Sets, Sequences, Matrix
description
Transcript of Sets, Sequences, Matrix
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Discrete StructuresPart 1 Sets Sequences Matrices
Dr Jorge A Peacuterezjaperez[at]rugnl
University of Groningen
November 12 2014
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Overview of Part 1
1 Sets and Subsets
2 Operations on Sets
3 Sequences
4 Strings
5 Integers
6 Matrices
7 Mathematical Structures
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets Collections of Distinct Objects (1)
bull V = horse cylinder teapot mars formulabull p isin V p is an element of the set Vbull p q isin V is shorthand notation for p isin V q isin Vbull p 6isin V p is not an element of the set V so p 6isin V lArrrArr not(p isin V )1
bull Example horse isin V but rabbit 6isin V
1 lArrrArr if and only ifJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets Collections of Distinct Objects (2)
bull A set has no ordering1 2 3 is the same set as 3 1 2bull Each member of a set occurs only oncea a b is the same set as a bbull A structure in which elements may occur more than once is called a bag
or multisetbull Two sets A and B are equal if they contain the same elements
Formally A = B holds whenever x isin A lArrrArr x isin Bbull The empty set contains no members by definition Notation
or empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Defining Sets Using Predicates
bull Let P (x) be a predicate about the object xFor instance ldquox is an integer between 10 and 20 rdquobull The set of all x that satisfy the predicate P (x) is written as
x | P (x) or x P (x)
bull We may explicitly specify the domain from which x is takenFor instance given the integers Z we could have
x isin Z | P (x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Numbers
Z = x | x is an integer= minus3minus2minus1 0 1 2 3
N = x | x is a positive integer or zero= 0 1 2 3
Z+ = N+ = x | x is a positive integer= 1 2 3
Q = x | x is a rational number
=pq| p q isin Z q 6= 0
=pq| p isin Z q isin N+
R = x | x is a real numberC = x | x is a complex number
= x+ iy | x y isin RJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Subsets
bull Given two sets S and T we say that S is a subset of T (notationS sube T ) iff each element of S is also an element of T bull More precisely
S sube T lArrrArr forallx (x isin S =rArr x isin T )
Above forall denotes the universal quantifier read ldquofor allrdquobull For every set S we have S sube S and empty sube Sbull We say that S is a proper subset of T (notation S sub T ) if bothS sube T and S 6= T bull Example Z+ sub N sub Z sub Q sub R sub C
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Equality of Sets
bull A = B holds whenever x isin A lArrrArr x isin B
bull In other words
A = B lArrrArr A sube B and B sube A
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Sets
bull Elements of a set may be sets themselves For instance
a b a a b
bull Therefore the set a is not the same as abull Important Set membership (isin) concerns an element and a set subset
inclusion (sube) concerns two setsFor instance if S = a b c then a isin S and a sube Sbull Question Is the set empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Russellrsquos paradox2
bull Consider the set R of all sets that are not members of themselves
R = V | V isin V
bull Question R isin R Answer yes and nobull To avoid this type of problems we consider a context which is given by a
well-defined universal set U of objectsAny set within this context is a subset of U
2Discovered by Bertrand Russell in 1901Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Intervals of R
50 3minus4 minus3 minus2 minus1 1 2 4
A subset of R defined by two real numbers a and b with the property thatany real between a and b is included in the setbull [a b] = x isin R | a 6 x 6 bbull (a b) = x isin R | a lt x lt bbull [a b) = x isin R | a 6 x lt bbull (a b] = x isin R | a lt x 6 bbull (minusinfin a] = x isin R | x 6 abull (a a] = [a a) = (a a) = emptybull a le b rArr [a b) = (a b] = (a b) = emptybull Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power Set
bull The power set P(S) of S is
P(S) = T | T sube S
bull Example If S = a b c then
P(S) =empty a b c a b b c a c a b c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Overview of Part 1
1 Sets and Subsets
2 Operations on Sets
3 Sequences
4 Strings
5 Integers
6 Matrices
7 Mathematical Structures
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets Collections of Distinct Objects (1)
bull V = horse cylinder teapot mars formulabull p isin V p is an element of the set Vbull p q isin V is shorthand notation for p isin V q isin Vbull p 6isin V p is not an element of the set V so p 6isin V lArrrArr not(p isin V )1
bull Example horse isin V but rabbit 6isin V
1 lArrrArr if and only ifJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets Collections of Distinct Objects (2)
bull A set has no ordering1 2 3 is the same set as 3 1 2bull Each member of a set occurs only oncea a b is the same set as a bbull A structure in which elements may occur more than once is called a bag
or multisetbull Two sets A and B are equal if they contain the same elements
Formally A = B holds whenever x isin A lArrrArr x isin Bbull The empty set contains no members by definition Notation
or empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Defining Sets Using Predicates
bull Let P (x) be a predicate about the object xFor instance ldquox is an integer between 10 and 20 rdquobull The set of all x that satisfy the predicate P (x) is written as
x | P (x) or x P (x)
bull We may explicitly specify the domain from which x is takenFor instance given the integers Z we could have
x isin Z | P (x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Numbers
