Review Current status of sorafenib nanoparticle delivery ...
Sorafenib - PerfectionSorafenib Cat. No.: A3009 CAS No.: 284461-73-0 Formula: C21H16ClF3N4O3 M.Wt:...
Transcript of Sorafenib - PerfectionSorafenib Cat. No.: A3009 CAS No.: 284461-73-0 Formula: C21H16ClF3N4O3 M.Wt:...
1 | www.apexbt.com
SorafenibCat. No.: A3009
CAS No.: 284461-73-0
Formula: C21H16ClF3N4O3
M.Wt: 464.82
Synonyms: BAY-43-9006,Sorafenib,Nexavar,sorafenibum
Target: Tyrosine Kinase
Pathway: PDGFR
Storage: Store at -20°C
In Vitro
23.25mg/mL in DMSO
Preparing
Stock Solutions
Mass
1mg 5mg 10mgSolvent
Concentration
1 mM 2.1514 mL 10.7569 mL 21.5137 mL
5 mM 0.4303 mL 2.1514 mL 4.3027 mL
10 mM 0.2151 mL 1.0757 mL 2.1514 mL
Please refer to the solubility information to select the appropriate solvent.
Shortsummary Raf kinases and tyrosine kinases inhibitor
IC₅₀ & Target , 22 nM (B-Raf), 90 nM (VEGFR2), 57 nM (PDGFRβ)
In Vitro
Cell Viability Assay
Cell Line: PLC/PRF/5 and HepG2 cells
Preparation method The solubility of this compound in DMSO is >10 mM. General tips for obtaining
a higher concentration: Please warm the tube at 37 °C for 10 minutes and/or
shake it in the ultrasonic bath for a while.Stock solution can be stored below
-20°C for several months.
Reacting conditions: IC50: 6.3 μM for PLC/PRF/5 cells 4.5 μM for HepG2 cells 72 hours
Applications: The effect of sorafenib on cell proliferation was measured by CellTiter-Glo
Product Name: SorafenibRevision Date: / /2020
Product Data Sheet
Solvent & Solubility
Biological Activity
1 | www.apexbt.com
SorafenibCat. No.: A300000000000099999999999
CAS No.: 282888288882828282828228288282228444444444444444444446161616161616161611611----7377777777777 -0
Formula: CC2C2C2C2C2C2C2C2CC2C2CCC 1H16ClF3N4O3
M.Wt: 464.82
Synonyms: BAY-YY 43-9006,Sorafenib,Nexavar,sorafenibum
Target: Tyrosine Kinase
Pathway: PDGFR
Storage: Store at -20°C
In Vitro
23.25mg/mL in DMSO
Preparing
Stock Solutions
Mass
1mg 5mg 10mgSolvent
Concentration
1 mM 2.1514 mL 10.7569 mL 21.5137 mL
5 mM 0.4303 mL 2.1514 mL 4.3027 mL
10 mM 0.2151 mL 1.0777777777575757575757575755757 mmmmmmmmmmmLLLLLLLLLLL 2.1514 mL
Pleaaaaaaaaaasesesesessesseseseeeeeeese rrrrrrrrrrrefefefefefefefeffeeeeeefeeeee ererererererrerererer tttttttttttto oooooooooo ttthtt e solubility information to select the appropriate solventntnttntttttt.
Shortsummary Raf kinases and tyrosine kinases inhibitor
IC₅₀ & Target , 22 nM (B-Raf), 90 nM (VEGFR2), 57 nM (PDGFRβ)
In Vitro
Cell Viability Assay
Cell Line:e:e:e:e:e:eee PLC/PRF/5 and HepG2 cells
PrPrPrPrPrrPrPrPrP epepepepepepepepepepepe araraarararararararratataatatttatatttttaatatttatiiiiioioioiiioioioiooioiooioionn n nnnn nnnnnn method The solubility of this compound in DDDDDDDDDDDDMSMSMSMSMSMSMSMSMSMSMSMMSMSMMSM O OO OO O OOOOOOOOOOOOO isisisissisisisisiss >>>>>>>>>>>>10101010110101011111 mM. General tips for obtaining
a higher concentration: Please wararararrarararrrarrmmmmmmmmmmmmmm thththththththththththhhhe tube at 37 °C for 10 minutes and/or
shake it in the ultrasonic bath for a while.Stock solution can be stored below
-20°C for several months.
