The EMBO Joumal vol.3 no.4 pp.901 -908, 1984

Selective amplification in methotrexate-resistant mouse cells of anartificial dihydrofolate reductase transcription unit making use ofcryptic splicing and polyadenylation sites

R.BreathnachLaboratoire de Genetique Moleculaire des Eucaryotes du CNRS, Unite 184de Biologie Moleculaire et de Genie Geneique de l'INSERM, Faculte deMedecine, 11 Rue Humann, 67085 Strasbourg Cedex, France

Communicated by P.Chambon

We have constructed a recombinant (pMOP) which is basedon the bacterial plasmid pML2 and contains bovine papil-loma virus type 1 (BPV 1) sequences linked to an artificialmouse dihydrofolate reductase (DHFR) transcription unit.This unit consists of the SV40 early gene promoter, a com-plete DHIFR coding sequence and splice and polyadenylationsites from a rabbit ,B-globin gene. Intact pMOP or a fragmentthereof devoid of pML2 sequences will transform mouse cellsto methotrexate resistance. The lines obtained contain - 200copies of the DHIFR transcription unit. In no case, however,did we find evidence of extrachromosomal maintenance ofBPV 1 or DHFR sequences. One line, when selected for re-sistance to elevated levels of methotrexate, contained ampli-fied copies of a 'novel' DHFR transcription unit resultingfrom fusion of two normal units. This line contained theDHFR RNA species present in the parent line plus some ad-ditional species. The structure of these various RNA specieswas determined and evidence found for the use of crypticsplice and polyadenylation sites.Key words: bovine papilloma virus/amplification/non-homologous recombination/cryptic sites

IntroductionBovine papilloma virus type 1 (BPV 1) will transform rodentfibroblasts in culture and is maintained extrachromosomallyin the transformed lines obtained (Amtmann et al., 1980;Lancaster, 1981; Law et al., 1981). A 69% fragment ofBPV 1 (defined by the unique BamHI and HindIII sites ofthe viral genome) contains all sequences essential for trans-formation and extrachromosomal maintenance (Sarver et al.,1981). When this fragment is linked to bacterial plasmid se-quences the resulting recombinants suffer a two orders ofmagnitude drop in transformation efficiency (Lowy et al.,1980; Binetruy et al., 1982). However, the transformingpower and extrachromosomal maintenance of such recombi-nants can be restored by incorporation of additional DNAfragments such as the 31 07o BPV 1 fragment (Sarver et al.,1982) or fragments of various genomic clones (Sarver et al.,1982; DiMaio et al., 1982). The interest in these recombinantslies in the fact that further genes placed in them will also bemaintained extrachromosomally and thus in a defined, repro-ducible and uniform environment. This allows comparativestudies of the expression of genes and their mutated counter-parts, for example.A further improvement to BPV 1 vectors would be the

ability to select cell lines using a dominant selective markerwithout loss of the extrachromosomal maintenance property.

Studies using BPV 1 vectors could be extended to cell lineswhere the focus-forming assay is difficult to apply, and non-transforming mutants of BPV 1 might be selected for con-struction of vectors for use in live animals. With these aims inmind, we have constructed a recombinant containing BPV 1sequences linked to an artificial mouse dihydrofolate re-ductase (DHFR) transcription unit and sequences of theplasmid pML2 [a derivative of pBR322 deleted for sequencesinhibiting replication of SV40 in monkey cells (Lusky andBotchan, 1981)]. This recombinant, either intact or cut with arestriction enzyme to remove pML2 sequences, will transformmouse fibroblasts to methotrexate resistance. However, re-sultant lines carry BPV 1 sequences apparently integrated in-to the host cell genome. No evidence for episomal forms wasfound. Maintenance of one such line in increasing concen-trations of methotrexate led to the amplification of a 'novel'DHFR transcription unit with concomitant appearance ofnew transcripts containing DHFR sequences.

ResultsLinked BPV I and DHFR sequences transform cells tomethotrexate resistanceWe have previously shown that a series of plasmids contain-ing BPV 1 sequences will transform rodent cells in culture(Binetruy et al., 1982). One such plasmid (pMH4, Figure lb)contains a HindIII-linearised BPV 1 genome in the HindIIIsite of pML2 (Lusky and Botchan, 1981). The BPV 1 moietyof pMH4 contains a unique BamHI site marking the bound-ary of the 69% of the genome required for transformation.We have introduced into this BamHI site an HhaI fragmentof pFL (Figure la) carrying a DHFR transcription unit con-sisting of the SV40 early gene promoter, a murine DHFRcDNA coding sequence and splice and polyadenylation sitesfrom a rabbit ,B-globin gene (O'Hare et al., 1981; Breathnachet al., 1982). The resulting plasmid pMOP (Figure Ic) thuscontains BPV 1 and DHFR sequences linked to bacterialplasmid pML2 sequences. These latter may be removed byHindIII digestion of pMOP (MOP insert, Figure Id).The DHFR encoded by pFL (and thus pMOP) is a mouse

enzyme sensitive to low levels of methotrexate (Chang et al.,1978). Nevertheless, pFL can transform mouse fibroblasts tomethotrexate resistance, albeit at low efficiency, doubtless byover-expression of the sensitive enzyme (Breathnach et al.,1982). We reasoned that were pMOP to be maintained extra-chromosomally in mouse fibroblasts at a copy number of>30 (an average copy number of BPV 1 in transformed celllines, Lowy et al., 1980) the fibroblasts would express suf-ficient DHFR to become methotrexate-resistant. We there-fore applied pMOP or the 'MOP insert' to NIH 3T3 cellsusing the calcium phosphate co-precipitation technique(Wigler et al., 1978). Methotrexate-resistant colonies were ob-tained in both cases at - 10 colonies/4g DNA, of whichabout one quarter showed obvious signs of morphologicaltransformation.

