8/2/2019 sb bld 430 quiz 2 key

1/1

BLD 430 Quiz 2

1. Genotype can always be determined by phenotype.A) TrueB) False

2. An allele is just another term for locus.

A) TrueB) False

3. The closer two genes reside on a chromosome, higher their linkage scores will be.A) True

B) False

4. The rate of recombination between two genetic loci has influence on their perceived

linkage.

A) TrueB) False

5. Hardy-Weinberg equilibrium relates to normal distribution of genetic traits in the

population.A) True

B) False

6. For a lod score to be significant it must be greater than 0.05.

A) TrueB) False

7. In depicting a the relationship of family members in a graphic format, circles representfemales, squares represent males.

A) True

B) False

8. The central dogma is that dna is transcribed to rna and rna is translated to protein.A) True

B) False

9. There are three start codons and only one stop codon.

A) TrueB) False

10. For the following oligonucleotide, ACGTACGTACGTACGTACGT, its Tm wouldbe, 60C.

A) True

B) False