation sitesare similar. Staining with anti-phospho-(p)T243-SPAK/pT185-OSR1 antibody was ab-sent in medullary TAL (mTAL) and weak incortical TAL (cTAL) of both genotypes,whereas in DCT, moderate apical signal inWT, but weaker staining in SPAK2/2micewas observed (Figure 2, A,C, E,G, I,K,M,O,and Q). Phosphorylation of the kinaseswithin their regulatory domains (S383for SPAK and S325 for OSR1) may facilitatetheir activity as well,20 so that staining with

Figure 1. SPAK deficiency is associated with compensatory adaptation of OSR1. (A–L)SPAK and OSR1 immunostaining in TAL and DCT and double-staining with segment-specific antibodies to NKCC2 for TAL or NCC for DCT. (A–H) In WT kidneys, SPAK signalin TAL is concentrated apically (A and B). (E and F) DCT shows also cytoplasmic SPAKsignal. (C, D, G, and H) Note the complete absence of SPAK signal in TAL and DCT inSPAK-deficient (SPAK2/2) kidney. (I–L) OSR1 signal is concentrated apically in TAL andDCT of WT kidneys, whereas DCT shows additional cytoplasmic signal in SPAK2/2kidneys. Note that OSR1 signal is stronger in TAL than in DCT in WT, whereas SPAK2/2shows the inverse. Bars show TAL/DCT transitions. (M) The distribution patterns of SPAKand OSR1 are schematized. Original magnification, 3400.

408 Journal of the American Society of Nephrology J Am Soc Nephrol 24: 407–418, 2013


anti-pS383-SPAK/pS325-OSR1 antibody was also performed;moderate apical TAL and apical plus cytoplasmic signal in DCTwere obtained in WT (Figure 3, A, E, I, M, and Q), whereas inSPAK2/2, TAL andDCTwere nearly negative (Figure 3, C, G, K,O, Q). These data are in agreement with earlier data showing thatbaseline phosphorylation of renal SPAK and OSR1 is low.21 Theyalso indicate that SPAK deficiency does not elicit compensatoryincrease of OSR1 phosphorylation.

Steady State Abundance and Phosphorylation ofNKCC2 and NCC upon SPAK DisruptionAs reported previously,9 SPAK deficiency caused opposingbaseline phosphorylation patterns of the cotransporters withNKCC2 showing enhanced pT96/pT101 signal without a

difference in NKCC2 abundance, whereas NCC revealed sub-stantially decreased pT58/pS71 signal along with decreasedNCC abundance (Supplemental Figure 1).

Effects of Short-Term Desmopressin on SPAK andOSR1 Phosphorylation in WT and SPAK2/2 MiceTo test whether AVP-V2R activates SPAK and/or OSR1 acutely,desmopressin (dDAVP) or vehicle were administered intraperi-toneally to WT and SPAK2/2 mice. Baseline endogenous AVPwas slightly lower in SPAK2/2 compared with WT mice (0.7versus1.5ng/ml),which ledus touseanestablished supraphysiologicdDAVP dose (1mg/kg bodyweight) in order to reach saturationof AVP signaling in both genotypes.13,15 Phosphorylation ofSPAK and/or OSR1 within their catalytic domains was studied

with anti-pT243-SPAK/pT185-OSR1 anti-body. Because immunoblotting producedunclear results, confocal evaluation waspreferred. dDAVP increased pT243-SPAK/pT185-OSR1 signals in mTAL andDCTof bothWT (15-fold formTAL and 3-fold for DCT) and SPAK2/2mice (8-foldfor mTAL and 2-fold for DCT), whereassignificant changes were not detected incTAL in either genotype (Figure 2). Phos-phorylation of the regulatory domain wasassessed with anti-pS383-SPAK/pS325-OSR1 antibody. Here, dDAVP increasedthe signal inmTAL andDCTofWT kidneys(1.5- and 2-fold, respectively), whereas nosignificant changes were recorded inSPAK2/2 kidneys (Figure 3). Correspond-ing immunoblots showed increased signalsinWTbut not in SPAK2/2 kidneys (Figure4). The abundances of SPAKandOSR1wereunaffected by dDAVP (data not shown).Short-term dDAVP administration thusstimulated phosphorylation of the kinasesdifferentially with a focus on pSPAK inmTAL and DCT.

Effects of Short-Term dDAVP onNKCC2 and NCC in WT andSPAK2/2 MiceNext, we studied the effects of dDAVP onsurface expression and phosphorylationof NKCC2 and NCC. Short-term dDAVPincreased the NKCC2 surface expression inboth WT and SPAK2/2 mice (+21% inWT and +26% SPAK2/2 mice; Figure 5,A, B, E, F, and I), whereas dDAVP had noeffect on NCC surface expression in eithergenotype (Figure 5, C, D, G, H, and J). Im-munoblots of NKCC2 phosphorylation atT96/T101 revealed that dDAVP increased

Figure 2. Short-term dDAVP induces differential phosphorylation of SPAK and OSR cat-alytic domains; confocal microscopy. (A–P) Immunolabeling of pT243-SPAK/pT185-OSR1(pT243/pT185) and double-staining for NKCC2 in renal medulla (A–H) and cortex (I–P) ofvehicle- and dDAVP-treated (30 minutes) WT and SPAK2/2 kidneys. Bars indicate TAL/DCT transitions. (Q) Signal intensities (units) obtained after confocal evaluation of pT243-SPAK/pT185-OSR1 signals in medullary (mTAL) and cortical segments (cTAL, DCT) usingZEN software. Data are the mean 6 SD. *P,0.05 for intrastrain differences (vehicle versusdDAVP). Note the more pronounced response to dDAVP in WT compared with SPAK2/2mice.