Z = x | x is an integer= minus3minus2minus1 0 1 2 3
N = x | x is a positive integer or zero= 0 1 2 3
Z+ = N+ = x | x is a positive integer= 1 2 3
Q = x | x is a rational number
=pq| p q isin Z q 6= 0
=pq| p isin Z q isin N+
R = x | x is a real numberC = x | x is a complex number
= x+ iy | x y isin RJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Subsets
bull Given two sets S and T we say that S is a subset of T (notationS sube T ) iff each element of S is also an element of T bull More precisely
S sube T lArrrArr forallx (x isin S =rArr x isin T )
Above forall denotes the universal quantifier read ldquofor allrdquobull For every set S we have S sube S and empty sube Sbull We say that S is a proper subset of T (notation S sub T ) if bothS sube T and S 6= T bull Example Z+ sub N sub Z sub Q sub R sub C
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Equality of Sets
bull A = B holds whenever x isin A lArrrArr x isin B
bull In other words
A = B lArrrArr A sube B and B sube A
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Sets
bull Elements of a set may be sets themselves For instance
a b a a b
bull Therefore the set a is not the same as abull Important Set membership (isin) concerns an element and a set subset
inclusion (sube) concerns two setsFor instance if S = a b c then a isin S and a sube Sbull Question Is the set empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Russellrsquos paradox2
bull Consider the set R of all sets that are not members of themselves
R = V | V isin V
bull Question R isin R Answer yes and nobull To avoid this type of problems we consider a context which is given by a
well-defined universal set U of objectsAny set within this context is a subset of U
2Discovered by Bertrand Russell in 1901Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Intervals of R
50 3minus4 minus3 minus2 minus1 1 2 4
A subset of R defined by two real numbers a and b with the property thatany real between a and b is included in the setbull [a b] = x isin R | a 6 x 6 bbull (a b) = x isin R | a lt x lt bbull [a b) = x isin R | a 6 x lt bbull (a b] = x isin R | a lt x 6 bbull (minusinfin a] = x isin R | x 6 abull (a a] = [a a) = (a a) = emptybull a le b rArr [a b) = (a b] = (a b) = emptybull Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power Set
bull The power set P(S) of S is
P(S) = T | T sube S
bull Example If S = a b c then
P(S) =empty a b c a b b c a c a b c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets Collections of Distinct Objects (1)
bull V = horse cylinder teapot mars formulabull p isin V p is an element of the set Vbull p q isin V is shorthand notation for p isin V q isin Vbull p 6isin V p is not an element of the set V so p 6isin V lArrrArr not(p isin V )1
bull Example horse isin V but rabbit 6isin V
1 lArrrArr if and only ifJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets Collections of Distinct Objects (2)
bull A set has no ordering1 2 3 is the same set as 3 1 2bull Each member of a set occurs only oncea a b is the same set as a bbull A structure in which elements may occur more than once is called a bag
or multisetbull Two sets A and B are equal if they contain the same elements
Formally A = B holds whenever x isin A lArrrArr x isin Bbull The empty set contains no members by definition Notation
or empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Defining Sets Using Predicates
bull Let P (x) be a predicate about the object xFor instance ldquox is an integer between 10 and 20 rdquobull The set of all x that satisfy the predicate P (x) is written as
x | P (x) or x P (x)
bull We may explicitly specify the domain from which x is takenFor instance given the integers Z we could have
x isin Z | P (x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Numbers
Z = x | x is an integer= minus3minus2minus1 0 1 2 3
N = x | x is a positive integer or zero= 0 1 2 3
Z+ = N+ = x | x is a positive integer= 1 2 3
Q = x | x is a rational number
=pq| p q isin Z q 6= 0
=pq| p isin Z q isin N+
R = x | x is a real numberC = x | x is a complex number
= x+ iy | x y isin RJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Subsets
bull Given two sets S and T we say that S is a subset of T (notationS sube T ) iff each element of S is also an element of T bull More precisely
S sube T lArrrArr forallx (x isin S =rArr x isin T )
Above forall denotes the universal quantifier read ldquofor allrdquobull For every set S we have S sube S and empty sube Sbull We say that S is a proper subset of T (notation S sub T ) if bothS sube T and S 6= T bull Example Z+ sub N sub Z sub Q sub R sub C
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Equality of Sets
bull A = B holds whenever x isin A lArrrArr x isin B
bull In other words
A = B lArrrArr A sube B and B sube A
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Sets
bull Elements of a set may be sets themselves For instance
a b a a b
bull Therefore the set a is not the same as abull Important Set membership (isin) concerns an element and a set subset
inclusion (sube) concerns two setsFor instance if S = a b c then a isin S and a sube Sbull Question Is the set empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Russellrsquos paradox2
bull Consider the set R of all sets that are not members of themselves
R = V | V isin V
bull Question R isin R Answer yes and nobull To avoid this type of problems we consider a context which is given by a
well-defined universal set U of objectsAny set within this context is a subset of U
2Discovered by Bertrand Russell in 1901Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Intervals of R
50 3minus4 minus3 minus2 minus1 1 2 4