Reacting conditions: IC50: 6.3 μM for PLC/PRF/5 cells 4.5 μM for HepG2 cells 72 hours
Applications: The effect of sorafenib on cell proliferation was measured by CellTiter-Glo
Product Name: SorafenibRevision Date: / /20200
etProduct Data Shee
Solvent & Soluuuuuubbbbbiiiiiillllllllliiiittttttttyyyyyyyyy
Biologicaaaalllll AAAAAActivity
2 | www.apexbt.com
assay. Sorafenib inhibited cell proliferation dose-dependently with an IC50 of
6.3 μmol/L in PLC/PRF/5 and 4.5 μmol/L in HepG2 cells.
In Vivo
Animal experiment
Animal models: Female CB17 SCID mice injected with PLC/PRF/5 cells
Dosage form: Oral administration; 10, 30, and 100 mg/kg body weight; once daily for 16 or 21
days
Applications: Sorafenib tosylate produced dose-dependent growth inhibition of s.c.
implanted PLC/PRF/5 tumor xenografts in SCID mice. Dose levels of 10 and 30
mg/kg produced significant and dose-dependent TGIs of 49% and 78%,
respectively. Sorafenib tosylate produced durable partial tumor regressions in
50% of the mice at the 100 mg/kg dose level.
Other notes: Please test the solubility of all compounds indoor, and the actual solubility may
slightly differ with the theoretical value. This is caused by an experimental
system error and it is normal.
1. Cheriyan VT, Alsaab H, et al. "A CARP-1 functional mimetic compound is synergistic with BRAF-targeting in non-small cell lung
cancers." Oncotarget. 2018 Jul 3;9(51):29680-29697.PMID:30038713
2. Sieber J, Wieder N, et al. "GDC-0879, a BRAF(V600E) Inhibitor, Protects Kidney Podocytes fromDeath." Cell Chem Biol. 2017 Dec
6.PMID:29249695
See more customer validations on www.apexbt.com.
[1] Liu L, Cao Y, Chen C, et al. Sorafenib blocks the RAF/MEK/ERK pathway, inhibits tumor angiogenesis, and induces tumor cell
apoptosis in hepatocellular carcinoma model PLC/PRF/5. Cancer research, 2006, 66(24): 11851-11858.
FOR RESEARCH PURPOSES ONLY.NOT FOR HUMAN, VETERINARY DIAGNOSTIC OR THERAPEUTIC USE.Specific storage and handling information for each product is indicated on the product datasheet. Most APExBIO products are stable
under the recommended conditions. Products are sometimes shipped at a temperature that differs from the recommended storage
temperature. Shortterm storage of many products are stable in the short-term at temperatures that differ from that required for
long-term storage. We ensure that the product is shipped under conditions that will maintain the quality of the reagents. Upon receipt
of the product, follow the storage recommendations on the product data sheet.
Product Citations
References
Caution
2 | www.apeexbt.commmmmmmmmmmmmm
assay. Sorafenib inhibited cell proliferation dose-dependently with an IC50 of
6.3 μmol/L in PLC/PRF/5 and 4.5 μmol/L in HepG2 cells.
In Vivo
Animal experiment
Animal models: Female CB17 SCID mice injected with PLC/PRF/5 cells
Dosage form: Oral administration; 10, 30, and 100 mg/kg body weighththththththththt;;;;;;;; onoooooooooo ce daily for 16 or 21
days
ApApApppppppppplplplplplplplpppliciciciciciciciciciccatatatatatatatataatatioioioioioioioioioonsnsnsnsnsnsnsnsnssns::::::::: Sorafenib tosylate produced dose-deeeeeeeepepepepepepepepeppepeendndndndndndndndndddenenenenenenenenennent ttttt tttt t tt t tt t t grgg owth inhibition of s.c.
implanted PLC/PRF/5 tumor xenogrgrgrgrgrgrgrgrgrrgrrrrrafafafafafafafafafafafafafafaftststststststststststststss iiiiiiiiiinnnnnnnnnn SCSCSCSCSCSCSCSCSCSCSCSCCID mice. Dose levels of 10 and 30
mg/kg produced significant and dddddddddososososososososososooooo eeeeeeeee-dependent TGIs of 49% and 78%,
respectively. Sorafenib tosylate produced durable partial tumor regressions in
50% of the mice at the 100 mg/kg dose level.
