71 

South Asian J Exp Biol; 3 (2): 71‐83; 2013 

ISSN: 2230‐9799                Vol. 3, Issue 2, Page 71‐83                                        http://www.sajeb.org  REGULAR ARTICLE 

 

Genetic  diversity  of  Callosobruchus  maculatus  Fabricus  (Cowpea     weevil) populations in various agro‐ecological areas of five countries in West African sub‐region  Eugène  Mbar  Tine1, 2,Toffène  Diome1, 2,  Kebe  Khadim1, 2,  Assane  Ndong1, 2,  Ali  Douma3,  Guil‐laume Ketoh5, Antoine Sanon4 and Mbacké Sembene1, 2 

 1Départment of Animal Biology, Faculty of Science and Technology, University C.A. Diop, P. Box 5005 Dakar, Senegal 2BIOPASS UMR 022 IRD‐CBGP Bel‐Air, P.O. Box. 1386 Dakar, Senegal 3University Abdou Moumouni of Niamey, Faculty of Science, P. Box. 10662, Niamey, Niger 4Laboratory of entomology, University of Ouagadougou, Burkina Faso 5Laboratory of entomology, Faculty of Science, University of Lome, P. Box. 1515, Lome, Togo  

ART ICLE   INFO   Article History: Received: 11 Mar 2013 Revised: 22 Apr 2013 Accepted: 22 Apr 2013  *Corresponding Author: Telephone: (00221) 77 408 59 28 Email: eugenetine2000@yahoo.fr   Keywords:  Callosobruchus  macula‐tus,  Cytochrome  b,  28S  ribosomal gene, Sequencing, West Africa           

ABSTRACT   The cowpea  (Vigna unguiculata  (L) Walp)  is a  legume of African origin.  It  is source of very  important nutritional needs  like protein and vitamins for the developing countries especially countries of West Africa. The attack by  the Bruchinae seed‐beetle Callosobruchus maculatus (Fab) whose larvae develop in seeds causes losses ranging from 30 to over 80% of the harvest between 6‐7months of storage. The objectives of this study were to identify the differ‐ent haplotypes of the weevils’ West African sub‐region, to study genetic di‐versity in different agro‐ecological zones and then highlight the phylogenetic affinities between  the weevils  from  these different areas.  In  this study, we have analysed  the sequences of  the mitochondrial gene cytochrome b and 28S ribosomal gene  in 75  individuals. 42 haplotypes for cytochrome b have been identified in three clades against 30 for the 28S divided into two clades. Individual haplotypes were mainly from the Guinean zone. Genetic distance and nucleotide diversity showed a  trend of population structure of weevils between  the different  agro‐ecological  zones.  This work  is  corroborated by low values of diversity within the zones and highly significant between them. Although Sudanian’ zone seemed not to confirm this view because of a rela‐tively small percentage of alignment for individuals from Tenkodogo (Burkina Faso). The phylogenetic reconstructions have thus shown that gene flow was maintained even if it remained within narrow zones between agro‐ecological zones for the populations of West African C. maculatus. 

1. Introduction 

The  cowpea  (Vigna unguiculata  L. Walp), plant of African  origin,  is  after  the  peanut  (Arachis  hypo‐gaea  L.),  the most  cultivated  leguminous  in Africa and Asia.  It  presents  an  important  source of  pro‐

teins and vitamins  for  the populations  in develop‐ing  countries  especially  in West  Africa  (Ndiaye  et al.,  2011). However  due  to  a  number  of  diseases and pests which attacks  the cowpea,  its yields are low despite the attempts to varietal improvements 

 72 

Mbar Tine et al., South Asian J Exp Biol; 3 (2): 71‐83; 2013 

brought on the plant  (Diaw, 1999). Of these pests, the most harmful to cowpea  is the Bruchinae Bee‐tle  Callosobruchus maculatus  Fabricus  (Ndiaye  et al., 2011). The  larvae  feed on  the  cowpea’s  seeds especially  in  the  fields  and  during  storage  (Seck, 1994).  In Senegal, Seck  (1994) estimated  that 50% of the seeds are destroyed within six months stor‐age. Approximately 30% of the annual cowpea pro‐duction in Niger and 80% in Togo and Burkina Faso is  destroyed  by  C.  maculatus  (Alzouma,  1995; Ngamo and Hance, 2007). 

Climate change has conditioned an increase in rain‐fall  variability  in  the  equatorial  regions  (Dore, 2005).  West  Africa  offers  three  principal  agro‐ecological  zones:  the  Sahelian  dry  zone,  the  Su‐danian  semi‐arid  zone  and  Guinean  humid  zone. Cowpea is cultivated in all these zones because it is adapted to many types of agro‐climates because of the multiplicity  of  these  cultivars  and  the  varietal improvement  technology  (Brink  and  Balay,  2006). The  variability of  rainfall  and  therefore of  vegeta‐tion  in these various zones would  impact on biodi‐versity  induced by changes  in  the natural environ‐ment  (Saïdou,  2011).  Thus  the  current  gene  flow between populations  is  likely  to be  interrupted as adaptability  to  the  agro‐climatic  conditions would change the operating mode and the morphology of individuals subject to the  laws of natural selection. Differences  between  these  zones  may  lead  to  a restructuring  of  C. maculatus  populations’  in  the West African sub‐region. 