A subset of R defined by two real numbers a and b with the property thatany real between a and b is included in the setbull [a b] = x isin R | a 6 x 6 bbull (a b) = x isin R | a lt x lt bbull [a b) = x isin R | a 6 x lt bbull (a b] = x isin R | a lt x 6 bbull (minusinfin a] = x isin R | x 6 abull (a a] = [a a) = (a a) = emptybull a le b rArr [a b) = (a b] = (a b) = emptybull Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power Set
bull The power set P(S) of S is
P(S) = T | T sube S
bull Example If S = a b c then
P(S) =empty a b c a b b c a c a b c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets Collections of Distinct Objects (2)
bull A set has no ordering1 2 3 is the same set as 3 1 2bull Each member of a set occurs only oncea a b is the same set as a bbull A structure in which elements may occur more than once is called a bag
or multisetbull Two sets A and B are equal if they contain the same elements
Formally A = B holds whenever x isin A lArrrArr x isin Bbull The empty set contains no members by definition Notation
or empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Defining Sets Using Predicates
bull Let P (x) be a predicate about the object xFor instance ldquox is an integer between 10 and 20 rdquobull The set of all x that satisfy the predicate P (x) is written as
x | P (x) or x P (x)
bull We may explicitly specify the domain from which x is takenFor instance given the integers Z we could have
x isin Z | P (x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Numbers
Z = x | x is an integer= minus3minus2minus1 0 1 2 3
N = x | x is a positive integer or zero= 0 1 2 3
Z+ = N+ = x | x is a positive integer= 1 2 3
Q = x | x is a rational number
=pq| p q isin Z q 6= 0
=pq| p isin Z q isin N+
R = x | x is a real numberC = x | x is a complex number
= x+ iy | x y isin RJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Subsets
bull Given two sets S and T we say that S is a subset of T (notationS sube T ) iff each element of S is also an element of T bull More precisely
S sube T lArrrArr forallx (x isin S =rArr x isin T )
Above forall denotes the universal quantifier read ldquofor allrdquobull For every set S we have S sube S and empty sube Sbull We say that S is a proper subset of T (notation S sub T ) if bothS sube T and S 6= T bull Example Z+ sub N sub Z sub Q sub R sub C
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Equality of Sets
bull A = B holds whenever x isin A lArrrArr x isin B
bull In other words
A = B lArrrArr A sube B and B sube A
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Sets
bull Elements of a set may be sets themselves For instance
a b a a b
bull Therefore the set a is not the same as abull Important Set membership (isin) concerns an element and a set subset
inclusion (sube) concerns two setsFor instance if S = a b c then a isin S and a sube Sbull Question Is the set empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Russellrsquos paradox2
bull Consider the set R of all sets that are not members of themselves
R = V | V isin V
bull Question R isin R Answer yes and nobull To avoid this type of problems we consider a context which is given by a
well-defined universal set U of objectsAny set within this context is a subset of U
2Discovered by Bertrand Russell in 1901Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Intervals of R
50 3minus4 minus3 minus2 minus1 1 2 4
A subset of R defined by two real numbers a and b with the property thatany real between a and b is included in the setbull [a b] = x isin R | a 6 x 6 bbull (a b) = x isin R | a lt x lt bbull [a b) = x isin R | a 6 x lt bbull (a b] = x isin R | a lt x 6 bbull (minusinfin a] = x isin R | x 6 abull (a a] = [a a) = (a a) = emptybull a le b rArr [a b) = (a b] = (a b) = emptybull Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power Set
bull The power set P(S) of S is
P(S) = T | T sube S
bull Example If S = a b c then
P(S) =empty a b c a b b c a c a b c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Defining Sets Using Predicates
bull Let P (x) be a predicate about the object xFor instance ldquox is an integer between 10 and 20 rdquobull The set of all x that satisfy the predicate P (x) is written as
x | P (x) or x P (x)
bull We may explicitly specify the domain from which x is takenFor instance given the integers Z we could have
x isin Z | P (x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Numbers
Z = x | x is an integer= minus3minus2minus1 0 1 2 3
N = x | x is a positive integer or zero= 0 1 2 3
Z+ = N+ = x | x is a positive integer= 1 2 3
Q = x | x is a rational number
=pq| p q isin Z q 6= 0
=pq| p isin Z q isin N+
R = x | x is a real numberC = x | x is a complex number
= x+ iy | x y isin RJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Subsets
bull Given two sets S and T we say that S is a subset of T (notationS sube T ) iff each element of S is also an element of T bull More precisely
S sube T lArrrArr forallx (x isin S =rArr x isin T )
Above forall denotes the universal quantifier read ldquofor allrdquobull For every set S we have S sube S and empty sube Sbull We say that S is a proper subset of T (notation S sub T ) if bothS sube T and S 6= T bull Example Z+ sub N sub Z sub Q sub R sub C
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Equality of Sets
bull A = B holds whenever x isin A lArrrArr x isin B
bull In other words
A = B lArrrArr A sube B and B sube A
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Sets
bull Elements of a set may be sets themselves For instance
a b a a b
bull Therefore the set a is not the same as abull Important Set membership (isin) concerns an element and a set subset
inclusion (sube) concerns two setsFor instance if S = a b c then a isin S and a sube Sbull Question Is the set empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Russellrsquos paradox2
bull Consider the set R of all sets that are not members of themselves