© IRL Press Limited, Oxford, England. 90i1

R.Breathnach

a)

b)

-~~~~~~-0P

_i,l

_1 mw%_ -_-a

SV40 promoter

DHFR cDNA

globin exonsBPVISV40 polyadenylation sites

Fig. 1. (a) Map of pFL. The HhaI sites used for preparation of the 2.4-kbDHFR transcription unit fragment are shown. Also shown are the extentsof the DHFR probe (linked arrowheads inside the circle) and globin intronprobe (linked arrowheads outside the circle). (b) Map of pMH4. The 69%transforming region of BPV 1 and the 31q7o region non-essential fortransformation are shown. (c) Map of pMOP (13.3 kb). The ampicillinresistance gene and origin of replication (ori) of the pML2 moiety are

shown. (d) Map of the 10.4-kb HindlII fragment obtained by digestion ofpMOP, sites are numbered for discussion in the text. Abbreviations:Hha = HhaI; Sac = Sacl; Eco = EcoRI; Hind = HindlII; Bgi = BgIlI;Kpn = KpnI; Ava = AvaI. An AvaI site used for sequencing is shown on

the MOP insert. The MOP insert contains other AvaI sites which are notshown. Drawings are not to scale.

Methotrexate-resistant lines carry integrated BPV 1 se-quences

We first investigated the state of pMOP sequences in metho-trexate-resistant lines obtained using the intact plasmid. DNAfrom Hirt supernatants and pellets, and total DNA sampleswere prepared from several lines and analysed by gel electro-phoresis, transfer to nitrocellulose and hybridisation with anick-translated pMOP probe. By quantitative comparison ofHirt supernatants and pellets (see Materials and methods) wewere able to show that pMOP sequences were not enriched inthe supernatants (data not shown). Analysis of total DNAsamples showed no sign of forms I or II pMOP; the pMOPsequences migrate with the bulk DNA as visualised byethidium bromide staining (Figure 2, lanes 1-3). When totalDNA samples were digested with EcoRI, BamHI, BglII orKpnI (enzymes with more than one site in pMOP) prior to gelelectrophoresis, bands co-migrating with those from a corre-sponding digest of pMOP were observed (see Figure 2, lanes4-6 for example). Some additional bands were observed,however (in particular see Figure 2, lane 4). By comparison ofband intensities of total DNA samples with band intensitiesof known amounts of pMOP we estimate that lines carry be-tween 100 and 300 copies of pMOP. When total DNAsamples were digested with SacI (which has a unique site in

902

Fig. 2. Structures of pMOP species present in some methotrexate-resistantlines obtained using the intact plasmid. Total DNA (5 /g) waselectrophoresed on a 1.2%7o agarose gel, transferred to nitrocellulose andhybridised with nick-translated pMOP. Lanes 1-3: sheared (Lowy et al.,1980) total cellular DNA from three different lines. The symbols I and IIagainst lane 1 show expected positions of migration of forms I and IIpMOP. Lanes 4-6: EcoRI digests of DNA from the same lines. Symbolsa, b, c against lane 6 show the expected positions of migration of bandsfrom an EcoRI digest of pMOP (Figure lc). Sizes of bands: a, 7200;b, 4900; c, 3100 nucleotides.

pMOP, Figure Ic) before gel electrophoresis, transfer tonitrocellulose and hybridisation with the pMOP probe, only afraction of the hybridising material co-migrated with Sacl-linearised pMOP; the bulk of the hybridising material mi-grated as a smear (data not shown).Had pMOP been maintained extrachromosomally in these

lines it should have been possible to observe forms I and IIpMOP in total DNA samples, and to enrich the pMOP se-quences in Hirt supernatants (reconstruction experimentshave verified that extrachromosomal pMOP would have beendetected by these methods, not shown). Furthermore, digestsof total DNA samples with Sacl, EcoRI etc., should havegenerated only material co-migrating with correspondingdigests of pMOP. We have therefore found no evidence forextrachromosomal maintenance of pMOP sequences in themethotrexate-resistant lines. Indeed all our data is consistentwith integration of the pMOP sequences into the host cellgenome. The same results were obtained whether linesshowed signs of oncogenic transformation or not.We investigated subsequently the state of pMOP sequences

in the methotrexate-resistant lines derived from the 'MOPinsert' (Figure Id). For the case of extrachromosomal main-tenance, we anticipated that the HindIII fragment of pMOPcarrying the BPV 1 and DHFR sequences (the MOP insert)would recircularise to generate a unique species in each linewhich could be extracted into a Hirt supernatant. However,comparison of Hirt supernatants and pellets from variouslines by gel electrophoresis, blotting and hybridisation to anick-translated BPV 1 probe demonstrated that MOP insertmaterial was not enriched in the Hirt supernatants. More-

Amplification of artificial DHFR transcription unit

a 1 2 3 .11

2 3 4

I

AW f' ....."'*.

