Running Title: Rickettsial plasmids · 22 Minnesota, 1980 Folwell Ave., St. Paul, MN 55108. Phone:...

1

1

Title: Low Copy Number Plasmids are Widely Dispersed in Rickettsia Species Associated with 2

Blood-feeding Arthropods and may have Multiple Origins 3

4

Running Title: Rickettsial plasmids 5

6

Gerald D. Baldridge*4, Nicole Y. Burkhardt

4, Marcelo B. Labruna

1, Richard C. Pacheco

1, 7

Christopher D. Paddock2, Philip. C. Williamson

3, Peggy. M. Billingsley

3 , Roderick F. 8

Felsheim4, Timothy J. Kurtti

4, and Ulrike G. Munderloh

4 9

Department of Entomology, University of Minnesota, St. Paul, Minnesota 55108 10

11

1Departamento de Medicina Veterinaria Preventiva e Saude Animal, Faculdade de Medicina 12

Veterinaria e Zootecnia, Universidade de Sao Paulo, Sao Paulo, Brazil 13

14

2Infectious Diseases Pathology Branch, Division of Viral and Rickettsial Disease, Centers for 15

Disease Control and Prevention, Atlanta, Georgia 16

17

3Department of Forensic and Investigative Genetics, University of North Texas Health Science 18

Center, Fort Worth, Texas 19

20

*4Corresponding author. Mailing address: Department of Entomology, University of 21

Minnesota, 1980 Folwell Ave., St. Paul, MN 55108. Phone: (612) 624-3688. 22

E-mail: [email protected] 23

Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02988-09 AEM Accepts, published online ahead of print on 22 January 2010

on May 12, 2020 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

ABSTRACT 24

25 Plasmids are mobile genetic elements of bacteria that can impart important adaptive traits such as 26

increased virulence or antibiotic resistance. We report existence of plasmids in Rickettsia 27

(Rickettsiales; Rickettsiaceae) species including R. akari, R. amblyommii, R. bellii, R. 28

rhipicephali and REIS, the rickettsial endosymbiont of Ixodes scapularis. All of the rickettsiae 29

were isolated from humans or North and South American ticks. R. parkeri isolates from both 30

continents did not possess plasmids. We have now demonstrated plasmids in nearly all Rickettsia 31

species that we have surveyed from three continents and that represent three of the four major 32

proposed phylogenetic groups associated with blood-feeding arthropods. Gel-based evidence 33

consistent with existence of multiple plasmids in some species was confirmed by cloning 34

plasmids with very different sequences from each of two R. amblyommii isolates. Phylogenetic 35

analysis of rickettsial ParA plasmid partitioning proteins indicated multiple parA gene origins 36

and plasmid incompatibility groups consistent with possible multiple plasmid origins. 37

Phylogenetic analysis of potentially host-adaptive rickettsial small heat shock proteins showed 38

that hsp2 genes were plasmid-specific and that hsp1 genes found only on plasmids of R. 39

amblyommii, R. felis, R. monacensis and R. peacockii were probably acquired independently of 40

the hsp2 genes. Plasmid copy numbers in seven Rickettsia species ranged from 2.4 to 9.2 per 41

chromosomal equivalent, as determined by real-time quantitative PCR. Plasmids may be of 42

significance in rickettsial evolution and epidemiology by conferring genetic plasticity and host 43

adaptive traits via horizontal gene transfer that counteracts the reductive genome evolution 44

typical of obligate intracellular bacteria. 45


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

INTRODUCTION 46

The α-proteobacteria of the genus Rickettsia (Rickettsiales: Rickettsiaceae) have 47

undergone the reductive genome evolution typical of obligate intracellular bacteria, resulting in 48

A/T-rich genomes (1.1 x 106 to 1.5 x 10

6 bp) with a high content of pseudogenes undergoing 49

elimination (3, 10, 20, 26). Initial sequencing of rickettsial genomes focused on the important 50

arthropod borne pathogens Rickettsia prowazekii, Rickettsia conorii, and Rickettsia typhi, and 51

appeared to confirm the prevailing belief that plasmids were absent and transposons were rare 52

among Rickettsia spp. (2, 28, 39, 44). As mobile genetic elements in bacteria, plasmids and 53

transposons drive horizontal gene transfer (HGT) and acquisition of virulence determinants and 54

environmental adaptive traits (30, 43, 60, 70). Subsequent sequencing of the Rickettsia felis 55

genome revealed the surprising presence of abundant transposase paralogs and the 63 kbp pRF 56

plasmid with 68 open reading frames (ORFs) encoding predicted proteins, as well as a 39 kbp 57

deletion form, pRFδ (45). Although pRF was suggested to be conjugative, it was initially thought 58

to be unique among the rickettsiae, a reasonable inference given that plasmids are uncommon 59

among the reduced genomes of obligate intracellular bacteria and were previously unknown in 60

the Rickettsiales (3, 4, 13). However, a phylogenetic analysis implied an origin for pRF in 61

ancestral rickettsiae and the possible existence of other rickettsial plasmids (28), which was soon 62

confirmed by the cloning of the 23.5 kbp pRM from Rickettsia monacensis (6). Some of the 23 63

ORFS on pRM had close pRF homologs and both plasmids carried transposon genes and the 64

molecular footprints of transposition events associated with HGT from other bacterial taxa. 65

The discoveries of pRF and pRM made obsolete the long-held dogma that plasmids were 66

not present in members of the genus Rickettsia and implied a source of unexpected genetic 67

diversity in the reduced rickettsial genomes, particularly if potentially conjugative plasmids 68


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

carrying transposon genes proved to be common among members of the genus. That hypothesis 69

gained credence when pulsed field gel electrophoresis (PFGE) and Southern blot surveys using 70

plasmid gene-specific probes demonstrated plasmids in Rickettsia helvetica, Rickettsia 71

hoogstraalii and Rickettsia massiliae and possible multiple plasmids in Rickettsia amblyommii 72

isolates (7). The same study demonstrated loss of a plasmid in the non-pathogenic Rickettsia 73

peacockii during long-term serial passage in cultured cells and absence of a plasmid in Rickettsia 74

montanensis M5/6, an isolate with a long laboratory passage history. Genome sequencing of R. 75

massiliae and Rickettsia africae revealed the 15.3 kbp pRMA and 12.4 kbp pRAF sequences 76

with 12 and 11 ORFS, respectively, that were more similar to those of pRF than pRM (11, 24). 77

The absence of plasmids in R. montanensis and important Rickettsia pathogens 78

maintained as laboratory isolates has left unresolved the question of the true extent of plasmid 79

distribution among Rickettsia spp. Until recently, the genus was thought to consist of closely 80

related species known chiefly as typhus and spotted fever pathogens transmitted by lice, fleas, 81

mites and ticks (31). It is now apparent that many, and possibly most, Rickettsia spp. inhabit a 82

diverse range of arthropods that do not feed on blood, as well as leeches, helminthes, crustaceans 83

and protozoans, suggesting an ancient and complex evolutionary history (54). A multi-gene 84

phylogenetic analysis of the Rickettsiales resulted in a “molecular clock”, which indicated the 85

order arose from a presumably free living ancestor and then adapted to intracellular growth 86

during the appearance of metazoan phyla in the Cambrian explosion (76). A transition to a 87

primary association with arthropods followed during the Ordovician and Silurian periods. The 88

genus Rickettsia arose approximately 150 million years ago and evolved into several clades, 89

including the early diverging hydra and torix lineages associated with leeches and protozoans. A 90

rapid radiation occurred about 50 million years ago in the arthropod associated lineages (76). 91


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

Whole genome sequencing has led to a revision of phylogenetic relationships among 92

Rickettsia spp. associated with blood feeding arthropods (10, 26, 28). A newly defined ancestral 93

group (AG) contains the earliest diverging species, Rickettsia bellii and Rickettsia canadensis, 94

while R. prowazekii and R. typhi transmitted by lice and fleas, respectively, constitute the typhus 95

group (TG). A proposed transitional group (TRG), consisting of the mite borne Rickettsia akari, 96

the flea borne R. felis, and the tick borne Rickettsia australis, bridges the genotypic and 97

phenotypic differences between the TG and the much larger spotted fever group (SFG) 98

consisting of tick borne rickettsiae (28). However, some presumptive SFG rickettsiae remain 99

poorly characterized and are of uncertain phylogenetic status, while accumulation of genomic 100

data from rickettsiae found in the diverse range of invertebrate hosts may have profound impacts 101

on the currently understood phylogeny of rickettsiae associated with blood feeding arthropods. 102

For example, it appears that the above AG and TRG species have many close relatives in insects 103

(76). Despite the recent phylogenomic advances, the genetic and host adaptive mechanisms 104

underlying the evolution of arthropod transmitted pathogens of vertebrates from ancestral 105

Rickettsia spp., including any possible role of plasmids, remain poorly understood. 106

In this report, we have taken advantage of recent isolations of rickettsiae from North and 107

South America to conclusively demonstrate that low copy number plasmids are indeed common 108

in low passage isolates of AG, TRG and SFG rickettsiae. The only exceptions were multiple 109

isolates from ticks and human eschar biopsies of R. parkeri, newly recognized as a mildly 110

pathogenic SFG rickettsia (49, 50, 52), and the previously characterized R. montanensis (7). We 111

confirmed that some Rickettsia isolates harbor more than one plasmid by cloning and sequencing 112

multiple plasmids from Rickettsia amblyommii isolates AaR/SC and Ac/Pa, and obtained PCR 113

and gel-based evidence that supported genome sequence evidence for existence of multiple 114


