Section J Analysis of cloned DNA Molecular Biology Course.
-
Upload
aspen-baldwin -
Category
Documents
-
view
224 -
download
0
Transcript of Section J Analysis of cloned DNA Molecular Biology Course.
Section JAnalysis of cloned DNA
Molecular Biology Course
J1 Characterization of clones
J2 Nucleic acid sequencingJ3 Polymerase chain reaction
J4 Organization of cloned genes
J5 Mutagenesis of cloned genes
J6 Application of cloning
Molecular Biology Course
1.Restriction mapping
2.Sequencing (DNA & RNA)
3.Northern and Southern blotting
4.PCR
Major Techniques used
These Techniques may be used for other purpose as well
Analysis of cloned DNA- overview
J1 Characterization of clonesJ1-1 Characterization
J1-2 Restriction mapping
J2-3 Partial digestion
J2-4 Labeling nucleic acid
J2-5 Southern and Northern blotting
Analysis of cloned DNA
J1-1 CharacterizationDetermining various properties of a recombinant DNA molecule, such as size, restriction map, nucleotide sequence, whether containing a gene (transcribed sequence), the position and polarity of any gene. Preparation of pure DNA is the first
step of any characterization
J1 Characterization of clones
Size of DNA fragment cloned
Restriction digestion & agarose gel electrophoresis using molecular weight marker
insert 0.8 kb
0.5 kb
1.0 kb
1.6 kb2.0 kb3.0 kb4.0 kb3.5 kb
J1 Characterization of clones
J1-2 Restriction Mapping
Cleavage pattern of the insert DNA by restriction enzymes. Useful in determining the order of multiple fragments (genes).
1. Combinational enzyme digestion
2. Partial digestion
J1 Characterization of clones
1. Combinational enzyme digestion
Nonessential regionLong (left)
armshort (right)
arm phage
Sal I: 19 kb, 15 kb, 9 kb
HindIII: 21 kb, 11 kb, 7 kb, 4 kb
SalI + HindIII: 19 kb, 7 kb, 6 kb, 5 kb, 4 kb, 2 kb
S – H – H – S – H – S 19 kb + 2 kb
2 kb + 7 kb + 6 kb + 5 kb + 4 kb 19 kb 9 kb15 kb
J1 Characterization of clones
Nonessential regionLong (left)
armshort (right)
arm
S S19 kb 9 kb15 kb
21 kbH
4 kb11 kb7 kbH H
Delineate the restriction sites on the DNA
J1 Characterization of clones
2. Partial digestion10 kb insert
Completedigestion
Partialdigestion
1 kb
2 kb
3 kb
4 kb6 kb7 kb10 kb
X X
EtBr Stained agarose gel:
Can not delineate the EcoRI sites
J1 Characterization of clones
10 kb insert****End-labeled radioactive DNA
partial digestion
Agarose electrophoresis
autoradiography
3 kb
4 kb6 kb10 kb
3 kb4 kb
6 kb
Delineate the restriction sites by partial digested end-labeled radioactive DNA
E E E
J1-4 Labeling of DNA or RNA probes
End labeling: put the labels at the endsUniform labeling: put the labels internally
radioactive labeling: display and/or magnify the signals by radioactivity
Non-radioactive labeling: display and/or magnify the signals by antigen labeling – antibody binding – enzyme binding - substrate application (signal release
J1 Characterization of clones
End labeling
Single stranded DNA/RNA
5’-end labeling: dephosphorylation polynucleotide kinase (PNK)
3’-end labeling: terminal transferase
J1 Characterization of clones
J1 Characterization of clones
End labelingDouble stranded DNA/RNA
Fill in the recessive 3’-ends by DNA polymerase
Labeled at both ends
---------------------G---------------------CTTAAp5’
For restriction mapping, cut the DNA with another enzyme
5’pAATTC G
J1 Characterization of clones
Uniformly labeling of DNA/RNANick translation:
DNase I to introduce random nicks DNA polI to remove dNMPs from 3’ to 5’ and add new dNMP including labeled nucleotide at the 3’ ends.
Hexanucleotide primered labeling: Denature DNA add random hexanucl
eotide primers and DNA pol synthesis of new strand incorporating labeled nucleotide .