__ _

Fig. 3. Structures of MOP insert species present in total DNA of somemethotrexate-resistant lines obtained using the HindlII digest of pMOP.Samples were treated as described in the legend to Figure 2. (a) Lanes2-4, EcoRI digest of DNA from three different lines. Lane 1, markerfragments of size 5.5 and 3.1 kb. The arrowhead indicates the position ofmigration of the 3.1-kb fragment Ecol-Eco2 (Figure Id). (b) Lanes 1-4,KpnI digest of DNA from four different lines. The arrowhead againstlane 1 indicates the position of migration of the 3.4-kb fragmentKpnl-Kpn3 (Figure Id).

over, digestion of total DNA samples with EcoRI or KpnI,which should generate respectively two or three fragments hy-bridising to a BPV 1 probe if the MOP insert had recircular-ised (Figure ld), gives rise to one major band and a smear(Figure 3a and b). These results are not consistent with extra-chromosomal maintenance of the MOP insert. However,they are compatible with a model where MOP inserts once in-side the cell become ligated together with varying degrees ofsequence deletion from the HindIII termini to form a pekele-some (Perucho et al., 1980) which subsequently integrates in-

to the host cell genome. An example is shown in Figure 4a.The product of ligation together of two MOP insert mole-cules A and B with deletion of sequences up to the arrows is aspecies which will generate on EcoRI digestion fragmentsEcolA-Eco2A and EcolB-Eco2B corresponding to fragmentEcol-Eco2 of the MOP insert (Figure Id) and also a fragmentEcolB-Eco2A whose size will depend on the extent of se-quence loss suffered by the MOP inserts on joining. As eachcell line contains -200 copies of the MOP insert (data notshown), many different such joining events will have oc-curred. The net result of EcoRI digest will be an intense bandcorresponding to the 3.1-kb fragment Ecol -Eco2 of theMOPinsert and a smear corresponding to many different sizedfragments like EcolB-Eco2A (see Figure 3a). Similarly aKpnI digest will give rise to an intense band corresponding tothe 3.4-kb fragment KpnI-Kpn3 of the MOP insert, and asmear corresponding to many different sized fragments likeKpnlB-Kpn3A (in Figure 4a we have shown a head to tailjoining of MOP inserts; head to head joining is also possible,but leads to the same result).

Amplification of a novel DHFR transcription unitAs shown above, we have found no evidence for extra-chromosomal maintenance of BPV 1 sequences in the linesobtained using a HindIII digest of pMOP. We hoped that byincreasing the selective pressure we would encourage DHFRgene amplification which might occur by excision and extra-chromosomal maintenance of linked BPV 1 and DHFRsequences.Four of the methotrexate-resistant cell lines obtained using

the 'MOP insert' were therefore grown in progressively in-creasing concentrations of methotrexate, starting at 0.8 AMand ending at 400 AM. Restriction enzyme digestion patternsof material derived from lines maintained in 0.8 zM or400 AM methotrexate were compared. For two lines, no dif-ferences were observed. However, for the other two lines(lines FL42 and FL54), extensive differences in restriction en-zyme digestion patterns with the enzymes BamHI, EcoRI andKpnI were observed (see for example Figures 5 and 6) be-tween the lines maintained in 0.8 uM methotrexate (FL42-0.8,FL54-0.8) and those maintained in 400 gM methotrexate(FL42400, FL54400). However, in neither case could thenovel species be enriched in Hirt supernatants (data notshown). For these experiments, two different probes wereused, either BPV 1 (BPV probe, Figure 5a) or a fragment of apFL-derived plasmid (DHFR probe, Figure 5b) carrying theSV40 promoter region and the DHFR coding sequence (seeMaterials and methods and Figure la).

In general, where a smear is observed in lines maintained in0.8 AM methotrexate, discrete bands become visible in linesmaintained in 400 liM methotrexate (compare lanes 2 and 3or lanes 4 and 5 of Figure 5, for example). Intriguingly, whilea BamHI digest of FL42-0.8 DNA hybridised to the DHFRprobe gives rise to a single band corresponding to the 2-kbfragment Baml-Bam2 of the MOP insert (Figure Id), aBamHI digest of FL42400 DNA gives rise to three bands at5.4, 2.1 and 2.0-kb (a, b, c of Figure Sb lane 4). Only one ofthese (c) corresponds to fragment Baml-Bam2. We decidedto investigate in more detail the nature of MOP insert se-quences in line FL42400 to determine the nature of these ad-ditional bands.The results of a variety of mapping and cloning exper-

iments (see below) allowed us to propose the following modelfor the identity and generation of the species giving rise to the

903

b 1

A I iVA

000

0w

c .a

I A I 1I

b) 43Il ~~~~mq D rCr-___ _1 D

W Wua Ea co

e c

c EcmVSX C X C C) V-E cm o EO~~~~~~~~~~~~~~~~~0~~ ~ ~ ~ ~ W

Cu u"Cm w mcY < 1.2 oY' 3-4 a CO mm

LAsw x co CO co

I fIl4Po

Fig. 4. (a) Head-to-tail joining of two MOP insert molecules A and B (Figure Id) by recombination at the arrows. Sites on the product are numbered as inFigure Id; they are lettered A or B depending on whether they have their origin in molecule A or B. (b) Head-to-tail joining of three MOP insert moleculesC, D and E (Figure Id) by recombination between sequences at arrows 3 and 4 or 1 and 2. Sites on the product are numbered as in Figure Id and lettered C,D or E depending on their origin. The linked arrowheads define the 6.4-kb Bgl5C-EcolE fragment recovered as a plasmid in E. coli. An AvaI site used forsequencing across arrow 1.2 is shown. Abbreviations and symbols are as in Figure 1.