R = V | V isin V
bull Question R isin R Answer yes and nobull To avoid this type of problems we consider a context which is given by a
well-defined universal set U of objectsAny set within this context is a subset of U
2Discovered by Bertrand Russell in 1901Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Intervals of R
50 3minus4 minus3 minus2 minus1 1 2 4
A subset of R defined by two real numbers a and b with the property thatany real between a and b is included in the setbull [a b] = x isin R | a 6 x 6 bbull (a b) = x isin R | a lt x lt bbull [a b) = x isin R | a 6 x lt bbull (a b] = x isin R | a lt x 6 bbull (minusinfin a] = x isin R | x 6 abull (a a] = [a a) = (a a) = emptybull a le b rArr [a b) = (a b] = (a b) = emptybull Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power Set
bull The power set P(S) of S is
P(S) = T | T sube S
bull Example If S = a b c then
P(S) =empty a b c a b b c a c a b c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Numbers
Z = x | x is an integer= minus3minus2minus1 0 1 2 3
N = x | x is a positive integer or zero= 0 1 2 3
Z+ = N+ = x | x is a positive integer= 1 2 3
Q = x | x is a rational number
=pq| p q isin Z q 6= 0
=pq| p isin Z q isin N+
R = x | x is a real numberC = x | x is a complex number
= x+ iy | x y isin RJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Subsets
bull Given two sets S and T we say that S is a subset of T (notationS sube T ) iff each element of S is also an element of T bull More precisely
S sube T lArrrArr forallx (x isin S =rArr x isin T )
Above forall denotes the universal quantifier read ldquofor allrdquobull For every set S we have S sube S and empty sube Sbull We say that S is a proper subset of T (notation S sub T ) if bothS sube T and S 6= T bull Example Z+ sub N sub Z sub Q sub R sub C
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Equality of Sets
bull A = B holds whenever x isin A lArrrArr x isin B
bull In other words
A = B lArrrArr A sube B and B sube A
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Sets
bull Elements of a set may be sets themselves For instance
a b a a b
bull Therefore the set a is not the same as abull Important Set membership (isin) concerns an element and a set subset
inclusion (sube) concerns two setsFor instance if S = a b c then a isin S and a sube Sbull Question Is the set empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Russellrsquos paradox2
bull Consider the set R of all sets that are not members of themselves
R = V | V isin V
bull Question R isin R Answer yes and nobull To avoid this type of problems we consider a context which is given by a
well-defined universal set U of objectsAny set within this context is a subset of U
2Discovered by Bertrand Russell in 1901Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Intervals of R
50 3minus4 minus3 minus2 minus1 1 2 4
A subset of R defined by two real numbers a and b with the property thatany real between a and b is included in the setbull [a b] = x isin R | a 6 x 6 bbull (a b) = x isin R | a lt x lt bbull [a b) = x isin R | a 6 x lt bbull (a b] = x isin R | a lt x 6 bbull (minusinfin a] = x isin R | x 6 abull (a a] = [a a) = (a a) = emptybull a le b rArr [a b) = (a b] = (a b) = emptybull Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power Set
bull The power set P(S) of S is
P(S) = T | T sube S
bull Example If S = a b c then
P(S) =empty a b c a b b c a c a b c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Subsets
bull Given two sets S and T we say that S is a subset of T (notationS sube T ) iff each element of S is also an element of T bull More precisely
S sube T lArrrArr forallx (x isin S =rArr x isin T )
Above forall denotes the universal quantifier read ldquofor allrdquobull For every set S we have S sube S and empty sube Sbull We say that S is a proper subset of T (notation S sub T ) if bothS sube T and S 6= T bull Example Z+ sub N sub Z sub Q sub R sub C
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Equality of Sets
bull A = B holds whenever x isin A lArrrArr x isin B
bull In other words
A = B lArrrArr A sube B and B sube A
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Sets
bull Elements of a set may be sets themselves For instance
a b a a b
bull Therefore the set a is not the same as abull Important Set membership (isin) concerns an element and a set subset
inclusion (sube) concerns two setsFor instance if S = a b c then a isin S and a sube Sbull Question Is the set empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Russellrsquos paradox2
bull Consider the set R of all sets that are not members of themselves
R = V | V isin V
bull Question R isin R Answer yes and nobull To avoid this type of problems we consider a context which is given by a
well-defined universal set U of objectsAny set within this context is a subset of U
2Discovered by Bertrand Russell in 1901Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Intervals of R
50 3minus4 minus3 minus2 minus1 1 2 4
A subset of R defined by two real numbers a and b with the property thatany real between a and b is included in the setbull [a b] = x isin R | a 6 x 6 bbull (a b) = x isin R | a lt x lt bbull [a b) = x isin R | a 6 x lt bbull (a b] = x isin R | a lt x 6 bbull (minusinfin a] = x isin R | x 6 abull (a a] = [a a) = (a a) = emptybull a le b rArr [a b) = (a b] = (a b) = emptybull Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power Set
bull The power set P(S) of S is
P(S) = T | T sube S
bull Example If S = a b c then
P(S) =empty a b c a b b c a c a b c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Equality of Sets
bull A = B holds whenever x isin A lArrrArr x isin B
bull In other words
A = B lArrrArr A sube B and B sube A