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

plasmids in REIS, the rickettsial endosymbiont of Ixodes scapularis. Phylogenetic analysis 115

provided strong evidence for multiple plasmid incompatibility groups and possible multiple 116

origins of plasmid-encoded parA genes in the genus Rickettsia. Other than genes encoding 117

plasmid replication initiation and partitioning proteins, the newly sequenced R. amblyommii 118

plasmids resembled the previously sequenced rickettsial plasmids in sharing limited similarities 119

in coding capacity (6, 7, 22). However, we have previously drawn attention to the presence of 120

hsp genes encoding α-crystalline small heat shock proteins as a conserved feature of most 121

rickettsial plasmids that may play a role in host adaptation (7). Phylogenetic analysis indicated 122

that the hsp2 genes were plasmid specific, while the hsp1 genes found on four rickettsial 123

plasmids may have been acquired by a chromosome-to-plasmid transfer event in a TRG-like 124

species. 125

126

MATERIALS AND METHODS 127

Rickettsiae. All rickettsiae were originally isolated in Vero (primate) cells unless stated 128

otherwise (Table 1). Whenever possible, low-passage isolates were used to eliminate the 129

possibility that isolates testing negative for presence of plasmids had done so due to their loss 130

during serial passage in the laboratory (7). Identity of each isolate was confirmed before analysis 131

for presence of plasmids by PCR amplification, DNA sequencing and comparison to Genbank 132

reference sequences of the gltA, ompA and 17-kilodalton antigen genes commonly used to 133

genotype Rickettsia spp. (1, 23). Rickettsiae were cultivated in Vero E6 or tick ISE6 cells as 134

described (39) with the exception of REIS, the rickettsial endosymbiont of Ixodes scapularis, 135

which was cultivated in IRE11 cells. Rickettsiae were released from host cells, separated from 136

cellular debris by filtration and concentrated by centrifugation (7). 137


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

Pulsed-field gel electrophoresis (PFGE). Purified rickettsiae were resuspended and 138

embedded in low-melting point agarose, digested with proteinase K in the presence of sodium 139

lauryl sarcosine and 0.5 M EDTA, and subjected to pulsed-field gel electrophoresis (PFGE) as 140

described (6) except that R. bellii isolates were run in 0.9% agarose gels to enhance separation of 141

larger plasmid isomers from chromosomal DNA. 142

Southern blot analyses. Rickettsial DNA was prepared and electrophoresed in PFGE 143

gels, depurinated and transferred onto Zeta Probe GT genomic membrane (Bio-Rad, Hercules, 144

CA) as described (5). The blots were hybridized with digoxigenin–labeled probes prepared by 145

PCR amplification of R. monacensis pRM plasmid genes, washed, and exposed to Kodak X-146

OMAT AR film (6, 7). 147

Determination of plasmid copy numbers. Plasmid copy numbers were determined as 148

ratios of the single copy plasmid hsp2 and chromosomal gltA genes using real-time quantitative 149

PCR (QPCR) and the relative quantification method (36, 37). To construct plasmids for 150

generation of species-specific standard curves, gltA sequences were PCR-amplified from each 151

Rickettsia sp. using 0.25 µM of the primer pair CS877F and CS1273R (54) and PfuTurbo 152

Hotstart DNA polymerase (Stratagene, La Jolla, CA). Cycle parameters with a Stratagene 153

robocycler were: 1 cycle at 95 0C for 2 min; 40 cycles at 95

0C for 30 s, 42

0C for 30 s, 1 min at 154

680C; and a final 10-min cycle at 68

0C. The PCR products were purified on spin-columns 155

(Qiagen, Valencia, CA), treated with Taq enzyme (Promega, Madison, WI) to create 3’-A 156

overhangs and cloned in the pCR4 vector (see below). The hsp2 sequences were amplified using 157

the Hsp2F3/Hsp2R3 primer pair (Table 2; all primers synthesized by Integrated DNA 158

Technologies, Coralville, Iowa) and GoTaq DNA Polymerase (Promega) with the following 159

cycle parameters: 1 cycle at 950C for 2 min; 40 cycles at 95

0C for 30 s, 46



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

720C; and a final 7-min period at 72

0C. Spin column-purified products were ligated into the 161

pCR4 vector with the TOPO TA Cloning kit and transformed into ONESHOT TOP10 competent 162

cells according to the manufacturer’s protocol (Invitrogen, Carslbad, CA). Plasmid DNA from 163

Kanamycin-resistant clones was prepared using the High Pure Plasmid Isolation Kit (Roche, 164

Indianapolis, IN) and sequenced to verify identity of the cloned PCR products (ABI 377 165

automated sequencer at Advanced Genetic Analysis Center, University of Minnesota). 166

For QPCR, serial dilutions of plasmid and rickettsial genomic DNAs were adjusted to 10 167

ng DNA per sample with salmon sperm DNA (Promega) and transferred to 96-well plates for 168

PCR amplification. The hsp2 sequences were amplified with species-specific primers and the 169

gltA sequences with the CS-F/CS-R primer pair (69) or species-specific primers (Table 2), using 170

the Brilliant or Brilliant II SYBR Green QPCR Master Mix, 240 nM primers, and an Mx3005p 171

qPCR cycler according to the manufacturer’s protocol (Stratagene). Cycle parameters were: 1 172

cycle at 950C for 10 min; 40 cycles at 95

0C for 30 s, 54

0C for 1 min, and 72

0C for 30 s. 173

Amplification specificity was confirmed by melting curve analysis. Data acquisition and analysis 174

were carried out with the MxPro software package, Version 4. Plasmid copy numbers per 175

chromosomal equivalent were determined by referencing values obtained from genomic samples 176

to the standard curves and were expressed as the mean ratios of hsp2/gltA amplification products 177

from three separate plates with all samples run in triplicate on each plate. 178

Cloning and sequencing R. amblyommii plasmids. Genomic DNA from R. amblyommii 179

isolates AaR/SC and Ac/Pa was partially digested with HpaI and SwaI (New England Biolabs, 180

Ipswich, MA), whose recognition sites occur at low frequency in rickettsial DNA. The digestion 181

products were ligated into the linear plasmid vector, pJAZZ (Lucigen Corp., Madison, WI) that 182

is optimized for cloning large A/T-rich inserts. Colony lifts of the libraries were hybridized with 183


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

probes derived from the R. monacensis pRM6, 8 and 16 plasmid genes (6). Positive clones that 184

contained inserts of approximately 6.5 – 25 kbp were Sanger sequenced by a primer walk 185

strategy using custom primers (Invitrogen, Carlsbad, CA) and BigDye* Terminator v.3.1 Cycle 186

Sequencing (Applied Biosystems, Inc. Foster City, CA using either an ABI PRISM* 310 or 187

3130xl Genetic Analyzer (Applied Biosystems). Sequence analysis, assembly and editing was 188

performed using Sequencher v4.7 (Gene Codes Corporation, Ann Arbor MI). Edited sequence 189

was prepared for submission to GenBank using Sequin Application Version 9.5 (NCBI) and 190

annotated using the NCBI Prokaryotic Genomes Automatic Annotation Pipeline (PGAAP). 191

Phylogenetic analyses of predicted ParA and Hsp proteins. Maximum Parsimony (67) 192

and Neighbor Joining (61) phylogenetic analyses were conducted using ParA, Hsp1 and Hsp2 193

proteins deduced from sequenced PCR products (see below) or plasmids and/or chromosomal 194

sequences of Rickettsia spp. and members of other bacterial taxa available at GenBank. 195

Sequences were manually aligned with Clustal X, edited to remove gaps, and imported into 196

PAUP* 4.0b (72) to construct phylogenetic trees. Node stability of dendrograms was estimated 197

with 1,000,000 random bootstrap replications (21). Additional Hsp2 sequences from R. bellii, 198

and R. hoogstraalii were derived from sequenced GoTaq PCR amplification products obtained 199

using the Hsp2F3/Hsp2R primer pair, and from R. helvetica using the Hsp2F3/Hsp2R3 and 200

Hsp2F/Hsp2R primer pairs (Table 2). Cycle parameters were: 1 cycle at 95 0C for 2 min; 40 201

cycles at 950C for 30 s, 46


0C; and a final 7-min step at 72

0C, except that 202

R. helvetica Hsp2F/Hsp2R reactions were annealed at 500C. The ParA sequences of REIS were 203

derived from sequenced Accu Taq (Sigma, St. Louis, MO) amplification products obtained using 204

pREIS1, 2, 3, and 4 primer pairs (Table 2). Cycle parameters were: 1 cycle at 94 0C for 3 min; 35 205

cycles at 940C for 30 s, 50


0C; and a final 5-min step at 72

0C. 206


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

Nucleotide sequence accession numbers. The R. amblyommii plasmid and PCR-207

amplified rickettsial hsp2 sequences reported here have been deposited in GenBank 208

(http://www.ncbi.nlm.nih.gov/Genbank) with the following accession numbers: pRAM18 209

(GU322808), pRAM23 (GU322807), R. bellii hsp2 (GU180086), R. helvetica hsp2 (GU180087) 210

and R. hoogstraalii hsp2 (GU180088). 211

212

RESULTS 213

Plasmids occur in R. rhipicephali, REIS and R. akari. In this study, we expanded the range of 214

arthropod-associated Rickettsia spp. analyzed for presence of plasmids using our previously 215

developed PFGE and Southern blot methods (7). In a PFGE lane loaded with an extract of the 216

South American R. rhipicephali HJ#5 isolate cultivated in tick ISE6 cells, plasmid isomers were 217

visible as SYBR Green-stained DNA bands that migrated at approximately 20, 45 and 55 kbp 218

relative to the linear DNA markers (Fig. 1A). The relative migration of the plasmid isomer and 219

DNA markers does not allow precise estimation of plasmid size because the plasmid isomers 220

represent a mixture of supercoiled and open circular forms as well as presumptive replication 221

single-stranded intermediates (6). Host cell mitochondrial DNA bands (7) co-migrated with 222

those in an uninfected ISE6 cell extract at approximately 25 and 35 kbp. In a lane loaded with 223

REIS cultivated in IRE11 cells, plasmid isomer bands migrated at approximately 40, 45 and 55 224

kbp, but only the smaller mitochondrial band was visible. The gel was Southern blotted and 225

hybridized (Fig. 1B) with a probe derived from the R. monacensis pRM16 gene, encoding a 226

DnaA-like replication initiator protein. In the lane with R. monacensis IrR/Munich, the 227

characteristic hybridization pattern of linear, open circular and supercoiled pRM isomers was 228

present with the major bands at approximately 25 and 45 kbp (6, 7). In the R. rhipicephali and 229