unexpected bands observed in digests of FL42-400 DNA. Wepropose that during the pekelesome formation involved in thegenesis of line FL42-0.8 three MOP insert molecules becamejoined as shown in Figure 4b. One of the joining events linkssequences (arrow 1, molecule D) within the f3-globin geneintron of the DHFR transcription unit of one MOP insert toBPV 1 sequences (arrow 2, molecule E) upstream from theSV40 promoter of the unit of a second insert molecule. A'novel' DHFR transcription unit representing the fusion oftwo normal units is thus formed. This novel unit and flankingsequences, present in one copy in FL42-0.8 DNA, is amplifiedin FL42-400 DNA. The nature of the flanking sequencesdepends on the fate of the extremities of molecules C and Eand has not been determined. We limit our consideration tosequences lying between sites BamIE and BamIC.A number of mapping results are consistent with this

model. BamHI digestion of FL42-400 DNA carrying theamplified unit followed by gel electrophoresis, transfer tonitrocellulose and hybridisation to the nick-translated BPV 1

probe gives rise to an intense band representing the 5.4-kbfragment Bam2D-BamlC (Figure 5a, lane 4). Hybridisationto the DHFR probe gives rise [in addition to a band rep-resenting the 2.0-kb fragment Baml-Bam2 of the MOP in-sert, (Figure Id)] to bands representing the 2.1- and 5.4-kbfragments Bam2E-Bam2D and Bam2D-BamlC (Figure 5b,bands b and a, respectively; the DHFR probe contains boththe DHFR-coding sequence and the SV40 promoter). A KpnIdigest of FL42-400 DNA hybridised to the DHFR probeidentifies bands representing the 3.4-kb fragment Kpn3-Kpnlof the MOP insert (Figure 6, lane 2, band a) and the 2.1-kbfragment KpnlE-KpnlD (Figure 6, lane 2, band b). FragmentKpnlE-KpnlD is the same size as fragment Bam2E-Bam2D(Figure 6, lane 3, band b). An EcoRI digest of FL42-400 hy-bridised to the DHFR probe gives rise to a band at 7.0-kb rep-resenting the fragment EcoIE-Eco2C. This fragment alsohybridises with the BPV probe (data not shown).

Proof of the existence of the novel DHFR transcriptionunit in FL42-400 DNA was obtained by an experiment in-volving digestion of FL42400 DNA with BglII and EcoRIfollowed by ligation to the large BamHI-EcoRI fragment ofpBR327. This material was used to transform Escherichia colito ampicillin resistance, and resulting colonies screened onfilters for DHFR sequences. In this way we isolated severalplasmids carrying a 6.4-kb BglII-EcoRI fragment whosestructure was demonstrated by restriction enzyme mappingand sequencing to correspond to that of fragment Bgl5C-EcoIE of Figure 4b. The sequencing studies allowed thepoints of joining (as shown in Figure 4b) of globin and BPV 1

(arrows 1 and 2) or BPV 1 and BPV 1 sequences (arrows 3and 4) to be determined exactly (Figure 7).The percentage of the DHFR transcription units present in

line FL42-400 which are of the novel form may be estimatedby comparison of the intensity of hybridisation with theDHFR probe of fragments Bam2E-Bam22D and BamlE-Bam2E, that is to say the intensities of bands b and c of Fig-ure 5b, lane 4. The intensity is about equal. However, theBamrIE-Bam2E fragment carries 750 bp of DNA (the DHFRcDNA-coding sequence) complementary to the DHFR probewhile the fragment Bam2E-Bam2D carries 1150 (DHFRcDNA-coding sequence + SV40 promoter). We thusestimate that there are around twice as many novel tran-scription units as 'normal' ones (i.e., those similar to thatcarried by pMOP) in FL42400 DNA.

Amplification of the 'novel' DHFR transcription unit leadsto the appearance of novel transcriptsCytoplasmic RNA from lines FL42-0.8 and 400 was electro-phoresed on a methyl-mercuryhydroxide/agarose gel, trans-ferred to DBM-paper and hybridised with a variety of nick-translated probes. Probes used were either the BPV probe,the DHFR probe or a probe containing only 3-globin geneintron sequences (see Materials and methods and Figure la).

904

R.Breathnach

a)