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Sets
bull Elements of a set may be sets themselves For instance
a b a a b
bull Therefore the set a is not the same as abull Important Set membership (isin) concerns an element and a set subset
inclusion (sube) concerns two setsFor instance if S = a b c then a isin S and a sube Sbull Question Is the set empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Russellrsquos paradox2
bull Consider the set R of all sets that are not members of themselves
R = V | V isin V
bull Question R isin R Answer yes and nobull To avoid this type of problems we consider a context which is given by a
well-defined universal set U of objectsAny set within this context is a subset of U
2Discovered by Bertrand Russell in 1901Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Intervals of R
50 3minus4 minus3 minus2 minus1 1 2 4
A subset of R defined by two real numbers a and b with the property thatany real between a and b is included in the setbull [a b] = x isin R | a 6 x 6 bbull (a b) = x isin R | a lt x lt bbull [a b) = x isin R | a 6 x lt bbull (a b] = x isin R | a lt x 6 bbull (minusinfin a] = x isin R | x 6 abull (a a] = [a a) = (a a) = emptybull a le b rArr [a b) = (a b] = (a b) = emptybull Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power Set
bull The power set P(S) of S is
P(S) = T | T sube S
bull Example If S = a b c then
P(S) =empty a b c a b b c a c a b c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sets of Sets
bull Elements of a set may be sets themselves For instance
a b a a b
bull Therefore the set a is not the same as abull Important Set membership (isin) concerns an element and a set subset
inclusion (sube) concerns two setsFor instance if S = a b c then a isin S and a sube Sbull Question Is the set empty
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Russellrsquos paradox2
bull Consider the set R of all sets that are not members of themselves
R = V | V isin V
bull Question R isin R Answer yes and nobull To avoid this type of problems we consider a context which is given by a
well-defined universal set U of objectsAny set within this context is a subset of U
2Discovered by Bertrand Russell in 1901Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Intervals of R
50 3minus4 minus3 minus2 minus1 1 2 4
A subset of R defined by two real numbers a and b with the property thatany real between a and b is included in the setbull [a b] = x isin R | a 6 x 6 bbull (a b) = x isin R | a lt x lt bbull [a b) = x isin R | a 6 x lt bbull (a b] = x isin R | a lt x 6 bbull (minusinfin a] = x isin R | x 6 abull (a a] = [a a) = (a a) = emptybull a le b rArr [a b) = (a b] = (a b) = emptybull Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power Set
bull The power set P(S) of S is
P(S) = T | T sube S
bull Example If S = a b c then
P(S) =empty a b c a b b c a c a b c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Russellrsquos paradox2
bull Consider the set R of all sets that are not members of themselves
R = V | V isin V
bull Question R isin R Answer yes and nobull To avoid this type of problems we consider a context which is given by a
well-defined universal set U of objectsAny set within this context is a subset of U
2Discovered by Bertrand Russell in 1901Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Intervals of R
50 3minus4 minus3 minus2 minus1 1 2 4
A subset of R defined by two real numbers a and b with the property thatany real between a and b is included in the setbull [a b] = x isin R | a 6 x 6 bbull (a b) = x isin R | a lt x lt bbull [a b) = x isin R | a 6 x lt bbull (a b] = x isin R | a lt x 6 bbull (minusinfin a] = x isin R | x 6 abull (a a] = [a a) = (a a) = emptybull a le b rArr [a b) = (a b] = (a b) = emptybull Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power Set
bull The power set P(S) of S is
P(S) = T | T sube S
bull Example If S = a b c then
P(S) =empty a b c a b b c a c a b c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Intervals of R
50 3minus4 minus3 minus2 minus1 1 2 4
A subset of R defined by two real numbers a and b with the property thatany real between a and b is included in the setbull [a b] = x isin R | a 6 x 6 bbull (a b) = x isin R | a lt x lt bbull [a b) = x isin R | a 6 x lt bbull (a b] = x isin R | a lt x 6 bbull (minusinfin a] = x isin R | x 6 abull (a a] = [a a) = (a a) = emptybull a le b rArr [a b) = (a b] = (a b) = emptybull Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power Set
bull The power set P(S) of S is
P(S) = T | T sube S
bull Example If S = a b c then
P(S) =empty a b c a b b c a c a b c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power Set
bull The power set P(S) of S is
P(S) = T | T sube S
bull Example If S = a b c then
P(S) =empty a b c a b b c a c a b c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Size Cardinality
bull A finite set is a set that has a finite number of elementsbull A set that is not finite is called infinitebull Example the set 123 is finite the interval [1 3] is infinitebull The cardinality (or size) of a finite set S is denoted as |S|bull Let S be a finite set The cardinality of P(S) is 2|S|
For instance if |S| = 3 then |P(S)| = 23 = 8
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Power set Binary images
All possible 2times 2 arrangements with 0123 or 4 foreground pixels|P(S)| = 2|S| = 24 = 16
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (1)
Let us write U to denote the universebull Union A cupB = x | x isin A or x isin B (or ldquoorrdquo)3
bull Intersection A capB = x | x isin A and x isin B (and ldquoandrdquo)bull Difference AminusB = x | x isin A and x isin B
Alternative notation A B
3Inclusive or x isin A or x isin B or bothJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Set Operations (2)