While analyzing’s DNA samples  from  individuals of C.  maculatus  infesting  cowpea  in  various  agro‐ecological  zones  in West Africa, our particular ob‐jectives were:  i)  to evaluate  the number of differ‐ent haplotypes found in the sub‐region, ii) to evalu‐ate  their genetic diversity  from  the parameters of genetic distances and nucleotide diversity and phy‐logenetic  affinities  between  populations.  This will allow us  to see  if  these bruchids are structured or not depending on the agro‐ecological zones consid‐ered. To reach  those objectives we performed  the PCR‐Sequencing of the mitochondrial cytochrome b gene and 28S ribosomal  gene. 

2. Materials and Methods 

2.1. Sampling 

Fourteen samples of cowpea seeds were collected during  the  dry  period  for  two  years  (2009  and 2010) in five countries in West Africa as mentioned in  Table  1.  Sampling  consisted  to  take  a  certain 

amount of cowpea  seeds  infested  in  several attics or  storage  areas  for  the  same  locality  in order  to gather  as  much  information  as  possible  for  the given  locality. The  samples were  then  transported to  the  laboratory  for  mass  rearing.  Adults  of  C. maculatus were obtained by  rearing  larvae  infest‐ing  these seeds and were  fixed and stored  in 96% ethanol  until  used  for  genetic  studies.  Samples were distinguished by  two  criteria:  the geographi‐cal  origin  and  agro‐ecological  zone  sampled.  Each sample was coded using the first two letters of the country  (Mali and Niger) or  initials of  the  country (Burkina  Faso  and  Senegal)  and  the  first  letter  of the place of harvest. For Togo we used the first let‐ter of  the country  followed  the  first  two  letters of the place of harvest. 

2.2. Genetic study  

2.2.1. Genotyping of Cytochrome b and 28S  in C. maculatus 

DNA extraction of C. maculatus was made using the Qiagen  DNeasy  Tissue  Kit.  The  insects  were  dis‐sected. Only the chest and legs were used to avoid contamination by fungi or bacteria that are usually in  the abdomen and elytra of  the  insect. PCR was performed on the mitochondrial gene coding: cyto‐chrome b. This gene was amplified using the prim‐ers  CB1  (5’‐TATGTACTACCATGAGGACAAATATC‐3’) and  CB2  (5’‐ATTACACCTCCTAATTTATTAGGAAT‐3'). The Cytochrome b gene was revealed polymorphic and discriminative in other insects in previous stud‐ies (Sembène, 2000). The 28S (ribosomal gene) was also  amplified  by  another  primers  D2CFD45F  (5'‐TACCGTGAGGGAAAGTTGAAA‐3’)  and  D2CRD45R (5'‐AGACTCCTTGGTCCGTGTTT‐3').  Amplification was performed  in  a  reaction  volume of 25µl  con‐taining 18.3µl of water, 2.5µl of buffer 10 x, 1µl of additional  MgCl2,  0.5µl  of  dNTP,  0.25µl  of  each primer,  0.2µl  of  Taq  polymerase  and  2µl  of  DNA extract. PCR were performed  for 35  cycles on Ep‐pendorf Thermocycler with the amplification condi‐tions as  indicated  in Table 2. DNA  fragments were visualized on a 1.5% agarose gel. Samples that am‐plified were purified  and  sent  to Macrogen Korea for sequencing. 

2.3. Statistical analysis  

Alignment was done by ClustalW (Thompson et al., 1994)  as  implemented  in  BioEdit.7.0.8  software. The  alignments  were manually  checked  and  cor‐rected. Haplotypes were  identified and verified by the software v. DNASP4.10 (Rozas and Rozas, 2005) 

 73 

Mbar Tine et al., South Asian J Exp Biol; 3 (2): 71‐83; 2013 

and Arlequin  3.0.  (Excoffier  et  al.,  2005).  Correla‐tion  tests  of  the  genetic  distance  and  the  geo‐graphical  distance  between  populations  (Mantel test) were conducted by the Pearson bilateral cor‐relation in the software XLSTAT 2011. The resulting data were subsequently used to calculate the stan‐dard clues of genetic variations such as the position and  the nature of  the mutations,  the  genetic dis‐tance  intra/inter  groups,  the  number  of  polymor‐phic  sites,  conserved  sites,  singleton  sites,  segre‐gating  sites  and  parsimony  informative  sites.  The transitions/transversions  rate bias  (R) and  the  fre‐quency of nucleotides are also calculated with the very  software MEGA4  by  the  substitution  Pattern test. Phylogenetic relationships were reconstructed with  MEGA4  software  v.4.0.0.162  using  the Neighbor‐Joining  method  (N‐J),  (Saitou  and  Nei, 1987)  based  on  ecotypes’  matrix  of  genetic  dis‐tance  (the  Kimura‘s  distance  2‐parameter)  was taken two by two in order to model the evolution‐ary  processes.  The  Maximum  Parsimony  method (MP), (Ficht, 1971) was carried out with the heuris‐tic search option with random stepwise taxon addi‐tion replicates, using the branch swapping  tree bi‐section‐reconnection  option.  A  bootstrap  proce‐dure  (500  iterations with  the same option of heu‐ristic  search)  was  used  to  establish  the  score  of 

each node  (Felsenstein, 1981) by  retaining groups compatible with  the 50% majority  rule consensus. A  strict  consensus  tree  was  computed  whenever multiple equally parsimonious trees were obtained. The Maximum Likelihood method (ML, Felsenstein, 1981) was used to test all the stories that may have led  to  the  current data  set analysed. This analysis was performed by MEGA version5.0. Node stability was  evaluated  using  100  bootstrapping  replica‐tions,  and  the majority‐rule  consensus  trees were conducted.  In  all  phylogenetic  analyses  Caryedon serratus was considered as out‐group. 