J Am Soc Nephrol 24: 407–418, 2013 SPAK and Arginine Vasopressin 409

www.jasn.org BASIC RESEARCH

http://jasn.asnjournals.org/lookup/suppl/doi:10.1681/ASN.2012040404/-/DCSupplemental

the abundance of pNKCC2 in WT (+55%) and more so inSPAK2/2mice (+187%). The abundance of total NKCC2 pro-tein was concomitantly augmented in WT, but unaffected inSPAK2/2 mice (Figure 6). dDAVP increased NCC phosphor-ylation substantially in WT (+164% for pS71-NCC and +50%for pT58-NCC), but less so in SPAK2/2mice (+53% for pS71-NCC [P,0.05] and n.s. for pT58-NCC; Figure 6). These resultswere confirmed and extendedbyconfocal analysis ofDCTprofilesincluding the use of an additional anti-pT53-NCCantibody (Sup-plemental Figure 2). SPAK deficiency thus had no effect ondDAVP-induced trafficking of NKCC2, facilitated its phosphory-lation, and attenuated NCC phosphorylation.

Effects of Short-Term dDAVP onInteractions of SPAK and OSR1 withNKCC2 and NCCThe truncated KS-SPAK isoform may limitthekinaseactivitiesofFL-SPAKorOSR1 inadominant-negative fashion (9). Here weused Brattleboro rats with central diabetesinsipidus (DI)13,15 to test whether dDAVPalters the association of activating or inhibi-tory SPAK andOSR1 isoforms with NKCC2and NCC using co-immunoprecipitationassays. Presence of KS-SPAK in the rat kid-neywas confirmed at the RNAand proteinlevels (Supplemental Figure 3). At base-line, NKCC2 was chiefly bound to KS-SPAK, whereas NCC was predominantlyassociated with FL-SPAK. OSR1 isoformsinteracted prominently with NKCC2, butless so with NCC (Figure 7, A and B).Short-term dDAVP significantly reducedbinding of KS-SPAK (230%) and in-creased binding of FL-SPAK to NKCC2(+62%), whereas SPAK2 and OSR1 iso-forms were not affected (Figure 7, A andC). In contrast, binding of SPAK andOSR1isoforms toNCCwasnot affected bydDAVP(Figure 7, B andD). dDAVP thus specificallymodulated the interaction of NKCC2 withactivating and inhibiting SPAK forms.

Effects of Long-Term dDAVP onRenal Function in WT and SPAK2/2MiceWe next evaluated whether SPAK is in-volved in the response of the distal neph-ron to long-term dDAVP treatment (3days via osmotic minipumps). Physio-logic effects, compared with vehicle,were more marked in WT (urine volumereduced to 25%, fraction excretion of so-dium [FENa] to 23%, potassium [FEK] to26%, and chloride [FECl] to 47%) than in

SPAK2/2mice (urine volume reduced to 38%, FENa to 57%;Figure 8). NKCC2 phosphorylation was raised in WT (+87%)but not in SPAK2/2, which conversely showed an increase inNKCC2 abundance (+96%; Figure 9A). NCC abundance wasraised inWT (+45%) andmore so in SPAK2/2mice (+201%),and NCC phosphorylation was stimulated as well in WT(+393% for pT58-NCC and +519% for pS71-NCC) and inSPAK2/2 (+475% for pT58-NCC and +355% for pS71-NCC; Figure 9A). However, due to different baseline levelsamong strains, values were normalized for WT vehicle levels(Figure 9). Thus, NKCC2, pNKCC2, and NCC abundanceshad reached similar levels in either genotype, whereas

Figure 3. Short-term dDAVP induces phosphorylation of the regulatory domain ofSPAK but not of OSR1; confocal microscopy. (A–P) Immunolabeling of pS383-SPAK/pS325-OSR1 (pS383/pS325) and double-staining for NKCC2 in renal medulla (A–H)and cortex (I–P) of vehicle- and dDAVP-treated (30 minutes) WT and SPAK2/2 kid-neys. Bars indicate TAL/DCT transitions. Note that dDAVP induces increases in bothearly and late DCT as identified by the absence or presence of intercalated cells(arrows). (Q) Signal intensities (units) obtained after confocal evaluation of pS383-SPAK/pS325-OSR1 signals in mTAL, cTAL, and DCT. Data are the mean 6 SD.*P,0.05 for intrastrain differences (vehicle versus dDAVP). Note nearly absent pS325-OSR1 signal in SPAK2/2 kidneys.






dDAVP-induced NCC phosphorylation was selectively attenu-ated upon SPAK disruption over the long term.

Effects of Long-Term dDAVP on Relative SPAK andOSR Isoform AbundancesWenext studied whether dDAVPalters the relative abundance ofSPAK and OSR1 products. Administration of dDAVP for 3 dayssignificantly increased the abundances of FL-SPAK (+62%) andSPAK2 (+67%) inWT, whereas OSR1 isoforms were unaffectedin either strain (Figure 10). These data were verified in DI ratsreceiving long-term dDAVP administration as well; resultingchangeswere similar to those obtained inWTmice (Supplemen-tal Figure 4). These results suggest a prominent role for SPAKproducts in distal nephron adaptation at long term.