bull Symmetric difference
AB =x | (x isin A and x isin B) or (x isin B and x isin A)
= (A B) cup (B A)
Alternative notation A∆Bbull Complement A = U A Alternative notation Ac
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (1)
Commutativity A cupB = B cupAA capB = B capA
Associativity (A cupB) cup C = A cup (B cup C)(A capB) cap C = A cap (B cap C)
Distributivity (cup over cap) A cup (B cap C) = (A cupB) cap (A cup C)(cap over cup) A cap (B cup C) = (A capB) cup (A cap C)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 1961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Algebraic Laws of Set Operations (2)
Idempotence A cupA = AA capA = A
Identity A cup empty = AA cap U = A
Complement A cupA = U
A capA = empty
Double Complement (A) = A
Relation universe - Empty set U = emptyempty = U
De Morgan Laws (A cupB) = A capB(A capB) = A cupB
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Annotated Linear Proof (ALP)
Proposition A cup (B cup C) = (A cupB) cup CProof 4
x isin A cup (B cup C)
equiv definition cup (x isin A) or (x isin B cup C)
equiv definition cup x isin A or (x isin B or x isin C)
equiv logic (x isin A or x isin B) or x isin C
equiv definition cupx isin A cupB or x isin C
equiv definition cupx isin (A cupB) cup C4Kolman et al write equiv instead of lArrrArr
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Sequences
bull A sequence is a list (or array) of objectsbull Unlike sets elements of a list are ordered there is a first element the
second element etcbull More formally a sequence is an indexed array sn n = 1 2 3
We call n the indexbull Example s = a b c d e is a sequence with s1 = a s2 = b etcbull Example an infinite sequence defined by sn = 2 middot snminus1 + 7 with s0=3
and n isin NWe have that s1 = 13 s2 = 33 s3 = 73
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Strings
bull A string is a sequence of letters (or symbols)bull Example William (finite sequence)bull Example b l a b l a b l a b l a (infinite sequence)bull We also write blablablabla bull The alphabet of a string is the set of all letters of the string
For example the alphabet of the above string is b l a
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Characteristic Function
bull Let A be a subset of the universe U We say that fA U rarr 0 1 is the characteristic function (orindicator function) of A It is defined (for all x isin U) as
fA(x) =
1 if x isin A0 if x isin A
bull Alternative notation χA(x)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2561
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Computer Representation of Sets
bull Each finite universe U can be represented by a finite sequencebull For example the set U = a c s q t corresponds to the sequenceα = a c s q tbull Every subset A sube U can be represented by its characteristic function fAbull We can make an array A of length n = |U | where A[k] = 1 iffA(α(k)) = 1 and A[k] = 0 if fA(α(k)) = 0
Representation of U 1 1 1 1 1
Representation of A = c q 0 1 0 1 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Countable and Uncountable Sets
bull A set V is called countable (or denumerable) if V can be represented bya sequencebull Each finite set is countablebull Infinite sets that are not countable are called uncountablebull Examples sets N Z an Q are countable
The set R is not countable - the proof uses Cantorrsquos diagonal-argument5
5A proof method devised in 1891 by Georg CantorJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Languages
bull Alphabet non-empty finite set of letters (symbols) Σbull WordString a finite string of letters from alphabet Σ
Example a1 a2 a3 an where ak isin Σ is a word of length nWe usually write it as a1a2a3 anbull Σlowast denotes the set of all words that can be produced with Σ
bull Every subset of Σlowast is a languagebull The empty string written Λ isin Σlowast has length 06
Examples
bull Let Σ = abull Some words in Σlowast a aa aaabull The set of all possible words is Σlowast = Λ a aa aaa aaaa
6In most books the empty string is denoted by the symbol εJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 2961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
String Concatenation
bull Consider the two strings
w1 = itisrainingcatsw2 = anddogs
bull We can append w2 to w1 so as to obtain
w1 middot w2 = itisrainingcatsanddogs
bull This operation is called the concatenation of w1 and w2We may sometimes write w1w2 instead of w1 middot w2
bull Note wΛ = Λw = w
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
The DNA Alphabet
Σ = A TCG
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Words in the DNA alphabet
Let Σ = A TCG Let us have a look at some words from Σlowastbull Λ AAAAAAAAAA We denote this set as Alowast
Similarly for T lowast Clowast and Glowastbull ATAG This set is denoted by A(T orG)
Alternative notation A(T |G)bull ATATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)lowastbull ATCGATCGCGATCGCGCGATCGCGCGCG
This set is denoted by AT (CG)+7
bull ATCTATGCTGATGGCTGGATGGGCTGGG This set is denoted by (A or C)TGlowast
7For completeness sake This notation is not used in Kolman et alJorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Expressions
Let Σ be an alphabet A regular expression (regexp) over Σ is definedrecursively in terms of members of the alphabet and the symbols
( ) or lowast Λ
according to the following definitionRE1 The symbol Λ is a regular expressionRE2 Each x isin Σ is a regular expressionRE3 If α and β are regular expressions then the expression α middot β is also
regularRE4 If α and β are regular expressions then the expression α or β is also
regularRE5 If α is a regular expression then (α)lowast is also a regular expression
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Regular Sets