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

REIS lanes, four- and three-band hybridization patterns, respectively, were present at positions 230

of the plasmid bands in Fig. 1A, consistent with their identity as plasmid isomers. A replicate gel 231

was hybridized (Fig. 1C) with a probe derived from the pRM6 gene, encoding hsp2, which 232

produced the expected three-band hybridization pattern in the R. monacensis lane. In the R. 233

rhipicephali lane, the pRM6 probe hybridized in a two-band versus the four-band pattern of the 234

pRM16 probe, suggesting plasmid isomers with different gene complements. In the REIS lane, 235

the pRM6 probe replicated the hybridization pattern of the pRM16 probe but a fourth higher 236

molecular weight band was also present. A second replicate gel was hybridized (Fig. 1D) with a 237

probe derived from the pRM8 gene, encoding a helicase RecD/TraA protein. It hybridized as 238

expected in the R. monacensis lane but to only two plasmid isomer bands in the REIS lane and 239

did not produce a signal in the R. rhipicephali lane. Analysis of R. akari Bronx revealed a 240

plasmid that migrated as a predominant isomer at approximately 47 kbp (Fig. 2A). It hybridized 241

to the pRM16 probe (Fig. 2B) but not to the pRM6 and pRM8 probes (Figs. 2C and 2D). 242

In summary, the results demonstrated that the mite-associated TRG member, R. akari, 243

and three SFG Rickettsia spp. isolated from ticks collected on three continents have plasmids. R. 244

rhipicephali and REIS appear to have more than one plasmid. Four putative plasmid sequences 245

from REIS have been obtained as a consequence of the I. scapularis genome sequencing project 246

and deposited in GenBank as the circular pREIS1 and pREIS2, the incompletely circularized 247

pREIS3, and the plasmid scaffold NZ_GG688316 (referred to here as pREIS4). We confirmed 248

the REIS identity of the parA genes on those plasmids by PCR amplification of DNA extracts 249

from our REIS isolate using primers flanking the parA genes on the GenBank-deposited pREIS 250

sequences. In all four cases, PCR products of the predicted lengths (815 to 1075 bp) were 251

obtained and their sequences were identical to those of the cognate pREIS1, 2, 3, and 4 252


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

sequences (data not shown), consistent with a REIS origin of the plasmids rather than from other 253

bacteria that may have been present in tissues used to prepare I. scapularis DNA. 254

Plasmids occur in North and South American R. amblyommii but not in R. parkeri. 255

Analysis of the North American SFG member, R. amblyommii Darkwater, revealed plasmid 256

isomers that migrated at approximately 47 and 62 kbp (Fig. 2A). In contrast, plasmids were 257

absent in lanes containing R. parkeri Ft. Story, Portsmouth and Tates Hell (Fig. 2A) and in three 258

additional North American isolates, High Bluff, Grand Bay and Oktibbeha (data not shown). The 259

pRM16 probe hybridized to the R. amblyommii plasmids but did not hybridize to R. parkeri 260

DNA (Fig. 2B). A replicate gel hybridized with the pRM6 probe (Fig. 2C) reproduced the R. 261

amblyommii two-band hybridization pattern of the pRM16 probe and identified a third band that 262

probably corresponded to a plasmid that was poorly resolved from the 25 kbp mitochondrial 263

DNA band in Fig. 1A. The pRM6 probe did not hybridize to DNA of R. parkeri. A second 264

replicate gel hybridized with the pRM8 probe (Fig. 2D) reproduced the R. amblyommii pRM6 265

hybridization pattern, but did not yield a signal in the R. parkeri lanes. 266

Analysis of the South American R. amblyommii An13 and Ac37 isolates revealed 267

plasmid isomers that migrated at approximately 17 and 50 kbp versus 17, 33, and 55 kbp, 268

respectively (Fig. 3A). The South American R. parkeri isolates At#24 and At#5 did not have 269

plasmid DNA bands. The pRM16 probe hybridized to plasmid isomers of R. amblyommii An13 270

in a three-band pattern that included an additional 33 kbp band not revealed by SYBR Green-271

staining, but recognized only the 17 and 33 kbp plasmid isomers of R. amblyommii Ac37 (Fig. 272

3B). The probe did not hybridize to R. parkeri DNA. Replicate gels hybridized with the pRM6 273

probe (Fig. 3C) and the pRM8 probe (Fig. 3D) produced similar hybridization patterns except 274

that the 17 kbp plasmid isomer of R. amblyommii An13 was not recognized. The results were 275


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

consistent with presence of plasmids carrying pRM6, 8 and 16 homologs in the R. amblyommii 276

isolates and their absence in the R. parkeri isolates. 277

In summary, the results demonstrated presence of plasmid in North and South American 278

R. amblyommii isolates that carried pRM6, 8 and 16 homologs. In contrast, eight R. parkeri 279

isolates from both continents did not carry plasmids and none of the probes hybridized to their 280

sheared chromosomal or low molecular weight DNA, consistent with absence of plasmid gene 281

homologs on the rickettsial chromosomes. The R. parkeri isolates were the only low passage 282

rickettsia isolates that we have analyzed that did not possess a plasmid. Previously analyzed high 283

passage R. montanensis also lacked a plasmid, while low passage R. peacockii possessed a 284

plasmid that was lost during serial passage (7). 285

Plasmids occur in low passage R. bellii, but not in a high passage isolate. Analysis of 286

South American isolates of R. bellii, a member of the AG rickettsiae, revealed prominent 287

plasmids that migrated at approximately 55 – 65 kbp in lanes containing isolates ovale, Ad25, 288

An4 and Mogi, and at 75 and 90 kbp in the isolate HJ#7 lane (Fig. 4A). The upper mitochondrial 289

DNA band migrated as a doublet in the 0.9% agarose gels. Plasmid bands were absent in the lane 290

loaded with R. bellii 369-C, which was originally isolated in 1966 from Dermacentor variabilis 291

ticks collected in Arkansas, USA. Replicate gels hybridized with the pRM16 probe (Fig. 4B) 292

and the pRM6 probe (Fig. 4C) revealed plasmids in two- or three-band patterns seen in Fig. 4A 293

and less abundant smaller isomers. However, none of the patterns were identical and the plasmid 294

of the ovale isolate did not hybridize with the pRM6 probe. The pRM8 probe hybridized weakly, 295

or not all (isolate An4), to the plasmid bands but strongly to sheared chromosomal DNA, 296

including that of isolate 369-C (Fig. 4D). Because R. bellii occupies a basal position in rickettsial 297

phylogenetic trees, we hybridized a replicate gel blot with a probe derived from the pRM12 298


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

gene, encoding a proline/betaine transporter. It was previously shown to recognize the plasmid of 299

R. hoogstraalii isolated from a North American Argasid tick, but not the plasmids of Rickettsia 300

spp. from other Ixodid ticks or R. felis from cat fleas (7). The pRM12 probe hybridized to 301

plasmids of three of the five R. bellii isolates and to chromosomal DNA of all five (Fig. 4E). In 302

summary, the results demonstrated absence of a plasmid in the high passage 369-C isolate in 303

contrast to the universal presence of relatively large plasmids in the low passage R. bellii 304

isolates. The plasmids varied in size and those of the An4 and ovale isolates were less conserved 305

than the others relative to pRM of R. monacensis. 306

To further assess conservation of rickettsial plasmid gene complement, we hybridized 307

PFGE Southern blots of rickettsiae reported in this study with a probe derived from the R. 308

monacensis pRM23 gene encoding a transposon resolvase similar to that of Burkholderia 309

thailandensis and probably derived by HGT (6). The probe hybridized to plasmid isomers of R. 310

akari Bronx, R. rhipicephali HJ#5 and REIS (Fig. 5B) but not to plasmids of R. amblyommii or 311

R. bellii (data not shown). Results of Southern blot analyses shown in Figs. 1 – 5 are summarized 312

in Table 3. 313

Plasmid Copy Numbers. Rickettsial plasmid copy numbers were estimated by QPCR as 314

the relative ratios of plasmid-encoded hsp2 gene homologs and the single-copy gltA genes found 315

on rickettsial chromosomes. Plasmid copy numbers among seven Rickettsia spp. fell within a 316

four-fold range from 2.4 in R. helvetica to 9.2 in R. peacockii (Table 4). Means and standard 317

deviations of standard curve DNA and rickettsial sample DNA hlp2 reaction efficiencies were 318

96.8 +/- 2.6 and 94.1 +/- 2.9, respectively, while the cognate values for gltA reactions were 99.5 319

+/- 1.5 and 95.9 +/- 2.9, respectively. In all cases, reaction products had well-defined single peak 320

melting curves. 321


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

R. amblyommii AaR/SC and Ac/Pa isolates each have multiple distinct plasmids. In 322

this (Fig. 1) and a previous study (7), PFGE, Southern blot, PCR and I. scapularis genome 323

sequence data suggested existence of two or more distinct plasmid species in R. amblyommii, R. 324

rhipicephali and REIS. We verified that hypothesis by isolation, cloning and sequencing 325

plasmids from genomic libraries of R. amblyommii AaR/SC and Ac/Pa. Screening of the libraries 326

by hybridization with a cocktail of probes derived from pRM genes yielded positive clones at a 327

frequency of less than 1%. Eight AaR/SC clones and seven Ac/Pa clones were selected for 328

further study. Southern blot analysis revealed plasmid DNA inserts of 6.5 to 24 kbp (data not 329

shown). Four R. amblyommii AaR/SC clones have been sequenced to confirm existence of at 330

least two plasmids in that isolate. The entire 18,497 bp pRAM18 was contained in a single Swa1 331

clone (verified by PCR amplification using end terminal primers), while the 22,781 bp pRAM23 332

sequence was obtained from a 21.9 kbp Hpa1 clone and a 0.9 kbp PCR product amplified with 333

primers complementary to end sequences of the Hpa1 clone. An as yet incompletely circularized 334

sequence represents a provisional third plasmid (pRAM30) estimated to be 30 kbp in length. The 335

completed pRAM18 and pRAM23 sequences encode homologs of the DnaA-like replication 336

initiator and ParA plasmid partitioning proteins encoded by the pRM16 and pRM18 genes. 337

Homologs of the pRM6 and pRM7 genes encoding Hsp1 and Hsp2 proteins were present on 338

pRAM23 but not on pRAM18, which was nearly identical to a slightly larger Ac/Pa plasmid 339

contained in a single clone. Incompletely sequenced Ac/Pa clones indicated presence of at least 340

one more plasmid in that isolate. Other notable aspects of the AaR/SC plasmids included the 341

presence on pRAM23 of a homolog of the R. bellii and Orientia tsustsugamushi phrB genes that 342

encode DNA UV-damage repair enzymes as well as two sca12 gene homologs encoding outer 343

membrane proteins with potential roles in host cell interactions. A predicted gene on pRAM18 344


