Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016
-
Upload
sophien-kamoun -
Category
Science
-
view
3.781 -
download
0
Transcript of Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016
![Page 1: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/1.jpg)
![Page 2: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/2.jpg)
Crop losses due to fungi and oomycetes (filamentous plant pathogens)
Fisher et al. 2012
![Page 3: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/3.jpg)
Crop losses due to fungi and oomycetes (filamentous plant pathogens)
Fisher et al. 2012
![Page 4: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/4.jpg)
Veredeling voor resistentie niet gelukt The Irish potato famine pathogen Phytophthora infestans causes potato blight
![Page 5: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/5.jpg)
Phytophthora Irish potato famine pathogen Greek for plant destroyer fungus-like oomycete
![Page 6: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/6.jpg)
Ü Infection cycle and diversity
Ü Evolutionary history
Ü Genome architecture and evolution
Ü Virulence mechanisms: effector biology
Ü Host resistance and evasion of resistance
Ü Breeding host resistance: prospects and challenges
What you will learn – Phytophthora and the oomycetes
![Page 7: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/7.jpg)
![Page 8: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/8.jpg)
Fifi the oomycete is a scary parasite,
With flagellated spores and hyphal threads
She kills crops and triggers blight.
Infection cycle and diversity
![Page 9: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/9.jpg)
Infection cycle of Phytophthora infestans
![Page 10: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/10.jpg)
Infection cycle of Phytophthora infestans
Zoospore cyst
appressorium Infection vesicle
haustorium
sporangium
![Page 11: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/11.jpg)
Phytophthora infestans
necrotrophy biotrophy
Phytophthora infestans is a hemibiotroph – undergoes a biotrophic phase and then becomes necrotrophic
![Page 12: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/12.jpg)
Filamentous growth of Phytophthora
![Page 13: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/13.jpg)
Appressoria – Infection structures that enable penetration of plant tissue
appressorium
![Page 14: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/14.jpg)
Haustoria – Infection structures that enable nutrient uptake and secretion of effector proteins
Coffey and Wilson, 1983
Tolga Bozkurt, Imperial College
Extrahaustorial membrane (EHM)
haustorium
![Page 15: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/15.jpg)
Haustoria – pathogen infection structures that are surrounded by a host-derived membrane
Bozkurt et al. Curr Opin Plant Biol 2012
![Page 16: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/16.jpg)
Haustoria enable secretion of effector proteins and nutrient uptake
suppress immunity, alter host physiology
nutrients?
![Page 17: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/17.jpg)
Asexual spores – finding the host and dispersal Sporangia and zoospores
![Page 18: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/18.jpg)
a d
c f
g h
↓ ↓
↓ ↓
↓
↓ ↓
↓ ↓
↓ b↓ ↓ ↓ ↓
↓ ↓ ↓ ↓
↓ ↓
↓ ↓
↓ ↓
↓
↓ ↓ ↓ ↓ ↓
↓ ↓ ↓ ↓
e↓ ↓
↓ ↓ ↓
↓ ↓ ↓
↓
↓ ↓
*
Phytophthora palmivora: Root tip (electrotaxis)
Pythium aphanidermatum: Wound exudates (chemotaxis)
Zoospore-root interactions
![Page 19: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/19.jpg)
![Page 20: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/20.jpg)
Fifi the oomycete is a scary parasite,
With flagellated spores and hyphal threads
She kills crops and triggers blight.
Infection cycle and diversity
![Page 21: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/21.jpg)
Oomycete phylogeny and diversity
Colonized many ecological niches yet more than 60% of species are parasitic on plants
![Page 22: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/22.jpg)
■ Obligate biotrophic parasites: require living plants to grow, usually do not kill host plants
■ Largest number of species
■ Typically host specific/specialized parasites: one species infects one plant species
■ Best studied is Hyaloperonospora arabidopsidis (Hpa); infects host plant Arabidopsis thaliana
Downy mildews
![Page 23: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/23.jpg)
Variety of symptoms caused by downy mildews on plants
![Page 24: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/24.jpg)
■ Phytophthora are the most important pathogens of dicot plants, causing tens of billions of dollars of losses annually
■ Phytophthora infestans, the agent of late blight of potato and tomato, causes more crop losses than any other member of the genus
■ But there are many other species that are damaging to natural and agricultural ecosystems
Phytophthora: “plant killers”
![Page 25: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/25.jpg)
Phytophthora capsici causes blight on several vegetables
![Page 26: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/26.jpg)
Phytophthora capsici causes blight on several vegetables
![Page 27: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/27.jpg)
Phytophthora ramorum and Phytophthora kernoviae infect many native British woodland species and are a threat to the environment
![Page 28: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/28.jpg)
![Page 29: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/29.jpg)
Fifi the oomycete is a heterokont, they say,
She’s fungus-like but the scientists
Know how she had plastids one day.
Evolutionary history
![Page 30: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/30.jpg)
Phytophthora is an oomycete not a fungus
![Page 31: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/31.jpg)
Oomycetes are fungus-like filamentous microbes: a unique group of eukaryotic plant pathogens
Plant pathogens in green Animal parasites in red Tree adapted from Embley and Martin (2006) Nature 440:623
(Het
erok
onts
)
![Page 32: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/32.jpg)
Christine Strullu-Derrien and Paul Kenrick @ Natural History Museum
Oomycetes form an ancient eukaryotic lineage § may have been parasitic ~300
million year ago § present in the 407 million year-old
Rhynie Chert, an ecosystem of plants, fungi and oomycetes
![Page 33: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/33.jpg)
■ Unrelated to fungi, more closely related to brown algae and diatoms in the Stramenopiles (Heterokonts)
■ Supported by molecular phylogenies based on ribosomal RNA sequences, compiled amino acid data for mitochondrial proteins, and protein encoding chromosomal genes
■ Exhibit fungal-like filamentous (hyphal) growth and several fungal-like morphological structures
Oomycetes - Phylogeny
![Page 34: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/34.jpg)
![Page 35: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/35.jpg)
Fifi the oomycete has a big genome, they say,
Full of repeats but don’t call it junk
‘cause can be handy one day.
Genome architecture and evolution
![Page 36: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/36.jpg)
Veredeling voor resistentie niet gelukt Why the misery? Why are oomycetes the scourge of farmers worldwide?
§ Phytophthora are astonishing plant destroyers that can wipe out crops in days but the secret of their success is their ability to rapidly adapt to resistant plant varieties
§ How did Phytophthora and other oomycetes manage to keep on changing and adapting to ensure their uninterrupted survival over evolutionary time?
![Page 37: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/37.jpg)
2006
intrinsic light scattering in bR) will help establishthe exact nature of the field interaction. The mainconclusion is that the experiment is clearly in theweak field limit and the laser field is not stronglyperturbing the underlying thermally populatedmodes, but rather inducing their interference inthe excited-state surface. Isomerization yieldswerealso compared with and without phase control(Fig. 6C), keeping spectral amplitudes constant(Fig. 6D; spectral profiles were confirmed usinga tunable monochromator with 0.2-nm spec-tral resolution). The data show a clear phasedependence indicative of coherent control.
Pure amplitude modulation alters the temporalprofile of the pulse (fig. S5); therefore, removingthe phase modulation affects the isomerizationyield by only 5 to 7%. The phase sensitivity ofthe control efficiency further illustrates the co-herent nature of the state preparation.
The temporal profiles of the shaped optimal andanti-optimal pulses and the observed degree of theisomerization yield control are consistent with theknown fast electronic dephasing of bR (10, 38).The largest field amplitudes are confined to ap-proximately 300-fs widths to yield 20% control. Inthe case of transform-limited pulses, all the vibra-tional levels within the excitation bandwidth areexcited in phase and there is a fast decoherence inthe initial electronic polarization (38). However,with the phase-selective restricted bandwidths inthe shaped pulses, there is an opportunity to ma-nipulate different vibrational stateswithmuch long-er coherence times than the electronic polarization.The resultant constructive and destructive interfer-ence effects involving vibrational modes displacedalong the reaction coordinate offer the possibility ofcontrolling isomerization. Experimental obser-vations presented here show that the wave proper-ties ofmatter can play a role in biological processes,to the point that they can even be manipulated.
References and Notes1. M. Shapiro, P. Brumer, Rep. Prog. Phys. 66, 859 (2003).2. S. H. Shi, H. Rabitz, J. Chem. Phys. 92, 364 (1990).3. W. T. Pollard, S. Y. Lee, R. A. Mathies, J. Chem. Phys. 92,
4012 (1990).4. Q. Wang, R. W. Schoenlein, L. A. Peteanu, R. A. Mathies,
C. V. Shank, Science 266, 422 (1994).5. K. C. Hasson, F. Gai, P. A. Anfinrud, Proc. Natl. Acad. Sci.
U.S.A. 93, 15124 (1996).6. T. Ye et al., J. Phys. Chem. B 103, 5122 (1999).7. R. Gonzalez-Luque et al., Proc. Natl. Acad. Sci. U.S.A. 97,
9379 (2000).8. T. Kobayashi, T. Saito, H. Ohtani, Nature 414, 531 (2001).9. J. Herbst, K. Heyne, R. Diller, Science 297, 822 (2002).
