Section: The Structure of DNARead each question, and answer based upon what you learn in the section.1. With what kinds of bacteria did Griffith inject mice?2. What was different about the S bacteria and the R bacteria?3. Why were the heat-killed S bacteria harmless?4. Why was the mixture of heat-killed S bacteria and R bacteria virulent?5. What did Griffith discover as a result of his experiments?6. How did Avery discover that the material responsible for transformation in bacteria was DNA?7. Viruses that infect bacteria are called [bacteriophages / rough].8. A virus is made of DNA and [proteins / cell walls].9. Radioactive sulfur was used to label the [DNA / protein] in the viruses.10. Radioactive phosphorus was used to label the [DNA / protein] in the viruses.11. Hershey and Chase discovered that after the 32P-labeled phages infected the bacteria, most of

the radioactive phosphorus was found in the layer containing [bacteria / phage].Match the letter of the phrase with the appropriate term_____ 12. double helix_____ 13. nucleotides_____ 14. deoxyribose_____ 15. hydrogen bond_____ 16. nitrogenous bases_____ 17. adenine_____ 18. cytosine_____ 19. ChargaffExplain how the terms in each pair are related to each other.20. base-pairing rules, complementary21.Wilkins and Franklin, DNA structure

a. a five-carbon sugarb. type of weak bond between base pairs that holds the double helix togetherc. four kinds and they form specific pairsd. subunits that make up DNAe. one of two pyrimidines used as a nitrogenous base in nucleotidesf. one of two purines used as a nitrogenous base in nucleotidesg. discovered that the amount of adenine always equaled the amount of cytosine and that guanine always equaled cytosineh. two strands of nucleotides twisted around each other

Concept Check.Using the rules of complementary bases and h-bonding, determine what each shape is. Box in and label each nucleotide. Box in and label the backbone.

To solve:Look at the number of rings then the number of bonds…A has ________ rings and has ______ bonds with _____.G has ________ rings and has ______ bonds with _____.

Directions:1)Answer Review Questions on back:

1. What is the basic subunit for DNA?2. What are the three parts?3. Which parts are the backbone?4. Which nucleotides are purines?5. Which nucleotides are pyrimidines?6. How do you tell the difference between the two?7. What type of bond holds together DNA strands?

2)Cut out the nucleotides from the Nucleotide Bank (right).3)Match them up with the template strand above based upon base-pairing rules then tape/glue beneath.4)Determine the sequence (order of the string of nucleotides read left to right) for both the template strand and the new complimentary strand. Label the sequence of the template and complimentary strand on the lines with the nucleotide abbreviation.

Construct a DNA model Using Base-pairing Rules.Homework: 25 Pts. Due tomorrow to gain access to DNA Extraction Lab.

Template Strand

Nucleotide Bank

2 rings

1 ring

3 bonds

Template Strand: G __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __

Complementary Strand:___ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __

1.________________________ 20.2.__________________________3.___________________________4.___________________________5.___________________________6.__________________________7.__________________________8._______________ _________9.__________________________10.________________________11._________________ _________________ _________________12._________________ _________________13._____________ _____________ _____________ _____________14._________________ _________________15._____________ _____________ _____________ _____________16.________________________17.____ ____ ____ ____18. There are _____ between ___ & ___; ___ between ___ & ___.19. ________________________

Replication.

Write the term and the matching description. 1. DNA replication 2. DNA helicase 3. replication forks 4. DNA polymerases 5. new DNA strand

Answer the following questions. 6. What is DNA replication? 7. When does DNA replication occur? 8. What must occur before DNA replication can begin? 9. What are the three main stages of replication and what happens at each stage?10. Identify the two major enzymes used during DNA replication and describe their function. a. b. 10. What prevents the separated DNA strands from reattaching to one another during DNA

replication? 11. What prevents the wrong nucleotide from being added to the new strand during DNA

replication? 12. Prokaryotic DNA is reproduced with ________ replication forks.13. Human replication occurs with ________ replication forks. 14. Each human chromosome is replicated in about ___ hours and in about _______ sections. 15. The number of nucleotides between each replication fork in human DNA is approximately ____.

a. add nucleotides to the exposed bases according to the base-pairing rules b. process of making a copy of DNAc. two Y-shaped areas that form when the double helix separates in DNA replicationd. opens up the double helix by breaking the hydrogen bonds between nitrogen

bases e. each double-stranded DNA helix is made up of one of these after DNA replication

13.2 In-class Activity: Replication Comparison

A

B

C

D

E

F

G

•Label the letters on a ½ sheet of paper. •Save this paper for a follow-up activity that will be turned in at the end of class.•Word-bank: Original DNA (x2), New DNA (x2), Replication Forks (x2), Replication bubble•You have 10 minutes!