J1 Characterization of clones
Strand-specific DNA probes: e.g.M13 DNA as templatethe missing strand can be re-
synthesized by incorporating radioactive nulceotides
Strand-specific RNA probes: labeled by transcription
J1 Characterization of clones
J1-5 Southern and Northern blotting
DNA on blot RNA on blot
1.Genomic DNA preparation RNA preparation2.Restriction digestion -3.Denature with alkali - 4. Agarose gel electrophoresis 5. DNA blotting/transfer and fixation RNA6. Probe labeling 6. Hybridization (temperature) 7. Signal detection (X-ray film or antibody)
J1 Characterization of clones
Southern analysis
J1 Characterization of clones
Steps of Southern blot
J1 Characterization of clones
bI1 bI2 bI3 bI4 bI5
Northern analysis COB RNAs in S. cerevisiae
mRNA
Pre-mRNAs
Blot type
Target
Probe Applications
Southern DNA DNA or RNA
mapping genomic clones
estimating gene numbers
Northern RNA DNA or RNA
RNA sizes, abundance,and expression
Western Protein Antibodies protein size, abundance
J1 Characterization of clones
J2 Nucleic acid sequencing
J2-1 DNA sequencingJ2-2 RNA sequencingJ2-3 Sequence databasesJ2-4 Analysis of sequencesJ2-5 Genome sequencing
projects
Analysis and uses of cloned DNA
J2-1 DNA sequencingTwo main methods:Maxam and Gilbert chemical method the end-labeled DNA is subjected to base-s
pecific cleavage reactions prior to gel separation.
Sanger`s enzymic method () the latter uses dideoxynucleotides as chain te
rminators to produce a ladder of molecules generated by polymerase extension of primer.
J2 nucleic acid sequencing
Maxam and Gilbert
Sanger’s enzymic methodJ2 nucleic acid sequencing
G ATCTC G
ATCTC GGCH3
TCTCG A
TCTCG A
DNA labeled at one end with 32P
DNA labeled at one end with 32P
Base modificationBase modification
Release or displace-ment of reacted basesRelease or displace-
ment of reacted bases
Strand scissionStrand scission
Maxam and Gilbert chemical method
J2 nucleic acid sequencing
32pGpCpTpGpCpTpApGpGpTpGpCpCpGpApGpC
32p32pGpCpTp
32pGpCpTpGpCpTpAp
32pGpCpTpGpCpTpApGp
32pGpCpTpGpCpTpApGpGpTp
32pGpCpTpGpCpTpApGpGpTpGpCpCp
32pGpCpTpGpCpTpApGpGpTpGpCpCpGpAp
32pGpCpTpGpCpTpApGpGpTpGpCpCpGpApGpC
Chain cleavage at guanines
Chain cleavage at guanines
Maxam-Gilbert sequencing.
We methylate guanines with
a mild DMS treatment that methylates on average one
guanine per DNA strand.Then
use piperidine to remove the
methylated base and break the DNA strand at the apurinic
site.
J2 nucleic acid sequencing
Sanger sequencing This figure shows t
he structure of a dideoxynucleotide (notice the H atom attached to the 3' carbon). Also depicted in this figure are the ingredients for a Sanger reaction. Notice the different lengths of labeled strands produced in this r
eaction.
J2 nucleic acid sequencing
This figure is a representation of an acrylamide sequencing gel. Notice that the sequence of the strand of DNA complementary to the sequenced strand is 5' to 3' ACGCCCGAGTAGCCCAGATT while the sequence of the sequenced strand, 5' to 3', is AATCTGGGCTACTCGGGCGT.
J2 nucleic acid sequencing
Automatic sequencer
1. Fluorescence Labeled ddNTP
2. Polymerase catalyzed
J2 nucleic acid sequencing
J2 nucleic acid sequencing
RNA sequencingIt is sometimes necessary to sequence R
NA directly, especially to determine the position of modified nucleotides present in, eg, tRNA and rRNA.
This is achieved by base-specific cleavage of 5’-end-labeled RNA using RNases (ribonuclease) that cleave 3’ to a particular nucleotide. Partial digestion is required to generate a ladder of cleavage products which are analyzed by PAGE.
J2 nucleic acid sequencing
RNase T1: cleaves after GRNase U2: after ARNase Phy M: after A and UBacillus cereus RNase: after U and C
J2 nucleic acid sequencing
0 2 10 20 50 G
43
64
25
43
95
121/122
157
222
308
P 2
P 2.1
J3/4P4
P5
P 6
111
P3’P7
P8
P 9
T1 cleaved
J2-3 Sequence databases
• Two largest DNA databases of are EMBL in Europe and Genbank in the USA.