10. J. T. M. Kennis et al., J. Phys. Chem. B 106, 6067 (2002).11. S. Hayashi, E. Tajkhorshid, K. Schulten, Biophys. J. 85,
1440 (2003).12. S. C. Flores, V. S. Batista, J. Phys. Chem. B 108, 6745 (2004).13. Y. Ohtsuki, K. Ohara, M. Abe, K. Nakagami, Y. Fujimura,
Chem. Phys. Lett. 369, 525 (2003).14. G. Vogt, G. Krampert, P. Niklaus, P. Nuernberger,
G. Gerber, Phys. Rev. Lett. 94, 068305 (2005).15. K. Hoki, P. Brumer, Phys. Rev. Lett. 95, 168305 (2005).16. J. L. Herek, W. Wohlleben, R. J. Cogdell, D. Zeidler,
M. Motzkus, Nature 417, 533 (2002).17. J. Tittor, D. Oesterhelt, FEBS Lett. 263, 269 (1990).18. S. L. Logunov, M. A. El-Sayed, J. Phys. Chem. B 101, 6629
(1997).19. H. J. Polland et al., Biophys. J. 49, 651 (1986).
20. F. Gai, K. C. Hasson, J. C. McDonald, P. A. Anfinrud,Science 279, 1886 (1998).
21. See supporting data on Science Online.22. V. I. Prokhorenko, A. M. Nagy, R. J. D. Miller, J. Chem.
Phys. 122, 184502 (2005).23. A. K. Dioumaev, V. V. Savransky, N. V. Tkachenko,
V. I. Chukharev, J. Photochem. Photobiol. B Biol. 3, 397(1989).
24. G. Schneider, R. Diller, M. Stockburger, Chem. Phys. 131,17 (1989).
25. A. Xie, Biophys. J. 58, 1127 (1990).26. S. P. Balashov, E. S. Imasheva, R. Govindjee, T. G. Ebrey,
Photochem. Photobiol. 54, 955 (1991).27. J. Paye, IEEE J. Quant. Electron. 28, 2262 (1992).28. H. L. Fragnito, J.-Y. Bigot, P. C. Becker, C. V. Shank, Chem.
Phys. Lett. 160, 101 (1989).29. A. B. Myers, R. A. Harris, R. A. Mathies, J. Chem. Phys. 79,
603 (1983).30. B. X. Hou, N. Friedman, M. Ottolenghi, M. Sheves,
S. Ruhman, Chem. Phys. Lett. 381, 549 (2003).31. R. Morita, M. Yamashita, A. Suguro, H. Shigekawa, Opt.
Commun. 197, 73 (2001).32. K. Blum, Density Matrix Theory and Applications (Plenum,
New York, 1981).33. D. Gelman, R. Kosloff, J. Chem. Phys. 123, 234506 (2005).34. J. Hauer, H. Skenderovic, K.-L. Kompa, M. Motzkus, Chem.
Phys. Lett. 421, 523 (2006).35. D. Oesterhelt, W. Stoeckenius, in Methods in Enzymology,
vol. 31 of Biomembranes (Academic Press, New York,1974), pp. 667–678.
36. The saturation energy is related to the absorption crosssection s as Es 0 1/strans (for a negligibly smallcontribution of the excited-state emission), and s is
related to the extinction coefficient e as s 0 [log(10)/NA]e 0 3.86 ! 10j21e, where NA is Avogadro’s number.
37. The fraction of excited molecules can be estimated as aratio between the number of absorbed photons np 0Eexc ! pd20/4 and the number of retinal molecules Nm 0C ! V in an excited volume V0 ; l0 ! pd20/4, where theconcentration is C 0 2.303A0/strans, A0 is OD at 565 nm(0.9), l0 0 0.04 cm is the path length in the cell used,and d0 0 0.015 cm is the beam diameter in the sample.This gives a fraction of excited molecules of 0.0236 (thatis, 1 out of 42.3 molecules will be excited during theexcitation pulse at a given fluence). The fraction ofdouble-excited molecules can be estimated from thePoisson distribution f(k) 0 ejl(l)k/k!, where l 0 0.0236,and k is the number of occurrences (k 0 1 for thesingle excitation, k 0 2 for the double excitation, etc.).Thus, the fraction of double-excited moleculesf(2)/f(1) 0 l/2; that is, 1.18%.
38. V. F. Kamalov, T. M. Masciangioli, M. A. El-Sayed, J. Phys.Chem. 100, 2762 (1996).
39. K. Edman et al., Nature 401, 822 (1999).40. This work was supported by the National Sciences and
Engineering Research Council of Canada. The authorsthank J.T.M. Kennis, Vrije Universiteit Amsterdam, forhelpful discussions of preliminary results.
Supporting Online Materialwww.sciencemag.org/cgi/content/full/313/5791/1257/DC1Materials and MethodsFigs. S1 to S5References
1 June 2006; accepted 10 August 200610.1126/science.1130747
Phytophthora Genome SequencesUncover Evolutionary Origins andMechanisms of PathogenesisBrett M. Tyler,1* Sucheta Tripathy,1 Xuemin Zhang,1 Paramvir Dehal,2,3 Rays H. Y. Jiang,1,4
Andrea Aerts,2,3 Felipe D. Arredondo,1 Laura Baxter,5 Douda Bensasson,2,3,6 Jim L. Beynon,5
Jarrod Chapman,2,3,7 Cynthia M. B. Damasceno,8 Anne E. Dorrance,9 Daolong Dou,1
Allan W. Dickerman,1 Inna L. Dubchak,2,3 Matteo Garbelotto,10 Mark Gijzen,11
Stuart G. Gordon,9 Francine Govers,4 Niklaus J. Grunwald,12 Wayne Huang,2,14
Kelly L. Ivors,10,15 Richard W. Jones,16 Sophien Kamoun,9 Konstantinos Krampis,1
Kurt H. Lamour,17 Mi-Kyung Lee,18 W. Hayes McDonald,19 Monica Medina,20
Harold J. G. Meijer,4 Eric K. Nordberg,1 Donald J. Maclean,21 Manuel D. Ospina-Giraldo,22
Paul F. Morris,23 Vipaporn Phuntumart,23 Nicholas H. Putnam,2,3 Sam Rash,2,13
Jocelyn K. C. Rose,24 Yasuko Sakihama,25 Asaf A. Salamov,2,3 Alon Savidor,17
Chantel F. Scheuring,18 Brian M. Smith,1 Bruno W. S. Sobral,1 Astrid Terry,2,13
Trudy A. Torto-Alalibo,1 Joe Win,9 Zhanyou Xu,18 Hongbin Zhang,18 Igor V. Grigoriev,2,3
Daniel S. Rokhsar,2,7 Jeffrey L. Boore2,3,26,27
Draft genome sequences have been determined for the soybean pathogen Phytophthora sojae andthe sudden oak death pathogen Phytophthora ramorum. Oomycetes such as these Phytophthoraspecies share the kingdom Stramenopila with photosynthetic algae such as diatoms, and thepresence of many Phytophthora genes of probable phototroph origin supports a photosyntheticancestry for the stramenopiles. Comparison of the two species’ genomes reveals a rapid expansionand diversification of many protein families associated with plant infection such as hydrolases, ABCtransporters, protein toxins, proteinase inhibitors, and, in particular, a superfamily of 700 proteinswith similarity to known oomycete avirulence genes.