DISCUSSION

Our results add to a growing body of work documentingsubstantial effects of AVPon cation chloride transporters alongthe nephron. Here, we show that the serine/threonine kinasesSPAK and OSR1 participate in that signaling mechanism.Althoughexpressed largelyby the samedistal nephron segments,SPAK and OSR1 affect TAL and DCT differentially. This wasillustrated earlier by the phenotype of SPAK2/2 mice, which

display a Gitelman-like syndrome pointingtoDCTmalfunction9,10; in contrast, deletionof OSR1 in the kidney caused Bartter-likesyndrome, indicating TAL insufficiency.11

In SPAK2/2, we resolved a confusing phe-notype of upregulated pNKCC2 in TAL anddownregulated pNCC in DCT, by identify-ing novel SPAK isoforms with opposing ac-tions.Whereas truncatedKS-SPAK inhibitedFL-SPAK- and OSR1-dependent phosphor-ylation of NKCC2 in TAL, FL-SPAKwas crit-ically involved in the phosphorylation ofNCC in DCT.9

This study further elucidates the role ofSPAK in the distal nephron and the poten-tial of homologous OSR1 to replace itsfunction. In spite of the known effect ofOSR1 onNKCC2 function,11 SPAK disrup-tion did not trigger any compensatory in-crease of its homolog in TAL. This may berelated with a diminished demand for anNKCC2-activating kinase in the absence ofan inhibitory one (KS-SPAK) or with par-allel actions of alternative kinase pathwayssuch as protein kinase A or AMP-activatedprotein kinase.8,18 In the DCT, however,the higher total OSR1 abundance may becompensatory. Because NCC abundanceand phosphorylation were markedly belowcontrol levels in the SPAK-deficient mice,

however, increased OSR1 is not capable of fully compensatingfor SPAK deficiency. The phosphorylation status of the cata-lytic and regulatory domains of SPAK/OSR revealed no com-pensatory increase of OSR1 phosphorylation in the absenceof SPAK either; rather, decreased signals for the two OSR1phosphoacceptor sites were detected in TAL and DCT. It there-fore appears that SPAK is essential for NCC function, whichagrees with the physiologic deficits of this model.9,10

Renal compensatory reactions are commonly triggered byendocrine stimuli.16 Surprisingly, plasma AVP and aldoste-rone levels were diminished in SPAK2/2 mice in spite ofextracellular volume depletion and a stimulated renin sta-tus.9,10 Because substantial expression of SPAK has beenshown in hypothalamic brain regions and in adrenal glomer-ulosa cells,22–24 SPAK deletion at those sites may interfere withAVP as well as aldosterone release. AVP release itself can alsoaffect aldosterone secretion, which may further contribute tothe endocrine phenotype in SPAK2/2.25,26 In DI rats lackingAVP, reduced aldosterone levels have been observed in spiteof a stimulated renin-angiotensin system as well, with theknown consequences of decreased N(K)CC abundance andactivity.26,27 Manifestations of SPAK deficiency such asreduced baseline phosphorylation of OSR1 and NCC maytherefore be partially related with the diminished AVP andaldosterone levels.

Figure 4. Short-term dDAVP induces phosphorylation of the regulatory domain ofSPAK but not of OSR1; immunoblotting. (A–C) Representative immunoblots from WTand SPAK2/2 kidneys at steady state (A) and after 30 minutes of vehicle or dDAVPtreatment (B and C) show two pS383-SPAK/pS325-OSR1 (pS383/pS325)–immunore-active bands between 50 and 75 kD in WT, whereas only the smaller product is clearlydetectable in SPAK2/2. The larger product probably corresponds to pSPAK and thesmaller, at least in part, to pOSR1. b-actin signals serve as the respective loadingcontrols. (D and E) Densitometric evaluation of the immunoreactive signals normalizedto loading controls shows increased signals in WT (+89% for the larger and +85% forthe smaller products) but not in SPAK2/2 kidneys upon dDAVP. Data are the mean 6SD. *P,0.05 for intrastrain differences.





Rapid activation of WNK1 and the SPAK/OSR1 kinasesupon hypertonic or hypotonic low-chloride conditions hasbeen reported.28,29 Here, short-term dDAVP-V2R stimulationrapidly increased the abundance of phosphorylated SPAK/OSR1 within their homologous catalytic domain. This wasdetected chiefly in mTAL and DCT by the recognition of acommon epitope (pT243-SPAK/pT185-OSR1).4 dDAVPtreatment also led to moderate increase in the abundance ofphosphorylated OSR1, in the SPAK2/2 animals, in which theSPAK deletion rendered the antibody specific to OSR1. Theheterogenous response to AVP along the distal tubule waslikely related with the distinct localization of upstream V2Rsignaling components such as the WNK isoforms.30 The reg-ulatory domain (pS383-SPAK/pS325-OSR1) was activatedonly in WTmice, which underlines the functional heteroge-neity between the kinases. Indeed, previous site-directed mu-tagenesis has shown that phosphorylation of SPAK at S383facilitates its activity by abolishing an autoinhibitory actionof the regulatory domain,20 whereas no such effects were de-scribed for OSR1.4

InWT,asexpectedfromprior reports,13–17

dDAVP rapidly increased the abundance ofpNKCC2 and pNCC. Interestingly, the abil-ity of dDAVP to increase pNKCC2 abun-dance was not only preserved in theSPAK2/2 animals, but was enhanced. Al-though NKCC2 phosphorylation inSPAK2/2 mice may be affected predomi-nantly by OSR1, the modest OSR1 activa-tion under these circumstances suggeststhat other kinases may be involved. By con-trast, the weak response of NCC to desmo-pressin in SPAK2/2 indicates that SPAKplays a dominant role in signaling AVP toNCC in the DCT.

Acute activation of the SPAK/OSR1-substrates, NKCC2 and NCC, occurs viatheir apical trafficking and, independentlyof this translocation, by their phosphoryla-tion at the luminal membrane.13–17 Deletionof SPAK did not affect dDAVP-induced lu-minal trafficking of NKCC2. Apart from thethus far unrecognized effect of OSR1, otherpathways involved in NKCC2 trafficking,such as cAMP/protein kinase A signaling,may be more relevant herein.18 Surface ex-pression of NCC was not altered by dDAVPin either mouse strain. This is in contrast toour previous report of dDAVP-inducedNCCtrafficking inDI rats.15 This difference, how-ever, may have resulted from differences inexperimental model; in the former study,we used DI rats, which lack any AVP at base-line. Here, WT mice, with basal AVP, wereutilized.