3. Results  

3.1. Nucleotide variability 

Of  the 110  starting  sequences, only 75  sequences were chosen, because after alignment, there were individuals which were  in  the  sequences  of  cyto‐chrome  b  and  they  were  not  sequenced  in  28S gene and vice versa. Thus, we found it necessary to work on  the  sequences obtained  in both portions of the two genes. Allowing to have the 75 individu‐als  sampled,  three  from  Burkina  Faso,  16  from Mali, 6  from Niger, 26  from  Senegal  and 24  from Togo.  Cytochrome  b with  451  base  pairs  has  280 conserved  sites, 171  variable  sites, 107  singletons and 64 parsimony  informative sites  (Figure 1). The 

Country  Locality  Number of  Individuals 

Code of  Individuals 

Agro‐ecological  zone 

Year of  sampling 

Burkina Faso  Tenkodogo  3  Bf  Sudanian  2010 

Mali  Benkorowéré  8  MaB  Sahelian  2010 

Sikasso  8  MaS  Sudanian  2009 

Niger  Niamey  6  NiN  Sahelian  2009 

  Sénégal 

Coki  3  SnC  Sahelian  2010 

Kébémer  9  SnK  Sahelian  2009 

Fouta  5  SnF  Sahelian  2010 

Tambacounda  9  SnT  Sudanian  2009 

    Togo 

Adidogome  2  TAd  Guinean  2010 

Assigame  4  TAs  Guinean  2010 

Dapaong  4  TDa  Guinean  2010 

Gbossine  5  TGb  Guinean  2010 

Mango  5  TMa  Guinean  2010 

Tsevié  4  TTs  Guinean  2010 

Table 1: indicates the countries, localities, number of scored individuals, and sample code of individuals, area’s climate and year of the populations analyzed. 

PCR conditions  Preliminary denaturation 

Number of cycles 

Initial dena‐turation 

Hybridization  Elongation  Final elongation 

T°C  Time  T°C  Time  T°C  Time  T°C  Time  T°C  Time 

Cytochrome b  94  3mn  35  94  1mn  47  1mn  72  1mn  72  10mn 

28 S  94  3mn  35  92  30s  55  30s  72  1mn  72  10mn 

Genes 

Table 2: Comparison of amplification conditions of studied genes.  

 74 

Mbar Tine et al., South Asian J Exp Biol; 3 (2): 71‐83; 2013 

nucleotide frequency was 0.362 for adenine, 0.299 for thymine, 0.227 for guanine and 0.112 for cyto‐sine. The mutation  rate of  transition  type was  the order  of  78.15%  while  21.85%  are  transversions. The  ratio  (R)  transition  /  transversion  are  2.04 (Figure  2  and  figure  3).  The  fraction  of  404  base pairs of  the 28S conserved 260 sites  for 144 poly‐morphic  sites, 94  singletons and 31 parsimony  in‐formative sites (Figure 1). The nucleotide frequency is 0.153  for adenine, 0.244  for  thymine, 0.321  for guanine  and  0.282  for  cytosine.  65.28%  of muta‐tions are transition‐type, 21.53% were transversion type and 13.19 were deletions. The ratio (R) transi‐tion / transversion was 4.16 (Figure 2 and figure 3). 

3.2. Diversity and genetic distances 

3.2.1.  Diversity  and  genetic  distance  of  Cyto‐chrome b 

Comparison  of  genetic  diversity  parameters  of  C. maculatus in different agro‐ecological zones (Figure 4) shown that the Guinean area, with 24 individuals presented  the  most  haplotypes  (19  haplotypes) while  the Sudanian zone  for 20  individuals had 11 haplotypes.  The  Sahelian  zone  had  16  haplotypes for  a  total  of  31  individuals.  The  genetic  distance between  agro‐ecological  zones was  the  largest  in Sudanian zone with a value of 0.038. The value of nucleotide diversity (π) was 0.035162 which confir‐med the variability that was expressed in this zone. Individuals in the Sahelian zone had the lowest va‐lues of genetic diversity. Their genetic distance and nucleotide  diversity  (π)  took  the  values  of  0.019 and 0.018168. Guinean was the  intermediate zone with distances and diversity values equal  to 0.022 and 0.021530. 

Comparison of genetic distances between different areas  showed  that  the  couple  formed  by  the  Su‐danian  and  the  Guinean  zones  has  the  highest value: 0.031. The  shortest distance was  found be‐tween  the  Guinean  area  and  the  Sahelian  zone which  was  0.022.  Between  it  and  the  Sudanian zone genetic distance was 0.029 (Figure 5). 

3.2.2. Diversity and genetic distance of 28S  ribo‐somal gene 

The  calculation  of  genetic  distances  with  the  se‐quences of 28S  (Figure 6) were  in agreement with the results obtained with cytochrome b. The Sahe‐lian zone presented  less diversity than other areas with  a  distance  equal  to  0.013  and  (π)  equal  to 0.010872.  Sudanian  zone  had  the  highest  genetic distance with a value of 0.016. This was confirmed 

by  nucleotide  diversity  (π)  which  was  0.014453. The high genetic distances are associated with high nucleotide  diversity.  Individuals  of  Guinean  zone had distances equal  to 0.013 and a nucleotide di‐versity of 0.012360. 

Genetic distances of the 28S inter‐area showed the torque  between  the  Sahelian  and  Guinean  areas with  the  lowest distance value  (0.013). The great‐est value was found between the Sahelian and Su‐danian zone and between it and Guinean zone and was of the order of 0.014 (Figure 7). Thus the calcu‐lations showed  that 28S sequences were  less vari‐able than those of cytochrome b. 

