Running head: Roles of PSK in TE differentiation Corresponding
Transcript of Running head: Roles of PSK in TE differentiation Corresponding
![Page 1: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/1.jpg)
Running head: Roles of PSK in TE differentiation
Corresponding author:
Dr. Hiroyasu Motose
Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo,
Komaba 3-8-1, Meguro-ku, Tokyo 153-8902, Japan
TEL: +1-81-5454-6729
e-mail: [email protected]
Research area: Development and Hormone Action
Plant Physiology Preview. Published on March 6, 2009, as DOI:10.1104/pp.109.135954
Copyright 2009 by the American Society of Plant Biologists
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 2: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/2.jpg)
Involvement of Phytosulfokine in the Attenuation of Stress Response during the
Transdifferentiation of Zinnia Mesophyll Cells into Tracheary Elements1[w]
Hiroyasu Motose*, Kuninori Iwamoto, Satoshi Endo, Taku Demura, Youji Sakagami,
Yoshikatsu Matsubayashi, Kevin L. Moore, and Hiroo Fukuda
Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo,
Komaba 3-8-1, Meguro-ku, Tokyo 153-8902, Japan (H. M.); Department of Biological Sciences,
Graduate School of Science, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-0033,
Japan (K. I., S. E., H. F.); Plant Science Center, RIKEN, Suehiro 1-7-22, Tsurumi-ku, Yokohama,
Kanagawa 230-0045, Japan (T. D.); Graduate School of Bio-agricultural Sciences, Nagoya
University, Chikusa, Nagoya 464-8601, Japan (Y. S., Y. M); Cardiovascular Biology Research
Program, Oklahoma Medical Research Foundation and the Departments of Cell Biology and
Medicine, University of Oklahoma Health Science Center, Oklahoma City, Oklahoma 73104, USA
(K. L. M.)
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 3: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/3.jpg)
Footnotes: 1This work was supported by Grants-in-Aid from the Ministry of Education, Sports, Culture,
Science, and Technology, Japan (grant no. 18770028 and 20770028 to H. M. and grant no.
19060009 and 70342863 to H. F.), the Japan Society for the Promotion of Science (grant no.
20247003 to H. F.), the Asahi Glass Foundation, the Sumitomo Foundation, and Program of Basic
Research Activities for Innovative Biosciences from BRAIN, and by National Institutes of Health
(NIH) Grant HD056022 to K.L.M.
* Corresponding author: Hiroyasu Motose, [email protected], +81-3-5454-6729
The author responsible for distribution of materials integral to the findings presented in this
article in accordance with the policy described in the Instructions for Authors
(www.plantphysiol.org) is: Hiroyasu Motose ([email protected]). [w] The online version of this article contains Web-only data.
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 4: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/4.jpg)
Phytosulfokine (PSK) is a sulfated peptide hormone required for the proliferation and
differentiation of plant cells. Here, we characterize physiological roles of PSK in
transdifferentiation of isolated mesophyll cells of zinnia (Zinnia elegans L. cv Canary Bird) into
tracheary elements (TEs). Transcripts for a zinnia PSK precursor gene, ZePSK1, show two-peaks
of expression during TE differentiation; the first accumulation is transiently induced in response to
wounding at the 24th h of culture, and the second accumulation is induced in the final stage of TE
differentiation and is dependent on endogenous brassinosteroids. Chlorate, a potent inhibitor of
peptide sulfation, is successfully applied as an inhibitor of PSK action. Chlorate significantly
suppresses TE differentiation. The chlorate-induced suppression of TE differentiation is overcome
by exogenously applied PSK. In the presence of chlorate, expression of stress-related genes for
proteinase inhibitors and a pathogenesis-related protein is enhanced and changed from transient to
continuous pattern. On the contrary, administration of PSK significantly reduces accumulation of
transcripts for the stress-related genes. Even in the absence of auxin and cytokinin, addition of
PSK suppresses stress-related gene expression. Microarray analysis reveals 66 genes
downregulated and 42 genes upregulated under the presence of PSK. The large majority of
downregulated genes show significant similarity to various families of stress-related proteins,
including chitinases, phenylpropanoid-biosynthesis enzymes, ACC synthase, and receptor-like
protein kinases. These results implicate involvement of PSK in the attenuation of stress response
and healing of wound-activated cells during the early stage of TE differentiation.
