Indian Journal of Experimental Biology Vol. 39, February 2001, pp. 148-154

Screening of Bacillus thuringiensis serotypes by polymerase chain reaction (PCR) for insecticidal crystal genes toxic against coffee berry borer

M.Madhava Naidu**, Cice ~ Rang*, Roger Frutos*, C.S.Sreenivasan & R.Naidu

Central Coffee Research Institute, r:offee Research Station, Chikmagalore 577 117, India *IGEPAM, CIRAD, Avenue du Val de Montferrand. Cedex I. Montpellier. France.

**Plantation products, Spices and Flavour Technology Department, Central Food Technological Research Institute, Mysore 570013, India

Received 5 February 1999: revised 29 September 2000

Using PCR,257 isolates of Bacillus thuringiensis(Bt) were screened for cry-type genes. Of 257 isolates/strains, 60 isolates were identified as cry7/8, 10 isolates as cry3 and 36 isolates as cry II. One specific strain of B.thuringiensis (sumiyoshiensis;T03B 00 I) was investigated for the presence of cry7 and cry8 genes. Genes Cry7 and cry8 were first detected in thi s strain using family primers prior to analysis by exclusion polymerase chain reaction (E-PCR) using specific type primers. E-PCR conducted with the above said primers led to the identification by agarose gel electrophoresis of a remaining 1.5 Kb family band indicating a potentially novel gene. This PCR product, ( 1.5 Kb). was purified from the gel and cloned in pGEM-T Easy vector. Twenty recombinant colonies bearing 1.5 Kb insert were identified and three randomly selected representatives of the group, clones 7,8 and 10, were sequenced and compared to all e~y7 and cry8 sequences available from Gene Bank. Alignments with available DNA and protein sequences showed that all these clones contained a gene related to cry8Aa I. Analysis usi ng protein sequence alignment showed that the sequence from clone 7 differed from the closest relative. known under the new nomenclature as cry 8Aal, by 44%. The crystal proteins from B.thuringiensis sumi yoshiensis (T03B 001) was toxic to coffee berry borer larvae. ·

Detection and identification of insecticidal toxin genes may be achieved by molecular techniques. Measurement of insecticidal activity of Bacillus. thuringiensis(Bt) may be linked to the production (during the course of its sporulation) of inclusion bodies known as crystals which account for up to 30% of the total protein content of the bacterium 1-3. These crystals contain insecticidal proteins which may vary depending on the bacterial strain both in number and type3. Each family of Bt toxin is host specific and is environment friendly pesticides. The objective of these studies is to screen for toxin genes which are active against coleopteran pests. Arabica coffee in India is most affected by coffee berry borer (Hypothenimus /zampei),Coleptera and is essential to screen an effective insecticidal toxin gene to control this pest. In the present study an attempt has been made to identify the insecticidal toxin gene sequence which would possibly be active against berry borer, shoot hole borer and white stem borer. These strains/isolates were also tested in vivo for actual toxicity against coffee pests.

Material and Methods Bacterial strains and primer design- B.

thuringie11.sis strain HD 133 and B.tlzuringiensis subsp tenebrionis were used as standard strains for the

presence of cryll and cry3A genes respectively. Other B. tlzuringiensis strains were obtained from the institute Pasteur, Paris, France and International Center for Agricultural Research and Development (CIRAD) Montpellier, France. Nucleotide sequences of cry genes available from Gene Bank, CIRAD, Montpellier, France were aligned using Megalign program of DNA Star software package. Genes cry 3, cry 5, cry 7 and cry 8 family ( + and -) were matched to any mid of the known family genes. Using a simila1 computer analysis, primers specific to a given type 0 1

cry gene, were designed to match the hyper-variab)( region of all cry 7 genes (cry? Aa1 ,cry? Aa2, cry? Ab J and cry? Ab2) as well as primers specific to cry8Aa 1 cry8Ba1 and cry8Cal (T1). Standard recombinan DNA techniques were performed as describe• earlier4 . PCR fragments were cloned into a pGEM-' Easy vector (Promega). DNA sequencing wa performed using the chain termination techniqu using an Applied Biosystem 370A nucleotid sequence analyzer. DNA and protein sequenc alignments and distance calculations were dor through cluster method using Megalign Softwa1 from DNA Star package.