3.2.3. Diversity and genetic distance of 28S + Cyto‐chrome b genes 

Genetic  diversity  by  the  splicing  of  two  genes (Figure 8) also showed  that  the Sudanian zone  re‐mained the most diversified with a genetic distance of 0.027 against 0.018 for Guinean zone and 0.016 for  the  Sahelian  zone.  The  nucleotide  diversity  of the  cytochrome b and 28S gave  rise  the Sudanian zone  the  highest  variability  with  a  value  of 0.025612,  followed  by  the  Guinean  area  to 0.017313 and finally the Sahelian zone to 0.014752. 

Genetic  distances  between  the  various  agro‐ecological  zones  gave  the  same  results  as  those calculated with  the  cytochrome  b  and  28S  taken separately. The couple formed by the Sudanian and Guinean  zones  had  the  highest  value:  0.023  fol‐lowed  the  couple  Sudanianzone/Sahelian  zone: 0.022  and  finally  the  shortest  distance  found  be‐tween  the  Sahelian  and  Guinean  zones  (0.018) (Figure 9). 

3.3. The Mantel correlation test 

Since  the  P‐value  calculated  (=0.138)  is  greater than the significance level Alpha = 0.05, we cannot reject the hypothesis H0 (the matrices are not cor‐related)  that  there  is no correlation between geo‐graphic distance and the genetic distance. The risk of rejecting the null hypothesis H0 is true then it is 13.81% (Figure 10). 

3.4. Phylogenetic trees 

3.4.1. Phylogenetic tress of cytochrome b 

The  topology  obtained  with  the Maximum  Parsi‐mony  is associated with high bootstrap values and includes  individuals  in  three  clades  (Figure  11a). Clade  1  is  the  largest  and  contains  40  individuals from  16  haplotypes  of  which  9  individual  haplo‐

 75 

Mbar Tine et al., South Asian J Exp Biol; 3 (2): 71‐83; 2013 

Figure  1:  Characteristic  relating  of  genes  28S  and  Cyto‐chrome  b  diversity  according  to  the  number  of  variable, conserved,  singleton,  parsimony  informative  sites  and  the number of nucleotide and sequences.  

Figure 2: Frequency of mutations of the genes according to the rate of transitions, transversions, deletions and the number of haplotypes. 

Figure 3: Nucleotide frequency of 28S and cytochrome b.   Figure 4: Genetic diversity according the number of haplotypes and  the  nucleotide  diversity  for  the  different  agro‐ecological zones for the Cytochrome b. 

Figure 5: Genetic distance intra and between agro‐ecological zones for the Cytochrome b.  

Figure 6: Genetic diversity according the number of haplotypes and  the  nucleotide  diversity  for  the  different  agro‐ecological zones for the 28S. 

 76 

Mbar Tine et al., South Asian J Exp Biol; 3 (2): 71‐83; 2013 

types. This clade  is composed mainly of  individuals from the Sahelian zone (19) and the Sudanian zone (14). Individuals of Guinean zone were 7 in number. The  clade  had  7  sub‐clades.  The most  important were  the  sub‐clade 5  that  consisted of  individuals from Kébémer and belonging to the Sahelian zone. The sub‐clade 6 contained all individuals of Tamba‐counda  except  two  individuals.  The  sub‐clade  7 consisted of  two  individuals of  the  Sudanian  zone that  was MaS1  and MaS10,  and  4  individuals  of Guinean  zone.  This  clade  contained  21  of  the  26 individuals  from  Senegal.  Clade  2  consisted  of  24 individuals with  16  haplotypes. All  agro‐ecological zones were  represented with  relatively equal pro‐portions. This clade consisted of two sub‐clades. In percentage  terms, the Guinean area was the most represented with 46% of the total of its individuals. While  the  Sahelian  and  Sudanian  zones were  re‐spectively  29  and  20%  of  their  total  individuals. Clade 3 contained only eight individuals, including 3 Sahelians,  1  Sudanian  and  4 Guineans.  This  clade contained  neither  of  individuals  from  the  Burkina Faso or Niger. The phylogenetic tree had three indi‐

viduals belonging to none of the three groups iden‐tified  (Bf1, Bf7 and Tad3)  from Sudanian and Gui‐nean areas). 

The  tree  reconstructed  by  the  neighbor‐Joining method had very low boostrap values (Figure 11b). It contained three major clades as the MP. But had irregularities with  respect  to  clade  formed by  the method of MP because clades did not contain  the same  individuals. Clade 1 of NJ  contained all  indi‐viduals of clade 1, clade 3 and sub‐clade 1 of clade 2 of  the MP  tree. Clade 2  consisted of  some  indi‐viduals of sub‐clade 2 of MP clade 2 that was NiN8, NiN10, MaS2, MaS8,  TAs5,  TMa1  and  TMa2.  The remaining individuals namely Bf8, Tad1, SnF3, SnF4 and SnF8 are classified in clade 3 of NJ. 

3.4.2. Phylogenetic trees of 28S 

The Neighbor‐Joining  tree assigns  the presence of two clades (Figure 12a). Clade 1 had 67  individuals belonging to 22 haplotypes. It consisted of all  indi‐viduals  from  the  Sahelian  and  Sudanian  zone (except Bf1  and Bf7) plus 75% of  individuals’ Gui‐

Figure  9:  Genetic  distance  intra  and  between  agro‐ecological zones for 28S + cytochrome b. 

Figure  10:  Regression  of  genetic  distance  (Kimura‐2‐  parame‐ters) against the  logarithm of geographical distance (in km) for the combined data set of 28S + Cytochrome b. 