Item Points

Step1: DNA unwinds 1

DNA Helicase 2

Correct DNA Sequence 2

Direction Replication is proceeding. 1

Step 2: New DNA forming 1

Leading Strand 1

Lagging Strand 1

Replication Fork 1

RNA Primer 1

Okasaki Fragment 1

DNA Polymerase 2

Free Nucleotides 1

Step 3: New DNA complete 1

5’ end all DNA 2

3’ end all DNA 2

New DNA (color blue) 1

Old DNA (color red) 1

DNA Ligase 2

Exact Copies 1

Total 25

DNA Replication Drawing Scoring Rubric•You are responsible for understanding the process of replication and being able to identify the 3 steps as well as identifying all the key components involved.•Your assignment is to draw all 3 steps in the process of replication in one drawing (template provided).•You must show each stage of replication in the illustration, labeling all the steps, proteins, landmarks, and & showing what DNA is where according to the rubric.•This is worth 25 points.

Replication Enzymes

Ligase

Helicase

DNA Polymerase

DNA Replication Drawing

G A AAT T C A T C G A C T C G

A G C

A C AG TC C A T C GT

Quick Lab (10pts): DNA Replication Rate

Cancer is a disease caused by cells that divide uncontrollably. Faster replication means faster spread of the disease. Scientists studying drugs that treat cancer often measure the effectiveness of a drug by its effect on DNA replication. During normal DNA replication, nucleotides are added at a rate of about 50 nucleotides per second in mammals and 500 nucleotides per second in bacteria.

1. (2pts) Calculate the time it would take a bacterium to add 4000 nucleotides to one DNA strand undergoing replication.

2. (2pts) Calculate the time it would take a mammalian cell to add 4000 nucleotides to one DNA strand undergoing replication.

3. (3pts) Critical Thinking. Predict Outcomes: How would the total time needed to add the 4000 nucleotides be affected if a drug that inhibits (prevents) DNA polymerases was present?

4. (3pts) Critical Thinking. Predict Outcomes: How do you think this is this an effective treatment of cancer?

Gene Expression. Transcription and TranslationIn the space provided, write the letter of the description that best matches the term or phrase.1. ribonucleic acid (RNA)2. uracil3. transcription4. translation5. gene expressionComplete each statement by identifying the correct term or phrase in the brackets.6. Transcription begins when [RNA / RNA polymerase] binds to the gene’s promoter.7. RNA polymerase adds complementary [DNA / RNA] nucleotides as it “reads” the gene.8. In eukaryotes, transcription takes place in the [nucleus / cytoplasm].Read each question, and write your answer in the space provided.9.What are two differences between transcription and DNA replication?10.What determines where on the DNA molecule transcription begins and where it ends?Compare the two terms in a sentence.11. RNA, messenger RNA12. codons, genetic codeStudy the following six steps in the synthesis of proteins. Determine the order in which the steps

take place. Write the number of each step in order.13. The codon following the start codon then receives the tRNA molecule with the complementary

anticodon. The tRNA carries the amino acid specified by the codon.14. Steps 2–5 are repeated until a stop codon is reached. The newly made protein is released into the

cell.15. The first tRNA detaches, leaves behind its amino acid, and moves away from the ribosome.16. Enzymes help form a peptide bond between the amino acids of adjacent tRNA molecules.17. The tRNA (with its growing protein chain) and mRNA move one codon down, and the next codon is

ready to receive the next tRNA and its amino acid.18. An mRNA, the ribosome, and a tRNA carrying the amino acid methionine bind together. The tRNA

bonds to the “start” codon AUG.

a. the entire process by which genes are used to build proteins/traits.b. a molecule made of linked nucleotidesc. the process of reading instructions on an RNA molecule to put together the amino acids that make up a proteind. the process of transferring a gene’s instructions for making a protein to an RNA moleculee. a nitrogenous base used in RNA instead of the base thymine found in DNA

Transcription/ Translation In-class Exercise

• Transcribe the gene!• As you’ve learned, DNA contains the instructions for making proteins in

the form of genes. mRNA is made by RNA polymerase as the compliment to the gene region in the process of transcription. Your exercise today is to transcribe a gene from the sequence below and answer the following questions. Pay attention to the start and stop signals!