Phytophthora plant pathogens attack awide range of agriculturally and orna-mentally important plants (1). Late blight
of potato caused by Phytophthora infestans re-sulted in the Irish potato famine in the 19th cen-
tury, and P. sojae costs the soybean industrymillions of dollars each year. In California andOregon, a newly emerged Phytophthora species,P. ramorum, is responsible for a disease calledsudden oak death (2) that affects not only the live
RESEARCH ARTICLES
www.sciencemag.org SCIENCE VOL 313 1 SEPTEMBER 2006 1261
LETTERS
Genome sequence and analysis of the Irish potatofamine pathogen Phytophthora infestansBrian J. Haas1*, Sophien Kamoun2,3*, Michael C. Zody1,4, Rays H. Y. Jiang1,5, Robert E. Handsaker1, Liliana M. Cano2,Manfred Grabherr1, Chinnappa D. Kodira1{, Sylvain Raffaele2, Trudy Torto-Alalibo3{, Tolga O. Bozkurt2,Audrey M. V. Ah-Fong6, Lucia Alvarado1, Vicky L. Anderson7, Miles R. Armstrong8, Anna Avrova8, Laura Baxter9,Jim Beynon9, Petra C. Boevink8, Stephanie R. Bollmann10, Jorunn I. B. Bos3, Vincent Bulone11, Guohong Cai12, Cahid Cakir3,James C. Carrington13, Megan Chawner14, Lucio Conti15, Stefano Costanzo16, Richard Ewan15, Noah Fahlgren13,Michael A. Fischbach17, Johanna Fugelstad11, Eleanor M. Gilroy8, Sante Gnerre1, Pamela J. Green18,Laura J. Grenville-Briggs7, John Griffith14, Niklaus J. Grunwald10, Karolyn Horn14, Neil R. Horner7, Chia-Hui Hu19,Edgar Huitema3, Dong-Hoon Jeong18, Alexandra M. E. Jones2, Jonathan D. G. Jones2, Richard W. Jones20,Elinor K. Karlsson1, Sridhara G. Kunjeti21, Kurt Lamour22, Zhenyu Liu3, LiJun Ma1, Daniel MacLean2, Marcus C. Chibucos23,Hayes McDonald24, Jessica McWalters14, Harold J. G. Meijer5, William Morgan25, Paul F. Morris26, Carol A. Munro27,Keith O’Neill1{, Manuel Ospina-Giraldo14, Andres Pinzon28, Leighton Pritchard8, Bernard Ramsahoye29, Qinghu Ren30,Silvia Restrepo28, Sourav Roy6, Ari Sadanandom15, Alon Savidor31, Sebastian Schornack2, David C. Schwartz32,Ulrike D. Schumann7, Ben Schwessinger2, Lauren Seyer14, Ted Sharpe1, Cristina Silvar2, Jing Song3, David J. Studholme2,Sean Sykes1, Marco Thines2,33, Peter J. I. van de Vondervoort5, Vipaporn Phuntumart26, Stephan Wawra7, Rob Weide5,Joe Win2, Carolyn Young3, Shiguo Zhou32, William Fry12, Blake C. Meyers18, Pieter van West7, Jean Ristaino19,Francine Govers5, Paul R. J. Birch34, Stephen C. Whisson8, Howard S. Judelson6 & Chad Nusbaum1
Phytophthora infestans is the most destructive pathogen of potatoand a model organism for the oomycetes, a distinct lineage offungus-like eukaryotes that are related to organisms such as brownalgae and diatoms. As the agent of the Irish potato famine in themid-nineteenth century, P. infestans has had a tremendous effect onhuman history, resulting in famine and population displacement1.To this day, it affects world agriculture by causing the most destruc-tive disease of potato, the fourth largest food crop and a criticalalternative to the major cereal crops for feeding the world’s popu-lation1. Current annual worldwide potato crop losses due to lateblight are conservatively estimated at $6.7 billion2. Managementof this devastating pathogen is challenged by its remarkable speedof adaptation to control strategies such as genetically resistant cul-tivars3,4. Here we report the sequence of the P. infestans genome,
which at 240 megabases (Mb) is by far the largest and most com-plex genome sequenced so far in the chromalveolates. Its expansionresults from a proliferation of repetitive DNA accounting for 74%of the genome. Comparison with two other Phytophthora genomesshowed rapid turnover and extensive expansion of specific familiesof secreted disease effector proteins, including many genes that areinduced during infection or are predicted to have activities that alterhost physiology. These fast-evolving effector genes are localized tohighly dynamic and expanded regions of the P. infestans genome.This probably plays a crucial part in the rapid adaptability of thepathogen to host plants and underpins its evolutionary potential.
The size of the P. infestans genome is estimated by optical map andother methods at 240 Mb (Supplementary Information). It is several-fold larger than those of the related Phytophthora species P. sojae
*These authors contributed equally to this work.
1Broad Institute of MIT and Harvard, Cambridge, Massachusetts 02141, USA. 2The Sainsbury Laboratory, Norwich NR4 7UH, UK. 3Department of Plant Pathology, The Ohio StateUniversity, Ohio Agricultural Research and Development Center, Wooster, Ohio 44691, USA. 4Department of Medical Biochemistry and Microbiology, Uppsala University, Box 597,Uppsala SE-751 24, Sweden. 5Laboratory of Phytopathology, Wageningen University, 1-6708 PB, Wageningen, The Netherlands. 6Department of Plant Pathology and Microbiology,University of California, Riverside, California 92521, USA. 7University of Aberdeen, Aberdeen Oomycete Laboratory, College of Life Sciences and Medicine, Institute of MedicalSciences, Foresterhill, Aberdeen AB25 2ZD, UK. 8Plant Pathology Programme, Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK. 9University of Warwick,Wellesbourne, Warwick CV35 9EF, UK. 10Horticultural Crops Research Laboratory, USDA Agricultural Research Service, Corvallis, Oregon 97330, USA. 11Royal Institute of Technology(KTH), School of Biotechnology, AlbaNova University Centre, Stockholm SE-10691, Sweden. 12Department of Plant Pathology and Plant-Microbe Biology, Cornell University, Ithaca,New York 14853, USA. 13Center for Genome Research and Biocomputing and Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon 97331, USA.14Biology Department, Lafayette College, Easton, Pennsylvania 18042, USA. 15Plant Molecular Sciences Faculty of Biomedical and Life Sciences, Bower Building, University of Glasgow,Glasgow G12 8QQ, UK. 16USDA-ARS, Dale Bumpers National Rice Research Center, Stuttgart, Arkansas 72160, USA. 17Department of Molecular Biology, Massachusetts GeneralHospital, Boston, Massachsetts 02114, USA. 18Delaware Biotechnology Institute, University of Delaware, Newark, Delaware 19711, USA. 19Department of Plant Pathology, NorthCarolina State University, Raleigh, North Carolina 27695, USA. 20USDA-ARS, Beltsville, Maryland 20705, USA. 21Department of Plant and Soil Sciences, University of Delaware,Newark, Delaware 19716, USA. 22Department of Entomology and Plant Pathology, University of Tennessee, Knoxville, Tennessee 37996, USA. 23Institute for Genome Sciences,University of Maryland School of Medicine, Baltimore, Maryland 21201, USA. 24Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, Tennessee 37232,USA. 25The College of Wooster, Department of Biology, Wooster, Ohio 44691, USA. 26Department of Biological Sciences, Bowling Green State University, Bowling Green, Ohio 43403,USA. 27University of Aberdeen, School of Medical Sciences, College of Life Sciences and Medicine, Institute of Medical Sciences, Foresterhill, Aberdeen AB25 2ZD, UK. 28Mycologyand Phytopathology Laboratory, Los Andes University, Bogota, Colombia. 29Institute of Genetics and Molecular Medicine, University of Edinburgh, Cancer Research Centre, WesternGeneral Hospital, Edinburgh EH4 2XU, UK. 30J. Craig Venter Institute, Rockville, Maryland 20850, USA. 31Department of Plant Sciences, Tel Aviv University, Tel Aviv 69978, Israel.32Department of Chemistry, Laboratory of Genetics, Laboratory for Molecular and Computational Genomics, University of Wisconsin Biotechnology Center, University of Wisconsin-Madison, Madison Wisconsin 53706, USA. 33University of Hohenheim, Institute of Botany 210, D-70593 Stuttgart, Germany. 34Division of Plant Science, College of Life Sciences,University of Dundee (at SCRI), Invergowrie, Dundee DD2 5DA, UK. {Present addresses: 454 Life Sciences, Branford, Connecticut 06405, USA (C.D.K.); Virginia BioinformaticsInstitute, Virginia Polytechnic and State University, Blacksburg, Virginia 24061, USA (T.T.-A.); Biomedical Diagnostics Institute, Dublin City University, Dublin 9, Ireland (K.O.).
Vol 461 | 17 September 2009 | doi:10.1038/nature08358
393 Macmillan Publishers Limited. All rights reserved©2009
2009
![Page 38: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/38.jpg)
Features of sequenced oomycete genomes
[3,11]. Within conserved blocks, gene density is high and repeat and transposable element content is low (Figure 3a). The trend is most extreme in the genome of P. infestans in which the gene-dense and gene-sparse regions can be easily distinguished at the whole-genome level using flanking intergenic region length data (Figure 3b). Re-mark ably, effector genes mostly populate the gene-sparse, repeat-rich regions of Phytophthora genomes [3,11] (Figure 3). Because these regions evolve more rapidly than the gene-dense compartments of the genome, P. infestans has been described as having a ‘two-speed’ genome [19]. The presence of effector genes in plastic genomic regions is thought to promote rapid adap tation to new hosts and evasion of recognition by host immune receptors. It is reminiscent of the occur rence of plant immune receptors (R genes) in rapidly evolving gene clusters of plant genomes [20,21].