Associated to each regexp over A there is a subset of Alowastbull Λ corresponds to the set Λbull x isin Σ corresponds to the set xbull If α and β are regexps that correspond to sets MN sube Σlowast thenbull α middot β corresponds to the set M middotN = s middot t | s isinM and t isin Nbull (α or β) corresponds to the set M cupN
bull If α is a regexp that corresponds to set M sube Σlowastthen (α)lowast corresponds to set Mlowast
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
DivisionRemainder Property of Natural Numbers
TheoremLet mn be integers with n gt 0There are unique integers q and r such that
n = m middot q + r and 0 6 r lt m
While q is called quotient is r called remainderWe can find them using the operators div and modbull q = n div qbull r = n mod q
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (1)
We consider the set of integers Zbull We write a | b if b = k middot a for some integer k
We say that a is a divisor of b or that b is a multiple of abull Example 7|98 for 98 = 7 middot 14bull ldquo|rdquo is transitive (a | b) and (b | c) =rArr a | c
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (2)
DefinitionA positive natural number n is a prime number if it has exactly twounique divisors 1 and n
Thus by definition 1 is not a prime Still 2 3 5 and 7 are prime
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Factors and Products (3)
Theorem (prime factorization)
Any positive integer n gt 1 can be uniquely written as a product of primenumbers
Consider the Hasse diagram of 60
60 = 2 middot 2 middot 3 middot 5 = 22 middot 3 middot 5168 = 2 middot 2 middot 2 middot 3 middot 7 = 23 middot 3 middot 7192 = 2 middot 2 middot 2 middot 2 middot 2 middot 2 middot 3 = 26 middot 3
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 3961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
There are infinitely many prime numbers
A Proof by Contradiction1 Suppose there are only finitely many primes say p1 p2 pk in
increasing order2 Let n be defined as (p1 times p2 times times pk) + 13 By assumption n not a prime n is greater than the greatest prime pk
So n must be divisible by at least two primes4 The number nminus 1 is divisible by p1 p2 pk
Two numbers that differ by 1 can not have the same prime divisorSo n is not divisible by any of the primes p1 p2 pk
5 Therefore the prime factors of n are not in the list p1 p2 pkThis contradicts the assumption that p1 p2 pk is the completelist of prime numbers
6 We conclude that there are infinitely many primes
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD
bull If a b and k are positive integers and k | a and k | b then k is acommon divisor of a and b If d is the largest such k then d is thegreatest common divisor (or GCD) We write gcd(a b) = dbull Example 3 and 2 are common divisors of 18 and 24
But gcd(18 24) = 6bull m and n are called relatively prime (or coprime) if gcd(mn) = 1
Example 17 and 24 are coprimebull A procedure for computing the CGD of two integers is the Euclideanalgorithm Given a = k middot b+ r1 it exploits the property
gcd(a b) = gcd(b r1) = gcd(r1 r2) = middot middot middot = gcd(rnminus1 rn)
In the example above (a = 24 b = 18) gcd(24 18) = gcd(18 6) = 6
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
LCM
If a | k and b | k then k is a common multiple of a and bThe smallest such k is the least common multiple (or LCM)We write lcm(a b) = k Example lcm(18 24) = 72
For any two positive natural numbers m and n we havebull gcd(mn) middot lcm(mn) = m middot nbull any common divisor of m and n is a divisor of gcd(mn)
bull any common multiple of m and n is a multiple of lcm(mn)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
GCD and LCM
bull Greatest common divisor (GCD)
gcd(168 192) = gcd(23 middot 3 middot 7 26 middot 3)
= 2min(36) middot 3min(11) middot 7min(10) = 23 middot 31 middot 70 = 24
bull Least common multiple (LCM)
lcm(168 192) = lcm(23 middot 3 middot 7 26 middot 3)
= 2max(36) middot 3max(11) middot 7max(10) = 26 middot 31 middot 71 = 1344
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Representation of Integers
bull Let b gt 1 be some integer which we call the baseEvery positive integer n can be written in the unique form
n = dk bk + dkminus1 b
kminus1 + d1 b1 + d0
where 0 le di lt b i = 0 1 k and dk 6= 0bull The sequence dkdkminus1 d1d0 is called the base b expansion of nbull b = 10 decimal expansionbull b = 2 binary expansionbull b = 8 octal expansionbull b = 16 hexadecimal expansion
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Definition of a Matrix
bull A matrix is a rectangular array of numbers arranged in (horizontal) rowsand (vertical) columns For instance
A = [aij ] =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
bull M and N are called the dimensions of the matrix
We say that the matrix is M by N written as M timesN bull If M = N we say that the matrix is a square matrix of order N
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Transpose of a Matrix
bull The transpose of a matrix A is the matrix obtained by interchangingthe rows and columns of A Example Let
A =
a11 a12 middot middot middot a1Na21 a22 middot middot middot a2N
aM1 aM2 middot middot middot aMN
The transpose of A denoted AT is defined as
AT =
a11 a21 middot middot middot aM1
a12 a22 middot middot middot aM2
a1N a2N middot middot middot aMN
bull A matrix is called symmetric if A = AT Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Special Matrices
Square matrices (n rows n columns)
Diagonal matrix
Dn =
a11 0 middot middot middot 00 a22 middot middot middot 0
0 0 middot middot middot ann
Identity matrix
In =
1 0 middot middot middot 00 1 middot middot middot 0
0 0 middot middot middot 1
Zero matrix
Zn =
0 0 middot middot middot 00 0 middot middot middot 0
