Texto adicional Texto adicional

Texto adicional texto adicional

Texto adicional texto adicional

Research Article

Identification of Candida Species Associated with Vulvovaginal Candidiasis by Multiplex PCR

Mahnaz Mahmoudi Rad, Ameneh Sh Zafarghandi, Maryam Amel Zabihi, Mahkam Tavallaee and Yasaman Mirdamadi.

Molecular BiologyStudents: Maria Teresa Obando Saenz John Sebastián Henao Espinosa 2012

Texto adicional Texto adicional

Texto adicional texto adicional

Texto adicional texto adicional

Introduction

Vulvovaginal Candidiasis is a common infection. The prevalence of this

disease is increasing because of different consequences like the

extensive utilization of broad- spectrum antibiotics.

Approximately, half the female population have Candida in the vaginal

flora .This study is necessary to know the differentiation of diverse species

of Candida, the improvements in molecular assay technology for

identifying Candida species has overcome some types of limits during the

last 2 years.

About Candida

• The gender Candida belong to the filum Ascomycota, subfilum Ascomycotina, class Ascomycetes, order Saccharomycetales and family saccharomycetaceae.

• It includes average 154 species, where candida albicans is the most frequent species.

• Candida is considerated like a normal part of the human flora. • It is the most frequent cause of human mycosis. • The gender candida can be found in the leaves, soil, flowers and water.

Vulvovaginal Candidiasis

• It is the second cause most common of vaginal infection.• Higher prevalence in women aged 20-40• Risk Factors: Sexual relations, contraception, femenine hygiene products,

antibiotics• Vulvovaginal candidiasis is easily treatable now, even with single-dose, but

at times the symptoms can be confused with other diseases

PCR• Developed by Kary Mullis in the 1980´s.• The objective is the amplification of genes or a DNA fragment or indirectly

through RNA, present in diverse mixtures of different sources

• It is based on enzymatic in vitro amplification. It is the geometrical increase in the number of copies of a particular DNA sequence

• Principles: - Double-stranded DNA denaturation in order to obtain single

strands of the DNA molecule

- Specific hybridization with an oligonucleotide ( primer ) of

single strands.

- Single strand replication by a DNA polymerase starting from

the oligonucleotide as a starter.

Relationship between PCR, Candida and Vulvovaginal Candidiasis

• Using techniques like PCR which can identify the nonalbicans species and can report an exact result is very useful for choosing a specific disease diagnosis and adecuated treatment

General Objective

• The aim of this study was to identify different species of vaginal Candida isolates in an Iranian patient population by using of some multiplex PCR techniques

Materiales y métodos

• Se hizo el muestreo dentro de la vagina con un hisopo estéril por el investigador y fue cultivado en un medio agar dextrosa sabouraud.

• Participantes del estudio: mujeres con signos y síntomas de Candidiasis Vulvovaginal que fueron admitidas en el centro de ginecología del Hospital Educacional Mahdieh, Irán

• Cada paciente fue evaluada solo una vez durante los dos años que duró el estudio

• Los participantes que presentaron los signos menos de 4 veces durante el previo año fueron clasificados como no recurrentes.

• Materiales y métodos

• Los participantes que presentaron picazón vaginal y secreciones iguales o mayor a 4 veces durante el año fueron considerados recurrentes

• La muestra fue recolectada de los 100 primeros pacientes Recurrentes y de los 100 primeros pacientes No Recurrentes.

• De las 200 personas seleccionadas, fueron excluidas 25 por contaminación o porque no se observaba crecimiento de los hongos.

• Los pacientes formularon un cuestionario con respecto a sus características demográficas y de comportamiento.

Materiales y métodos

• Todos firmaron un consentimiento informado sobre el estudio que se iba a realizar y se protegió estrictamente la confidencialidad de ellas.

• Las colonias de especies Candida también fueron identificadas por la formación del tubo germinativo en suero, producción de clamidosporas en CMA y absorción de carbohidratos usando el kit API 20C-AUX .

• La extracción del DNA se hizo por medio de un kit para extracción de DNA

• Se utilizaron varias pruebas PCR mediante la utilización de un kit de mezcla de estas.