Not all plant pathogenic oomycetes have highly expanded, repeat-rich genomes. Phytophthora ultimum has the lowest level of repetitive DNA at 7%; this may be attributed to the presence of DNA methylases, which have been shown to inhibit repeat expansion and are absent in the P. infestans genome [13]. The relatively compact genome sizes of Albugo candida and A. laibachii (45 and 37 Mb, respectively) may reflect the loss of biosynthetic pathways in these obligate parasites [14,15]. However, to fully understand genome evolution in para-sitic oomycetes, we still need to compare the genomes of the parasites to their saprophytic kin. Fortunately, genome sequencing projects of several non-parasitic oomycete species are in progress.
Effectors and their functions in plantsEffector proteins belong to two classes that target distinct sites in the host plant: apoplastic effectors are secreted into the plant extracellular space, whereas cytoplasmic effectors are translocated inside the plant cell, where they target different subcellular compartments [22]. Both classes of effectors are modular proteins with cleavable amino-terminal secretion signals. Cytoplasmic effectors carry an additional domain after the signal peptide that mediates translocation inside host cells and is defined by conserved motifs, such as the RXLR amino acid sequence [22].
Several functional classes of apoplastic effectors have been described, including enzyme inhibitors and the NEP1-like toxin proteins (NLPs) [22,23]. One important function of apoplastic effectors is to disable extracellular plant defenses and enable the pathogen to adapt to the protease-rich environment of the plant apoplast [24,25]. Protease inhibitor effectors that target both plant serine and cysteine proteases have been reported in several oomycetes [3,11-13]. The P. infestans cystatin-like EPIC1 and EPIC2B inhibit the cysteine proteases PIP1, RCR3 and C14 from tomato and potato host plants [24-26]. Interestingly, C14 is also targeted by the cytoplasmic effector AVRblb2, which interferes with its secretion into the apoplast [27]. Overall, pathogen effectors have proved to be useful probes to identify plant proteases that have roles in immunity. For example, the tomato protease RCR3 is targeted by effectors from a fungus, an oomycete and a nematode, suggesting that it may have an important role in plant apoplastic defenses [24,28].
Figure 2. Features of sequenced oomycete pathogen genomes. The representative phylogeny depicts oomycete pathogens with sequenced genomes and was generated using Interactive Tree Of Life (iTOL) with National Center for Biotechnology Information (NCBI) taxonomy identifiers (branch lengths are arbitrary). Pathogen lifestyles and major variations in effector gene families are indicated along the tree branches. Potential loss of particular effector classes in a lineage is indicated by a red cross. The principal host, genome size, repetitive DNA content (as a percentage of genome size), gene space (the percentage of the genome encoding genes), number of protein-coding genes and number and percentage of proteins encoding predicted secreted proteins (secretome) are indicated from left to right for each pathogen. CRN, Crinkler; ND, not determined.
Pythium ultimum
Phytophthora ramorum
Phytophthora infestans
Phytophthora sojae
Phytophthora parasitica
Hyaloperonospora arabidopsidis
Saprolegnia parasitica
Albugo candida
Albugo laibachii
CRNeffectors
CHXC effectors
Host
Varied
Arabidopsis
Arabidopsis
Vegetables
Potato,tomatoVaried
Soybean
Varied
Fish
Woody plants
53
8065
100
45
53
Genomesize (Mb)
% RepetitiveDNA content
ND
3917
ND
43
22
Proteincoding genes
20,822
16,988
14,451
14,543
15,824
20,088
Secretome (%)
1,561
1,867
1,523
727
1,255
RefsOomycetes% genespace
32
2831
17
43
49
(7.5)
(11.0)
(10.5)
(5.0)
(3.3)515
(6.2)
NPP1-like
NPP1-like
64 19 1,17619,80529 (5.9)
240 74 18,155 1,588 (8.7)10
43 7 15,291 843 (5.5)44
37 28 13,032 413 (3.2)48
Plant Biotroph
Plant Necrotroph Fish Saprotroph/Necrotroph
Non-repetitive Repetitive Non-coding Coding
Phytophthora capsici
RXLR effectors
YxSL[RK]& RXLReffectors
YxSL[RK] effectors
[6]
[11]
[12][13]
[13]
[14]
[15][16]
[17][18]
Apoplastic effectors Cytoplasmic effecttors
Plant Hemibiotroph
Key (i): Key (ii):
Pais et al. Genome Biology 2013, 14:211 http://genomebiology.com/2013/14/6/211
Page 3 of 10
Pais et al. Genome Biology, 2013
![Page 39: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/39.jpg)
The 240 Mbp genome of Phytophthora infestans – a repeat and transposon driven expansion
![Page 40: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/40.jpg)
P. infestans
P. sojae
P. ramorum
P. sojae
P. infestans
P. ramorum
B. Haas, S. Kamoun et al. Nature, 2009
Phytophthora infestans genome architecture - repeat-rich and gene-poor loci interrupt colinear regions
![Page 41: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/41.jpg)
RXLR
Crinklers
Protease inhibitors
Phytophthora infestans genome: so many effectors!
Apoplastic
Host-translocated
~38
~550
~200 ~250ψ
![Page 42: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/42.jpg)
P. infestans
P. sojae
P. ramorum
P. sojae RXLR effector gene
P. infestans
P. ramorum
B. Haas, S. Kamoun et al. Nature, 2009
RSLR
43 47 100 22 1
AVRblb2
Host translocation Effector activity
Signal Peptide
Phytophthora infestans effectors typically occur in the expanded, repeat-rich and gene-poor loci
![Page 43: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/43.jpg)
Length of intergenic regions (kb)
Nb of genes :80-8575-8070-7565-7060-6555-6050-5545-5040-4535-4030-3525-3020-2515-2010-155-100-5
1615141312111098765432100-5
11-1516-20
6-10
21-25
31-3536-40
26-30
41-45
51-5556-60
46-50
61-65
71-7576-80
66-70
81-85
P. infestans (16442 genes)
Core orthologs (7580) RXLR effectors (520)
Phytophthora infestans effectors typically occur in the expanded, repeat-rich and gene-poor loci
B. Haas, S. Kamoun et al. Nature, 2009
![Page 44: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/44.jpg)
The “two-speed genome” of P. infestans underpins high evolutionary potential
P. sojae
P. infestans
P. ramorum
§ Gene-sparse regions of genome show highest rates of structural and sequence variation, signatures of adaptive selection
§ Gene-sparse regions underpin rapid evolution of virulence (effector) genes and host adaptation; cradle for adaptive evolution
![Page 45: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/45.jpg)
Several filamentous plant pathogens (fungi and oomycetes) have a “two-speed” genome architecture
A C
D
B
![Page 46: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/46.jpg)
O, Fifi the oomycete
Was as virulent as she’s been;
and scientists say she secretes her way
Inside potatoes and bean.
Virulence mechanisms: effector biology
![Page 47: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/47.jpg)
bacterium
fungus
oomycete
haustorium
apoplas4c effectors
plant cell
Microbes alter plant cell processes using secreted “effector” molecules
Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010
Cytoplasmic effectors
targets
targets
Alter plant cell processes
Help microbe colonize plant
![Page 48: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/48.jpg)
Ü Effectors have been described in bacteria, oomycetes,
fungi, nematodes, insects etc.
Ü Current paradigm - effector activities are key to
understanding parasitism (and symbiosis)
Ü Operationally effectors are plant proteins - Encoded by
genes in pathogen genomes but function in (inside)
plant cells
Key concepts about plant pathogen effectors
![Page 49: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/49.jpg)
Effectors - sensus Dawkins in “The extended phenotype: the long reach of the gene” p. 210, 1981
“...parasite genes having phenotypic expression in host bodies and behavior”
Phytoplasmas see Saskia Hogenhout’s lectures
![Page 50: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/50.jpg)
RXLR
Crinklers
Protease inhibitors
The diverse effectors of Phytophthora infestans
Apoplastic
Host-translocated
~38
~550
~200 ~250ψ
![Page 51: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/51.jpg)
Apoplastic effectors are typically small cysteine-rich secreted proteins
- often get processed upon secretion
- disulfide bridges provide stability in apoplast
Targeting Function
![Page 52: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/52.jpg)
(tomato cell)
(apoplast)
RCR3 PIP1 C14 CYP3 CatB1ALP CatB2
Immune response
EPIC1 EPIC2B
Phytophthora infestansOomycete
Phytophthora and fungal effectors inhibit the same plant immune proteases
with Renier van der Hoorn
Cladosporium fulvumFungus
AVR2
![Page 53: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/53.jpg)
RLLR SEER
21 44 59 147
Signal Peptide
1
RSLR DEER
21 51 72 152 1
Signal Peptide
RFLR EER
23 54 69 168 1
Signal Peptide
PEX-RD3
IPIO1
NUK10
AVR3a
RQLR GEER Signal Peptide
19 50 77 213 1
Cytoplasmic effectors of oomycetes have a conserved domain defined by the RXLR motif
Targeting Function
![Page 54: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/54.jpg)
P. infestans RXLR effectors target a variety host proteins and processes
Ü AVR3a targets an E3 Ubiquitin Ligase CMPG1 to suppress
immunity (Bos et al. PNAS, 2010)
Ü AVR2 targets a Kelch repeat phosphatase BSL1 to suppress
immunity (Saunders et al. Plant Cell, 2012)
Ü PexRD54 binds ATG8 and antagonizes selective autophagy to
counteract plant defense (Dagdas, Belhaj et al. eLife 2016)
Ü AVRblb2 interferes with secretion of cysteine protease C14 to
counteract plant defense (Bozkurt et al. PNAS, 2011)
![Page 55: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/55.jpg)
Kamoun & van der Hoorn Labs
EPIC C14
P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases
![Page 56: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/56.jpg)
Kamoun & van der Hoorn Labs
EPIC C14
C14
P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases
![Page 57: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/57.jpg)
Kamoun & van der Hoorn Labs
EPIC C14
C14
P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases
![Page 58: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/58.jpg)
Kamoun & van der Hoorn Labs
EPIC C14
AVRblb2
P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases
![Page 59: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/59.jpg)
Fifi the oomycete found
A resistant plant that day,
So she said, "Let's run and
There’ll be no fun
Until I mutate away."