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 5: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/5.jpg)
Intercellular communication is indispensable to coordinate cellular behaviors of multicellular
organisms during morphogenesis and responses to environmental stimuli. In animals, many
peptide signals play important roles in cell-cell interactions. In contrast, plant cell-cell interactions
have been thought to be mediated mainly by non-peptide small organic compounds, such as abscisic
acid, auxin, brassinosteroids, cytokinin, ethylene, gibberellic acid, jasmonate, and salicylic acid.
Recently, several peptides and glycopeptides have been found as a new class of plant signaling
molecules during defense response (Pearce et al., 1991; 2001a; 2001b; Pearce and Ryan, 2003), cell
proliferation and expansion (Matsubayashi and Sakagami, 1996; Amano et al., 2007), meristem
formation (Fletcher et al., 1999; Fiers et al., 2005; Kondo et al., 2006; Kinoshita et al., 2007), stem
cell fate (Ito et al., 2006), xylem differentiation (Motose et al., 2001b; Motose et al., 2004), stomatal
development (Hara et al., 2007), and self-incompatibility (Schopfer et al., 1999; Takayama et al.,
2000). Some of these signaling peptides have been shown to interact with specific receptor-like
protein kinases (RLKs) and activate intracellular signaling cascades (reviewed in Matsubayashi,
2003; Fukuda et al., 2007).
Plant cells cultured at cell densities less than a critical value (typically 1.0 x 104 cells mL-1)
cannot proliferate despite the administration of any classical phytohormones and defined nutrients.
Addition of conditioned medium prepared from rapidly growing cell cultures stimulated
proliferation of cells cultured at low densities (Stuart and Street, 1969). This phenomenon
indicates that the conditioned medium contains secretory growth factor(s) essential for cell
proliferation. Matsubayashi and Sakagami (1996) isolated a disulfated pentapeptide named
phytosulfokine (PSK; Tyr(SO3H)-Ile-Tyr(SO3H)-Thr-Gln) as a potent mitogenic factor from
conditioned medium derived from cultures of asparagus mesophyll cells. PSK was also discovered
from suspension cultures of rice, maize, and carrot, and stimulated somatic embryogenesis as well
as cell proliferation (Matsubayashi et al., 1997; Kobayashi et al., 1999; Hanai et al., 2000a).
Identification of genes encoding ~80-aa precursors of PSK from various plant species revealed that
each preproprotein of PSK has a secretory signal sequence at N-terminal and a PSK sequence near
C-terminal flanked by dibasic amino acid residues, implying proteolytic processing similar to that
of animal peptide hormones (Yang et al., 1999; 2001; Lorbiecke and Sauter, 2002; Igasaki et al.,
2003). Tyrosine O-sulfation of PSK precursor, which is catalyzed by tyrosylprotein
sulfotransferase in Golgi apparatus (Hanai et al., 2000b), is essential for the biological activities of
PSK (Matsubayashi et al., 1996). After the processing and secretion, PSK binds to the leucine rich
repeat-receptor like kinase (LRR-RLK) on the plasma membranes (Matsubayashi et al., 2002).
Recent extensive analysis of Arabidopsis PSK receptor AtPSKR1 clearly indicates that PSK
promotes cellular longevity and potential for growth (Matsubayashi et al., 2006).
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 6: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/6.jpg)
Isolated zinnia mesophyll cells transdifferentiate into tracheary elements (TEs) in the presence of
auxin and cytokinin, providing a useful model system for plant cell transdifferentiation (reviewed in
Fukuda, 2004; Roberts and McCann, 2000). TE transdifferentiation was suppressed when zinnia
mesophyll cells were cultured at low cell densities less than 1.0 × 104 cells mL-1 (Fukuda and
Komamine, 1980; Matsubayashi et al., 1999; Motose et al., 2001a). This suppression was restored
by the administration of PSK or conditioned medium derived form the zinnia xylogenic culture,
which contained considerable amount of PSK (Matsubayashi et al., 1999), indicating the
requirement of endogenous PSK for TE differentiation. Therefore, real physiological functions of
PSK might be uncovered by studying the causal relationship between TE differentiation and PSK in
the zinnia xylogenic culture. For this purpose, we here characterized the expression of a zinnia
PSK gene and investigated effects of PSK on gene expressions using a microarray and a PSK
inhibitor.