B M.o Mo cxw ~e

r -I I -_

r_E -1

:cc

CL

De

--

~~~~I . I

*. I. ___ _

Amplificadon of artificial DHR transciption unit

1 2 3

aIt .

v

)l b b.._. .e. _

AC.

5 Fig. 6. Structure of species present in line FL42400. Total DNA samples(20 jig) were treated as in the legend to Figure 5 with hybridisation to theDHFR probe. Lane 1: marker bands of sizes 7.0, 3.8, 3.5 and 1.7 kb.Lane 2: KpnI digest of FL42400 DNA. Bands a and b correspond to the3.4-kb Kpn3E-KpnlE and the 2.1-kb KpnlE-KpnlD fragments of Figure4b, respectively. Lane 3: BamHI digest of FL42-400 DNA. Bands b and care as in Figure 5b, lane 4.

5211 5248I

A) 5'.... TACACAGGGACTTGCATTCGTACTCTTGCATGAAGAGC... 3'-* 4 3.4B) 5'....ACAAAGTACGTTGCCGGTCGGGGTCAAACCGTCTTCGG... 3'.*.-33

I7753 7790

981 1018v I

c) 5'... ACTGTTTGAGATGAGGATAAAATACTCTGAGTCCAAAC ... 3'.w- 1 1.2

D) 5'....ACACTTCAGGATCTTCCGTGGGCACCTGTGTGTAGTAC... 3'----224999 tT 4962

Fig. 5. Detection of differences between lines maintained in low or highmethotrexate concentrations. Total DNA samples (20 jig except lane 4,10 Ag) were digested with BamHI, electrophoresed on a 1.2% agarose gel,transferred to nitrocellulose and hybridised with a nick-translated BPV Iprobe (a) or DHFR probe (b). For a and b: lane 2, FL54-400 DNA; lane3, FL54-0.8 DNA; lane 4, FL42-400 DNA; lane 5, FL42-0.8 DNA. For a,lane 1 shows three marker bands of sizes 5, 3.1 and 2.3-kb. For b, lane 1shows three marker bands of sizes 12.0, 5.4 and 2.0 kb. In lane 4 bands a,b, c correspond to the 5.4-kb Bam2D-BamlC, the 2.1-kb Bam2E-Bam2Dand the 2.0-kb BamlE-Bam2E fragments of Figure 4, respectively.

The results obtained are as follows: line FL42-0.8 RNA con-tains two species of -500 (species 4) and 1000 (species 3)nucleotides which hybridise with the DHFR probe only. LineFL424400 RNA contains in addition species at 1100 (species2), 3500 (species 1) and 8000 nucleotides (species 0) which hy-bridise with both the DHFR probe and the ,B-globin intronprobe. RNA species 0 and 1 also hybridise with the BPV 1

probe. Some of these results are shown in Figure 8. Species 4is however not visible on this gel which was run long to opti-mise resolution of species 2 and 3. Species 0 is of low abun-

E) 5'. .. TCAGTGGAAGCT ....................... 3'F) 5'... .TCAGTGGAAGTGTAAT ..............TACAGVCT... 3'

Fig. 7. A-D: Sequences around arrows 4, 3, 1 and 2 respectively of Figure4b. Sequences around arrows 1.2 and 3.4 of Figure 4b may be obtained byreading the underlined sequence. Numbers on sequences A, B and D referto the BPV I sequence of Chen et al. (1982). Numbers on sequence C referto the ,B-globin gene sequence of Van Ooyen et al. (1979). Sequencesaround arrows 1.2 and 3.4 were determined using the cloned Bgl5C-EcolEfragment (Figure 4b) 5' end-labelled at the HpaC site (a HpaI site atnucleotide 7945) or the Aval site (nucleotide 4840) respectively, on theBPV 1 sequence. E: Sequence of a region of a cDNA clone correspondingto RNA species 4 (see text). F: Derivation of sequence shown in E bysplicing of a donor site in the DHFR coding sequence (left) to the (3-globingene acceptor (right). In sequence D, the dinucleotide TG shown by arrowsis present in the BPV 1 sequence of Chen et al. (1982) but not in thesequence around arrow 1.2 determined on the fragment Bgl5C-EcolE.

dance and difficult to see in this figure; however, it is clearlyvisible on the original autoradiograms.The nature of the diverse RNA species observed was eluci-

905

a 1 2 3 4

b

.5

bi 2 3 4

aV

b

-c-C

R.Breathnach

a b0

3 _I

c d0 mm

e f00'.

1mW. i. '.W.:

2

Fig. 8. RNA species present in lines FL42-0.8 and FL42400. CytoplasmicRNA (20 zg) was electrophoresed on a 1%7o agarose gel containing 10 mMmethylmercury hydroxide and transferred to DBM-paper beforehybridisation with a series of nick-translated probes. The same filter wasused in these experiments following dehybridisation. Size markers weremouse 28S and 18S and E. coli RNAs. Lanes a, c, e: RNA from lineFL42-400. Lanes b, d, f: RNA from lines FL42-0.8. Lanes a, b:hybridisation to DHFR probe. Lanes c, d: hybridisation to BPV 1 probe.Lanes e,f: hybridisation to globin intron probe. Arrowheads mark thepositions of species 0-3 RNAs.

3' 5'

3 A A_

4 A As J 2

o X ,,, X QE< ._X o EwIm t I cCol m m :I Co m

I7A71 I I I ir' -.-, I i I i

1

Fig. 9. Structure of some RNA species present in line FL42400 as deducedfrom RNA gel blotting experiments and structures of cDNA clones. Partof the novel DHFR transcription unit is shown taken from Figure 4b.Some sites are shown within the ,B-globin intron and correspond to thefollowing positions on the sequence of Van Ooyen et al. (1979):Hinc = HincII at 653; Rsa = RsaI at 821; Bst = BstNI at 937;Hpa = HpaII at 1020. For RNA species 1-4, horizontal lines solid orbroken indicate which sequences of the DHFR transcription unit theycontain. Raised solid lines indicate sequences spliced out. A represents thepoly(A) tail at the 3' end of the RNAs. The solid horizontal lines indicatethe extent of sequence found in corresponding cDNA clones. The brokenhorizontal lines indicate additional sequences probably present in theseRNA species.

dated by construction and analysis of a cDNA library fromFL42-400 RNA. The library was constructed using the Okay-ama and Berg technique (Breathnach and Harris, 1983; seeMaterials and methods) and -2000 filter-bound colonieswere screened using the DHFR probe. Plasmids were pre-pared from 23 positive colonies and the structures of thecDNA inserts determined by restriction enzyme mapping, andin some cases by nucleotide sequencing. The cDNA insertsfell into four classes (see Figure 9). One class (13 members) ofinserts 500 nucleotides in length had sites for EcoRI and