Because KS-SPAK may limit the activities of FL-SPAK andOSR1 in a dominant-negative fashion, the interactions ofSPAK/OSR1 isoforms with NKCC2 and NCC were studied inDI rats supplementedwith dDAVP. In agreementwithpreviousdata on the segmental distribution of SPAK and OSR1 iso-forms,9–11 the present co-immunoprecipitation experimentsrevealed prominent binding of KS-SPAK to NKCC2 and of FL-SPAK to NCC, whereas OSR1 strongly co-immunoprecipitatedwith NKCC2 but less so with NCC at baseline. Short-termdDAVP substantially modulated SPAK isoforms in their inter-action with NKCC2, providing in vivo evidence that indeed,activating as well as inhibiting kinase isoforms may competefor the RFXV/I motif.9 We believe that the AVP-induced,quantitative switch between FL- and KS-SPAK isoformsbound to NKCC2 facilitates the activation of the transporter.Binding of SPAK isoforms to NCC was unaffected. Individualadjustments of FL- and KS-SPAK therefore occur selectively inTAL as previously suggested.31 Conversely, the absence of aresponse of OSR1 isoforms to dDAVP corroborated existingdata on the heterogeneity between SPAK and OSR1.4,20 Our

Figure 5. Short-term dDAVP stimulates luminal trafficking of NKCC2 in WT andSPAK2/2 but has no effect on NCC in either genotype. (A–F) Immunogold staining ofNKCC2 in cortical TAL (A, B, E, and F) and NCC in DCT (C, D, G, and H) from WT andSPAK2/2 mice after vehicle or dDAVP treatment (30 minutes). Transporters are dis-tributed in the luminal plasma membrane (PM, arrows) and in cytoplasmic vesicles(arrowheads); a change is visualized for NKCC2 but not NCC (I and J). Numericalevaluations of PM NKCC2 signals (I) and NCC signals (J) per total of signals. Data arethe mean 6 SD. *P,0.05 for intrastrain differences.



data thus show for the first time that interactions betweenSPAK isoforms and their substrates can be selectively modu-lated in TAL and that this can be triggered by AVP.

Long-term dDAVP decreased water and electrolyte excre-tion in WTand SPAK2/2mice consistent with earlier data.32

The effects of dDAVP were less pronounced in SPAK2/2mice. This difference is likely to result from the reduction inNCC abundance and phosphorylation in these animals, atbaseline.9 The weaker NCC phosphorylation in SPAK2/2mice upon dDAVP supported this interpretation. It can beargued that a substitution with dDAVP for only 3 days maynot have been sufficient to restore the established hypotrophyof DCT in SPAK2/2 mice9; however, NCC abundance hadreached WT levels upon dDAVP. An attenuation of NCC

phosphorylation upon SPAK disruptionmust therefore be noticed. On the otherhand, the effects of long-term dDAVP onNCC reveal a previously unrecognized,SPAK-independent, stimulation ofNCC phosphorylation. This suggeststhat the increased NCC phosphorylationduring chronic treatment may be an in-direct response to physiologic changes,because acute dDAVP has little effect inSPAK2/2 animals (see above). Giventhe compensatory redistribution ofOSR1 in SPAK-deficient DCT and itsability to respond to AVP, we believethat OSR1 may partly mediate activationof NCC in the absence of SPAK.

The changes in kinase abundancesupon long-term AVP substitution inmice and rats further confirm a cleardominance of SPAK over OSR1 in therespective nephron adaptations to AVP,which include a rise in abundance andactivity of both cotransporters.27 Selec-tive changes of SPAK but not OSR1abundance have likewise been reportedafter long-term angiotensin II adminis-tration.33 Although V2R-mediated ef-fects of AVP along TAL and DCT arewell established,13–17 we cannot ruleout potential interference of dDAVPwith the renin-angiotensin system inour setting.25,26 Further studies are re-quired to dissect between the directand indirect effects of AVP in the distalnephron.

In summary, our results show anessential role for SPAK in acute AVPsignaling to NCC in the DCT. Interest-ingly, however, compensatory processesoccur during chronic V2R stimulation,which can permit AVP to stimulate NCC

in a SPAK-independentmanner. In contrast to the effects alongDCT, SPAK deletion, which increases basal NKCC2 phos-phorylation along the TAL, leads to an enhanced acute dDAVPeffect onNKCC2. As shown diagrammatically in Figure 11, thedominant inhibitory KS-SPAK and the stimulatory FL-SPAKvariants were modulated differentially in response to AVP toselectively bind to and control the activation of NKCC2,whereas the phosphorylation of NCC was chiefly governedby FL-SPAK. By contrast, OSR1 appeared to exert predomi-nantly baseline functions, mainly in TAL, where its activitymay be highly dependent on KS-SPAK abundance. Our datathus identify SPAK as a crucial kinase that differentially regu-lates Na+ reabsorption in the renal cortex and medulla underthe endocrine control of AVP.

Figure 6. SPAK disruption facilitates short-term dDAVP-induced NKCC2 phosphor-ylation but attenuates NCC phosphorylation. Taking into account the dramatic dif-ferences in steady state phosphorylation of NKCC2 and NCC between genotypes,immunoblots from WT and SPAK2/2 kidney extracts are run in parallel and the de-tection conditions are adapted to obtain a linear range for adequate signal genera-tion. (A and B) Representative immunoblots from WT (A) and SPAK2/2 kidneys (B)after 30 minutes of vehicle or dDAVP treatment showing NKCC2, pT96/pT101-NKCC2, NCC, pS71-NCC, and pT58-NCC immunoreactive bands (all approximately160 kD). b-actin signals serve as the respective loading controls (approximately 40 kD).(C and D) Densitometric evaluation of immunoreactive signals normalized for theloading controls. Data are the mean 6 SD. *P,0.05 for intrastrain differences.