Figure 8: Genetic diversity according  the number of haplotypes and  the  nucleotide  diversity  for  the  different  agro‐ecological zones for 28S + Cytochrome b. 

Figure  7:  Genetic  distance  intra  and  between  agro‐ecological zones for the 28S. 

 77 

Mbar Tine et al., South Asian J Exp Biol; 3 (2): 71‐83; 2013 

Clade 3 

Clade 2 

Clade 1 

Sc1 

Sc3 

Sc6 

Sc7 

Sc5 

Sc4 

Sc2 

Sc8 

Sc9 

Sc10 

Clade 1 

Clade 3 

Clade 2 

Sc7 

Sc6 

Sc5 

Sc4 

Sc3 

Sc2 

Sc1 

Sc1 

Sc2 

61% Sahel 65% Soudan 33% Guinée 

29% Sahel 20% Soudan 46% Guinée 

5% Sahel 20% Soudan 17% Guinée 

84% Sahel 75% Soudan 79% Guinée 

6.5% Sahel 10% Soudan 13% Guinée 

9.5% Sahel 5% Soudan 4% Guinée 

Figure 11A: Phylogenetic tree obtained by the Maximum Parsimony’s method of Cytochrom b gene rooted with Caryedon serratus. Figure 11B: Phylogenetic tree obtained by the Neighbor Joining’s method of Cytochrom b gene rooted with Caryedon serra‐tus. 

 78 

Mbar Tine et al., South Asian J Exp Biol; 3 (2): 71‐83; 2013 

nean  zone.  This  clade  contained  two  sub‐clades: the  sub‐clade  1  and  the  sub‐clade  2  consisting  of individuals  of  the  Guinean  zone  from  Togo,  and another  sub‐clade  including  individuals  from Mali but  not  sharing  the  same  agro‐ecological  area. Clade 2 consisted of six individuals for many haplo‐types from Sudanian and Guinean zone. Individuals TMa4 and TMa5 were classified as either clade 1 or clade 2 and in each represent a single haplotype. 

The  maximum  parsimony  (Figure  12b)  had  the same topology as the NJ as well as for the clade 1 for the clade 2. The only difference is that the sub‐clades,  for  the MP,  are  4  in  number  of  boostrap values with much more significant (100%). The sub‐clades 1 and 4 were composed of  individuals from Togo and Mali whiles other sub‐clades of Mali but did not share the same agro‐ecological zones.   

3.4.3. Phylogenetic trees of 28S+Cytochrome b  

The  dendrogram  of  the  two  portions  of  28S  and cytochrome b genes had the same topology as the shaft  consisting  of  the  cytochrome  b  to  the  MP boostrap values with  relatively equal  (Figure 13a). The only differences observed between these trees were  in  the  clade 1 with  the presence of  SnT3  in the  sub‐clade  formed  by  individuals  of  Tamba‐counda  in  the  Sudanian  zone.  The  sub‐clade  7  of clade 1  consisted of MaS1and MaS10. Other  indi‐viduals  namely  TDa5,  TGb1,  TGb3  and  TTs4  are classified  in  sub‐clade  1  of  clade  2.  Individuals MaB4, MaB5 and TDa2 earlier in the cytochrome b clade 3,  form  the sub‐clade 3 of clade 2. Thus  the clade 1 had 37  individuals from the Sahelian zone, 14 from Sudanian zone and 4 individuals from Gui‐nean  zone. Clade 2  comprised 31  individuals with 11 individuals in the Sahelian zone, 4 individuals of the Sudanian zone and 16 individuals from Guinean zone including 11 individuals in sub‐clade 1. Finally the clade 3 had 4 individuals (SnC9, TMa3, TTs1 and TTs3). 

The maximum  likelihood  (Figure 13b)  showed  the same  characteristics  as  the  NJ  tree  of  the  cyto‐chrome b except here there are two clades instead of  three.  Clade  2  of  NJ  cytochrome  b  is  now  in‐cluded  in  the  clade  1  of  ML.  All  agro‐ecological zones  are  represented  in  different  clades  of  the cytochrome b NJ and the ML two genes. 

4. Discussion and conclusion 

The objective of the work was to study the genetic structure of populations of  the  cowpea weevil  (C. maculatus Fab.)  in various agro‐ecological zones of 

the West African  sub‐region and assess  their phy‐logenetic  affinities  with  the  technique  of  PCR‐Sequencing  of  mitochondrial  cytochrome  b  and ribosomal 28S genes. The cytochrome b gene am‐plification revealed 42 haplotypes including 30 indi‐vidual  haplotypes.  However  the  ribosomal  28S gene  showed  for  the  75  sequences  obtained,  30 haplotypes  including 29  individual haplotypes. This prompted (Ndong et al., 2011) to question whether the gene  is used to characterize strains Bruchinae. The  polymorphism  of  these  genes  in  addition  to environmental factors to which C. maculatus popu‐lations' evolve, was perhaps due  to  the use of  in‐secticides for cowpea storage. Since insecticides act on  the  airways  by  inhibiting  the  activity  of monooxygenases  (Ketoh  et  al.,  1998),  polymor‐phism  of  cytochrome  b  becomes  much  stronger because this gene plays a role in breathing. Plus the fact  that  insecticides  affect  the  biological  balance of  the  ecosystem  cowpea  beetles  commodities have developed  resistance phenomena due  to  the multiplicity, nature, dose and processing technique (Delobel et Tran., 1993). According  to FAO studies in 2003, wetland  farmers would use more  insecti‐cides on crops because of the variety of pests that semi‐arid  to  arid  zones.  This  would  explain  the large number of haplotypes found in Sudanian and Guinean zones. On the other hand, there is the sig‐nificant presence of other host plants of the natural weevil.  These  plants  allow  the  beetle  to  survive better  in the fields during the dry seasons. The Sa‐helian zone offers these special features. Formerly, this  area  was  suitable  for  growing  cowpeas  but with  the  fall  of  precipitations,  insects  trying  to adapt  to  new  climatic  conditions  of  the  area  and the  introduction of  improved varieties of  cowpea. Millet  is the only crop that matches the conditions of  the  Sahel  (Guèye,  2011).  Therefore,  only  the haplotypes that are better adapted to their chang‐ing environment are likely to survive. The sequence of bases  in genes are therefore a function of envi‐ronment and conditions where  live weevils. This  is because  several  individuals’ haplotypes essentially consisted  of  individuals  from  the  same  agro‐ecological zone. The splicing of the two portions of genes 28S and cytochrome b also shows that there are mutations of nucleotide sequences for all from the three agro‐ecological zones sampled. 