Isolation of DNA- Purified DNA was obtaim from B. thuringiensis by the method as mentiom

NAIDU et al.: SCREENING OF BACILLUS THURINGIENSIS SEROTYPES BY POLYMERASE CHAIN REACTION . I49

earlier5. The pellet was washed three times with 5 mL of 70% cold ethanol (centrifuged at 3000g for IS min. at each time) and air dried. The pellet was resuspended in sterile distilled water and the concentration was estimated by measuring absorbency at 260 and 280 nm.

PCR amplification and cloning of PCR product-Identification of selected cry genes was conducted for Bacillus tlzuringiensis DNA (SOOng) with 2.5 units (0.5 )lL) of Taq DNA polymerase(Eurobio), 5 )lL of 10 X buffer, 200 nM (0.5)lL) each of dATP, dTTP, dGTP and dCTP, 20 pmoles of sense ( +) and reverse primers (-) and 3 rnM (3 )lL) of MgC12 in a final volume of 50 )lL. Amplification was done in Perkin-Elmer Cetus thermal cycler. After initial de-naturation at 94°C for 5 min, 25 cycles of amplification were performed under the conditions as (denaturation: 2 min at 94°C; annealing: 45 sec at sooc and extension: 2 min at noc. An extra extension step of 10 min at 72°C was given after completion of 25 cycles). PCR reaction mixture was analysed by I% agarose gel electrophoresis in tris- borate-EDT A (TBE) buffer. The vector(p-GEM) was a blunt ended, linearised vector to which to match, a 3' terminal thymidine was added at both ends. These protruding T residues greatly improved the efficiency of ligation of a Tag-generated PCR fragment into the plasmid. To improve cloning efficiency, two insert/vector molar ratios (3: I and 6: I) were used. The concentration of PCR product was estimated by comparing to DNA mass standards on a gel. The amount of PCR product to be added to the vector was calculated.

Plasmid DNA extraction was done following the alkaline lysis method2• The quality of the plasmid DNA was checked by agarose (I%) gel electrophoresis.

Preparation of crystal proteins- Bacteria was grown in SCG (sodium, citrate, glucose) agar medium at 30°C for 50-60 hr. Spore-crystal and cell crystal suspensions were analyzed by SDS PAGE. The quantity of crystal proteins was estimated3. Crude proteins were incorporated into diet for insect bioassays.

Bioassays- An artificial diet6 for rearing of coffee berry borer (Hypothenemus hampei Ferrari) was used for the present studies. Different concentrations (0, 250, 500, 750 and 1000 )lg/L) of the crystal proteins were incorporated into diet and fresh IIIrd instar larvae was allowed for rearing. The larvae were obtained from freshly collected coffee fruit. Experiments were set up in randomized block design

(RBD) with two replicates. The mortality was recorded after 72hr. Data was analyzed using Probit Regression Equation Y = 1.4143= 1.31 03X and LD50 was calculated.

Results and Discussion This method, novel PCR technique? allows for a

quick and easy characterization of any family of insecticidal crystal protein genes or cry genes. PCR approach was applied for detection of cry genes encoding toxins active against coleopteran insects, within a collection of 200 strains of Bacillus thuringiensis isolates. Four sets of PCR primers which amplify DNA fragments from cry3,cry1I, cry? and cry8 families of genes were selected from conserved regions. Once a strain is identified as an organism that contains a particular type of gene, it could be easily characterized by performing additional PCR with specific primers selected for more specific variable regions.

Strains known to contain genes belonging to targeted families were used as positive control during PCR experiments. B. thuringiensis sub species morrisoni DSM 2803 also named B. thuringiensis tenebrionis carries cry 3Aai gene whereas cry 1I gene is present in the strain HD 133. Strain containing either cry? or cry8 gene was not available. Several families of proteins active against coleopteran insects have been described (Table I). According to previous nomenclature, they correspond to the proteins from cry III family which are active against both lepidopteran and coleopteran insects. As per the recent nomenclature8 in which toxins were classified based on sequence homology, proteins active against coleopteran insects are divided into four families ie. cry3, cryll , cry? and cry8. The genes formally named cry V are now known as cry llgenes.