Other notes: Please test the solubility of all compounds indoor, and the actual solubility may
slightly differ with the theoretical value. This is caused by an experimental
system error and it is normal.
1. Cheriyan VT, AlAlAlAlAlAAAlAlAlAAlAlAAA sasasasasasasasasasasasasasas abaababababababbbbabbbabbaababab HHHHHH, et al. "A CARP-1 functional mimetic compound is synergistic wwwwwwwwwwwitititititititittitititittthhhhhhhhhhhhhh BRBRBRBRBRBRBRBRBRBRRRBRRBRBRRBRBRBRRAFAAAAAAAAAAA -targeting in non-small cell lung
cancers." Oncotarget. 2018 Jul 3;9(51):29680-29697.PMID:30038713
2. Sieber J, Wieder N, et al. "GDC-0879, a BRAF(V600E) Inhibitor, Protects Kidney Podocytes fromDeath." Cell Chem Biol. 2017 Dec
6.PMID:29249695
See more customer validations on www.apexbt.com.
[1] Liu L, Cao Y, Chen C, et al. SSSSSSSSSSororororororororororrafafafafafafafafafaffenenenenenenenenenenene iiiibi blocks the RAF/MEK/ERK pathway, inhibits tumor annnnnnnnngigigigigigigigigiggiogogogogogogogogogogggeneeneneneneneneneenenenennneneeeeseseseseseseseeseseeeessesesisisisisississisisisiis, and induces tumor cell
apoptosis in hepatocelluuuuuuuuulalalalalaalalalaaar rrrrrrrr cacacacacacacacaccaacarcrcrcrcrcrcccccrcrcrccccccccrccrcinininininnininininninomooooooooo a model PLC/PRF/5. Cancer research, 2006, 66(24): 1111111111118585858585858585855855111111111-------1111111111111111111111118585858585858585858558585588 8.8
FOR RESEARCH PURPOSES ONLY.NOT FOR HUMAN, VETERINARY DIAGNOSTIC OR THERAPEUTTIC USE.Specific storage and handling information for each product is indicatted on the product datasheet. Most APEPEPEPEEPEPEEPEEExBxBxBxBxBxBxBxBBxBBEEEEEEEEEEEEEEEEE IOIOIOIOIOIOIOIOO ble products are stab
under the recommended conditionsss... PrPrPrPrPPrPrPPrPrPProdooooooooo ucts are sometimes shipped at a temperature that differs mmended storageed at a temperature that differs fffffffffrorororrorrrroror m mmmmmmmmmmmmmmmmm ththththththththtthheeeeeeeeeeee rerererererererereerereccccocccccccc mmended storag
temperature. Shortterm storageeeeeeeegee oooooooooooff f ff f f f ff mammamamamamamamamamamam nynynynynynynynyynyynynyny products are stable in the sshort-term at temperatures tttttttthahahahahahahahahahahahahat t t t t tt t tt didididididididiid ffffffffffffffffffffffffffff ereeeeeererererererereererererr fffffffffffffffrom that required for
long-term storage. We eeeeeeeeeensnsnsnsnsnsnsnsnsnsssurururururuururuu e eeeeeeeeee ththhhhthhthhthththththththththhththhatatatatatatatataatatatttataaa tttttttthehh product is shipped under conditions that will maintaiaiaiaiaiaiaaiiaiaiaiaaaiaaa n n n n n nn nnnnnnnnnnn thhhhhhhhhhthththththttthhthhtthe e e e eee eee quququququququququuquqququuaaalalalalaalalaaaa itiii y of the reagents. Upon receipt e
of the product, folllllllllllowowowowwowowwwowowwwwwo ttttttttthehehehehehehehehehehe ssssssssssstototototototototootootootorarararrrrarararrar ge recommendations on the product ddata sheet.
Product Citaaaaatttttiiiiiooooonnnnnnssssssssss
References
Caution
3 | www.apexbt.com
APExBIO Technologywww.apexbt.com
7505 Fannin street, Suite 410, Houston, TX 77054. Tel: +1-832-696-8203 | Fax: +1-832-641-3177 | Email: [email protected]
3 | www.apexbt.com
APExBIO Technologywww.apexbt.com
7505 Fannin street, Suite 410, Houston, TX 77054.Tel: +1-8333333333222222222222--6966666666666 6-8203 | Fax: +1-832-641-3177 | Email: [email protected]