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

encoded a chimeric protein containing both SpoT and leucine-rich repeat domains, thus 345

combining potential stringent response and protein interaction functions. 346

The pRAM18 gene complement, but not that of pRAM23, was highly similar to that of 347

pRMA from R. massiliae, and included a homolog of the pRMA-p05 site specific recombinase 348

gene. In a PFGE/Southern blot analysis, a probe derived from the pRAM18 p05 homolog 349

hybridized to a subset of the R. amblyommii AaR/SC plasmid isomers that were not recognized 350

by the pRM6 probe (data not shown), further confirming existence of multiple plasmid species in 351

a single rickettsia isolate. 352

Phylogenetic analysis of rickettsial ParA proteins. Maximum parsimony analysis of 154 353

amino acids (145 informative) of the rickettsial ParA proteins showed that those encoded on 354

rickettsial chromosomes clustered tightly within the tree (Fig. 6, at left center) as a group that 355

diverged from a node on a branch bearing a ParA from Ehrlichia chaffeensis, also a member of 356

the Rickettsiaceae. Of all the rickettsial plasmid-encoded type Ib ParA proteins, only that 357

encoded by pREIS4 from the rickettsial endosymbiont of I. scapularis was present on the same 358

branch with the chromosomal ParA proteins, diverging from the most basal node on the branch. 359

The rickettsial plasmid ParA proteins were highly diverse relative to the chromosomal ParA 360

proteins, as illustrated by comparison with the tree positions of plasmid-encoded ParA proteins 361

from other families of bacteria. The majority of the rickettsial plasmid ParA sequences clustered 362

in three groups with good bootstrap support. The first group (at right) was at a distal position on 363

a branch with a basal node that led off to pRAF-encoded ParA of R. africae and a medial node 364

that led off to plasmid-encoded ParA sequences from Yersinia and Salmonella spp. The distal 365

group consisted of highly similar ParA homologs encoded by pRAM23 of R. amblyommii and 366

pRMA of R. massiliae, as well as a less similar homolog encoded on a contig reported from an 367


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

incomplete genome sequence assembly of the aquatic eukaryote Trichoplax adhaerens (68), the 368

simplest known multi-cellular animal. We detected many homologs of Rickettsia genes on the 369

Trichoplax contigs and predict that previously observed bacterial endosymbionts in Trichoplax 370

(62) will prove to be rickettsiae. The second rickettsial plasmid ParA group (bottom right) 371

consisted of homologs encoded by pRPR of R. peacockii and pRF of R. felis that clustered at the 372

distal ends of a branch containing an adjacent node that led to a ParA encoded by a plasmid of 373

Pseudomonas syringae. A more basal node on the branch led to ParA proteins from from 374

pREIS1 and plasmids of Yersinia and Pseudomonas spp., while the most basal node led to the 375

ParA encoded by pRM of R. monacensis. The third group (upper left) consisted of ParA proteins 376

encoded by pRFδ of R. felis, pREIS2 and pREIS3. The ParA proteins encoded by pRAM18 and 377

the provisional pRAM30 diverged from nodes without bootstrap support on a branch (top right) 378

that also contained a ParA encoded by the Borrelia burgdorferi cp32 plasmid. Neighbor joining 379

analysis supported the maximum parsimony results (not shown). 380

Phylogenetic analysis of rickettsial small heat shock proteins. Maximum parsimony 381

analysis of the rickettsial plasmid-encoded Hsp2 proteins (113 amino acids; 100 informative) 382

showed that they clustered tightly as a single group (Fig. 6B, circled at bottom right). The most 383

basal group member was encoded by the R. felis chromosomal RF1004 gene. Sequence analysis 384

indicated it was a chimera that may have originally been a plasmid gene that was integrated into 385

the chromosome by a recombination event adjacent to RF1005, which suffered a 5’end-terminal 386

deletion of its ORF (data not shown). The chromosome-encoded Hsp proteins of three facultative 387

intracellular pathogens from other bacterial taxa and of Wolbachia pipientis (Rickettsiales) 388

occupied intermediate positions in the tree. The Rickettsia chromosome-encoded Hsp1 proteins 389

clustered tightly as a group that branched away from the Legionella pneumophila node. The “R. 390


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

rickettsii complex” in that group included the SFG members R. rickettsii, R. africae, R. conorii, 391

R. massiliae, R. peacockii and R. sibirica. The plasmid-encoded Hsp1 proteins of R. felis, R. 392

monacensis, R. peacockii and R. amblyommii pRAM23 (pRAM18 has no hsp genes) formed a 393

second group (circled at top) that clustered as a side branch to the chromosomal Hsp1 cluster. 394

Neighbor joining analysis produced the same tree topology (not shown). 395

396

DISCUSSION 397

With this and previous PFGE/Southern blot analyses (6, 7), we have demonstrated 398

presence of plasmids in low passage isolates of AG, TRG and SFG Rickettsia spp. obtained from 399

arthropods or clinical samples collected from humans in North and South America and Europe. 400

Similar isolates of R. africae from Africa have plasmids (22) and it now seems likely that 401

plasmids occur in rickettsiae associated with blood-feeding arthropods throughout the world. 402

However, plasmids were not present in R. parkeri, newly recognized as a mild SFG pathogen 403

(49, 50, 52), or in the GenBank-deposited genome sequences of major pathogens in the SFG (R. 404

conorii and R. rickettsii) and the TG (R. prowazekii and R. typhi). Plasmids were detected in five 405

low-passage isolates of R. bellii, but not in R. bellii 369-C (Fig. 4) or in R. montanensis M5/6 (7), 406

both having undergone serial passage since their isolations in the 1960s (9, 56 and E. J. Bell, 407

unpublished). In this context, it would be reasonable to re-evaluate the major rickettsial 408

pathogens (i.e. R. conorii, R. prowazekii, R. rickettsii and R. typhi) as low-passage isolates for 409

presence of plasmids using PFGE/Southern blot assays. 410

We obtained the first estimates of rickettsial plasmid copy numbers. Single copy hsp2 411

genes occur on the pRF, pRM, pRAM23 and pRPR sequenced plasmids. The unsequenced 412

plasmids of R. bellii, R. helvetica, and R. hoogstraali have hsp2 homologs (Fig. 4C and ref. 7) 413


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

but their existence as single copies was an assumption. Rickettsial chromosomes typically carry 414

single copy gltA genes but whether this is true for the unsequenced R. amblyommii, R. helvetica 415

and R. hoogstraalii awaits confirmation. With the exception of R. felis, hsp2 homologs are not 416

present in the known rickettsial chromosome sequences. Given those caveats, plasmid copy 417

numbers in seven Rickettsia spp. representing the AG, TRG and SFG averaged 4.4 per 418

chromosomal equivalent (Table 4). The rickettsiae thus have low copy number plasmids (i.e. less 419

than 10 per chromosome) consistent with their possession of par genes, which are essential for 420

the maintenance and stable inheritance of such plasmids (25, 27, 73). Plasmids are absent in 421

members of the other genera of the Rickettsiales and are rare in other obligate intracellular 422

bacteria associated with arthropods. Among such bacteria, the plasmids of the Buchnera 423

endosymbionts of aphids (Hemiptera: Aphididae) are the best known. Ratios of the leuABCD and 424

trpEG genes encoded on separate plasmids to single copy chromosomal genes among Buchnera 425

spp. associated with three aphid hosts ranged from 0.6 to 23.5 (35, 58, 75). However, copy 426

number interpretations of those values may be complicated by trpEG gene amplification and 427

fluctuations in Buchnera chromosome ploidy during host lifetimes (75). 428

Apparent homologs of the R. monacensis pRM16 and pRM6 genes encoding plasmid 429

maintenance and probable host-adaptive functions, respectively, were well conserved among the 430

plasmids of 21 Rickettsia isolates (Table 3 and ref. 7), but there were interesting divergences in 431

plasmid gene conservation versus host association and phylogeny. Among SFG members, the 432

plasmid gene complement of R. hoogstraalii, isolated from a North American Argasid tick, was 433

much better conserved relative to that of R. monacensis than was that of R. helvetica, both of 434

which were isolated from the same European Ixodid tick. Apparent homologs of the pRM23 435

gene encoding a transposon resolvase were present on plasmids of the mite borne R. akari of the 436


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

TRG as well as R. rhipicephali and REIS, SFG members that were isolated from South and 437

North American ticks of different genera (Fig. 5). In contrast, pRM23 homologs were not present 438

on plasmids of other SFG rickettsiae or those of R. felis (TRG) and R. bellii (AG). The plasmid 439

gene complements were neither wholly consistent with rickettsial phylogeny and host 440

associations nor with descent from a single ancestral plasmid, suggesting possible multiple 441

origins and/or the influence of HGT. 442

We obtained evidence for multiple origins of the plasmids through phylogenetic analysis. 443

Plasmids carry conserved partitioning genes (par) that are usually organized in an auto-regulated 444

operon and are required for plasmid segregation at cell division (25, 73). The encoded ParA 445

proteins are Walker-type ATPases whose ATP-bound forms interact with a nucleoprotein 446

complex consisting of ParB protein dimers bound to sequence repeats at the parS centromere to 447

mediate intracellular location, movement, segregation and incompatibility of plasmids (14, 25). 448

The ParB protein sequences are highly conserved but the more variable ParA sequences allow 449

phylogenetic analysis of plasmid lineages (27). Maximum parsimony analysis showed that most 450

rickettsial plasmid-encoded ParA proteins fell into three groups that clustered with ParA proteins 451

encoded on plasmids from other bacterial genera rather than with the highly conserved ParA 452

sequences encoded on rickettsial chromosomes (Fig. 6). In conjunction with the evidence for 453

multiple plasmids in single Rickettsia spp. discussed below, the results provided strong evidence 454

for the presence of plasmids from multiple incompatibility groups in the genus Rickettsia. 455