Two hundred and fifty seven from the strains and isolates from the Institute Pasteur and CIRAD were tested using E-PCR approach for the presence of cry 3, cryli, cry? and cry8 genes. Out of 68 strains from Pasteur Institute, 28 strains contained at least one of the targeted sequences. Only one strain (T4500 1, H serotype roskildienensis) responded positively with cry3 primers (Fig. 1), whereas 9 strains showed a positive response with cryli primers (Fig.2) and 25 strains responded with cry? and cry8 groups of genes (Fig.3). Out of 189 isolates from CIRAD collection, 72 isolates responded positively to at least one set of primers. Nine isolates contained a sequence related to cry3 gene, 27 isol ates responded

150

:E ~

~

INDIAN J EXP BIOL, FEBRUARY 2001

Table I-Classification of cry genes coding for B.thuringiensis endotoxins active against coleoptera

Gene Old name Protein Toxicity Bibliographic size reference

Cly3Aal cry lilA 75kDa Coleoptera Herrnstadt et a/. 11

Cry3Aa2 Sekar et al. 12

Cry3Aa3 Hofte et at. 13

Cry3Aa4 McPherson et al. 14

Cry3Aa5 Donovan et a/. 15

Cry3Aa6 Adams et at. 16

Cry3Bal crylllB Sick et a/. 17

Cry3Bbl Donovan eta/. 18

Cryllal cryV 80-85kDa Lepidoptera & Tailor et at. 19

Coleoptera Crylla2 Gleave et a/.4

Crylla3 Chin et a/.,20

Crylla4 Kostichka et a/. 21

Crylla5 Selvapandiyan et a/. 22

Cryllbl Chin et a/.20

Cry7Aal o y lllC 130-135kDa Coleoptera Hofte et a/.9

C!y7Abl Narva & Fu24

Cry7Ab2

Cry8Aal cryiiiE 130-135kDa Coleoptera Narva & Fu24

Cry8Bal crylllG Cry8Cal crylllF Sato et a/.25

~. 0 0 :E 00 ...-. ,....... ,....... ,....... ,........ ........ ...-. ('.1 0 0 0 0 0 0 0 0 ~

NAIDU et al.: SCREENING OF BACILLUS THURINGIENSIS SEROTYPES BY POLYMERASE CHAIN REACTION 151

positively with primers directed against cryll family of genes and 36 isolates were detected by the primers specific to cry7/cry8 group. The crystal proteins were analyzed by SDS PAGE and 125-130 KD proteins was observed in the gel. Toxicity of crystal proteins from B.thuringiensis sumiyoshiensis (T03B 001) was found to be vary effective against coffee berry borer larvae. The bioassays revealed that the insect larvae became

inactivated after 12 hr of exposure to the diet and they died within 72 hr, whereas in controls all larvae increased their size. Percentage of mortality increased with the increasing concentration of crystal proteins. Maximum mortality (91%) was observed at 1000 J..lg/L of proteins. Data were analyzed using Probit Regression equation Y=1.4143+1.3103x. The calculated LD50 and LD90 values were 545.10 and 5183.00 respectively .

Table 2- Sequence and position of primers used to amplify cry sequences from Bt subspecies

Primer Family Position Size of Primer sequence recognized band

III(+) cry3 930 900bp AAACHGAAYTAACAAGAGAC III(-) 1742 ASTKAGWKGTWGAAGCATA

V(+) cryll(cryV) I 1200 bp ATGAAACTAAAGAATCCAGA V(-) 1145 AGGATCCTTGTGTTGAGATA

7/8(+) cry7/8 771 1500 bp YCRDTTYCGYAGAGARATGA 7 /8(-) 2371 YYTCTAAWYCYTGACTACTT

7/8( +) 804 150011600 bp YCRDTTYCGYAGAGARATGA 7 /8(-) 2449 YYTCTAAWYCYTGACTACTT

7A cry7A 1305 1067 bp GACGTATGATTCTATTGATC 8A Cly8Aa l 1459 991 bp TCTATATTACCTCCCATTC

88 cry8Bal 1125 1346 bp GCATATCGGTACGAGTAGTA 8C cry8Cal 1226 1215 bp ACAGAGTTGTTGTATGGACT

:::E ...--<

:::E - 0 ...--< 0 - - - 0 ('1", 8 0 0 0 0 0 0 0 0 0 ('1", ~ ~ u 0

152 INDIAN J EXP BIOL, FEBRUARY 2001

::?: 0 8 g ....... - - - ..... ...- ..... -- 8 ..... ::?: 0 0 ~§ 8 8 8

...... 0 0 ~ co <

NAIDU eta/.: SCREENING OF BACILLUS THURINGIENSIS SEROTYPES BY POLYMERASE CHAIN REACTION 153

25

.----------- Cry8Aa1 .--------1

L-------- Cry8Ba1 '-------------- Cry8Ca1

L-------------- Prot 03B-clone7

20 15 10 5 0

Cry7Aa1

Cry7Ab2

Cry7Ab1

Fig. 5- Phylogenetic tree of 03B clone7 with cry 8 and cry7 family.