• Newly determined DNA,RNA and protein sequence are entered into databases.The collections of all known sequences are available for analysis by computer.
J2 nucleic acid sequencing
Sequence database J2 nucleic acid sequencing genebank
Sequence database
EMBLEMBL
J2 nucleic acid sequencing
J2-4 Analysis of sequences
• Using computers and software packages, such as GCG sequence analysis package offered by Univ. of Wisconsin
1. Identify important sequence features such as restriction sites,open reading frames,start and stop codons, as well as potential promoter sites, intron-exon junctions,etc.
J2 nucleic acid sequencing
100 200 300 400 500 600 700ORF #1
ORF #2
Sequence analysis of a cloned DNA sequence revealed some important features
J2 nucleic acid sequencing
2. compare new sequence with all other known sequences in the databases, which can determine whether related sequences have been obtained before.
J2 nucleic acid sequencing
J2-5 Genome sequencing projects
• With the development of automated DNA sequencers and robotic workstations to prepare samples for sequencing,the entire genome sequence of several organisms have been determined.Many phages and virusesSeveral Bacteria (E. coli, 4 x 106)Plant (Arabidopsis 6.4 x 107 , rice)Human 3 x 109
J2 nucleic acid sequencing
J3 Polymerase chain reaction
J3-1 PCRJ3-2 The PCR cycle J3-3 TemplateJ3-4 PrimersJ3-5 EnzymesJ3-6 PCR optimization
Analysis and uses of cloned DNA
J3-1 PCR
The polymerase chain reaction(PCR) is to used to amplify a sequence of DNA using a pair of primers each complementary to one end of the the DNA target sequence.
J3 Polymerase chain reaction
J3-2 The PCR cycle
• Denaturation: The target DNA (template) is separated into two stands by heating to 95℃
• Primer annealing: The temperature is reduced to around 55℃ to allow the primers to anneal.
• Polymerization (elongation, extension): The temperature is increased to 72℃ for optimal polymerization step which uses up dNTPs and required Mg++.
J3 Polymerase chain reaction
J3 Polymerase chain reaction
Template
Primers
Enzymes
Fig. Steps of PCR
J2 nucleic acid sequencing
J3-3 Template
•Any source of DNA that provides one or more target molecules can in principle be used as a template for PCR
•Whatever the source of template DNA, PCR can only be applied if some sequence information is known so that primers can be designed.
J3 Polymerase chain reaction
J3-4 Primers
• PCR primers need to be about 18 to 30 nt long and have similar G+C contents so that they anneal to their complementary sequences at similar temperatures.They are designed to anneal on opposite strands of the target sequence.
• Tm=2(a+t)+4(g+c): determine annealing temperature. If the primer is 18-30 nt, annealing temperature can be Tm5oC
J3 Polymerase chain reaction
Degenerate primers: an oligo pool derived from protein sequence.E.g. His-Phe-Pro-Phe-Met-Lys can generate a primer 5’-CAY TTY CCN TTY ATG AARY= PyrimidineN= any baseR= purine
J3 Polymerase chain reaction
J3-5&6 Enzymes and PCR Optimization
• The most common is Taq polymerase.It has no 3’ to 5’ proofreading exonuclease activity. Accuracy is low, not good for cloning.
• We can change the annealing temperature and the Mg++ concentration or carry out nested PCR to optimize PCR.
J3 Polymerase chain reaction
PCR optimization
I.Reverse transcriptase-PCR
II.Nested PCR
J2 nucleic acid sequencing
Fig Nested PCRFig Nested PCR
First roundprimers
First roundPCR
Second roundprimers
Second roundPCR
Gene of interest
J2 nucleic acid sequencing
Reverse transcriptase-PCR
AAA(A)n
5‘-Cap5‘-CapmRNA
(dT)12~18 primer anneal
5‘-Cap5‘-Cap
AAA(A)n
3‘ 5‘
Reverse transcriptase
dNTP
5‘-Cap5‘-Cap
AAA(A)n
5‘
cDNA:mRNA hybridRegular
PCR
Fig RT-PCR
J2 nucleic acid sequencing
J4 Organiztaion of cloned genesJ4-1 OrganizationJ4-2Mapping cDNA on Genomic DNA (whe
re)J4-3 S1 nuclease mapping (5’ and 3’ en
d)J4-4 Primer extension (5’ end)J4-5 Gel retardation (binding protein)J4-6 DNase I footprinting (protein binding
sites) J4-7 Reporter genes (promoter study)
Analysis and uses of cloned DNA
cDNA clones have defined organization.