Similar phylogenetic analyses of plasmid maintenance proteins encoded by repABC operons of 456

the repABC plasmids have demonstrated presence of multiple plasmid incompatibility groups 457

within several genera of α-proteobacteria, including as many as nine in the Roseobacter clade 458

that can stably coexist in the same cell, while six occur in each of two Rhizobium spp. (17, 55). 459


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

21

Similar to the rickettsial ParA phylogeny, different repABC replicons within the same bacterial 460

strain tend to belong to different phylogenetic clades with lineages that are not congruent with 461

species trees, suggesting that incompatibility groups arise as a consequence of divergent 462

evolution that may be interrupted by HGT events between plasmid lineages (16). 463

Differential hybridization patterns of the pRM6 and pRM16 probes to plasmid isomers of 464

both R. rhipicephali and REIS (Fig. 1) and several R. amblyommii isolates (Fig. 2, and ref. 7) 465

were reminiscent of the simultaneous presence of the 63-kbp pRF and the 39-kbp pRFδ deletion 466

form in R. felis (45). Although the pREIS1, 2, 3 and 4 plasmid sequence scaffolds from the I. 467

scapularis genome sequence project have varying degrees of similarity, they possess different 468

parA genes and none clearly represents a deletion form of another. We obtained PCR evidence 469

for their legitimate identity as REIS plasmids and obtained physical confirmation that multiple 470

plasmids exist in single rickettsiae isolates by cloning and sequencing pRAM18 and pRAM23 471

from R. amblyommii AaR/SC. Their sequence similarities were confined to genes that encoded 472

DnaA-like replication initiators and Par proteins and they were therefore distinct plasmids rather 473

than a major plasmid accompanied by a deletion form. We are sequencing a third plasmid 474

(pRAM30) from the AaR/SC isolate and two from the R. amblyommii Ac/Pa isolate. Because 475

those isolates represent uncloned bacterial populations it is not yet clear whether individual cells 476

contain only single or multiple plasmid species. 477

The presence of multiple plasmid species in single R. amblyommii isolates is intriguing 478

given the biology of their primary hosts. Amblyomma ticks are widely distributed from tropical 479

to temperate climates and are known for their aggressive propensity to feed on a wide range of 480

hosts that are parasitized by other ticks and blood-feeding arthropods (18, 29). Those attributes 481

are well suited to facilitating HGT within the “intracellular arena” of bacterial genetic exchange 482


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

22

in potentially co-infected arthropods (12, 13). A surprisingly diverse range of bacteria occur in 483

ticks (40) and co-infections of single ticks with different obligate intracellular microbes have 484

been demonstrated in several genera, including Amblyomma (19), and as many as three 485

Rickettsia spp. have been found in single ticks (15). The wide distribution and host biology of 486

Amblyomma ticks, and the presence of multiple plasmids that may be of different lineages in 487

single R. amblyommii strains, is consistent with the possibility that Amblyomma ticks have been 488

an active locus of HGT into and within the genus Rickettsia. 489

The high content of transposon-related sequences characteristic of all sequenced 490

rickettsial plasmids suggests that they may be HGT “hotspots” within rickettsial genomes, 491

perhaps as a consequence of their exposed positions as cytoplasmic episomes relative to the 492

packaged chromosomes associated with the bacterial cell walls. As mobile genetic elements, 493

plasmids are crucial drivers of HGT that enhance bacterial diversity and often provide the host 494

bacterium with functions such as drug resistance or environmental adaptive capacity that play 495

roles in pathogenicity (30, 43, 60, 70, 74). Plasmids may play those roles in rickettsiae by acting 496

as a mechanism for gain of new genes in the otherwise reductive Rickettsia genomes. The 497

rickettsial α-crystalline hsp genes that are prime candidates for provision of host adaptive 498

functions (7) provide a likely example. Phylogenetic analysis indicated that the hsp2 genes of 499

the Rickettsia were plasmid-specific, with the exception of a chromosomal homolog in R. felis, 500

and were probably acquired independently of the hsp1 genes (Fig. 6B). The plasmid-encoded 501

Hsp1 cluster consisted of proteins from R. felis (TRG) and three SFG spp. (R. monacensis, R. 502

peacockii and R. amblyommii) but branched from a deep node within the chromosomal Hsp1 503

group that lies between R. bellii (AG) and the TRG and TG rickettsiae. That result was consistent 504

with a potential evolutionary origin of the plasmid hsp1 genes in a chromosome-to-plasmid 505


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

23

transfer event in a TRG-like Rickettsia species. This possibility is supported by phylogenetic 506

analyses that showed the R. monacensis OmpA and OmpB proteins have much greater similarity 507

to homologs from TRG rickettsiae than to those from SFG rickettsiae (38), consistent with a 508

much closer affinity between R. monacensis and the TRG members than has previously been 509

realized. Additional support derives from presence of a 12 kbp plasmid-like sequence in the R. 510

typhi chromosome (28, 39) and our observation that the R. felis RF1004 gene may have 511

undergone a plasmid to chromosome transfer. 512

We have now demonstrated that plasmids occur in nearly all arthropod-borne AG, TRG 513

and SFG rickettsiae that we have surveyed for their presence. The pRF plasmid of R. felis was 514

the first to be discovered in the genus Rickettsia and was suggested to be conjugative on the basis 515

of encoding conjugative transfer genes and the presence of pili on the surfaces of R. felis cells 516

(45). It is now known that conjugative genes are widespread in the genus and that they are 517

horizontally transmitted (77). The presence of wide-spread and potentially mobile plasmids in 518

Rickettsia spp. has evolutionary and epidemiologic implications. The true impact of those 519

implications requires further investigation of the full extent of the distribution of rickettsial 520

plasmids within the many members of the genus not found in arthropod vectors and whether the 521

plasmids are currently mobile. 522

523

ACKNOWLEDGEMENT 524

This research was supported by NIH grant RO1 AI49424 to U.G.M. 525

526

REFERENCES 527


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24

1. Anderson, B. E. and T. Tzianabos. 1989. Comparative sequence analysis of a genus-528

common rickettsial antigen gene. J. Bacteriol. 171:5199-5201.2 529

2. Andersson, S. G., A. Zomorodipour, J. O. Andersson, T. Sicheritz-Ponten, and U. C. Alsmark. 530

R. M. Podowski, A. K. Naslund, A. Eriksson, H. H. Winkler and C. G. Kurland. 1998. The 531

genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature. 396:133-532

140. 533

3. Andersson, S. G. E. and C. G. Kurland. 1998. Reductive evolution of resident genomes. 534

Trends Microbiol. 6:263-268. 535

4. Andersson, J. O. and S. G. E. Andersson. 2001. Pseudogenes, junk DNA and the 536

dynamics of rickettsia genomes. Mol. Biol. Evol. 18:829-839. 537

5. Baldridge, G. D., N. Burkhardt, M. J. Herron, T. J. Kurtti, and U. G. Munderloh. 2005. 538

Analysis of fluorescent protein expression in transformants of Rickettsia monacensis, an obligate 539

intracellular tick symbiont. Appl. Environ. Microbiol. 71:2095-2105. 540

6. Baldridge, G. D., N. Y. Burkhardt, R. F. Felsheim, T. J. Kurtti, and U. G. Munderloh. 541

2007. Transposon insertion reveals pRM, a plasmid of Rickettsia monacensis Appl. Environ. 542

Microbiol. 73:4984-4995. 543

7. Baldridge, G. D., N. Y. Burkhardt, R. F. Felsheim, T. J. Kurtti, and U. G. Munderloh. 544

2008. Plasmids of the pRM/pRF family occur in diverse Rickettsia species. Appl. Environ. 545

Microbiol. 74:645-652. 546

8. Beati, L., O. Peter, W. Burgdorfer, A. Aeschlimann, and D. Raoult. 1993. Confirmation 547

that Rickettsia helvetica spp. nov. is a distinct species of the spotted fever group of rickettsiae. 548

Int. J. Syst. Bacteriol. 43:521-526. 549


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

25

9. Bell, E. J., G. M. Kohls, H. G. Stoenner, and D. B. Lackman. 1963. Nonpathogenic 550

rickettsias related to the spotted fever group isolated from ticks, Dermacentor variabilis and 551

Dermacentor andersoni from eastern Montana. J. Immunol. 90:770-781. 552

10. Blanc, G., H. Ogata, C. Robert, S. Audic, K. Suhre, G. Vestris, J. - M. Claverie, and D. 553

Raoult. 2007. Reductive genome evolution from the mother of Rickettsia. PLoS Genet. 3(1):e14. 554

11. Blanc, G., H. Ogata, C. Robert, S. Audic, J. - M. Claverie, and D. Raoult. 2007. Lateral 555

gene transfer between obligate intracellular bacteria: Evidence from the Rickettsia massiliae 556

genome. Genome Research. 17:1657-1664. 557

12. Bordenstein, S. R., and J. J. Wernegreen. 2004. Bacteriophage flux in endosymbionts 558

(Wolbachia): Infection frequency, lateral transfer, and recombination rates. Mol. Biol. Evol. 559

21:1981-1991. 560

13. Bordenstein, S. R., and W.S. Reznikoff. 2005. Mobile DNA in obligate intracellular 561

bacteria. Nature Rev. 3:688-699. 562

14. Bouet, J. -Y., K. Nordstrom, and D. Lane. 2007. Plasmid partition and incompatibility – 563

the focus shifts. Mol. Microbiol. 65:1405-1414. 564

15. Carmichael, J. R., and P. A. Fuerst. 2009. Molecular detection of Rickettsia bellii, 565

Rickettsia montanensis, and Rickettsia rickettsii in a Dermacentor variabilis tick from nature. 566

Vector Borne Zoonotic Dis. Epub ahead of print. 567

16. Castillo-Ramirez, S., J. F. Vazquez-Castellanos, V. Gonzalez, and M. A. Cevallos. 2009. 568

Horizontal gene transfer and diverse functional constrains within a common replication-569

partitioning system in Alphaproteobacteria: the repABC operon. BMC Genomics. 10:536. 570

17. Cevallos, M. A., R. Cervantes-Rivera, and R. M. Gutierrez-Rios. 2008. The repABC 571

plasmid family. Plasmid. 60:19-37. 572


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

26

18. Childs, J.E., and C.D. Paddock. 2003. The ascendancy of Amblyomma americanuum as a 573

vector of pathogens affecting humans in the United States. Annu. Rev. Entomol. 48:307-337. 574