Host resistance and evasion of resistance
![Page 60: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/60.jpg)
Resistance to Phytophthora infestans
§ The Hypersensitive Response (HR): a programmed cell death response
§ Activation of a plant immune receptor (R) by an effector
![Page 61: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/61.jpg)
effectors
bacterium
fungus
oomycete
haustorium
plant cell
Some effectors “trip the wire” and activate immunity in particular plant genotypes
Alter plant cell processes
targets
NB-‐LRR/NLR immune receptors
NLR-‐ triggered immunity
Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010
![Page 62: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/62.jpg)
effectors
bacterium
fungus
oomycete
haustorium
plant cell
Concept: Host Resistance and Susceptibility genes
Alter plant cell processes
targets
NB-‐LRR/NLR immune receptors
NLR-‐ triggered immunity
Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010
R
S
![Page 63: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/63.jpg)
Wheat
Potato
Tomato
Corn
Rice
Barley
Bacteria
Nematodes
Oomycetes
Insects
Fungi
Viruses
CC
NB-
ARC
LR
R (xx
LxLx
x)
Plants utilize a ubiquitous disease resistance toolkit to defend against unrelated pathogens
![Page 64: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/64.jpg)
NLR / NB-‐LRR immune receptors
How do pathogen effectors evade immunity?
AVR effector § Effectors evade activating immune receptors by acquiring stealthy mutations
target
§ But, they have to maintain their virulence activity!
§ Still many effectors become nonfunctional (pseudogenes) or get deleted in the pathogen genome
![Page 65: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/65.jpg)
Functional redundancy among pathogen effectors enables “bet-hedging”
Ü Many effectors are functionally redundant; affect different steps or converge on same target
Ü Functional redundancy enables robustness in the face of the evolving plant immune system
Ü “Bet-hedging”
Win, J., et al. Cold Spring Harbor Symposium on Quantitative Biology, 2013
![Page 66: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/66.jpg)
For Fifi the oomycete
Keeps evolving in her way,
But don’t wave her goodbye,
Don't you even try,
She’ll be back again some day.
Breeding host resistance: prospects and challenges
![Page 67: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/67.jpg)
![Page 68: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/68.jpg)
An arms race between the plant breeder/biotechnologist and the pathogen?
• Ability of the pathogen to adapt is astounding
• “Don’t bet against the pathogen” – silver bullet solutions unlikely to be durable
• Framework to rapidly generate new resistance specificities and introduce these traits into crop genomes
• Can we generate and deploy new resistance traits faster than the pathogen can evolve?
![Page 69: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/69.jpg)
![Page 70: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/70.jpg)
09/08/2013 10:19
Can GMO corn cause allergies? Don’t believe Elle’s scary story. - Slate Magazine
Page 1 of 7
http://www.slate.com/articles/health_and_science/science/2013/08/ca…y.single.html?original_referrer=https%253A%252F%252Fm.facebook.com
HOME / SCIENCE : THE STATE OF THE UNIVERSE.
No, You Shouldn’t Fear GMO
CornHow Elle botched a story about genetically modified food.
By Jon Entine Posted Wednesday, Aug. 7, 2013, at 2:45 PM
Most science says fear of GMO foods is overblown.
Photo by Olivier Morin/AFP/Getty Images
A few weeks ago, Amy Harmon, a respected science journalist at the New York Times, turned
her attention to the GMO debate, writing a masterfully textured story about the plight of the
Florida orange and the role biotechnology might play in rescuing it from a potentially deadly
disease. It was widely praised by independent journalists for its even-handed analysis of the
costs and benefits associated with adopting new technologies, like genetic modification, to
food.
As influential as the Times may be among the chattering classes, don’t expect this story to
alter the trajectory of the debate over GMO foods. While every major scientific regulatory
oversight body in the world, including the National Academies of Science and the Food and
Drug Administration in the United States, has concluded that genetically modified foods pose
no harm not also found in conventional or organic foods, the public remains deeply suspicious
of them. A survey published in the same newspaper the day before Harmon’s piece ran found
that 37 percent of those interviewed worried about GMOs, saying they feared that such foods
cause cancer or allergies.
Those fear-based views are regularly reinforced by popular lifestyle magazines and the echo
chamber of the Web. In the past two weeks alone, Details and Elle have run pieces that
credulously stoke conspiratorial fears that the government is covering up evidence that GMO
foods can damage the public health.
Caitlin Shetterly’s long feature, “The Bad Seed: The Health Risks of Genetically Modified
Corn,” in Elle—a magazine with more than 1.1 million monthly readers—was particularly
appalling.
George Clooney's Next
Movie Is Based on a
Story You Won't Believe
Edward Snowden's Email
Provider Abruptly Shuts
Down, Issues Cryptic
Statement
Are Millennials Really
More Narcissistic?
Flight Delays Don’t Have
to Ruin Your Trip. Here’s
How to Game the
System.
Follow Follow @slate@slate 638K followers
LOG IN/REGISTER
|
1.2k
1784
Like 5.1k TweetTweet 181
NEWS & POLITICS TECH BUSINESS ARTS LIFE HEALTH & SCIENCE SPORTS DOUBLE X PODCASTS PHOTOS VIDEO SLATEST BLOGS MYSLATE
![Page 71: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/71.jpg)
... for peace of mind in potato cultivation
UNDER DEVELOPMENT FOR YOUR CONVENIENCEOn top of that, you have to ensure that the
weather is favorable in terms of wind strength
and precipitation. If you want to put an end to
precisely that situation, Fortuna is the right
potato variety for you, as it provides lasting
protection against late blight. So there’s no
more need for you to regularly inspect your
fi elds and check for signs of this disease. With
Fortuna, you no longer have to worry about the
right time and the right weather. And best of all,
when you plant out your crops you can look for-
ward to an extremely high yield and outstanding
quality without any stress.
4 | 5
What is Fortuna?
Fortuna is a further development of the leading
European potato variety used for making fries.
Fortuna is identical to its parent variety, but has
one key additional benefi t: It provides complete
protection against late blight. Fortuna therefore
offers impressively high tuber yield and thanks
to its tuber form, color and taste, it satisfi es all
the requirements to be used in making fries or
as fresh produce.
How was Fortuna developed?
Dutch researchers have undertaken extensive
research into the special resistance of the wild
potato. They managed to identify the genes
which give the wild potato protection against
late blight. Agricultural and biotechnological
experts at BASF then transferred these genes
to the leading French fries potato variety using
the soil bacterium Agrobacterium. This resulted
in Fortuna which is equipped with the wild po-
tato‘s effective protection against late blight –
without modifying its outstanding agronomic
characteristics.
Why is Fortuna so useful to you?
If you’re a potato farmer, you’re sure to be fami-
liar with the following situation. July and August
are mainly wet. Late blight attacks all of your
potato fi elds, which you cared for intensively
throughout the whole year. All you can do is
wait until the rain subsides and machinery can
move on the soil again. Now you have the prob-
lem of, on the one hand, choosing the right
time to use fungicides to protect against late
blight. On the other hand, you don‘t want to risk
driving on the land and causing soil compaction.
20 30
P
40
P+A
50
P P P
Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years)
60
P+A
70
P P PP P P
80
Fungicide treatments in conventionally improved potatoes
20 30 40
A
50
Application against Alternaria (A) and Phytophthora (P)
60
A
70 80
Fungicide treatments in Fortuna (due to lasting Phytophthora resistance)
Fortuna, the potato variety for your peace of mind. With natural resistance to Phytophthora
On top of that, you have to ensure that the
weather is favorable in terms of wind strength
and precipitation. If you want to put an end to
precisely that situation, Fortuna is the right
potato variety for you, as it provides lasting
protection against late blight. So there’s no
more need for you to regularly inspect your
fi elds and check for signs of this disease. With
Fortuna, you no longer have to worry about the
right time and the right weather. And best of all,
when you plant out your crops you can look for-
ward to an extremely high yield and outstanding
quality without any stress.