Sequence analysis of  two genes shows  that haplo‐type  diversity  is  significant.  Genetic  distances within  the  areas  are  relatively  lower  than  those between the areas except the Sudanian zone which constitutes  the  upper  limit.  The  28S with  low  ge‐

 79 

Mbar Tine et al., South Asian J Exp Biol; 3 (2): 71‐83; 2013 

Clade 1 

Clade 2 Clade 2 

Clade 1 

Sc3 

Sc4 Sc2 

Sc1 

Sc1 

Sc2 

Sc3 

100% Sahel 90% Soudan 75% Guinée 

10% Soudan 17% Guinée 

10% Soudan 17% Guinée 

100% Sahel 90% Soudan 75% Guinée 

Figure 12A: Phylogenetic tree obtained by the Neighbor Joining’s method of 28S gene rooted with Caryedon serratus. Figure 12B: Phylogenetic tree obtained by the Maximum Parsimony’s method of 28S gene rooted with Caryedon serratus. 

 80 

Mbar Tine et al., South Asian J Exp Biol; 3 (2): 71‐83; 2013 

Sc2 

Sc5 

Sc1 

Sc4 

Sc8 

Sc3 

Sc6 

Sc7 

Sc1 

Sc3 

Sc2 

Sc9 

Sc7 

Sc10 

Sc14 

Sc1 

Sc3 

Sc2 

Sc4’ 

Sc4 

Sc8 

Sc5 

Sc6 

Sc11 

Sc12 

Sc13 

Clade 2 

Clade 1 

Clade 1 

Clade 2 

Clade 3 

62% Sahel 70% Soudan 16.5% Guinée 

35% Sahel 20% Soudan 67% Guinée 

3% Sahel 12.5% Guinée 

90% Sahel 85% Soudan 92% Guinée 

10% Sahel 5% Soudan 4% Guinée 

Figure 13A: Phylogenetic tree obtained by the Maximum Parsimony’s method of 28S and cytochrome b genes rooted with Caryedon serratus. Figure 13B: Phylogenetic tree obtained by the Maximum  likelihood’s method of 28S and cytochrome b genes rooted with Caryedon serratus. 

 81 

Mbar Tine et al., South Asian J Exp Biol; 3 (2): 71‐83; 2013 

netic distances do not structure weevil populations. However, with a value of 0.031 between  the Gui‐nean and the Sudanian area and 0.029 between the last  and  the  Sahelian  zone,  cytochrome  b  gives more  information  on  structuring  bruchids  accord‐ing to the areas  in which they originate. These ge‐netic  distances  are  nearly  equal  to  the  distance found by Sembène  (2006) which  is of  the order of 0.035. This distance structures biotypes population of  Caryedon  serratus  subservient  to  Piliostigma reticulatum, Bauhinia  rufescens  and Arachis hypo‐gaea  from Senegal. The splicing of genes can con‐firm  this  structuring  by  its  high  values  of  genetic distances  between  the  various  areas  sampled. All of  which  leads  that  geographical  distance  would have  no  effect  on  the  Bruchinea’s  structural  but different  haplotypes  can  be met within  a  biotype thus  constituting different ecotypes  (Diome et al., 2011). This is confirmed by the Mantel test indicat‐ing that the risk to reject the hypothesis that there is no correlation between genetic distance and geo‐graphic distance is 13.81%. Indeed, individuals of a species are often grouped naturally subject  to dif‐ferent  local  evolutionary  processes  (natural  selec‐tion, mutation, drift and migration) of different  in‐tensities, resulting  in distinct genetic compositions for  each  group.  Thus,  the  variation  in  flowering time  is evolving  strategies  related  to crop adapta‐tion  to  different  environmental  conditions  and therefore  agro‐  ecological  (Roux  et  al.,  2006). Therefore, to ensure that the pest offspring adjust their  life  cycles  in  harmony with  that  of  the  host plant. This change  in cycle  induced by the genome gives  each  individual  the  ability  to  survive  in  the environment  to  which  it  evolves.  It’s  named  co‐evolution.  Thus  approaching  the  individuals  with whom  he  lives while  away  from  other  individuals who  do  not  share  the  same  agro  climate.  This  is what makes  the genetic diversity within  the zones is  small compared  to  the diversity between areas. However, Burkina Faso has a high variability possi‐bly  due  to  the multiplicity  of  varieties  grown  and the  fact  that  the  authors  suggest  that  this  is  the starting point of  infestation by  the  cowpea weevil in Africa. 