A run of A residues defines the clone’s 3’-end.
There will be a stop codon at its upstream. If the clone is complete, there also will be a start condon. These two codon indicates an ORF.
J4-1 OrganiztionJ4 Organization of cloned genes
• The presence and polarity of any gene in a genomic clone is not obvious (5’ and 3’ end)
• It can be determined by mapping and probing experiments
• To determine:• which genomic sequences are present in
the mature mRNA transcript• The absent sequences are usually
introns and sequences upstream of the transcription start site and down stream of the 3’-processing site.
•Start and stop sites for transcription•regulatory sequences.
J4 Organization of cloned genes
J4-2 Mapping cDNA on genomic DNA• The genomic clone is digested on a gel and then
subjected to Southern blot using all or part of the cDNA as a probe.
• Using full length cDNA as probe can show which genomic restriction fragments contain sequences also present in the cDNA
• Using a probe from one end of a cDNA can show the polarity of the gene in the genomic clone.
• Some of the restriction sites will be common in both clones but may be different distances apart. These can often help to determine the organization of the genomic clone.
J4 Organization of cloned genes
J4-3 S1 nuclease mapping determines the precise 5’- and 3’- ends of RNA
transcripts. Sequence ladder is required to determine the precise position
S1 nuclease is an enzyme which specifically hydrolyses single-stranded RNA or DNA.
RNA 5’DNA 3’ *5’
3’
RNA 5’DNA 3’ 5’
3’
PAGE Analysis
Add S1 nuclease
J4 Organization of cloned genes
J4-4 Primer extension• Determine the 5’ ends of RNA molecules using
reverse transcriptase to extend an antisense DNA primer in the 5’ to 3’ direction. Sequence ladder is required to determine the precise position
J4 Organization of cloned genes
J4-5 Gel retardation
• Mixing a protein extract with a labeled DNA fragment and running the mixture on a native gel will show the presence of DNA-protein complex as retarded bands on the gel.
Labeled free DNA/RNA
Protein bound with DNA/RNA
J4 Organization of cloned genes
DNA bound totwo proteins
DNA-proteincomplex
Bare DNA
Fig Gel retardation A short labeled nucleic acid is mixed with a cell or nuclear extract expected to contain
the binding protein. Then, samples of labeled nucleic acid, with and without
extract, are run on a gel. The DNA-protein complexes are shown by the presence of
slowly migrating bands.
J4 Organization of cloned genes
J4-6 Dnase I footprinting
Identify the actual region of sequence with which the protein interacts.
AATAAG5’ *
Sequence ladder is required to determine the precise position
J4 Organization of cloned genes
Bind protein
DNase(mild),then removeprotein and denature DNA
Fig DNase footprinting The protein protects
DNA from attack by DNase. We treat the DNA
-protein complex with DNase I under mild conditions, so that an average of only one cut occur per DNA molecule.
Electrophoresis,autoradiograph
J4 Organization of cloned genes
0 1 5ProteinConc:
The three lanes represent DNA that was bound to 0,
1, and 5 units of protein.
The lane with no protein shows a regular ladder of fragments. The lane with
one unit shows some protection, and the lane
with 5 units shows complete
protection in the middle. We usually include
sequencing reactions performed on the same
DNA in parallel lanes, which
tells exactly where the protein bound.
TCGGAGCAACGCAAACAAACGTGCTTGG
J4 Organization of cloned genes
J4-7 Reporter genes
To study the function of a control element of a gene (promoter and regulatory elements), reporter genes such as b-galactosidase to “report” the promoter action.
J4 Organization of cloned genes
J5 Mutagenesis of cloned genes
J5-1 Deletion mutagenesisJ5-2 Site-directed mutagenesis J5-3 PCR mutagenesis
Analysis and uses of cloned DNA
J5-1 Deletion mutagenesis
In the cDNA clones,it is common to delete progressively from the ends of the coding region to discover with parts of the whole protein have properties.
In genomic clones,when the transcription part has been identified,upstream are removed progressively to discover the minimum length of upstream sequence that has promoter and regulatory function .
J5 Mutagenesis of cloned genes
Exonuclease III
S1 or mung bean nuclease
Ligation
J5 Mutagenesis of cloned genes
J5-2 Site-directed mutagenesis
Formerly,single-stranded templates prepared using M13 were used,but now PCR techniques are now preferred.