19. Clay, K., O. Klyachko, N. Grindle, D. Civitello, D. Oleske, and C. Fuqua. 2008. 575

Microbial communities and interactions in the lone star tick, Amblyomma americanum. Mol. 576

Ecol. 17:4371-4381. 577

20. Darby, A. C., N. -H. Cho, H. -H. Fuxelius, J. Westberg, and S. G. E. Andersson. 2007. 578

Intracellular pathogens go extreme: genome evolution in the Rickettsiales. Trends Genet. 579

23:511-520. 580

21. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. 581

Evolution. 39:783-791. 582

22. Felsheim, R. F., T. J. Kurtti, and U. G. Munderloh. 2009. Genome sequence of the 583

endosymbiont Rickettsia peacockii and comparison with virulent Rickettsia rickettsii: 584

Identification of virulence factors. PLoS One. 4(12): e8361. 585

23. Fournier, P. -E., J. S. Dumler, G. Greub, J. Zhang, Y. Wu, and D. Raoult. 2003. Gene 586

sequence-based criteria for identification of new Rickettsia isolates and description of Rickettsia 587

heilongjiangensis spp. nov. J. Clin. Microbiol. 41:5456-5465. 588

24. Fournier, P. -E., K. E. Karkouri, Q. Leroy, C. Robert, B. Giumelli, P. Renesto, C. 589

Socolovschi, P. Parola, S. Audic, and D. Raoult. 2009. Analysis of the Rickettsia africae 590

genome reveals that virulence acquisition in Rickettsia species may be explained by genome 591

reduction. BMC Genomics. 10:166. doi: 10.1186/1471-2164-10-166. 592

25. Funnell, B. 2005. Partition-mediated plasmid pairing. Plasmid 53:119-125. 593

26. Fuxelius, H. -H., A. Darby, C. -K. Min, N. -M. Cho, and S. G. E. Andersson. 2007. The 594

genomic and metabolic diversity of Rickettsia. Res. Microbiol. 158:745-753. 595


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

27

27. Gerdes, K., J. Moller-Jensen, and R. Bugge Jensen. 2000. Plasmid and chromosome 596

partitioning: surprises from phylogeny. Mol. Microbiol. 37:455-466. 597

28. Gillespie, J. J., M. S. Beier, M. S. Rahman, N. C. Ammerman, J. M. Shallom, A. 598

Purkayastha, B. S. Sobral, and A. F. Azad. 2007. Plasmids and rickettsial evolution: Insight 599

from Rickettsia felis. PLoS One. 3:1-17. 600

29. Goddard, J. and A. S. Varela-Stokes. 2009. Role of the lone star tick, Amblyomma 601

americanum (L.), in human and animal diseases. Veterin. Parasitol. 160:1-12. 602

30. Hochut, B., U. Dobrindt, and J. Hacker. 2006. The contribution of pathogenicity islands to 603

the evolution of bacterial pathogens, pp83-108. In H. S. Siefert and V. J. Dirita (ed.) Evolution of 604

Microbial Pathogens. ASM Press, Washington, D.C. 605

31. Jones, K.E., N.G. Patel, M.A. Levy, A. Storeygard, D. Balk, J.L. Gittleman, and P. 606

Daszak. 2008. Global trends in emerging infectious diseases. Nature. 451:990-993. 607

32. Labruna, M. B., T. Whitworth, D. H. Bouyer, J. McBride, L. Marcelo, A. Camargo, E. 608

P. Camargo, V. Popov, and D. H. Walker. 2004. Rickettsia bellii and Rickettsia amblyommii in 609

Amblyomma ticks from the state of Rondonia, Western Amazon, Brazil. J. Med. Entomol. 610

41:1073-1081. 611

33. Labruna, M. B., R. C. Pacheco, S. Nava, P. E. Brandao, L. J. Richtzenhain, and A. A. 612

Guglielmone. 2007. Infection by Rickettsia bellii and Candidatus “Rickettsia amblyommii” in 613

Amblyomma neumanni ticks from Argentina. Microbial Ecol. 54:126-133. 614

34. Labruna, M. B., R. C. Pacheco, L. J. Richtzenhain, and M. P. J. Szabo. 2007. Isolation of 615

Rickettsia rhipicephali and Rickettsia bellii from Haemaphysalis juxtakochi ticks in the state of 616

Sao Paulo, Brazil. Appl. Environ. Microbiol. 73:869-873. 617


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

28

35. Lai, C. – Y., P. Baumann, and N. Moran. 1996. The endosymbiont (Buchnera sp.) of the 618

aphid Diuraphis noxia contains plasmids consisting of trpEG and tandem repeats of trpEG 619

pseudogenes. Appl. Environ. Microbiol. 62:332-339. 620

36. Lee, C., J. Kim, S. G. Shin, and S. Hwang. 2006. Absolute and relative QPCR 621

quantification of plasmid copy number in Escherichia coli. J. Biotechnol. 123:273-280. 622

37. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using 623

real-time quantitative PCR and the 2-∆∆C

T method. Methods. 25:402-408. 624

38. Mattila, J. T., N. Y. Burkhardt, H. J. Hutcheson, U. G. Munderloh and T. J. Kurtti. 625

2007. Isolation of cell lines and a rickettsial endosymbiont from the soft tick Carios capensis 626

(Neumann) (Acari: Argasidae: Ornithodorinae). J. Med. Ent. 44:1091-1101. 627

39. McLeod, M. P., X. Qin, S. E. Karpathy, J. Gioia, S.K. Highlander, G. E. Fox, T. Z. 628

McNeill, H. Jiang, D. Muzny, L. S. Jacob, A. C. Hawes, E. Sodergren, R. Gill, J. Hume, M. 629

Morgan, G. Fan, A. G. Amin, R. A. Gibbs, C. Hong, X. Yu, D. H. Walker, and G. M. 630

Weinstock. 2004. Complete genome sequence of Rickettsia typhi and comparison with 631

sequences of other rickettsiae. J. Bacteriol. 186:5842-5855. 632

40. Moreno, C.X., F. Moy, T.J. Daniels, H.P. Godfrey, and F.C. Cabello. 2006. Molecular 633

analysis of microbial communities identified in different developmental stages of Ixodes 634

scapularis ticks from Westchester and Dutchess counties, New York. Environ. Microbiol. 8:761-635

772. 636

41. Munderloh, U. G., S. D. Jauron, V. Fingerle, L. Leitritz, S. F. Hayes, J. M. Hautman, C. 637

M. Nelson, B. W. Huberty, T. J. Kurtti, G. G. Ahlstrand, B. Greig, M. A. Mellencamp, and 638

J. L. Goodman. 1999. Invasion and intracellular development of the human granulocytic 639

ehrlichiosis agent in tick cell culture. J. Clin. Microbiol. 37:2518-2524. 640


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

29

42. Noda, H., U. G. Munderloh, and T. J. Kurtti. 1997. Endosymbionts of ticks and their 641

relationship to Wolbachia and tick-borne pathogens of man and animals. Appl. Environ. 642

Microbiol. 63:3926-3932. 643

43. Ochmann, H., J. G. Lawrence, and E. A. Grolsman. 2000. Lateral gene transfer and the 644

nature of bacterial innovation. Nature. 405:299-304. 645

44. Ogata, H., S. Audic, P. Renesto-Audiffren, P. – E. Fournier, V. Barbe, D. Samson, V. 646

Roux, P. Cossart, J. Weissenbach, J. – M. Claverie, and D. Raoult. 2001. Mechanisms of 647

evolution in Rickettsia conorii and R. prowazekii. Science. 293:2093-2098. 648

45. Ogata, H., P. Renesto, S. Audic, C. Robert, G. Blanc, P. - E. Fournier, H. Parinello, J. - 649

M. Claverie, and D. Raoult. 2005. The genome sequence of Rickettsia felis identifies the first 650

putative conjugative plasmid in an obligate intracellular parasite. PLoS Biol. 3(8):e248. 651

46. Pacheco, R. C., J. M. Venzal. L. J. Richtzenhain, and M. B. Labruna. 2006. Rickettsia 652

parkeri in Uruguay. Emerg. Infect. Dis. 12:1804-1805. 653

47. Pacheco, R., S. Rosa, L. Richtzenhain, M. P. J. Szabó, and M. B. Labruna. 2008. 654

Isolation of Rickettsia bellii from Amblyomma ovale and Amblyomma incisum ticks from 655

southern Brazil. Rev. MVZ Córdoba 13:1273-1279. 656

48. Pacheco, R. C., M. C. Horta, A. Pinter, J. Moraes-Filho, T. F. Martins, M. S. Nardi, S. 657

S. Souza, C. E. Souza, M. P. Szabó, L. J. Richtzenhain, and M. B. Labruna. 2009. Pesquisa 658

de Rickettsia spp em carrapatos Amblyomma cajennense e Amblyomma dubitatum no Estado de 659

São Paulo. Rev. Soc. Bras. Med. Trop. 42:351-353. 660

49. Paddock, C. D. 2005. Rickettsia parkeri as a paradigm for multiple causes of tick-borne 661

spotted fever in the Western Hemisphere. Ann. N.Y. Acad. Sci. 1063:315-326. 662


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

30

50. Paddock, C. D., J. W. Sumner, J. A. Comer, S. R. Zaki, C. S. Goldsmith, J. G. Goddard, 663

S. L. F. McLellan, C. L. Tamminga, and C. A. Ohl. 2004. Rickettsia parkeri: A newly 664

recognized cause of spotted fever rickettsiosis in the United States. Clin. Infec. Dis. 38:805-811. 665

51. Paddock, P. D., T. Koss, M. E. Eremeeva, G. A. Dasch, S. R. Zaki, and J. W. Sumner. 666

2006. Isolation of Rickettsia akari from eschars of patients with rickettsialpox. Am. J. Trop. 667

Med. Hyg. 75:732-738. 668

52. Paddock, C. D., R. W. Finley, C. S. Wright, H. N. Robinson, B. J. Schrodt, C. C. Lane, 669

O. Ekenna, M. A. Blass, C. L. Tamminga, C. A. Ohl, S. L. F. McLellan, J. Goddard, R. C. 670

Holman, J. J. Openshaw, J. W. Sumner, S. R. Zaki, and M. Eremeeva. 2008. Rickettsia 671

parkeri rickettsioisis and its clinical distinction from Rocky Mountain spotted fever. Clin. Infect. 672