CONCISE METHODS

Animals, Tissues, and TreatmentsAdult (aged 10–12 weeks) male WT and SPAK2/2 mice9 and Brat-

tleboro rats with central DI rats (aged 10–12 weeks) were kept on

standard diet and tap water. For evaluation

of short-term AVP effects, mice and DI rats

were divided into groups (n=8 for mice [4

mice for morphologic- and 4 mice for bio-

chemical evaluation] and n=5 for rats [bio-

chemical analysis only]) receiving dDAVP

(1 mg/kg body weight) or vehicle (saline) for

30 minutes by intraperitoneal injection. A su-

praphysiologic dose was chosen in order to

reach saturation of AVP signaling, because

SPAK2/2 had lower baseline AVP levels than

WT mice (0.7 versus 1.5 ng/ml; P,0.05).

Plasma AVP levels were determined using

ELISA (Phoenix Pharmaceuticals, Burlingame,

CA); to this end, blood was collected from the

vena cava concomitantly with organ removal.

For the long-term study of AVP, WT- and

SPAK2/2 mice and DI rats were divided into

groups receiving 5 ng/h dDAVP or saline as ve-

hicle (n=3 in each group of mice and n=6 in

each group of rats) for 3 days via osmoticmini-

pumps (Alzet). Rats received normal food and

tap water ad libitum. Mice received a water-

enriched food in order to keep endogenous

AVP levels low; food was prepared as de-

scribed.34Mice received this food (21 g/animal)

for 3 days before implantation of the mini-

pumps and during treatment. After minipump

implantation, mice were individually placed in

metabolic cages and urine was collected dur-

ing the last 24 hours of the experiment. Plasma

and urine sodium, potassium, chloride, and

creatinine concentrations were determined

and the FE of electrolytes calculated. Formor-

phologic evaluation, mice were anesthetized

and perfusion-fixed retrogradely via the

aorta using 3% paraformaldehyde.13,15

For biochemical analysis, mice and rats were

sacrificed and the kidneys removed. All ex-

periments were approved by the Berlin Senate

(permission G0285/10) and Oregon Health &

Science University Institutional Animal Care

and Usage Committee (Protocol A858).

ImmunohistochemistryAntibodies against NKCC2,13 NCC,15 pNCC

(pT53, pT58, and pS71ofmouseNCC),10,11,15

SPAK (C-terminal antibody; Cell Signaling),

OSR1 (University of Dundee),4 and phos-

phorylated SPAK-OSR1 (pT243-SPAK/

pT185-OSR1; antibody recognizes pT243 of mouse SPAK and pT185

of mouse OSR1 [T-loop; University of Dundee] and pS383-SPAK/

pS325-OSR1; antibody recognizes pS383 of mouse SPAK and pS325

of mouse OSR1 [S-motif; University of Dundee])4 were applied as

primary antibodies. For detection of phosphorylated kinases and

Figure 7. Short-term dDAVP selectively modulates interactions of SPAK variants withNKCC2 but has no effects on OSR1. (A and B) Representative immunoblots of pre-cipitates obtained after immunoprecipitation of NKCC2 from medullary (A) or NCCfrom cortical kidney homogenates (B) of DI rats treated with vehicle or dDAVP (30minutes). NKCC2-, NCC-, C-SPAK- (full-length SPAK, translationally truncated SPAK2,and kidney-specific truncated splice SPAK variant), and OSR1-immunoreactive bands(full-length and truncated OSR1 forms) are depicted. IgG bands are recognizedowing to the identical host species for antibodies to NKCC2 and SPAK. Controlimmunoprecipitation with IgG is performed to exclude nonspecific binding of co-immunoprecipitates. (C and D) Results of densitometric quantification of single SPAK-and OSR1 isoforms normalized to NKCC2- (C) or NCC signals (D) and evaluation ofFL-SPAK/KS-SPAK ratios. Data are the mean 6 SD. *P,0.05 for intrastrain differences.(E and F) Effects of dDAVP stimulation were verified by parallel increases of pNKCC2or pNCC signals in kidney extracts obtained before immunoprecipitation. IP, immu-noprecipitation; FL, full-length; KS, kidney specific; T, truncated; n.d., not detectable,indicates no significant signal.



transporters, the antibodieswere preabsorbedwith corresponding non-

phosphorylated peptides in 10-fold excess before the application on

kidney sections. Cryostat sections from mouse and rat kidneys were

incubated with blocking medium (30 minutes), followed by primary

antibody diluted in blocking medium (1 hour). For multiple staining,

antibodies were sequentially applied, separated by washing step. Fluo-

rescent Cy2-, Cy3-, or Cy5-conjugated antibodies (DIANOVA) or

horseradish peroxidase–conjugated antibodies (Santa Cruz Biotechnol-

ogy) were applied for detection. Sections were evaluated in a Leica

DMRB or a Zeiss confocal microscope (LSM 5 Exciter). For confocal

evaluation of pSPAK/OSR1 and pNCC signal intensities, kidney sec-

tions were double-stained for NKCC2 or NCC to identify TAL and

DCT, respectively. At least 20 similar tubular profiles were evaluated

per individual animal. Intensities of the confocal fluorescent signals

were scored across each profile using ZEN2008 software (Zeiss), and

mean values within 2mmdistance at the apical side of each tubule were

obtained. Background fluorescence levels were determined over cell

nuclei and subtracted from the signal.