J5 Mutagenesis of cloned genes
J5-3 PCR mutagenesis
Deletion or point mutation
J5 Mutagenesis of cloned genes
SP6 primer
T7 primer
Forward mutagenic primer
Reverse mutagenic primer
First PCR
Remove primersDenature and anneal
PCR mutagenesis
Two separate PCR reactions are
performed, one amplifying the
5’-portion of the insert using SP6 and the reverse primer, and the other amplifying
the 3’-portion of the insert
using the forward and T7 primers.
J5 Mutagenesis of cloned genes
Extend and dosecond PCR
SP6 primer
T7 primer
PCR mutagenesis
Two separate PCR reactions are
performed, one amplifying the
5’-portion of the insert using SP6 and the reverse primer, and the other amplifying
the 3’-portion of the insert
using the forward and T7 primers.
Subclone
J5 Mutagenesis of cloned genes
J5 Mutagenesis of cloned genes
PCR
elongation
PCR
P(deltaP
5abc) construction
E1-P5P5’-E2
exon intron P5abc
J5 Mutagenesis of cloned genes
J6 Applications of cloning
J6-1 ApplicationsJ6-2 Recombinant proteinJ6-3Genetically modified
organismsJ6-4 DNA fingerprintingJ6-5 Medical diagnosisJ6-5 Gene therapy
Analysis of cloned DNA
J6-1 Applications
J6 Applications of cloning
DNAfingerprinting
DNAfingerprinting
GeneticallyModified
Organisms
GeneticallyModified
Organisms
Recombinantprotein
Recombinantprotein
Genetherapy
Genetherapy
MedicaldiagnosisMedical
diagnosis
CLONING
J6-2 Recombinant protein
·Prior to the advent of gene cloning, production of protein was to purify them from tissues. Drawbacks: small amounts, viral contamination etc. ·Gene cloning has circumvented the listed problems.
J6 Applications of cloning
J6 Applications of cloning
Prokaryotic expression system can be used to produce eukaryotic proteins, but there are some
problems:• Only cDNA clones can be used as they contain no introns
• Insoluble, precipitated
• Lack of eukaryotic post- translational modifications
J6 Applications of cloning
Fusion protein
These problems can be solved by using the eukaryotic expression systems, such as the yeast, Baculovirus
and humn cell lines.
These problems can be solved by using the eukaryotic expression systems, such as the yeast, Baculovirus
and humn cell lines.
J6 Applications of cloning
J6-3 Genetically modified organisms
• Genetically modified organisms(GMOs) are created when cloned genes are introduced into germ cells.
• In eukaryotes, if the introduced genes are derived from another organism, the resulting transgenic plants or animals can be propagated by normal breeding.
e.g. A tomato has a gene for a ripening enzyme inactivated
J6 Applications of cloning
J6 Applications of cloning
J6-4 DNA fingerprinting
How is DNA fingerprinting done?
I. Performing Southern blotII. Making a radioactive probeIII.Creating a hybridization reactionIV. VNTRs
J6 Applications of cloning A given person's VNTRs come fro
m the genetic information donated by his or her parents; he or she could have VNTRs inherited from his or her mother or father, or a combination, but never a VNTR either of his or her parents do not have. Shown in the left are the VNTR patterns for Mrs. Nguyen [blue], Mr. Nguyen [yellow], and their four children: D1 (the Nguyens' biological daughter), D2 (Mr. Nguyen's step-daughter, child of Mrs. Nguyen and her former husband [red]), S1 (the Nguyens' biological son), and S2 (the Nguyens' adopted son, not biologically related [his parents are light and
dark green]).
The application of DNA fingerprinting:
I. Paternity and maternity
II.Criminal identification and forensics
III.Personal identification
J6 Applications of cloning
J6-5 Medical diagnosis
A great variety of medical conditions arise from mutation. e.g. muscular dystophy, many cancers. By using sequence information to design PCR primers and probes, many tests have been developed to screen patients for these clinically important mutations.
J6 Applications of cloning
J6 Applications of cloning
Classical methods for scanning mutations:Classical methods for scanning mutations:
Complete gene sequencing
Single-strand conformation analysis
Heteroduplex analysis
Chemical cleavage of mismatch and enzymatic cleavage of mismatch
Protein-truncation test
J6-6 Gene therapy Attempts have
been made to treat some genetic disorders by delivering a normal copy of the defective gene to patients. This is known as gene therapy.
J6 Applications of cloning
Fundamentals of Gene
Therapy
Cell replacement
Retroviralvector
J6 Applications of cloning
Thanks