906

BamHI, but not Sacl nor HincII, and corresponded to RNAspecies 4. This RNA initiates under control of the SV40 pro-moter, and uses a donor site within the DHFR cDNA codingsequence for splicing to the 3-globin gene acceptor. This wasshown by sequencing the cDNA insert from the EcoRI site inthe globin exon moiety lying 50 nucleotides downstream fromthe globin acceptor site (see Figures 7 and 9). A second class(four members) of cDNA inserts was - 1000 nucleotides insize and had sites for EcoRI, BamHI and SacI but not HincIIand corresponded to species 3. This RNA is the 'expected'transcript initiating from the SV40 promoter, carrying a fulltranscript of the DHFR cDNA-coding sequences and usingthe 3-globin donor and acceptor sites for splicing. A thirdclass (four members), also - 1000 nucleotides in size, hadsites for HincII and Sacl, but not for EcoRI or BamHI, andcorresponded to RNA species 2. The 5' ends of three cDNAinserts of this class were determined by sequencing and shownto lie within the DHFR segment, either in the 5'-non-translated region or within the coding sequence. These insertsmay represent incomplete cDNA copies of mRNAs initiatingunder control of the SV40 promoter. The 3' ends of the in-serts mapped within the ,B-globin intron between a RsaI site at821 nucleotides and a BstNI site at 940 nucleotides on the 3-globin gene sequence of Van Ooyen et al. (1979). Species 2RNA is thus apparently unspliced and uses a novel poly-adenylation site within the rabbit f3-globin large intron. Afourth class (two members) of insert was obtained whichpresumably corresponds to species 1. The structure of thelonger of these inserts is shown in Figure 9. The 5' end mapsin the BPV 1 sequence upstream from the SV40 promoter.We propose that this is an incomplete cDNA copy of a com-plete transcript of the 'novel' DHFR transcription unit asindicated in Figure 9. We have not been able to elucidate thestructure of the low-abundance RNA species 0.

DiscussionWe have constructed a recombinant (pMOP) containing thebacterial plasmid pML2 (Lusky and Botchan, 1981), a BPV 1genome and an artificial DHFR transcription unit comprisingan SV40 early gene promoter, a DHFR cDNA-coding se-quence and splice and polyadenylation sites from a rabbit j-globin gene. The recombinant, either intact or freed ofbacterial plasmid sequences by restriction enzyme digestion,will transform mouse NIH 3T3 cells to methotrexate resist-ance. However, we have found no evidence for extrachromo-somal maintenance of the BPV 1 sequences. RecentlyMatthias et al. (1983) and Meneguzzi et al. (personal com-munication) have obtained extrachromosomal maintenanceof a BPV 1 recombinant expressing the G418 resistancemarker following G418 selection, demonstrating that selec-tion for transformation is not a prerequisite for extrachromo-somal maintenance. The structure of their recombinants isdifferent from ours and makes use of the herpes simplex virusthymidine kinase gene transcription signals. It is possible thatthe SV40 early gene promoter fragment used in our construc-tion and which contains the SV40 enhancer region may inter-fere with BPV 1 transcription or the BPV 1 replicationorigin, perhaps by introducing undesirable chromatin struc-tures (Jongstra et al., 1984). In any case our results indicatethat the extrachromosomal maintenance of BPV 1-selectivemarker recombinants will depend on their structure and maybe abolished by the incorporation of additional sequences.

Perucho et al. (1980) have proposed a model where DNA

Amplification of artifidal DHFR transcription unit

introduced into cells by the calcium phosphate transfectionprocedure becomes linked into long arrays (termed pekele-somes) before association with the host genome. This modelprovides a convenient explanation for the results we have ob-tained with lines generated using the HindIII digest ofpMOP. Such lines appear to contain arrays of MOP insert se-quences (Figure Id) joined together with varying degrees ofsequence loss from the HindIII termini. One such line (FL42),when maintained in high levels of methotrexate, accumulatedmultiple copies of a 'novel' DHFR transcription unit formedby fusion of two of the transcription units present on pMOP.We have elucidated the structure of this unit by restriction en-zyme mapping of total cellular DNA and by isolation of a6.4-kb fragment covering it by cloning in E. coli (Figure 4b).Although other explanations are possible, we propose thatthis unit was created during pekelesome formation, and hasbeen amplied -200-fold in response to the increase in selec-tive pressure. Using the cloned material, we have investigatedby sequencing the nature of the recombination events in-volved in the generation of the 'novel' DHFR transcriptionunit (Figure 7). No sequence homology around the sequencesto be joined was detected. This is in accord with previouswork which has shown that non-homologous recombinationevents appear to take place readily in eukaryotic cells, and torequire no special sequence features (see, for example,Savageau et al., 1983).