Ultrastructural AnalysesFor immunogold evaluation of NKCC2 and NCC, perfusion-fixed

kidneys were embedded in LR White resin. Ultrathin sections were

incubated with primary antibodies to NKCC2 or NCC.13,15 Signal was

detected with 10-nm nanogold-coupled secondary antibodies

(Amersham) and visualized using transmission electron microscopy.

Quantification of immunogold signals in TAL and DCT profiles was

performed onmicrographs according to an established protocol.35Gold

particles were attributed to the apical cell membrane when located near

(within 20 nm of distance) or within the bilayer; particles found below

20 nm of distance to the membrane up to a depth of 2 mm or until the

nuclear envelope were assigned to cytoplasmic localization. At least 10

profiles and 4–5 cells per profile were evaluated per individual animal.

Immunoblotting and Co-ImmunoprecipitationFor immunoblotting, kidneys were homogenized in buffer containing

250mMsucrose, 10mMtriethanolamine, protease inhibitors (Complete;

Roche Diagnostics), and phosphatase inhibitors (Phosphatase Inhibitor

Cocktail 1; Sigma) (pH 7.5) and nuclei removed by centrifugation

(10003g for 15minutes). Supernatants (postnuclear homogenates) were

separated in 10% polyacrylamide minigels, electrophoretically trans-

ferred to polyvinylidenefluoridemembranes, anddetectedusing primary

antibodies against NKCC2, pT96/T101-NKCC2, NCC, pT58-NCC,

pS71-NCC, SPAK, pSPAK-OSR1,4,9,10,13,15 b-actin (Sigma), or glycer-

aldehyde-3-phosphate dehydrogenase (Santa Cruz Biotechnology),

horseradish peroxidase–conjugated secondary antibodies, and chemi-

luminescence exposure of x-ray films. Films were evaluated densito-

metrically. Immunoprecipitation of NKCC2 from rat medullary

kidney homogenates or NCC from rat cortical homogenates was per-

formed overnight at 4°C in TBS/0.5% Tween using anti-NKCC2

(Millipore) or anti-NCC15 antibodies covalently bound to Dynabeads

M-270 Epoxy (Invitrogen). The detergent concentration was estab-

lished by testing a concentration range from 0.1% to 2% Tween. The

co-immunoprecipitated products were detected by immunoblotting as

described above. The specificity of the co-immunoprecipitation experi-

ments was confirmed by IgG controls.

Figure 8. SPAK disruption attenuates dDAVP-induced water andelectrolyte retention at long term. (A) Water-enriched diet (foodmixed with a water-containing agar) during 3 days before dDAVPor vehicle administration strongly decreases endogenous plasmaAVP levels in both genotypes compared with normal AVP levels inWT mice on a regular diet. (B–E) Urine volume and FENa, FECl,and FEK are shown. The two-tailed t test is utilized to analyze theintrastrain differences between vehicle and dDAVP treatments(*P,0.05), whereas the differences in strength of dDAVP effectsbetween WT and SPAK2/2 mice are evaluated by two-wayANOVA (**P,0.05). Data are the mean 6 SD. WD, water-enriched diet; RD, regular diet.



Cloning of Rat KS-SPAKFor identification of the alternatively spliced KS.-SPAK in rat kidney

cDNA primers were designed based on alignment of rat intron 5 with

mouse exon 5A sequence and two primer pares were selected from

regions of aligned sequence with low homology to mouse exon 5A to

reduce the possibility of amplifying mouse cDNA (forward primer 59

CATGTGTATGCCAGATTCATCTCGAAAGAG 39 [putative exon

5A] + reverse primer 59 GGGCTATGTCTGGTGTTCGTGTCAGCA

39 [exon 10], predicted PCR product size 510 bp and forward primer

59 CCCAGGCTTTGTGGCTTTGGGTAAC 39 [putative exon 5A] +

reverse primer 59CAGGGGCCATCCAACATGGGG 39 [exon 6], pre-

dicted PCR product size 363 bp). RT-PCR was performed using total

RNA extracted fromwhole rat kidney and PCR products were cloned

into pGEMT-easy vector and verified by sequencing.

Figure 9. SPAK disruption selectively attenuates activation ofNCC upon long-term dDAVP. (A) Representative immunoblotsfrom WT and SPAK2/2 kidneys after 3 days of vehicle or dDAVPtreatment showing NKCC2, pT96/pT101-NKCC2, NCC, pS71-NCC, and pT58-NCC immunoreactive bands (all approximately160 kD). GAPDH signals serve as the respective loading controls(approximately 40 kD). (B) Densitometric evaluation of immuno-reactive signals normalized to loading controls and calculation ofpNCC/NCC ratios. Values obtained in WT after vehicle applica-tion are set at 100%. Data are the mean 6 SD. *P,0.05 for in-trastrain differences (vehicle versus dDAVP); §P,0.05 for baselineinterstrain differences (WT versus SPAK2/2 upon vehicle); $P,0.05for different responses to dDAVP in WT versus SPAK2/2 genotypesas analyzed by two-way ANOVA. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Figure 10. Long-term dDAVP increases abundances of SPAK butnot OSR1 variants. (A) Representative immunoblots showing SPAKandOSR1 immunoreactive bands in kidneys fromWT and SPAK2/2mice after 3 days of vehicle or dDAVP treatment. GAPDH bandsbelow the corresponding immunoblots serve as loading controls.(B) Densitometric evaluation of single immunoreactive bands nor-malized to loading controls. Values obtained in WT after vehicleapplication set as 100%. Data are the mean 6 SD. *P,0.05 for in-trastrain differences (vehicle versus dDAVP). GAPDH, glyceralde-hyde-3-phosphate dehydrogenase; n.d., not detectable, indicatesno significant signal.