The cytochrome b phylogenetic reconstructions by parsimony  showed  two  major  clades.  The  same number of clades has been revealed on the ground‐nut  bruchid  (Caryedon  serratus)  by  Ndiaye  and Sembène  (2011).  The distribution of bruchid does not  fully explain  the  structure  revealed by  the ge‐netic diversity parameters because although differ‐ent ecotypes are found  in every country,  it  is clear 

that there’s a significant gene flow between them. In  this,  is  the  fact  that  several  genetically  distinct populations  may  be  more  or  less  bound  by  the movement  of  individuals  and  thus  form  a meta‐population  in which each population  is  influenced by other  (Hanski  and  Simberloff, 1997),  especially between  the CILSS  (Comité permanent  Inter‐Etats de Lutte contre  la Sécheresse dans  le Sahel) mem‐ber  country  such as Burkina Faso, Mali, Niger and Senegal linked by trade. This is affirmed by the dis‐tribution  of  Niger  individuals’  in  the  cladograms that have an affinity with individuals from Mali and Togo. Niger, a major producer of cowpea serves as a crossroads between West, East and North Africa by  trade,  is  none  the  less  significant  importer  of cowpea from Benin which is a country also practic‐ing  trade  with  Togo  (Adigoun,  2002).  However, within a clade,  it  there’s an  internal structure  that can  highlight  the  central  role  of  agro‐ecological zone.  This  is  true  of  the  population  of  Tamba‐counda,  which  is  encountered  in  a  clade.  This  is explained by the fact cowpea in the eastern part of Senegal  is mainly  food  and  this  place  is  very  iso‐lated. This is more likely in the Guinean area where physical  barriers  (trees,  rivers,  etc.)  play  a  role  in the migration of the weevil. The country maintains trade  links with  Ivory Coast and Benin, which  is a major producer of cowpea. 

Weevils  from  different  agro‐ecological  zones  of West Africa were  genetically  characterized  by  the technique of PCR‐Sequencing of mitochondrial  cy‐tochrome  b  gene  and  ribosomal  28S  gene.  This helped get the weevils are divided into three clades for a  total of 42 haplotypes  for cytochrome b and 30  haplotypes  for  28S.  Individual  haplotypes  are more numerous in Guinean area. 

Genetic diversity  is much more pronounced  in Su‐danian zone especially in Burkina Faso. This genetic diversity  tends  to  give  a  structure  of  different populations of weevils in ecotypes because the ge‐netic  distances  separating  the  various  areas  are higher than those in areas and have very significant values. 

The current  study, verified by phylogenetic  recon‐structions did  stink be  fully  confirmed, but never‐theless  it  remains  valid  because  the  ecotypes‐groups  are  much  more  accentuate  in  the  clado‐grams. 

Diversity  between  populations  of  cowpea weevils from  the  same  country  and  same  locality  worth studied  for  a  better  strategy  of  protection  the 

 82 

Mbar Tine et al., South Asian J Exp Biol; 3 (2): 71‐83; 2013 

stocks of cowpea in the sub‐region: 

By  studying  the  genetic  diversity  of  the  C. maculatus’  populations  according  cowpea varieties  grown  in West  Africa  especially  in Burkina Faso and Niger.  

By studying the genetic diversity of C. macu‐latus’  populations  indentured  to  different host plants. 

Estimating differentiation,  the genetic  struc‐ture of  populations,  genes  flow  at  different special scales by selectively neutral markers, and  variables  that  are  informative microsa‐tellite loci. 

In  determining  populations  of  C. maculatus to  design  control  methods  other  than  the chemical  method  which  is  dangerous  and expensive. 

Acknowledgements 

This  publication was  produced with  financial  sup‐port  from  IRD‐DSF  and  the  International  Founda‐tion for Science (IFS) and Observatoire Homme Mi‐lieu (OHM‐Tessékéré). 

 

References 

Adigoun  FA  (2002)  Impact  des  traitements  phytosanitaires  du niébé  sur  l’environnement  et  la  santé  des  populations  :  cas  de Klouékanmé et de la basse vallée de l’Ouémé (Bénin). Mémoire de Maitrise Professionnelle Option Environnement. Université d’Abo‐mey Calavi.   

Alzouma I (1995) Connaissance et contrôle des coléoptères Bruchi‐dae ravageurs des légumineuses alimentaires au Sahel. Sahel Inte‐grated Pest Management  (I.P.M)/Gestion Phytosanitaire  Intégrée. Revue Institut CILSS du Sahel 1:  2‐16. 

Brink M, Balay G (2006) Ressources végétales de l’Afrique tropicale 1. Céréales et légumes secs. PROTA, Wageningen, Pays‐Bas / Back‐huys  Publishes,  Leiden,  Pays‐Bas  /  CTA, Wageningen,  Pays‐Bas. 328p. 

Delobel A, Tran M  (1993) Les Coléoptères des denrées alimentai‐res entreposées dans les régions chaudes. ORSTOM/CTA. pp : 312‐316. 

Diome T, Ndiaye A, Ndong A, Doumma A, Sanon A, Ketoh GK, Sem‐bene M  (2011) Genetic  identification of West African ecotypes of the  groundnut  seed‐beetle  Caryedon  serratus  Ol.  (Coleoptera, Chrysomelidae). South Asian Journal of Experimental Biology 1 (2): 88‐93. 

Diaw  SC  (1999)  Evaluation  de  la  résistance  variétale  du  niébé (Vigna unguiculata L. Walp.) à Callosobruchus maculatus (F.). Mé‐moire  d’Ingénieur  Agronome  :  Productions  Végétales.  ENSA (Thiès/ Sénégal). 