4 | 5
What is Fortuna?
Fortuna is a further development of the leading
European potato variety used for making fries.
Fortuna is identical to its parent variety, but has
one key additional benefi t: It provides complete
protection against late blight. Fortuna therefore
offers impressively high tuber yield and thanks
to its tuber form, color and taste, it satisfi es all
the requirements to be used in making fries or
as fresh produce.
How was Fortuna developed?
Dutch researchers have undertaken extensive
research into the special resistance of the wild
potato. They managed to identify the genes
which give the wild potato protection against
late blight. Agricultural and biotechnological
experts at BASF then transferred these genes
to the leading French fries potato variety using
the soil bacterium Agrobacterium. This resulted
in Fortuna which is equipped with the wild po-
tato‘s effective protection against late blight –
without modifying its outstanding agronomic
characteristics.
Why is Fortuna so useful to you?
If you’re a potato farmer, you’re sure to be fami-
liar with the following situation. July and August
are mainly wet. Late blight attacks all of your
potato fi elds, which you cared for intensively
throughout the whole year. All you can do is
wait until the rain subsides and machinery can
move on the soil again. Now you have the prob-
lem of, on the one hand, choosing the right
time to use fungicides to protect against late
blight. On the other hand, you don‘t want to risk
driving on the land and causing soil compaction.
20 30
P
40
P+A
50
P P P
Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years)
60
P+A
70
P P PP P P
80
Fungicide treatments in conventionally improved potatoes
20 30 40
A
50
Application against Alternaria (A) and Phytophthora (P)
60
A
70 80
Fungicide treatments in Fortuna (due to lasting Phytophthora resistance)
Fortuna, the potato variety for your peace of mind. With natural resistance to Phytophthora
![Page 72: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/72.jpg)
... for peace of mind in potato cultivation
UNDER DEVELOPMENT FOR YOUR CONVENIENCEOn top of that, you have to ensure that the
weather is favorable in terms of wind strength
and precipitation. If you want to put an end to
precisely that situation, Fortuna is the right
potato variety for you, as it provides lasting
protection against late blight. So there’s no
more need for you to regularly inspect your
fi elds and check for signs of this disease. With
Fortuna, you no longer have to worry about the
right time and the right weather. And best of all,
when you plant out your crops you can look for-
ward to an extremely high yield and outstanding
quality without any stress.
4 | 5
What is Fortuna?
Fortuna is a further development of the leading
European potato variety used for making fries.
Fortuna is identical to its parent variety, but has
one key additional benefi t: It provides complete
protection against late blight. Fortuna therefore
offers impressively high tuber yield and thanks
to its tuber form, color and taste, it satisfi es all
the requirements to be used in making fries or
as fresh produce.
How was Fortuna developed?
Dutch researchers have undertaken extensive
research into the special resistance of the wild
potato. They managed to identify the genes
which give the wild potato protection against
late blight. Agricultural and biotechnological
experts at BASF then transferred these genes
to the leading French fries potato variety using
the soil bacterium Agrobacterium. This resulted
in Fortuna which is equipped with the wild po-
tato‘s effective protection against late blight –
without modifying its outstanding agronomic
characteristics.
Why is Fortuna so useful to you?
If you’re a potato farmer, you’re sure to be fami-
liar with the following situation. July and August
are mainly wet. Late blight attacks all of your
potato fi elds, which you cared for intensively
throughout the whole year. All you can do is
wait until the rain subsides and machinery can
move on the soil again. Now you have the prob-
lem of, on the one hand, choosing the right
time to use fungicides to protect against late
blight. On the other hand, you don‘t want to risk
driving on the land and causing soil compaction.
20 30
P
40
P+A
50
P P P
Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years)
60
P+A
70
P P PP P P
80
Fungicide treatments in conventionally improved potatoes
20 30 40
A
50
Application against Alternaria (A) and Phytophthora (P)
60
A
70 80
Fungicide treatments in Fortuna (due to lasting Phytophthora resistance)
Fortuna, the potato variety for your peace of mind. With natural resistance to Phytophthora
On top of that, you have to ensure that the
weather is favorable in terms of wind strength
and precipitation. If you want to put an end to
precisely that situation, Fortuna is the right
potato variety for you, as it provides lasting
protection against late blight. So there’s no
more need for you to regularly inspect your
fi elds and check for signs of this disease. With
Fortuna, you no longer have to worry about the
right time and the right weather. And best of all,
when you plant out your crops you can look for-
ward to an extremely high yield and outstanding
quality without any stress.
4 | 5
What is Fortuna?
Fortuna is a further development of the leading
European potato variety used for making fries.
Fortuna is identical to its parent variety, but has
one key additional benefi t: It provides complete
protection against late blight. Fortuna therefore
offers impressively high tuber yield and thanks
to its tuber form, color and taste, it satisfi es all
the requirements to be used in making fries or
as fresh produce.
How was Fortuna developed?
Dutch researchers have undertaken extensive
research into the special resistance of the wild
potato. They managed to identify the genes
which give the wild potato protection against
late blight. Agricultural and biotechnological
experts at BASF then transferred these genes
to the leading French fries potato variety using
the soil bacterium Agrobacterium. This resulted
in Fortuna which is equipped with the wild po-
tato‘s effective protection against late blight –
without modifying its outstanding agronomic
characteristics.
Why is Fortuna so useful to you?
If you’re a potato farmer, you’re sure to be fami-
liar with the following situation. July and August
are mainly wet. Late blight attacks all of your
potato fi elds, which you cared for intensively
throughout the whole year. All you can do is
wait until the rain subsides and machinery can
move on the soil again. Now you have the prob-
lem of, on the one hand, choosing the right
time to use fungicides to protect against late
blight. On the other hand, you don‘t want to risk
driving on the land and causing soil compaction.
20 30
P
40
P+A
50
P P P
Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years)
60
P+A
70
P P PP P P
80
Fungicide treatments in conventionally improved potatoes
20 30 40
A
50
Application against Alternaria (A) and Phytophthora (P)
60
A
70 80
Fungicide treatments in Fortuna (due to lasting Phytophthora resistance)
Fortuna, the potato variety for your peace of mind. With natural resistance to Phytophthora
![Page 73: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/73.jpg)
Ü Genomics-enabled gene mapping and cloning
Ü Impacting plant breeding: from Marker Assisted Selection
(MAS) to Genomic Selection (GS)
Ü Applicable to both Resistance and Susceptibility genes
Next-generation crop (disease resistance) breeding
©20
12 N
atur
e A
mer
ica,
Inc.
All
righ
ts r
eser
ved.
NATURE BIOTECHNOLOGY ADVANCE ONLINE PUBLICATION 1
A RT I C L E S
The world population is predicted to reach 9 billion within the next 40 years, requiring a 70–100% increase in food production relative to current levels1. It is a major challenge to ensure sustainable food production without further expanding farmland and damaging the environment, in the midst of adverse conditions such as rapid climatic changes. Crop breeding is important for improving yield and toler-ance to existing and emerging biotic and abiotic stresses2. However, current breeding approaches are mostly inefficient, and have not incorporated the findings of the genomics revolution3.
Most crop traits relevant to agronomic improvement are con-trolled by several loci, including quantitative trait loci (QTL), that when disrupted lead to minor phenotypic effects4. To enable plant breeding by marker-assisted selection, it is important to identify the locus or chromosome region harboring each gene contributing to an improved trait. However, compared with genes with major effects that determine discrete characteristics, allelic substitutions at agronomic trait loci lead to only subtle changes in phenotype. Consequently, cloning genes that control agronomic traits is not straightforward.
Here we describe MutMap, a method of rapid gene isolation using a cross of the mutant to wild-type parental line, and apply it to a large population of mutant lines of an elite Japanese rice cultivar. We used MutMap to localize genomic positions of rice genes controlling agronomically important traits including semidwarfism. As mutant plants and associated molecular markers can be made available to plant breeders, this approach could markedly accelerate crop breed-ing and genetics.