Dis. 47:1188-1196. 673

53. Paddock, C. D., P. – E. Fournier, J. W. Sumner, J. Goddard, Y. Elshenawy, M. G. 674

Metcalfe, and A. Varela-Stokes. In press. Isolation of Rickettsia parkeri and identification of a 675

novel spotted fever group Rickettsia sp. from Gulf Coast ticks (Amblyomma maculatum) in the 676

United States. Appl. Environ. Microbiol. 677

54. Perlman, S. J., M. S. Hunter and E. Zchori-Fein. 2006. The emerging diversity of 678

Rickettsia. Proc. R. Soc. B. 273:2097-2106. 679

55. Petersen, J., H. Brinkmann, and S. Pradella. 2009. Diversity and evolution of repABC 680

type plasmids in Rhodobacterales. Environ. Microbiol. 11:2627-2638. 681

56. Philip, R. N., E. A. Casper, R. L. Anacker, J. Cory, S. F. Hayes, W. Burgdorfer, and C. 682

E. Yunker. 1983. Rickettsia bellii sp. nov.: a tick-borne Rickettsia, widely distributed in the 683

United States, that is distinct from the spotted fever and typhus biogroups. Internat. J. Syst. 684

Bacteriol. 33:94-106. 685


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

31

57. Pinter, A., and M. B. Labruna. 2006. Isolation of Rickettsia rickettsii and Rickettsia bellii 686

in cell culture from the tick Amblyomma aureolatum in Brazil. Ann. N. Y. Acad. Sci. 1078:523-687

529. 688

58. Plague, G. R., C. Dale, and N. A. Moran. 2003. Low and homogenous copy number of 689

plasmid-borne symbiont genes affecting host nutrition in Buchnera aphidicola of the aphid 690

Uroleucon ambrosiae. 691

59. Pornwiroon, W., S. S. Pourciau, L. D. Foil, and K. R. Macaluso. 2006. Rickettsia felis 692

from colonized cat fleas: Isolation and culture in a tick-derived cell line. Appl. Environ. 693

Microbiol.72:5589-5595. 694

60. Rashkin, D. M., R. Seshadri, S. U. Pukatzki, and J. J. Mekalanos. 2006. Bacterial 695

genomics and pathogen evolution. Cell. 124:703-714. 696

61. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for 697

reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425. 698

62. Schierwater, B. 2005. My favorite animal, Trichoplax adhaerens. BioEssays 27:1294-1302. 699

63. Sekeyova, Z., P.E. Fournier, J. Rehacek, and D. Raoult. 2000. Characterization of a new 700

Spotted Fever Group Rickettsia detected in Ixodes ricinus (Acari: Ixodidae) collected in Slovakia. 701

J. Med. Entomol. 37:707-713. 702

64. Silveira, I., R. C. Pacheco, M. P. Szabo, H. G. Ramos, and M. B. Labruna. 2007. Rickettsia 703

parkeri in Brazil. Emerg. Infec. Dis. 13:1111-1113. 704

65. Simser, J. A., A. T. Palmer, U. G. Munderloh and T. J. Kurtti. 2001. Isolation of a 705

spotted fever group rickettsia, Rickettsia peacockii, in a Rocky Mountain Wood Tick, 706

Dermacentor andersoni, cell line. Appl. Environ, Microbiol. 67:546-552 707


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

32

66. Simser, J. A., A. T. Palmer, V. Fingerle, B. Wilske, T. J. Kurtti, and U. G. Munderloh. 708

2002. Rickettsia monacensis spp. nov., a spotted fever group rickettsia, from ticks (Ixodes 709

ricinus) collected in a European city park. Appl. Environ. Microbiol. 68:4559-4566. 710

67. Sober, E. 1988. Reconstructing the past: parsimony, evolution and inference. MIT Press, 711

Cambridge, Mass. 712

68. Srivastava, M., E. Begovic, J. Chapman, N. H. Putman, U. Hellsten, T. Kawashima, A. 713

Kuo, T. Mitros, A. Salamov, M. L. Carpenter, A. Y. Signorovitch, M. A. Moreno, K. 714

Kamm, J. Grimwood, J. Schmutz, H. Shapiro, I. V. Grigoriev, L. W. Buss, B. Schierwater, 715

S. L. Dellaporta, and D. S. Rokhsar. 2008. The Trichoplax genome and the nature of 716

placozoans. Nature. 454:955-960. 717

69. Stenos, J., S. R. Graves, and N. B. Unsworth. 2005. A highly sensitive and specific real-718

time PCR assay for the detection of spotted fever and typhus group rickettsiae. Am. J. Trop. 719

Med. Hyg. 73:1083-1085. 720

70. Stine, O. C., and J. P. Nataro. 2006. The evolution of bacterial toxins. In: Evolution of 721

Microbial Pathogens. H. S. Siefert and V. J. Dirita, Eds. Pp. 167-188. ASM Press. Washington 722

D.C. 723

71. Stothard, D. 1995. Ph.D. thesis. The evolutionary history of the genus Rickettsia as inferred 724

from 16S and 23S ribosomal RNA genes and the 17 kilodalton cell surface antigen gene. The 725

Ohio State University. Columbus, OH. 726

72. Swofford, D. L. 2001. PAUP*. Phylogenetic analysis using parsimony (*and other 727

methods), version 4.0b8 (PPC). 728

73. Thomas, C. M. 2000. Paradigms of plasmid organization. Mol. Microbiol. 37:585-491. 729


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

33

74. Thomas, C. M. 2000. The Horizontal Gene Pool. Harwood Academic Publishers, 730

Amsterdam, The Netherlands. 731

75. Thao, M. L., L. Baumann, P. Baumann, and N. A. Moran. 1998. Endosymbionts 732

(Buchnera) from the aphids Schizaphis graminum and Diuraphis noxia have different copy 733

numbers of the plasmid containing the leucine biosynthetic genes. Current Microbiol. 36:238-734

240. 735

76. Weinert, L. A., J. H. Werren, A. Aebi, G. N. Stone, and F. M. Jiggins. 2009. Evolution 736

and diversity of Rickettsia bacteria. BMC Biology. 7:6. doi:10.1186/1741-7007-7-6. 737

77. Weinert, L. A., J. J. Welch, and F. M. Higgins. 2009. Conjugation genes are common 738

throughout the genus Rickettsia and are transmitted horizontally. Proc. R. Soc. B 276:3619-3627. 739

78. Weller, S. J., G. D. Baldridge, U. G. Munderloh, H. Noda, J. Simser, and T. J. Kurtti. 740

1998. Phylogenetic placement of rickettsiae from the ticks Amblyomma americanum and Ixodes 741

scapularis. J. Clin. Microbiol. 36:1305-1317. 742

79. Whitman, T. J., A. L. Richards, C. D. Paddock, C. L. Tamminga, P. J. Sniezek, J. Jiang, 743

D. K. Byers, and J. W. Sanders. 2007. Rickettsia parkeri infection after tick bite, Virginia. 744

Emerg. Infec. Dis. 13:334-336. 745

746


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

34

FIGURE LEGENDS 747

748

Fig. 1. Presence of plasmids in R. rhipicephali from S. America and REIS from N. America. (A) 749

PFGE of DNA from REIS isolate Camp Ripley, R. rhipicephali isolate HJ#5 and R. monacensis 750

isolate IrR/Munich. Relative migration positions of rickettsial chromosomal (C), ISE6 host cell 751

mitochondrial (M), and prominent rickettsial plasmid (P) DNAs are indicated at right. Migration 752

positions of 25, 50 and 100 kbp linear DNA markers are indicated at left. Panels B, C and D: 753

Southern blots of replicate gels hybridized with pRM16, pRM6 and pRM8 gene probes, 754

respectively. Band identities (right) and migration positions of marker DNAs (left). 755

756

Fig. 2. Presence of plasmids in R. akari and R. amblyommii isolates and absence of plasmids in 757

R. parkeri isolates from N. America. (A) PFGE of DNA from R. akari isolate Bronx, R. parkeri 758

isolates Ft. Story, Portsmouth and Tates Hell and R. amblyommii isolate Darkwater. Panels B, C, 759

and D: Southern blots of replicate gels hybridized with pRM16, pRM6 and pRM8 gene probes. 760

Band identities (right) and migration positions of marker DNAs (left) as in Fig. 1. 761

762

Fig. 3. Presence and absence of plasmids in South American isolates of R. amblyommii and R. 763

parkeri, respectively. (A) PFGE of DNA from R. amblyommii isolates An13 and Ac37 and R. 764

parkeri isolates At#24 and At#5. Panels B, C and D: Southern blots of replicate gels hybridized 765

with pRM16, pRM6 and pRM8 gene probes, respectively. Band identities (right) and migration 766

positions of marker DNAs (left) are as in Fig. 1. 767

768


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

35

Fig. 4. Presence of plasmids in S. American isolates of R. bellii. (A) PFGE of DNA from R. 769

bellii isolates ovale, Ad25, An4, Mogi and HJ#7 (S. America) and RML 369-C (N. America). 770

(B) Southern blot of same gel hybridized with the pRM16 gene probe. Panels C, D and E: 771

Southern blots of replicate gels hybridized with pRM6, pRM8 and pRM12 gene probes, 772

respectively. Band identities (right) and migration positions of marker DNAs (left) as in Fig. 1. 773

774

Fig. 5. A probe derived from the R. monacensis pRM23 gene encoding a homolog of a 775

Burkholderia thailandensis transposon resolvase gene hybridizes to plasmids of three Rickettsia 776

spp. (A) PFGE of DNA from R. monacensis IrR/Munich, R. akari Bronx, REIS and R. 777

rhipicephali HJ#5. (B) Southern blot of same gel hybridized with the pRM23 probe. Band 778

identities (right) and migration positions of marker DNAs (left) as in Fig. 1. 779

780

Fig. 6. Maximum parsimony phylogenetic tree (unrooted) of rickettsial ParA proteins. Scale bars 781

indicate number amino acid changes within branch lengths. Bootstrap scores indicated by 782

numerals. GenBank Accession numbers: plasmid-encoded ParA sequences were pRAM18 783