Novel transcripts containing DHFR sequences appear con-comitantly with the amplification of the novel DHFR tran-scription unit in the line FL42. Their structure as deduced byRNA-gel blotting experiments and sequence analysis of corre-sponding cDNA clones is shown in Figure 9. One of thesetranscripts (species 2) appears to be unspliced and to use anovel polyadenylation site within the /3-globin intron. Restric-tion enzyme mapping of corresponding cDNA clones locatesthe 3' end of species 2 RNA as lying between a RsaI site and aBstNI site at nucleotides 821 and 937, respectively on the f-globin sequence of Van Ooyen et al. (1979). In this regionmay be found the sequences ATTAAA and ATAAA whichmight be capable of functioning as polyadenylation signals.These sequences, however, do not function as such in thenormal cellular rabbit j-globin gene. It may be that their useis favoured in the novel DHFR transcription unit if the tran-scribing RNA polymerae pauses significantly upstream of thedownstream SV40 promoter element or terminates anywhereupstream of the normal 3-globin polyadenylation site.We have found, in lines obtained using HindIII-digested

pMOP, an RNA species which makes use of a donor sitelying in the DHFR coding sequence for splicing to the ,3-glo-bin gene acceptor (Figure 7). This donor site has the sequence5' .. .GGAAG1GTAAAC... 3'. It is created in the DHFRcoding sequence during maturation of the precursor tran-script of the normal cellular gene (Crouse et al., 1982) whenthe exon 2 donor (5' . . . GGAAG1GTAAT . .. 3')becomes spliced to the exon 3 acceptor (5' . . . TATT-ATAG1GTAAAC. . . 3'). Splicing of any donor5' ... XXXIGT ... 3' to an acceptor of the form5'AG1GT ... 3' will in a similar manner regenerate a se-

quence 5' . . . XXX 1GT . .. 3' which may be capable offunctioning as a donor. As acceptors of this form are com-

mon, many cDNA fragments may contain sequences capableof acting as donors. This may be disadvantageous when suchfragments are introduced into eukaryotic expression vectorsupstream of a pair of splice sites, as is the case in pMOP,

where use of a donor contained in the fragment will reducethe yield of the desired transcript. It may be better to expresssuch fragments from vectors in which the fragment liesdownstream from a pair of splice sites, as new acceptor sitesare less likely to be formed by the process described above forgeneration of donor sites. We have described such vectorselsewhere (Breathnach and Harris, 1983).Our findings of novel splice and polyadenylation sites in

the artificial DHFR transcription units not normally used inthe cellular globin or DHFR genes emphasise the role playedby the environment in the activity of such sites. Many se-quences close to the consensus sequences for splice or poly-adenylation sites exist within exon sequences of eukaryoticgenes but are not normally used. They may, however, becomeactive when gene fragments are expressed out of their usualcontext.The use of novel splice and polyadenylation sites described

above may provide a clue as to why, of all the 200-odd DHFRtranscription units present in line FL42-0.8, only the noveltranscription unit is amplified in response to increased selec-tive pressure. We hypothesise that the novel transcription unitcan encode a methotrexate-resistant DHFR. For example, thepresence in the same transcription unit of two DHFR codingsequences in the same orientation could allow splicing to oc-cur from a donor site in the upstream sequence to an acceptorsite in the downstream sequence. A candidate for such adonor site has already been identified. This hypotheticalRNA species might be produced inefficiently and haveescaped detection in the experiments shown in Figure 8. Inthis respect, it is of interest to note that the transcript of thenormal cellular DHFR gene present in NIH 3T3 cells was ofinsufficient abundance to be detected in these experiments.

Materials and methodsPreparation ofplasmids and probesThe construction of plasmids pMH4 and pFL has been described elsewhere(Binetruy et al., 1982; Breathnach et al., 1982). pMH4 contains an insert ofHindIII-linearised BPV 1 (7945 bp) in the HindIll site of pML2 (2900 bp)(Lusky and Botchan, 1981); pFL contains the SV40 early gene promoter[HpaII-HindIII fragment, nucleotides 346 -5171, BBB system (Tooze, 1981)]as an EcoRI-BamHI fragment, linked to a complete coding sequence for a

mouse DHFR [750 bp TacI-BgllI fragment (Chang et al., 1978)]. The DHFRcoding sequence is followed by a 1.2-kb BamHI-PvuII fragment of a rabbit (3-globin gene containing the large intron and polyadenylation site. The globinsequence is followed by a 140-bp fragment of SV40 carrying the early messen-

ger polyadenylation site (2666 -2533). For construction ofpMOP (13.3-kb), a

2.4-kb HhaI fragment of pFL (Figure la) was purified by sucrose gradientcentrifugation and made flush-ended by treatment with DNA polymerase I(Biolabs) before ligation to BamHI linears of pMH4, also rendered flush-ended by polymerase treatment. The ligation mixture was transfected into E.cohi C600 and ampicillin-resistant colonies screened using the technique of Ish-Horowicz and Burke (1981). Conditions used for these cloning steps were as

described previously (O'Hare et al., 1981).The DHFR probe (see text) was prepared from a plasmid similar to pFL

but retaining the BgIII site at the end of the DHFR coding sequence (gift ofG.Rautmann). An EcoRl +BglII digest of this plasmid generates an - 1150nucleotide fragment containing the SV40 early gene promoter (346 -5171)linked to the 750 nucleotide DHFR Tacl-BgllI fragment described above.This fragment (see Figure la) was isolated by agarose gel electrophoresis(Dretzen et al., 1981). The rabbit j3-globin gene intron present in pFL extendsfrom nucleotides 493-1066 on the sequence of Van Ooyen et al. (1979). A367 nucleotide HincII-HpaII fragment from this intron (653-1020; Figure 9)was cloned between the Clal and PvuII sites of pBR322 producing a plasmidpGLI. This plasmid was used as a probe for globin intron sequences.Cell transfectionNIH 3T3 cells were maintained in Dulbecco's medium supplemented with0l7o calf serum. 24 h prior to transfection, cells were plated at 800 000 cells