B. thuringiensis insecticidal proteins are highly specific insect gut poisons and their mode of action is thought to involve a cascade of events leading to insect death within several hours following ingestion2·8-10. Proteins (cryl) which are active primarily against lepidopteran pests have been extensively studied B.thuringiensis insecticidal proteins with respect to their structure and mode of action 10.

The proteins which are found in the crystal are biologically inactive. Cleavage by gut protease produces a smaller 60-65kDa activated protein which recognize specific binding sites in the brush border membrane surface of the epithelial columnar cells lining the gut lumen9. The next steps are pore formation, membrane transport disruption and cell lysis leading ultimately to insect death9. In the present study one strain, B.thuringiensis sumiyoshiensis (T03B 001), was investigated for the presence of cry7 and cry8 genes undetected when specific type primers were used. The analysis of cry7 and cry8 gene contents of the strai n has been shown as an example (Fig. 4). Genes cry7 and cry8 were first detected in this strai n using family primers prior to analysis by E-PCR using the primers specific to cry7 A, cry8A, cry8B and cry8C (Table 2, Fig. 4). E-PCR conducted with the above mentioned primers led to the identification in agarose gel of a remaining 1.5 Kb family band indicating that a potentially novel gene was present (Fig. 4).

PCR product of 1.5 Kb was purified from the gel and cloned in pGEM-T Easy vector for further sequencing. The cloned PCR product was sequenced and compared with cry7 and cry8 sequences avai lable from Gene Bank. Alignments with both avai lable DNA and protein sequences showed that all these three clones contained a gene related to cry8Aa 1 (Fig.5). Further analysis, using protein sequence alignment showed that DNA deduced

protein sequence from all known members of cry8 protein group showed that the protein sequence from clone 7 differed from the closest relative, known under the new nomenclature as cry8Aa1 by 44%. Complete sequencing will be required to determine the exact divergence. The presence of these sequences will allow the identification of a selected strain potentially active against colepteran pest. These PCR screened strains were tested in vivo for actual toxicity against coffee berry borer. The concentration of 1 OOOJ..i.g/L crystal protein required to achieve 91 % mortality of coffee berry borer larvae within 72 hr was observed. Further work is in progress.

Acknowledgement The financial support from DBT, New Delhi to the

author (MMN) is gratefully acknowledged.

References I Agaisse H & Lereclus D, How does Bacillus thuringiensis

produce so much insecticidal crystal protein? 1 Bacterial. 177(1 995) 6027.

2 Aronson A I, The two faces of Bacillus thuringiensis: Insecticidal proteins and post-exponential survival Mol Microbial, 7( 1993)489.

3 Birnboim H C & Doly J, A rapid alkaline extraction procedure for screening recombinant plasmid DNA, Nucleic Acid Res, 7(1979)1513.

4 Gleave A P, Williams R & Hedges R.J, Screening by polymerase chain reaction of Bacillus thuringiensis serotypes for the presence of cryV like insecticidal protein genes and characterization of CIY V gene cloned from B.thuringiensis subsp. Kurstaki. Appl Environ Microbial, 59(1993) 1683.

5 Kronstad J W & Whiteley H R, Inverted repeat sequences flank a Bacill,ts tlwringiensis crystal protein gene, J.Bacteriol. 160 (1984) 95.

6 Brun L 0 , Gaudichan V & Wigley P J, An artific ial diet for continuous rearing of the coffee berry borer, Hypothenemus hampei (Ferrari) (Coleoptera:Scolytidae), Insect Sci Appl, 14(1993) 585.

7 Jaurez-Perez V M, Ferrandis M D & Frutos R, P{:::R-based approach for detection of novel Bacillus thuringiensis cry genes, Appl Environ Microbial, 63 (1977) 2997.

8 Crickmore N, Zeigler DR, Feitel son K, Schnepf E. Van Rie J, Lereclus D, Baum J & Dean D H, Revi sion of the nomenclature for the Bacillus thurinRiensis pesticidal crystal proteins, Microbial Mol Bio! Rev, 62 (1998) 807.