RESULTSMutMap methodWe explain the principle of MutMap (Fig. 1) using the example of rice. We first use a mutagen (for example, ethyl methanesulfonate) to mutagenize a rice cultivar (X) that has a reference genome sequence. Mutagenized plants of this first mutant generation (M1) are self- pollinated and brought to the second (M2) or more advanced genera-tions to make the mutated gene homozygous. Through observation of phenotypes in the M2 lines or later generations, we identify recessive mutants with altered agronomically important traits such as plant height, tiller number and grain number per spike. Once the mutant is identified, it is crossed with the wild-type plant of cultivar X, the same cultivar used for mutagenesis. The resulting first filial generation (F1) plant is self-pollinated, and the second generation (F2) progeny (>100) are grown in the field for scoring the phenotype. Because these F2 progeny are derived from a cross between the mutant and its parental wild-type plant, the number of segregating loci responsible for the phenotypic change is minimal, in most cases one, and thus segrega-tion of phenotypes can be unequivocally observed even if the pheno-typic difference is small. All the nucleotide changes incorporated into the mutant by mutagenesis are detected as single-nucleotide polymor-phisms (SNPs) and insertion-deletions (indels) between mutant and wild type. Among the F2 progeny, the majority of SNPs will segregate in a 1:1 mutant/wild type ratio. However, the SNP responsible for the change of phenotype is homozygous in the progeny showing the mutant phenotype. If we collect DNA samples from recessive mutant F2 progeny and bulk sequence them with substantial genomic coverage
Genome sequencing reveals agronomically important loci in rice using MutMapAkira Abe1,2,7, Shunichi Kosugi3,7, Kentaro Yoshida3, Satoshi Natsume3, Hiroki Takagi2,3, Hiroyuki Kanzaki3, Hideo Matsumura3,4, Kakoto Yoshida3, Chikako Mitsuoka3, Muluneh Tamiru3, Hideki Innan5, Liliana Cano6, Sophien Kamoun6 & Ryohei Terauchi3
The majority of agronomic traits are controlled by multiple genes that cause minor phenotypic effects, making the identification of these genes difficult. Here we introduce MutMap, a method based on whole-genome resequencing of pooled DNA from a segregating population of plants that show a useful phenotype. In MutMap, a mutant is crossed directly to the original wild-type line and then selfed, allowing unequivocal segregation in second filial generation (F2) progeny of subtle phenotypic differences. This approach is particularly amenable to crop species because it minimizes the number of genetic crosses (n = 1 or 0) and mutant F2 progeny that are required. We applied MutMap to seven mutants of a Japanese elite rice cultivar and identified the unique genomic positions most probable to harbor mutations causing pale green leaves and semidwarfism, an agronomically relevant trait. These results show that MutMap can accelerate the genetic improvement of rice and other crop plants.
1Iwate Agricultural Research Center, Kitakami, Japan. 2United Graduate School of Agricultural Sciences, Iwate University, Morioka, Japan. 3Iwate Biotechnology Research Center, Kitakami, Japan. 4Gene Research Center, Shinshu University, Ueda, Japan. 5Graduate University for Advanced Studies, Hayama, Japan. 6The Sainsbury Laboratory, Norwich Research Park, Norwich, UK. 7These authors contributed equally to this work. Correspondence should be addressed to R.T. ([email protected]).
Received 28 July 2011; accepted 14 December 2011; published online 22 January 2012; doi:10.1038/nbt.2095
©20
12 N
atur
e A
mer
ica,
Inc.
All
righ
ts r
eser
ved.
NATURE BIOTECHNOLOGY ADVANCE ONLINE PUBLICATION 1
A RT I C L E S
The world population is predicted to reach 9 billion within the next 40 years, requiring a 70–100% increase in food production relative to current levels1. It is a major challenge to ensure sustainable food production without further expanding farmland and damaging the environment, in the midst of adverse conditions such as rapid climatic changes. Crop breeding is important for improving yield and toler-ance to existing and emerging biotic and abiotic stresses2. However, current breeding approaches are mostly inefficient, and have not incorporated the findings of the genomics revolution3.
Most crop traits relevant to agronomic improvement are con-trolled by several loci, including quantitative trait loci (QTL), that when disrupted lead to minor phenotypic effects4. To enable plant breeding by marker-assisted selection, it is important to identify the locus or chromosome region harboring each gene contributing to an improved trait. However, compared with genes with major effects that determine discrete characteristics, allelic substitutions at agronomic trait loci lead to only subtle changes in phenotype. Consequently, cloning genes that control agronomic traits is not straightforward.
Here we describe MutMap, a method of rapid gene isolation using a cross of the mutant to wild-type parental line, and apply it to a large population of mutant lines of an elite Japanese rice cultivar. We used MutMap to localize genomic positions of rice genes controlling agronomically important traits including semidwarfism. As mutant plants and associated molecular markers can be made available to plant breeders, this approach could markedly accelerate crop breed-ing and genetics.
RESULTSMutMap methodWe explain the principle of MutMap (Fig. 1) using the example of rice. We first use a mutagen (for example, ethyl methanesulfonate) to mutagenize a rice cultivar (X) that has a reference genome sequence. Mutagenized plants of this first mutant generation (M1) are self- pollinated and brought to the second (M2) or more advanced genera-tions to make the mutated gene homozygous. Through observation of phenotypes in the M2 lines or later generations, we identify recessive mutants with altered agronomically important traits such as plant height, tiller number and grain number per spike. Once the mutant is identified, it is crossed with the wild-type plant of cultivar X, the same cultivar used for mutagenesis. The resulting first filial generation (F1) plant is self-pollinated, and the second generation (F2) progeny (>100) are grown in the field for scoring the phenotype. Because these F2 progeny are derived from a cross between the mutant and its parental wild-type plant, the number of segregating loci responsible for the phenotypic change is minimal, in most cases one, and thus segrega-tion of phenotypes can be unequivocally observed even if the pheno-typic difference is small. All the nucleotide changes incorporated into the mutant by mutagenesis are detected as single-nucleotide polymor-phisms (SNPs) and insertion-deletions (indels) between mutant and wild type. Among the F2 progeny, the majority of SNPs will segregate in a 1:1 mutant/wild type ratio. However, the SNP responsible for the change of phenotype is homozygous in the progeny showing the mutant phenotype. If we collect DNA samples from recessive mutant F2 progeny and bulk sequence them with substantial genomic coverage
Genome sequencing reveals agronomically important loci in rice using MutMapAkira Abe1,2,7, Shunichi Kosugi3,7, Kentaro Yoshida3, Satoshi Natsume3, Hiroki Takagi2,3, Hiroyuki Kanzaki3, Hideo Matsumura3,4, Kakoto Yoshida3, Chikako Mitsuoka3, Muluneh Tamiru3, Hideki Innan5, Liliana Cano6, Sophien Kamoun6 & Ryohei Terauchi3
The majority of agronomic traits are controlled by multiple genes that cause minor phenotypic effects, making the identification of these genes difficult. Here we introduce MutMap, a method based on whole-genome resequencing of pooled DNA from a segregating population of plants that show a useful phenotype. In MutMap, a mutant is crossed directly to the original wild-type line and then selfed, allowing unequivocal segregation in second filial generation (F2) progeny of subtle phenotypic differences. This approach is particularly amenable to crop species because it minimizes the number of genetic crosses (n = 1 or 0) and mutant F2 progeny that are required. We applied MutMap to seven mutants of a Japanese elite rice cultivar and identified the unique genomic positions most probable to harbor mutations causing pale green leaves and semidwarfism, an agronomically relevant trait. These results show that MutMap can accelerate the genetic improvement of rice and other crop plants.
1Iwate Agricultural Research Center, Kitakami, Japan. 2United Graduate School of Agricultural Sciences, Iwate University, Morioka, Japan. 3Iwate Biotechnology Research Center, Kitakami, Japan. 4Gene Research Center, Shinshu University, Ueda, Japan. 5Graduate University for Advanced Studies, Hayama, Japan. 6The Sainsbury Laboratory, Norwich Research Park, Norwich, UK. 7These authors contributed equally to this work. Correspondence should be addressed to R.T. ([email protected]).
Received 28 July 2011; accepted 14 December 2011; published online 22 January 2012; doi:10.1038/nbt.2095
![Page 74: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/74.jpg)
www.sciencemag.org SCIENCE VOL 341 23 AUGUST 2013 833
BACTERIA MAY NOT ELICIT MUCH SYMPA-
thy from us eukaryotes, but they, too, can get
sick. That’s potentially a big problem for the
dairy industry, which often depends on bac-
teria such as Streptococcus thermophilus to
make yogurts and cheeses. S. thermophilus
breaks down the milk sugar lactose into tangy
lactic acid. But certain viruses—bacterio-
phages, or simply phages—can debilitate the
bacterium, wreaking havoc on the quality or
quantity of the food it helps produce.
In 2007, scientists from Danisco, a
Copenhagen-based food ingredient com-
pany now owned by DuPont, found a way to
boost the phage defenses of this workhouse
microbe. They exposed the bacterium to
a phage and showed that this essentially
vaccinated it against that virus (Science,
23 March 2007, p. 1650). The trick has
enabled DuPont to create heartier bacterial
strains for food production. It also revealed
something fundamental: Bacteria have a
kind of adaptive immune system, which
enables them to fi ght off repeated attacks
by specifi c phages.