0 0 middot middot middot 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Addition of Matrices
bull Consider two matrices A and B with the same dimensionbull The sum of A and B is computed by adding the corresponding
elements For instance when A and B have dimensions 3times 2
A+B =
a11 a12a21 a22a31 a32
+
b11 b12b21 b22b31 b32
=
a11 + b11 a12 + b12a21 + b21 a22 + b22a31 + b31 a32 + b32
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 4961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (1)
bull The product of an M times P matrix A and a P timesN matrix B is theM timesN matrix C = [cij ] denoted ABbull To compute cij take row i of A and column j of B multiply the
corresponding elements and sum all these productsbull Example Consider M = 2 P = 3 and N = 2 We have
A =
(a11 a12 a13a21 a22 a23
)B =
b11 b12b21 b22b31 b32
The product AB is the 2times 2 matrix defined as follows(
c11 = a11b11 + a12b21 + a13b31 c12 = a11b12 + a12b22 + a13b32c21 = a21b11 + a22b21 + a23b31 c22 = a21b12 + a22b22 + a23b32
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Product of Matrices (2)
bull A concrete example
A =
(2 3 minus41 2 5
)B =
7 1minus6 69 0
AB = [cij ] =
(minus40 2040 13
)In fact it is easy to verify that
c11 = (2 middot 7) + (3 middot minus6) + (minus4 middot 9) = minus40
c12 = (2 middot 1) + (3 middot 6) + (minus4 middot 0) = 20
c21 = (1 middot 7) + (2 middot minus6) + (5 middot 9) = 40
c22 = (1 middot 1) + (2 middot 6) + (5 middot 0) = 13
bull The matrix product is associative ie A(BC) = (AB)C
bull In general the matrix product is not commutative ie AB 6= BA
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5161
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Matrices
Figure Mathematician George Boole (1815-1864)
bull In a Boolean matrix elements are either 1 (ldquotruerdquo) or 0 (ldquofalserdquo)bull Let A = [aij ] and B = [bij ] be Boolean matrices We define
bull Join A orB = C = [cij ] where cij =
1 if aij = 1 or bij = 1
0 if aij = bij = 0
bull Meet A andB = C = [cij ] where cij =
1 if aij = bij = 1
0 if aij = 0 or bij = 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5261
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (1)
bull The product of Boolean matrices is similar to that of ordinary matricesbull Given A and B we denote their product as AB = C = [cij ]bull To compute element cij we take row i of A and column j of B multiply
the corresponding elements and take the maximum of all these productsmdash which can be either zero or onebull A particular case
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(max(a11b11 a12b21 a13b31) max(a11b12 a12b22 a13b32)max(a21b11 a22b21 a23b31) max(a21b12 a22b22 a23b32)
)Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5361
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Boolean Product of Matrices (2)
bull Another view
AB =
(a11 a12 a13a21 a22 a23
)
b11 b12b21 b22b31 b32
=
(M(a11b11 a12b21 a13b31) M(a11b12 a12b22 a13b32)M(a21b11 a22b21 a23b31) M(a21b12 a22b22 a23b32)
)
where M(n) =
0 if n = 0
1 if n gt 0
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5461
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Mathematical Structures
Definition (Mathematical Structure (MS))
A mathematical structure is a collection of objects with operations definedon them (and their associated properties)
bull Notation(collection operation1 operation2 operationn)
bull Examples
(R+times) the real numbers with the operationsaddition and multiplication
(P (U)cupcap middot) the power set of U with the operationsunion intersection and complement
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5661
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Closures
bull A MS (VO1 On) is closed with respect to an operation Oi if theresult of applying Oi yields again an element of V bull Example Strings are closed with respect to concatenationbull Type of operations Obull Unary O has one argument
Example Complement of a set O(A) = Abull Binary O has two arguments
Example Sum of two integers O(x y) = x+ ybull Ternary O has 3 argumentsbull
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5761
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Prefix Infix Postfix Notation
bull The postfix notation is typical of unary operationsFor instance we write AT for matrix transposition mdashas opposed to theprefix notation T (A)bull The infix notation is commonly used to denote binary operations
For instance we A cupB for set union mdashas opposed to the prefixnotation cup(AB)
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5861
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (1)
bull A unary operation in a MS (V ) is called idempotent if
(x) = x forallx isin V
bull A binary operation in a MS (V ) is calledbull associative if for all x y z isin V
(x y) z = x (y z)
bull commutative if for all x y isin V
x y = yx
bull An element e is called an identity element of if for all x isin V
x e = ex = x
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 5961
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
Properties of Operations (2)
bull Let (V O ) be a MS with binary operations and OWe say that distributes over O if for all x y z isin V
x (yO z) = (x y)O (x z)
bull Let (V O ) be a MS with a unary operation and binary operations and O The operations satisfy De Morganrsquos laws if for x y isin V
(x y) = xO y
(xO y) = x y
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6061
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-
Sets and Subsets Operations on Sets Sequences Strings Integers Matrices Mathematical Structures
End of Part 1
Jorge A Peacuterez Discrete Structures (2014-2015) ndash Part 1 6161
- Sets and Subsets
- Operations on Sets
- Sequences
- Strings
- Integers
- Matrices
- Mathematical Structures
-