Materiales y métodos

• Los primers utilizados en esta reacción se sintetizaron en TAGC (Berlín, Alemania) incluyendo primers universales (ITS1 [5´- TCCGTAGGTGAACTTGCGG - 3´] and ITS2 [ 5´- GCTGCGTTCTTCATCGATGC - 3´] y primers específicos para C. albicans ( CA3 [ 5´- GGTTTGCTTGAAAGACGGGTAG -3´] y CA4 [ 5´- AGTTTGAAGATATACGTGGTAG 3´] )

• Una porción conservada del DNAr 18s y del 28s fueron amplificadas usando los primers ITS1 e ITS2

• El proceso de amplificación de PCR se llevó a cabo con un ciclador térmico Eppendorf bajo las siguientes condiciones:

- Denaturación inicial ( 94°C, 3 min)- 35 ciclor de denaturación ( 94°C, 1 min)- Endurecimiento por calor y sucesivo enfriado (60°C, 1min)- Extensión ( 72°C, 1 min )

• Controles positivos fueron incluidos en cada experimento con PCR y consitían en un cebador para cada Candida

Materiales y métodos

• Controles positivos fueron incluidos en cada experimento con PCR y consitían en un cebador para cada Candida

• Dos bandas de DNA fueron correspondientes para C. albicans mientras que una sola banda fue correspondiente para las otras especies de Candida.

• Una evaluación de las diferentes especies de CVVR y NRVC también se hizo.

• La estadística descriptiva, prueba de chi cuadrado y la correlación de Spearman se utilizó para analizar los datos.

• Los productos de la PCR fueron analizados por electroforesis a través de gel de agarosa (2%) que contiene Bromuro de Etidio

Resultados

• No hubo diferencia significativa

de edad entre NRVVC y

RVVC, media de 32,4 años

• Mujeres mayores tienen

mayor prevalencia de ser

infectadas con C. galbrata;

que las mujeres jóvenes

Correlation of participants’ age range and isolated C.glabrata.

Multiplex PCR using primers ITS1, ITS2, CA3, and CA4.-Lane 1: 50-bp DNA ladder. -Lane 2: negative control. -Lanes 3 to 8, 11 to 13 and 15 to 16: eleven clinical isolates. -Lane 9: mixed reference strains C. krusei CBS573, C. albicans ATCC14053, and C. glabrataCBS2175 -Lane 10: reference strain C. tropicalis CBS94, and -Lane 14: reference strain C. parapsilosis CBS2195.

Resultados

• Infección por una especie de Candida 89.7%

• Infección por más de una especie de Candida 10.3%

• Hubo más prevalencia de C. albicans (65.1%) y C. glabrata (13.1%)

• Infección mixta más frecuente por C. glabrata and C. albicans (5.7%)

Resultados

• Pacientes con NRVVC tenían una sola especie de Candida (90.2%)

• Pacientes con RVVC 89.7%

• Los resultados que presentó la PCR múltiple coincidieron con los resultados de la prueba de tubo germinal y la producción clamidosporas en CMA y kit de API 20C-AUX.

Resultados

DiscussionAUTHOR STATEMENT YES OR NO

N. M. Tarini, W. Mardiastuti, F. Ibrahim, A. Yasmon, and S.Djauzi.

The multiplex PCR method is a highly sensitive and specific technique based on the results of the previous studies

YES

S. R. Fan, X. P. Liu, and J. W. Li.

The results of this study showed that 10.3% of participants were infected withmore than one species of Candida which is a higher rate compared to the other studies conducted in China

NO

AUTHOR STATEMENT YES OR NO

S. R. Fan, X. P. Liu, and J. W. Li, K. H. Abu-Elteen, F. I. Okungbowa, O. S. Isikhuemhen, and A. P. O. Dede.

The first and second most common isolated species in this study were C. albicans and C. glabratawhich was in

agreement with similar studies conducted worldwide

YES

K. H. Abu-Elteen, F. J. Fleury, R. A. Falleiros De P´adua, E. Guilhermetti, and T. I. Estivalet Svidzinski.

The prevalence of other species had the same pattern in our study as seen in

earlier findings

YES

Conclusions• Doctors have to use the best method for the patients, it has to be ethical,

safe and useful for everybody• If PCR exam is useful to identify Candida species this assey is a good

method to guide the treatment to patients with candidiasis• The candidiasis like a sexually transmitted disease can prevent without

promiscuity• The study of other methods to identify Candida species is a possibility to find

the best way, fast, effective, economic and optimal, this can be PCR

GRACIAS