Statistical AnalysesResults were evaluated using routine parametric statistics. Groups

were compared by means of the t test or, if the data violated a normal

distribution, the nonparametric Mann–Whitney test. The two-way

ANOVAwith Bonferroni correctionwas utilized to analyze the differ-

ences in effect of dDAVP between WT and SPAK2/2 genotypes. A

probability level of P,0.05 was accepted as significant. All results are

expressed as the mean 6 SD.

ACKNOWLEDGMENTS

The authors thank Kerstin Riskowski, Petra Schrade, John Horn,

Shaunessy Rogers, and Joshua Nelson for assistance and advice.

This work was supported by Deutsche Forschungsgemeinschaft

(FOR667).

DISCLOSURESNone.

REFERENCES

1. GambaG:Molecular physiology andpathophysiology of electroneutralcation-chloride cotransporters. Physiol Rev 85: 423–493, 2005

2. Simon DB, Karet FE, Hamdan JM, DiPietro A, Sanjad SA, Lifton RP:Bartter’s syndrome, hypokalaemic alkalosis with hypercalciuria, iscaused by mutations in the Na-K-2Cl cotransporter NKCC2.Nat Genet13: 183–188, 1996

3. Simon DB, Nelson-Williams C, Bia MJ, Ellison D, Karet FE, Molina AM,Vaara I, Iwata F, Cushner HM, KoolenM, Gainza FJ, Gitleman HJ, LiftonRP: Gitelman’s variant of Bartter’s syndrome, inherited hypokalaemicalkalosis, is caused by mutations in the thiazide-sensitive Na-Cl co-transporter. Nat Genet 12: 24–30, 1996

4. Vitari AC, Deak M, Morrice NA, Alessi DR: The WNK1 and WNK4protein kinases that are mutated in Gordon’s hypertension syndromephosphorylate and activate SPAK andOSR1protein kinases.Biochem J

391: 17–24, 20055. Uchida S: Pathophysiological roles of WNK kinases in the kidney.

Pflugers Arch 460: 695–702, 20106. Richardson C, Alessi DR: The regulation of salt transport and blood

pressure by the WNK-SPAK/OSR1 signalling pathway. J Cell Sci 121:3293–3304, 2008

7. Piechotta K, Lu J, Delpire E: Cation chloride cotransporters interact withthe stress-related kinases Ste20-related proline-alanine-rich kinase(SPAK) and oxidative stress response 1 (OSR1). J Biol Chem 277:50812–50819, 2002

8. Richardson C, Sakamoto K, de los Heros P, Deak M, Campbell DG,Prescott AR, Alessi DR: Regulation of the NKCC2 ion cotransporter bySPAK-OSR1-dependent and -independent pathways. J Cell Sci 124:789–800, 2011

9. McCormick JA, Mutig K, Nelson JH, Saritas T, Hoorn EJ, Yang CL,Rogers S, Curry J, Delpire E, Bachmann S, Ellison DH: A SPAK isoformswitch modulates renal salt transport and blood pressure. Cell Metab

14: 352–364, 201110. Yang SS, Lo YF, Wu CC, Lin SW, Yeh CJ, Chu P, Sytwu HK, Uchida S,

Sasaki S, Lin SH: SPAK-knockoutmicemanifestGitelman syndrome andimpaired vasoconstriction. J Am Soc Nephrol 21: 1868–1877, 2010

11. Lin SH, Yu IS, Jiang ST, Lin SW, Chu P, Chen A, Sytwu HK, Sohara E,Uchida S, Sasaki S, Yang SS: Impaired phosphorylation of Na(+)-K(+)-2Cl(-) cotransporter by oxidative stress-responsive kinase-1 de-ficiency manifests hypotension and Bartter-like syndrome. Proc Natl

Acad Sci U S A 108: 17538–17543, 201112. McCormick JA, Ellison DH: The WNKs: Atypical protein kinases with

pleiotropic actions. Physiol Rev 91: 177–219, 2011 [Review]13. Mutig K, Paliege A, Kahl T, Jöns T, Müller-Esterl W, Bachmann S: Vaso-

pressinV2 receptorexpressionalong rat,mouse, andhuman renal epitheliawith focus on TAL. Am J Physiol Renal Physiol 293: F1166–F1177, 2007

14. Giménez I, Forbush B: Short-term stimulation of the renal Na-K-Cl co-transporter (NKCC2) by vasopressin involves phosphorylation andmembrane translocation of the protein. J Biol Chem 278: 26946–26951, 2003

15. Mutig K, Saritas T, Uchida S, Kahl T, Borowski T, Paliege A, Böhlick A,Bleich M, Shan Q, Bachmann S: Short-term stimulation of the thiazide-sensitive Na+-Cl- cotransporter by vasopressin involves phosphoryla-tion and membrane translocation. Am J Physiol Renal Physiol 298:F502–F509, 2010

16. Pedersen NB, Hofmeister MV, Rosenbaek LL, Nielsen J, Fenton RA:Vasopressin induces phosphorylation of the thiazide-sensitive sodiumchloride cotransporter in the distal convoluted tubule. Kidney Int 78:160–169, 2010

17. Welker P, Böhlick A, Mutig K, Salanova M, Kahl T, Schlüter H, BlottnerD, Ponce-Coria J, Gamba G, Bachmann S: Renal Na+-K+-Cl- co-transporter activity and vasopressin-induced trafficking are lipid raft-dependent. Am J Physiol Renal Physiol 295: F789–F802, 2008

18. AresGR,CaceresPS,Ortiz PA:Molecular regulationofNKCC2 in the thickascending limb. Am J Physiol Renal Physiol 301: F1143–F1159, 2011