(GU322808), pRAM23 (GU322807), pRAF (YP_002845772), pREIS1, 2, 3 and 4 (EER20867, 784

EER20809, EER20748, and NZ_GG688316 – translated nucleotides 10818 to 11573), pRF 785

(YP_247439), pRM (YP_001967398), pRMA (YP_001497196), pRPR (YP_002921997), cp32 786

(AAL60459), pPSR1 (NP_940697), pWes-1 (YP_002332254), pYptb32953 (YP_068544), 787

pMATVIM7 (YP_001427366), 153 kb plasmid (YP_001393406). Trichoplax adhaerens contig: 788

(EDV19036). Chromosome-encoded ParA sequences were: E. chaffeensis (ABD44691), R. 789

africae (YP_002844799), R. bellii (YP_538520), R. canadensis (YP_001491792), R. felis 790

(YP_246133), I. scapularis endosymbiont (ZP_04698724), R. massiliae (YP_001498948), 791


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

36

R. peacockii (ACR47329), R. typhi (YP_067042). 792

793

Fig. 7. Maximum parsimony phylogenetic tree (unrooted) of rickettsial small heat shock 794

proteins. Scale bars indicate number amino acid changes within branch lengths. Bootstrap scores 795

indicated by numerals. GenBank Accession numbers: plasmid-encoded or *PCR-amplified 796

plasmid-encoded Hsp sequences were pRAM23 (GU322807), pRB* (GU180086), pRF 797

(YP_247467 and YP_170678), pRHE* (GU180087), pRHO* (GU180088), pRIS 798

(NZ_CM000771), pRM (YP_001967388 and YP_001967389), pRPR (YP_002922008 and 799

YP_002922009); chromosome-encoded Hsp sequences were R. africae (ZP_02336191), R. akari 800

(YP_001493212), R. bellii (YP_538007), R. canadensis (YP_001492044), R. conorii 801

(NP_360000), R. felis (YP_247020 and YP_247021), R. massiliae (YP_001499170), R. 802

peacockii (YP_002916350), R. prowazekii (NP_220658), R. rickettsii (YP_001494483), R. 803

siberica (ZP_00142181), R. typhi (YP_067227), B. thailandensis (ZP_02384335), Francisella 804

tularensis (YP_170678), L. pneumophila (YP_096204), T. adhaerens (XP_002118475), and W. 805

pipientis (YP_001975380). 806

807

808

809

810

811


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Table 1. Origins and passage histories of Rickettsia species evaluated for plasmids and plasmid copy number.

Rickettsia sp. Isolate Source Geographic origin Year of isolation Passage history1

Reference(s)

R. akari Bronx human New York 2002 5 (E6) 51

“R. amblyommii” AaR/SC Amblyomma. americanum South Carolina 1999 6 (ISE6)2

T.J. Kurtti, unpubl.

Ac/Pa Amblyomma cajennense Panama 2007 2 (ISE6)2 U.G. Munderloh, unpubl

Ac37 A. cajennense Brazil 2004 5 (E6) 2 (ISE6) 32

An13 Amblyomma neumanni Argentina 2007 7 (E6), 2(ISE6) 33

Darkwater A. americanum Florida 2006 5 (E6) C.D. Paddock, unpubl.

R. bellii RML 369-C Dermacentor variabilis Arkansas 1966 uncertain, 2 (ISE6) E.J. Bell, unpubl, 53

An4 Amblyomma neumanni Argentina 2007 5 (E6), 4 (ISE6) 33

HJ#7 Haemaphysalis juxtakochi Brazil 2007 8 (E6), 2 (ISE6) 34

Ad25 Amblyomma dubitatum Brazil 2007 3 (E6), 2 (ISE6) 48

Ovale Amblyomma ovale Brazil 2007 3 (E6), 2 (ISE6) 47

Mogi Amblyomma aureolatum Brazil 2006 11 (E6), 2 (ISE6) 57

R. felis LSU Ctenocephalides felis Louisiana 2006 9 (ISE6)2 59

R. helvetica C9P9 Ixodes ricinus Switzerland 1993 uncertain, 14 (ISE6) 8

R. hoogstraalii RCCE3 Carios capensis Georgia 2007 37 (CCE5)2, 12 (ISE18) 38

R. monacensis IrR/Munich I. ricinus Germany 2002 18 - 29 (ISE6)2 65

R. parkeri Portsmouth human Virginia 2002 8 (E6) 50

Ft. Story human Virginia 2006 5 (E6) 52


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Tate’s Hell Amblyomma maculatum Florida 2005 4 (E6) 53

High Bluff A. maculatum Florida 2007 3 (E6) 53

Grand Bay A. maculatum Mississippi 2007 3 (E6) 53

Oktibbeha A. maculatum Mississippi 2007 6 (E6) 53

AT#5 Amblyomma triste Uruguay 2006 9 (E6), 2 (ISE6) 46

AT#24 A. triste Brazil 2007 8 (E6), 2 (ISE6) 64

R. peacockii DAE100R Dermacentor andersoni Colorado 2001 11 (DAE100)2

, 5 (ISE6) 65

R. rhipicephali HJ#5 H. juxtakochi Brazil 2007 5 (E6), 2 (ISE6) 34

REIS same Ixodes scapularis Minnesota 2008 7 (IRE11)2

T.J. Kurtti, unpubl.

1Number of passages in cultured cell lines: Vero (E6); I. scapularis embryonic (ISE6) and (ISE18); I. ricinus embryonic (IRE11); D. andersoni

embryonic (DAE100). Carios capensis (CCE5). 2Indicates cell line of Rickettsia sp. isolation if other than Vero. R. bellii 369-C was isolated in

embryonated chicken eggs.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Table 2. Species specific and general PCR amplification primers for hsp21, gltA

2 and parA

3 genes

Species Primer Acronym Sequence (5’ to 3’)

R. monacensis qHsp2F GTAAACTAATAGAGCGGGAGAAAG

qHsp2R TGAGGGCAAAAATGAACAATC

R. peacockii Rpeac qHsp2F GATGGTAAACTAATAGAACGG

Rpeac qHsp2R GAATTACCAGGCATTACACAAG

R. amblyommii AcPa qHsp2F1 GTAAACTAATAGAGCGAGCAAAAG

AcPa qHsp2R1 TGAGGGCAAAAAGGAACAATC

AcPa qCSR TCGTACATTTCTTTCCATTGTGC

R. hoogstraalii Rhoogs qHsp2F1 GATGGTAAACTAATGGATCGC

RhoogsqHsp2R TGAGGGCAAAAATGAACAATC

R. helvetica Rhelv qHsp2F1 TTAGATGGTAAACTAATAGATCGC

RhelvqHsp2R TGAGGGCAAAAATGAACAATC

R. felis Rfelis qHsp2F1 GTAAACTAATGGAGCGAGAGAAAG

Rfelis qHsp2R1 TGATGGTAAAAAGGAACAATCGAC

Rfelis qCSF GTCGCAAATGTTTACGGTACTTT

Rfelis qCSR TCGTGCATTTCTTTCCACTGT

R. bellii Rbellii qHsp2F1 ACTTATGGAACGGTAGAAAGAGCC

Rbellii qHsp2R1 GGAACTTCCAGGTGTAATACAAGA

Rbellii qCSF TCATGCATCTCTTTCCATTGTGC

Rbellii qCSR CCGCAGATGTTCACAGTGCTTT

general Hsp2F AAACTAATAGAGCGGGAGAAAGAACC

Hsp2R AGGCAAAGGCGAGAGAAATACC

Hsp2F3 CTTAGCCTTACTTTGTTCTTTTTTAGG

Hsp2R3 CTTTTAATTTATCACGTATTAGAAATAAATCAG

CS877F GGGGACCTGCTCACGGCGG

CS1273R CATAACCAGTGTAAAGCTG

REIS pREIS1F TATGCATTATGTGTGTTATCATTGTGA

pREIS1R GTTTCAATAGATGATATGGCAAAGC

pREIS2F CGCTATCCTACAAACAACCAATAAC

pREIS2R GCATCTAGTTGTCTTAAACGAAAGG

pREIS3F TCCTGATGCAGAACTAATACGATTT

pREIS3R TGTGTCATATGTGTAATGTCAAATCG

pREIS4F ATAGCATAAGTTTAATGGTGTAACTTCG

pREISrR TCTAACTGCTCAGCATTCACTACAAA 1

Primer acronyms beginning with lower case q were used only for quantitative PCR estimations of plasmid copy

number; 2 gltA genes were amplified with the CS877F/CS1273R general primer pair except as noted.

3 Only parA genes of REIS were PCR-amplified.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Table 3. Southern blot detection of pRM gene homologs on plasmids of New World Rickettsia isolates.

pRM R. akari R. amblyommii R. bellii R. rhipicephali REIS

genea Bronx An13 Ac37 Dark

b Ad25 An4 HJ#37 Mogi ovale HJ#5 Camp Ripley

pRM6 - + + + + + + + - + +

pRM8 - + + + + - + +

+ - -

pRM12 - - - - + - + + - -

+

pRM16 + + + + + + + + + + +

pRM23 + - - - - - - - - + +

aThe R. monacensis pRM plasmid genes encode respectively, from top to bottom, a small heat shock

protein, a RecD/TraA protein, a proline betaine membrane transporter, a DnaA-like replication

initiator and a transposon resolvase (6). b isolate Darkwater.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Table 4. Plasmid Copy Numbers in Selected Rickettsia spp.

Species (isolate) copy numbera SD

b

R. helvetica (C9P9) 2.4 0.3

R. monacensis (IrR/Munich) 2.7 0.3

R. amblyommii (Ac/Pa) 3.5 0.1

R. hoogstraalii (RCCE3) 5.5 1.1

R. bellii (An4) 4.3 0.4

R. felis (LSU) 5.9 0.5

R. peacockii ( DAE100R) 9.2 1. 9

aratio of hsp2 to gltA gene number expressed as means of

three experiments of three replicates each. bstandard deviation.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Running Title: Rickettsial plasmids · 22 Minnesota, 1980 Folwell Ave., St. Paul, MN 55108. Phone:...

Documents

Transcript of Running Title: Rickettsial plasmids · 22 Minnesota, 1980 Folwell Ave., St. Paul, MN 55108. Phone:...