Dore MHI  (2005) Climate change and changes  in global precipita‐tion  patterns: What  do we  know?  Environment  International  31 

(8): 1166‐1181. 

Excoffier L, Laval G, Schneider S (2005) Arlequin ver. 3.0: An  inte‐grated  software  package  for  population  genetics  data  analysis. Evolutionary Bioinformatics Online 1: 47‐50. 

United Nations Organization  for Food and Agriculture  (2003) Ga‐rantir  la  sécurité  sanitaire  et  la  qualité  des  aliments.  Directives pour le renforcement des systèmes nationaux de contrôle alimen‐taire. Rome 2003.  

Felsentein  J  (1981)  Evolutionary  trees  from  DNA  sequences:  A maximum  likelihood  approach.  Journal  of  Molecular  Evolution 17:368‐376. 

Fitch WM  (1971) Toward defining  the  course of evolution: Mini‐mum change for a specific tree topology. Systematic and Zoology 20:406‐416. 

Gueye MT, Seck D, Wathelet JP, Lognay G (2011) Lutte contre  les ravageurs des stocks de céréales et de légumineuses au Sénégal et en Afrique occidentale  : synthèse bibliographique. Biotechnology, Agronomy, Society and Environment 15(1): 183‐194.  

Hanski  I,  Simberloff  D  (1997)  The metapopulation  approach,  its history, conceptual domain and application to conservation. pp. 5‐26. In I. A. Hanski and M. E. Gilpin (eds.), Metapopulation Biology. Academic Press, San Diego, Californina. 

Ketoh  GK,  Glitho  IA,  Nuto  Y,  Koumaglo  HK  (1998)  Effets  de  six huiles  essentielles  sur  les œufs  et  les  larves  de  Callosobruchus maculatus F. (coleoptera : bruchidae). Revue CAMES. 00. 

Ndiaye A, Sembene M (2011) Haplotypic diversity of West African populations  of  groundnut  seed‐beetle,  Caryedon  serratus  Ol. (Coleoptera, Chrysomelidae, Bruchinae): Results from geographical and DNA sequences data. Journal of Cell and animal Biology 5: 187‐195. 

Ndiaye A, Gauthier P, Sembene M (2011) Genetic discrimination of two  cowpeas  (Vigna  unguiculata  L.)  (Walp)  Bruchid  (Coleoptera, Chrysomelidae,  Bruchinae):  Callosobruchus  maculatus  (F.)  and Bruchidius atrolineatus  (PIC.).  International  Journal of Plant, Ani‐mal and Environmental Sciences 1:196‐201. 

Ndong A, Diome T, Thiaw C, Ndiaye A, Kebe K, Douma A, Ketoh G, Sanon  A,  Sembene  M  (2011)  Several  haplotypes  of  groundnut (Arachis  hypogaea  L.)  seed‐beetle,  Caryedon  serratus  Ol. (Coleoptera:  Chrysomelidae,  Bruchinae),  in West  Africa:  Genetic identification using 28S sequences. African Journal of Biotechnolo‐gy 10 : 11409‐11420. 

Ngamo LST, Hance T (2007) Diversité des ravageurs des denrées et méthodes alternatives de lutte en milieu tropical. Tropicultura 25: 215‐220. 

Roux F, Touzet P, Cuguen J, Corre VL (2006) How to be early flow‐ering:  an  evolutionary  perspective.  Trends  in  Plant  Science  11: 1360‐1385. 

Rozas J, Rozas R (2005) DnaSP version 4: an integrated program for molecular  population  genetics  and molecular  evolution  analysis. Bioinformatics 15: 174‐175. 

Saïdou A‐A  (2011) Etude moléculaire, évolution et caractérisation de gènes impliqués dans l’adaptation du mil (Pennisetum glaucum [L.]  R.  Br.)  aux  changements  climatiques.  Thèse  de  doctorat  en Evolution,  Ecologie,  Ressources  génétiques  Paléontologie.  Sup Agro Montpellier. 

Saitou N, Nei M (1987) Neighbor‐joining Method. Molecular Biolo‐gy and Evolution 4 : 406‐425 

 83 

Mbar Tine et al., South Asian J Exp Biol; 3 (2): 71‐83; 2013 

Seck  D  (1994)  Développement  de  méthodes  alternatives  de contrôle des principaux insectes ravageurs des denrées emmagasi‐nées  au  Sénégal  par  l’utilisation  de  plantes  indigènes.  Thèse  de doctorat,  Faculté  des  sciences  Agronomiques  de  Gembloux (Belgique). 

Sembene M (2000) Variabilité de l’Espaceur Interne Transcrit (ITS) de  l’ADN ribosomique et polymorphisme des  locus microsatellites chez  la bruche Caryedon serratus  (Olivier)  : différenciation en  ra‐ces hôtes et infestation de l’arachide au Sénégal. Thèse de Docto‐rat d’Etat en Sciences Université Cheikh Anta Diop, 180p. 

Sembene M (2006) The origin of groundnut infestation by the seed beetle Caryedon serratus (Olivier) (Coleoptera: Bruchidae): Results from  cytochrome  b  and  ITS1  gene  sequences.  Journal  of  Stored Products Research 42: 97‐111. 

Thompson J, Higgins D, Gibson T (1994) CLUSTAL W: improving the sensitivity  of  progressive  multiple  sequence  alignment  through sequence  weighting,  position‐specific  gap  penalties  and  weight matrix choice. Nucleic Acids Research 22: 4673‐4690.