per 95 mm Petri dish. Transfections were carried out as described by Wigler et

907

R.Breathnach

al. (1978) using either 20 jug of a HindlII digest of pMOP, or 1 Ag of pMOPplus 10,ug salmon sperm DNA. Precipitates were left on the cells for 24 h,before a glycerol shock was applied (O'Hare, 1981). 24 h later cells wereplated at a 10-fold dilution in medium containing 0.8 j4M methotrexate(Sigma), and this medium was changed every 3-4 days. After 3 weekscolonies were picked using cloning cylinders and grown into mass culture.DNA and RNA analysisPreparation of total cellular DNA (Breathnach et al., 1980), cytoplasmicRNA (O'Hare et al., 1981), gel electrophoresis and blotting of DNA (Breath-nach et al., 1980) and RNA (Gerlinger et al., 1983) and nick-translation(Breathnach et al., 1980) were all as described in the corresponding references.Preparation of Hirt supernatants was as described by O'Hare (1981), exceptthat after the high-speed centrifugation the pellet was gently suspended in10 mM Tris-HCl pH 7.5 containing 1 mM EDTA, 0.5% SDS and 500 ,g/mlproteinase K and incubated for 4 h at 37°C before phenol-chloroform extrac-tion and three ethanol precipitations. Equal fractions of Hirt supernatantsand pellets were then analysed.

Preparation of a cDNA library from line FL42-400 poly(A) I RNA was asdescribed in Breathnach and Harris (1983). About 20 000 colonies were ob-tained from 1 isg of poly(A)+ RNA. Of these, 2000 were screened using thetechnique of Grunstein and Hogness (1975) with a nick-translated DHFRprobe. For recovery of linked BPV 1 and DHFR sequences as plasmids in E.coli, total cellular DNA from line FL42-400 was cut by BglII and EcoRI, and200 ng ligated to 20 ng of the large EcoRI-BamHI fragment of pBR327,previously purified by sucrose gradient centrifugation. E. coli C600 weretransfected and spread on ampicillin plates so as to give a high density ofcolonies. Screening of colonies by transfer to nitrocellulose and hybridisationwith a nick-translated DHFR probe was as described by Hanahan andMeselson (1980). Positive areas of the plate were picked and inoculated intoL-broth for preparation of cleared lysates (Ish-Horowicz and Burke, 1981).Resulting DNA was re-transfected into E. coli and screening repeated at lowerdensity.

AcknowledgementsWe are indebted to Professor P.Chambon for useful discussions and a criticalreading of the manuscript. We thank M.C.Gesnel, M.Acker and B.Augs-burger for excellent technical assistance. This work was supported by grantsfrom CNRS (ATP 3582), INSERM (PRC 124025) and MIR (83V0092).

ReferencesAmtmann,E., Muller,H. and Sauer,G. (1989) J. Virol., 35, 962-964.Binetruy,B., Meneguzzi,G., Breathnach,R. and Cuzin,F. (1982) EMBOJ., 1,

621-628.Breathnach,R., Mantei,N. and Chambon,P. (1980) Proc. Natl. Acad. Sci.

USA, 77, 740-744.Breathnach,R., Benoist,C. and O'Hare,K. (1982) in Winnacker,E.L. and

Schone,H.H. (eds.), Proceedings ofthe 9th Workshop Conference Hoechst'Genes and Tumor Genes', Raven Press, NY, pp. 145-153.

Breathnach,R. and Harris,B. (1983) Nucleic Acids Res., 11, 7119-7136.Chang,A.C.Y., Nunberg,J.H., Kaufman,R.J., Ehrlich,H.A., Schimke,R.T.

and Cohen,S.N. (1978) Nature, 275, 617-624.Chen,E.Y., Howley,P.M., Levinson,A.D. and Seeburg,P.H. (1982) Nature,

299, 529-534.Crouse,G.F., Simonsen,C.C., McEwan,R.N. and Schimke,R.T. (1982) J.

Biol. Chem., 257, 7887-7897.Di Maio,D., Treisman,R. and Maniatis,T. (1982) Proc. Natl. Acad. Sci.

USA, 79, 4030-4034.Dretzen,G., Bellard,M., Sassone-Corsi,P. and Chambon,P. (1981) Anal.

Biochem., 112, 295-298.Gerlinger,P., Krust,A., LeMeur,M., Perrin,F., Cochet,M., Gannon,F.,

Dupret,D. and Chambon,P. (1982) J. MoL Biol., 162, 345-364.Grunstein,M. and Hogness,D. (1975) Proc. Natl. Acad. Sci. USA, 72, 3961-

3965.Hanahan,D. and Meselson,M. (1980) Gene, 10, 63-67.Ish-Horowicz,D. and Burke,J.T. (1981) Nucleic Acids Res., 9, 2898-2998.Jongstra,J., Reudelhuber,T., Oudet,P., Benoist,C., Chae,C.-B., Jeltsch,

J.M., Mathis,D. and Chambon,P. (1984) Nature, in press.Lancaster,W.D. (1981) Virology, 108, 527-538.Law,M.F., Lowy,D.R., Dvoretzky,I. and Howley,P.M. (1981) Proc. Natl.Acad. Sci. USA, 78, 2727-2731.

Lowy,D.R., Dvoretzky,I., Shober,R., Law,M.F., Engel,L. and Howley,P.M. (1980) Nature, 287, 72-74.

Lusky,M. and Botchan,M. (1981) Nature, 293, 79-81.Matthias,P.J., Bernard,H.U., Scott,A., Brady,G., Hashimoto-Gotoh,T. and

Schutz,G. (1983) EMBO J., 2, 1487-1492.O'Hare,K. (1981) J. Mol. Biol., 151, 203-210.

O'Hare,K., Benoist,C. and Breathnach,R. (1981) Proc. NatI. Acad. Sci.USA,78, 1527-1531.

Perucho,M., Hanahan,D. and Wigler,M. (1980) Cell, 22, 309-317.Sarver,N., Gruss,P., Law,M.F., Khoury,G. and Howley,P.M. (1981) Mol.

Cell. Biol., 1, 486-496.Sarver,N., Byrne,J.C. and Howley,P.M. (1982) Proc. Natl. Acad. Sci. USA,

79, 7147-7151.Savageau,M.A., Metter,R. and Brockman,W. (1983) Nucleic Acids Res., 11,

6559-6570.Tooze,J., ed. (1982) DNA Tumor Viruses, published by Cold Spring Harbor

Laboratory Press, NY.Van Ooyen,A., Van den Berg,J., Mantei,N. and Weissmann,C. (1979)

Science (Wash.), 206, 337-344.Wigler,M., Pellicer,A., Silverstein,S. and Axel,R. (1978) Cell, 14, 725-731.

Received on 18 January 1984

908