9 Hoftc H & Whiteley H R, Insecticidal crystal proteins of Bacillus thuringiensis. Microbial Rev, 53(1992)242.

I 0 Knowles B H Mechani sm of action of Bacillus thuringiensis insecticidal proteins, Adv Insect Physiol, 24 (1994)275.

II Herrnstadt C, Gi lory T E, Sobieski D D, Bennett B D & Gaertner F H, Nucleotide sequence and deduced amino ac id sequence of a coleopteran-active delta endotoxin gene from Bacillus thuringiensis subsp.Sandiego, Gene, 57( 1987) 37.

12 Sekar V, Thompson D V. Maroney M J, Bookland R G & Adang M J, Molecular c loning and characterization of the insecticidal crystal protein gene of Bacillus thuringiensis var tenebrionis, Proc Nat/ A cad Sci USA, 84( 1987) 7036.

154 INDIAN J EXP BIOL, FEBRUARY 2001

13 Hofte H, Seurinck J, Houtven A V & Vaeck M, Nucleotide sequence of a gene encoding an insecticidal prote in of Bacillus thuringiensis var. tenebrionis toxic against coleoptera, Nucleic Acids Res, 15 ( 1987) 71 83.

14 Mcpherson SA, Perlak F J , Fuchs R L Marrane P G, Lavrik P B & Fischhoff D A, Characterization of the coleopteran specific protein gene of Bacillus thuringiensis var tenebrioni s, Bio!Technology, 6 (1 989) 6 1.

15 Donovan W P, Dankocsikc C. Gil be11 M P, Gawaran-Burke M C, Groat R G & Carlton B C, Amino acid sequence and entomocidal activity of the p2 crystal protein : An insect tox in from Bacillus thuringiensis var. kurstaki, J Bioi Chem, 263( 1988) 56 1.

16 Adams L F, Mathewes, P.O'Hara, Petersen A & Gurtler H Elucidation of the mechanism of cry Ili A overproduction in a mutagenezed strain of Bacillus thuringiensis var. tenebrionis, Mol Microbial, 14(1994) 38 1.

17 Sick A, Gaerliner F & Wong A, Nucleotide sequence of a coleopteran active tox in gene from a new isolate of Bacillus thuringiensis subsp tolworthi , Nucleic Acid Res, 18 ( 1990) 1305 .

18 Donovan W P, Rupar M J, Slaney A C, Malvar T, Gawrom Burke M C & Johnson T B. Characterization of two genes encoding Bacillus thuringiensis insecicidal crystal proteins tox ic to coleopteran species, Appl En viron Microbial, 58 ( 1992) 392 1.

19 Tai lor R, T ippett J , Gibb G, Pells S, Pike D, Jordan L & Ely S, Identification and charac terization of a novel Bacillus thuringiensis delta endotox in entomocidal to coleopteran and

lepidopteran larvae, Mol Microbial, 6 (1992) 1211. 20 Chin X J, Curti ss E, Alcantara & Dean D H, Mutation in

domain I of Bacillus tlwringiensis delta endotoxin CI}' IAb reduce the irreversible binding of tox in to Manduca sexta brush border membrane vesicles, J Bivl Chem, 270 ( 1995) 6412.

21 Kostichka K, Warren G W, Mullins M, Mullins A D, Craig J A, Koziel M G & Estruch J J. Cloning of a cy V-type insecticidal protein gene from Bacillus thuringiensis the cru V-encoded protein is expressed early in stationary phase, J Bacterial, 178 (1996) 2141.

22 Selvapandiyan A, Ahmad S, Majumder K, Arora N & Bhatnagar R K, Evidence for the shikimate 3-phosphate interacting site in the N-terminal domain of 5-enolpyruvylshikimate 3 phosphate sy nthase of Bacillus subtilis, Biochem Mol Biollnt/ , 40 ( 1996) 603.

23 Sambrook J, Fritsch E F, & Mani atis Plasmid vectors A laboratory Manual on Molecualr Cloning 2"d edition (Cold spring harbar Laboratory press, Cold spring Harbar. New York) 1989, 21.

24 Narva J P & Fu J, Bacillus thuringiensis gene encoding nematode-active tox ins. US Patent No.5 589 382.

25 Sato R, Takeuchi K, Ogiwara K, Minami M, Kaji Y, Suzu ki N, Hori H, Asano S, Ohba M & lwahana H, Cloning heterolocous expression and localization of a novel crystal prote in gene from Bacillus thuringiensis serovar j aponensis strain buibui toxic to scarabaied insects. Curr Microbial. 28 (1994) 15.