Gene Xlr23: CGAACCTACAGTTCCGCGTCGGGCTAGACTGGCAATG1. What is the first step in transcription?2. How does the RNA polymerase know where to start?3. Identify the “start” sequence within the sequence (underline it).4. What is the second step of transcription?5. What RNA nucleotide complements adenine?6. What is the third step of transcription?7. How does RNA polymerase know where to end?8. Identify the “stop” sequence (underline it).9. What is the sequence of the mRNA for the gene Xlr23?

TRX/TRL: CW/HW: Using the Genetic Code HWGenetic Code of Keratin

Keratin is one of the proteins in hair. The gene for keratin is transcribed and translated by certain skin cells just underneath the growing hair. The sequence below is part of the mRNA molecule that is transcribed from the gene for keratin.

Analysis

1. Determine the sequence of amino acids that will result from the translation of the segment of mRNA above. Use the genetic code in Figure 13.

_____________________________________________________________________________

_____________________________________________________________________________

2. Determine the anticodon of each tRNA molecule that will bind to this mRNA segment.

______________________________________________________________________________________________________________________________________________________________

3. Critical Thinking Recognizing Patterns: Determine the sequence of nucleotides in the segment of template DNA from which this mRNA strand was transcribed.

______________________________________________________________________________________________________________________________________________________________

4. Critical Thinking Recognizing Patterns: Determine the sequence of nucleotides in the segment of DNA that is complementary to the DNA segment that is described in item 3.

______________________________________________________________________________________________________________________________________________________________

TRX/TRL: CW/HW: Using the Genetic Code HWGenetic Code of Keratin

Keratin is one of the proteins in hair. The gene for keratin is transcribed and translated by certain skin cells just underneath the growing hair. The sequence below is part of the mRNA molecule that is transcribed from the gene for keratin.

Analysis

1. Determine the sequence of amino acids that will result from the translation of the segment of mRNA above. Use the genetic code in Figure 13.

_____Methionine – Serine – Arginine – Glutamic Acid – Phenylalanine – Serine - __________

2. Determine the anticodon of each tRNA molecule that will bind to this mRNA segment.

_____UAC – AGA – GCA – CUU – AAA – AGG ______________________________________________________________________

3. Critical Thinking Recognizing Patterns: Determine the sequence of nucleotides in the segment of template DNA from which this mRNA strand was transcribed.

____TAC – AGA – GCA – CTT – AAA – AGG ______________________________________________________________________________

4. Critical Thinking Recognizing Patterns: Determine the sequence of nucleotides in the segment of DNA that is complementary to the DNA segment that is described in item 3.

____ATG – TCT – CGT – GAA – TTT – TCC ______________________________________________________________________________

In Class Exercise• Complete the Gene.• Translation is the last step of gene expression

as it forms the final polypeptide. Your exercise today is to take the Xlr23 gene we transcribed in the transcription exercise and translate it into a polypeptide. Write your polypeptide as a series of circles with the name of the corresponding amino acid within. The circles represent the individual amino acids.

A = B = C =

You translate the rest

MutationsExplain how the terms in each pair differ in meaning.

1. mutation, mutagen

2. point mutation, silent mutation

3. reading frame, frameshift mutationComplete each statement by underlining the correct term in the brackets.

4. If a mutation causes a sequence of nucleotides to change from ACGAGA to ACGAGGA, the mutation is called a(n) [insertion / deletion] mutation.

5. Mutations that change one or just a few nucleotides in a gene on a chromosome are called [random / point] mutations.

6. If a point mutation is such that it causes a codon to specify a different amino acid, the mutation is called a [missense / silent] mutation.

7. If a mutation causes a sequence of nucleotides to change from ACGAGA to ACGGA, the mutation is called a(n) [insertion / deletion] mutation.

8. A chromosomal mutation that leads to repetitive alleles is called a(n) [inversion / duplication].Complete each statement by writing the correct term in the space provided.

9. Mutations can only be passed on to offspring if they occur in cells called ______________ cells.

10. Mutations that cause a cell to divide uncontrollably can lead to growth of a _______________.

11. When chromosome pairs fail to separate properly during meiosis, the error is called _________.

12. The condition of having two or more sets of chromosomes is called __________________.From the list on the far right, determine the word that would best fit into the blank that would determine the cause or affect for the situation.

Cause13. _________________14. nonsense mutation15. _________________16. tumor17. changes in chromosome structure

Effectdysfunctional protein___________________Down syndrome________________________________________

Lista. cancerb. trisomy 21c. frameshift mutationd. stope. mutations