That immune system has suddenly
become important for more than food scien-
tists and microbiologists, because of a valu-
able feature: It takes aim at specific DNA
sequences. In January, four research teams
reported harnessing the system, called
CRISPR for peculiar features in the DNA of
bacteria that deploy it, to target the destruc-
tion of specifi c genes in human cells. And in
the following 8 months, various groups have
used it to delete, add, activate, or suppress tar-
geted genes in human cells, mice, rats, zebra-
fi sh, bacteria, fruit fl ies, yeast, nematodes,
and crops, demonstrating broad utility for the
The CRISPR CrazeA bacterial immune system yields a potentially
revolutionary genome-editing technique
CR
ED
IT: E
YE
OF
SC
IEN
CE
/SC
IEN
CE
SO
UR
CE
NEWSFOCUS
Fighting invasion. When
viruses (green) attack
bacteria, the bacteria
respond with DNA-targeting
defenses that biologists
have learned to exploit
for genetic engineering.
Published by AAAS
on
Augu
st 2
3, 2
013
ww
w.s
cien
cem
ag.o
rgD
ownl
oade
d fro
m
www.sciencemag.org SCIENCE VOL 341 23 AUGUST 2013 833
BACTERIA MAY NOT ELICIT MUCH SYMPA-
thy from us eukaryotes, but they, too, can get
sick. That’s potentially a big problem for the
dairy industry, which often depends on bac-
teria such as Streptococcus thermophilus to
make yogurts and cheeses. S. thermophilus
breaks down the milk sugar lactose into tangy
lactic acid. But certain viruses—bacterio-
phages, or simply phages—can debilitate the
bacterium, wreaking havoc on the quality or
quantity of the food it helps produce.
In 2007, scientists from Danisco, a
Copenhagen-based food ingredient com-
pany now owned by DuPont, found a way to
boost the phage defenses of this workhouse
microbe. They exposed the bacterium to
a phage and showed that this essentially
vaccinated it against that virus (Science,
23 March 2007, p. 1650). The trick has
enabled DuPont to create heartier bacterial
strains for food production. It also revealed
something fundamental: Bacteria have a
kind of adaptive immune system, which
enables them to fi ght off repeated attacks
by specifi c phages.
That immune system has suddenly
become important for more than food scien-
tists and microbiologists, because of a valu-
able feature: It takes aim at specific DNA
sequences. In January, four research teams
reported harnessing the system, called
CRISPR for peculiar features in the DNA of
bacteria that deploy it, to target the destruc-
tion of specifi c genes in human cells. And in
the following 8 months, various groups have
used it to delete, add, activate, or suppress tar-
geted genes in human cells, mice, rats, zebra-
fi sh, bacteria, fruit fl ies, yeast, nematodes,
and crops, demonstrating broad utility for the
The CRISPR CrazeA bacterial immune system yields a potentially
revolutionary genome-editing technique
CR
ED
IT: E
YE
OF
SC
IEN
CE
/SC
IEN
CE
SO
UR
CE
NEWSFOCUS
Fighting invasion. When
viruses (green) attack
bacteria, the bacteria
respond with DNA-targeting
defenses that biologists
have learned to exploit
for genetic engineering.
Published by AAAS
on
Augu
st 2
3, 2
013
ww
w.s
cien
cem
ag.o
rgD
ownl
oade
d fro
m
infects plant scientists
![Page 75: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/75.jpg)
REVIEW Open Access
Plant genome editing made easy: targetedmutagenesis in model and crop plants using theCRISPR/Cas systemKhaoula Belhaj†, Angela Chaparro-Garcia†, Sophien Kamoun* and Vladimir Nekrasov*
Abstract
Targeted genome engineering (also known as genome editing) has emerged as an alternative to classical plantbreeding and transgenic (GMO) methods to improve crop plants. Until recently, available tools for introducingsite-specific double strand DNA breaks were restricted to zinc finger nucleases (ZFNs) and TAL effector nucleases(TALENs). However, these technologies have not been widely adopted by the plant research community due tocomplicated design and laborious assembly of specific DNA binding proteins for each target gene. Recently, aneasier method has emerged based on the bacterial type II CRISPR (clustered regularly interspaced short palindromicrepeats)/Cas (CRISPR-associated) immune system. The CRISPR/Cas system allows targeted cleavage of genomic DNAguided by a customizable small noncoding RNA, resulting in gene modifications by both non-homologous endjoining (NHEJ) and homology-directed repair (HDR) mechanisms. In this review we summarize and discuss recentapplications of the CRISPR/Cas technology in plants.
Keywords: CRISPR, Cas9, Plant, Genome editing, Genome engineering, Targeted mutagenesis
IntroductionTargeted genome engineering has emerged as an alter-native to classical plant breeding and transgenic (GMO)methods to improve crop plants and ensure sustainablefood production. However, until recently the availablemethods have proven cumbersome. Both zinc fingernucleases (ZFNs) and TAL effector nucleases (TALENs)can be used to mutagenize genomes at specific loci, butthese systems require two different DNA binding proteinsflanking a sequence of interest, each with a C-terminalFokI nuclease module. As a result these methods have notbeen widely adopted by the plant research community.Earlier this year, a new method based on the bacterialCRISPR (clustered regularly interspaced short palindromicrepeats)/Cas (CRISPR-associated) type II prokaryoticadaptive immune system [1] has emerged as an alter-native method for genome engineering. The ability toreprogram CRISPR/Cas endonuclease specificity usingcustomizable small noncoding RNAs has set the stagefor novel genome editing applications [2-8]. The system is
based on the Cas9 nuclease and an engineered singleguide RNA (sgRNA) that specifies a targeted nucleic acidsequence. Given that only a single RNA is required to gen-erate target specificity, the CRISPR/Cas system promisesto be more easily applicable to genome engineering thanZFNs and TALENs.Recently, eight reports describing the first applications
of the Cas9/sgRNA system to plants have been published[9-16]. In this review, we summarise the methods andfindings described in these publications and provide anoutlook for the application of the CRISPR/Cas system as agenome engineering tool in plants.
Plant genome editing using the CRISPR/Cas systemThe application of the bacterial CRISPR/Cas system toplants is very recent. In the August 2013 issue of NatureBiotechnology three short reports described the first ap-plications of the Cas9/sgRNA system to plant genomeengineering [9-11]. Shortly after, five more reportsfollowed [12-16]. The papers mainly focused on testingthe CRISPR/Cas technology using transient expressionassays (Table 1 and Figure 1), such as protoplast trans-formation and in planta expression using Agrobacterium
* Correspondence: [email protected]; [email protected]†Equal contributorsThe Sainsbury Laboratory, Norwich Research Park, Norwich, UK
PLANT METHODS
© 2013 Belhaj et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the CreativeCommons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, andreproduction in any medium, provided the original work is properly cited. The Creative Commons Public Domain Dedicationwaiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwisestated.
Belhaj et al. Plant Methods 2013, 9:39http://www.plantmethods.com/content/9/1/39
![Page 76: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/76.jpg)
Humans have been modifying the genomes of animals and plants…
…using mutagens (chemicals, irradiation) and selective breeding
§ We are now moving into an era of precise genome editing (synthetic biology, biohacking etc.); ultimate in editing
§ Accessing and generating genetic diversity will not be a limiting factor anymore; key is to know which genes influence agronomically important traits
![Page 77: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/77.jpg)
500 -
400 -
300 -
bp 1 2 8 10 WT
500 - 400 -
300 -
bp
200 -
1 2 8 3 4 5 6 7 9 10
ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG!ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG!ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48!ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48!ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48!ACATAGTAAAAGGTGTACCTGTGGTGGA-------------------------------------------------TTGATTAACTTTGTACTCTTTCAGG -49!
WT Plant 1 Plant 2 Plant 8
Plant 10
PAM PAM Target 1 Target 2
500 - 400 - 300 -
8-1 500 - 400 - 300 -
bp 8-2 8-3 8-4 8-5 WT 8-6
SlMlo1
T-DNA
8-4
T-DNA: - - + -
WT slmlo1&8-6
a
b c
d
e
f
Figure 1
Transform with Cas9/sgRNAs
Callus tissue
T0 plantlets
T1 seeds slmlo1 T-DNA segregating
Regenerate T0 plants and screen
for slmlo1 homozygotes
Screen T1 generation for T-DNA-free plants
3.5 months
T2 seeds slmlo1 T-DNA-free
Supplementary Figure 1
0 3 6 9.5 Time, months 3 months 3 months 3.5 months
Tomelo – A DNA deletion results in fungus resistanceTomelo – A DNA deletion in the S gene mlo results in resistance to powdery mildew fungus
Vladimir Nekrasov
![Page 78: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/78.jpg)
Deletion of CMPG1 in tomato reduces infection by P. infestans Le
sion
siz
e (m
m2 )
Wild-Type
cmpg1 mutants
Mutant 1 Mutant 2 Mutant 3
P. infestans 88069 (5 dpi)
Wild-Type
cmpg1 mutant Angela Chaparro-Garcia
![Page 79: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/79.jpg)
![Page 80: Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016](https://reader031.fdocuments.us/reader031/viewer/2022020410/58e678031a28ab2a298b5de9/html5/thumbnails/80.jpg)