19. van Vonderen IK, Wolfswinkel J, Oosterlaken-Dijksterhuis MA, RijnberkA, Kooistra HS: Pulsatile secretion pattern of vasopressin under basalconditions, after water deprivation, and during osmotic stimulation indogs. Domest Anim Endocrinol 27: 1–12, 2004

20. Gagnon KB, Delpire E: On the substrate recognition and negativeregulation of SPAK, a kinase modulating Na+-K+-2Cl- cotransport ac-tivity. Am J Physiol Cell Physiol 299: C614–C620, 2010

Figure 11. Proposed model of AVP-WNK-SPAK/OSR1-NKCC2/NCC signaling in the distal nephron. Arrows indicate the down-stream effects of V2R activation, and the T bar indicates inhibition.The thickness of the arrows indicates the significance of the re-spective kinases and their actions in AVP-induced phosphorylationof NKCC2 or NCC. Boxes shaded in gray indicate phosphoacceptorsites activated by AVP signaling. In TAL, AVP attenuates the in-hibitory action of KS-SPAK (cross) and facilitates the actions ofFL-SPAK and OSR1. In DCT, expression of KS-SPAK is nearly absentand FL-SPAK plays the dominant role in AVP signaling. It is presentlyunclear which WNK isoforms mediate AVP signaling upstream ofSPAK/OSR1.



21. Rafiqi FH, Zuber AM, Glover M, Richardson C, Fleming S, Jovanovi�c S,Jovanovi�c A, O’Shaughnessy KM, Alessi DR: Role of the WNK-activatedSPAK kinase in regulating blood pressure. EMBO Mol Med 2: 63–75,2010

22. Piechotta K, Garbarini N, England R, Delpire E: Characterization of theinteraction of the stress kinase SPAK with the Na+-K+-2Cl- co-transporter in the nervous system: Evidence for a scaffolding role of thekinase. J Biol Chem 278: 52848–52856, 2003

23. Nugent BM, Valenzuela CV, Simons TJ, McCarthy MM: Kinases SPAKand OSR1 are upregulated by estradiol and activate NKCC1 in thedeveloping hypothalamus. J Neurosci 32: 593–598, 2012

24. UshiroH,TsutsumiT,SuzukiK,KayaharaT,NakanoK:Molecular cloningandcharacterization of a novel Ste20-related protein kinase enriched in neuronsand transporting epithelia. Arch Biochem Biophys 355: 233–240, 1998

25. Mazzocchi G, Malendowicz LK, Rocco S, Musajo F, Nussdorfer GG:Arginine-vasopressin release mediates the aldosterone secretagogueeffect of neurotensin in rats. Neuropeptides 24: 105–108, 1993

26. Möhring J, Kohrs G, Möhring B, Petri M, Homsy E, Haack D: Effects ofprolonged vasopressin treatment in Brattleboro rats with diabetes in-sipidus. Am J Physiol 234: F106–F111, 1978

27. Ecelbarger CA, Kim GH, Wade JB, Knepper MA: Regulation of theabundance of renal sodium transporters and channels by vasopressin.Exp Neurol 171: 227–234, 2001

28. Zagórska A, Pozo-Guisado E, Boudeau J, Vitari AC, Rafiqi FH, ThastrupJ, Deak M, Campbell DG, Morrice NA, Prescott AR, Alessi DR: Regu-lation of activity and localization of the WNK1 protein kinase by hy-perosmotic stress. J Cell Biol 176: 89–100, 2007

29. Richardson C, Rafiqi FH, Karlsson HK, Moleleki N, Vandewalle A,Campbell DG,Morrice NA, Alessi DR: Activation of the thiazide-sensitive

Na+-Cl- cotransporter by the WNK-regulated kinases SPAK and OSR1.J Cell Sci 121: 675–684, 2008

30. OhnoM, Uchida K,Ohashi T, Nitta K,Ohta A, ChigaM, Sasaki S, UchidaS: Immunolocalization of WNK4 in mouse kidney. Histochem Cell Biol136: 25–35, 2011

31. Reiche J, Theilig F, Rafiqi FH, Carlo AS, Militz D, Mutig K, Todiras M,Christensen EI, Ellison DH, Bader M, Nykjaer A, Bachmann S, Alessi D,Willnow TE: SORLA/SORL1 functionally interacts with SPAK to controlrenal activation of Na(+)-K(+)-Cl(-) cotransporter 2. Mol Cell Biol 30:3027–3037, 2010

32. Perucca J, Bichet DG, Bardoux P, Bouby N, Bankir L: Sodium excretionin response to vasopressin and selective vasopressin receptor antag-onists. J Am Soc Nephrol 19: 1721–1731, 2008

33. van der LubbeN, LimCH, Fenton RA,MeimaME, JanDanser AH, ZietseR, Hoorn EJ: Angiotensin II induces phosphorylation of the thiazide-sensitive sodium chloride cotransporter independent of aldosterone.Kidney Int 79: 66–76, 2011

34. Bouby N, Bachmann S, Bichet D, Bankir L: Effect of water intake on theprogression of chronic renal failure in the 5/6 nephrectomized rat.Am JPhysiol 258: F973–F979, 1990

35. Sandberg MB, Riquier AD, Pihakaski-Maunsbach K, McDonough AA,Maunsbach AB: ANG II provokes acute trafficking of distal tubule Na+-Cl(-) cotransporter to apical membrane. Am J Physiol Renal Physiol293: F662–F669, 2007

This article contains supplemental material online at http://jasn.asnjournals.org/lookup/suppl/doi:10.1681/ASN.2012040404/-/DCSupplemental.





SPAK Differentially Mediates Vasopressin Effects on...

Documents

Transcript of SPAK Differentially Mediates Vasopressin Effects on...