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 7: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/7.jpg)
RESULTS
Expression Pattern of ZePSK1
We cloned a zinnia gene encoding a putative PSK precursor and analyzed its expression pattern
in zinnia xylogenic culture. Isolation of zinnia cDNA for PSK was carried out by 3’-RACE
followed by 5’-RACE. The resulting cDNA fragments were sequenced and determined to cover
an open reading frame (ORF) for 75 amino acid residues (Fig. 1A, accession number AB089283).
The gene represented by this cDNA is designated ZePSK1 (Zinnia elegans PSK1). ZePSK1
belongs to a PSK gene family including OsPSK and AtPSK (Fig. 1B), which were experimentally
confirmed to encode PSK precursor (Yang et al., 1999; 2001, Matsubayashi et al., 2006). The
deduced amino acid sequence contained a N-terminal signal sequence and the pentapeptide
backbone of PSK (YIYTQ) near the C-terminal of ORF (Fig. 1A). The Asp residue, which was
indispensable for Tyr O-sulfation of PSK (Hanai et al., 2000b), was conserved immediately
N-terminal of the PSK sequence. Two Arg (amino acids 58-59) and two Lys (amino acids 72-73)
were found to border the PSK sequence, suggesting proteolytic processing of this precursor as in the
case of animal prohormone precursors. The signature motif
Cx(4-9)[E/D/Q]xCx(2)RRx(3-4)AH[T/L/V]DYIYTQ derived from comparisons of 36 PSK genes
(Lorbiecke and Sauter, 2002) were also conserved (Fig. 1B).
Reverse-transcript (RT)-PCR analysis was carried out to detect ZePSK1 transcripts (Fig. 1C to
1F) because transcripts for ZePSK1 could not be detected with RNA gel blot analysis. There are
two peaks of the accumulation of ZePSK1 transcripts in cells cultured in TE-inductive medium
containing 0.1 µg L-1 1-naphthaleneacetic acid (NAA) and 0.2 µg L-1 6-benzyladenine� �BA� (D
medium); first peak at the 24th h and second peak at 72nd h of culture (Fig. 1C). Effects of auxin
and cytokinin on the expression of ZePSK1 were analyzed for cells cultured in media with different
combinations of phytohormones; hormone-free medium (C0), medium containing only 0.1 µg L-1
NAA (CN), medium containing only 0.2 µg L-1 BA (CB), and medium containing 0.1 µg L-1 NAA
and 0.001 µg L-1 BA (CP). Cells cultured in C0, CN, and CB medium did not differentiate into TEs,
and those in CP medium differentiated rarely into TEs. The transcripts for ZePSK1 accumulated
even in these control cultures, although they did not accumulate significantly at 72 h in cells
cultured in C0 and CB media (Fig. 1C, D).
Because the transient accumulation of the ZePSK1 transcripts at 24 h was not affected by
phytohormones, the effect of wounding on the accumulation was examined. When zinnia first true
leaves were cut into small pieces and incubated on the hormone free C0 medium, the expression of
ZePSK1 was induced at the 12th and 24th h after wounding (Fig. 1E). This result suggests that the
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 8: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/8.jpg)
early increase in the ZePSK1 transcripts is due to wound stimuli.
Endogenous brassinosteroids are essential for TE transdifferentiation of zinnia mesophyll cells
(Iwasaki and Shibaoka, 1991) and in particular, for the entry into the final stage of TE
differentiation, which usually occurs between 48 h and 72 h of culture (Yamamoto et al., 1997;
2001). To investigate whether brassinosteroids were required for the expression of ZePSK1 or not,
we analyzed the effect of uniconazole, which inhibits brassinosteroid biosynthesis, and brassinolide,
a biologically active brassinosteroid, on the expression of ZePSK1 (Fig. 1F). Uniconazole is also
known to inhibit gibberellin biosynthesis, but in zinnia xylogenic culture, it is confirmed that
brassinosteroids overcome uniconazole-induced suppression of TE differentiation while gibberellin
could not (Iwasaki and Shibaoka, 1991). The accumulation of the ZePSK1 transcripts was
suppressed at the 60th and 72nd h of culture by the administration of uniconazole at the start of
culture and this suppression was fully reversed by the exogenously supplied brassinolide (Fig. 1F).
This result suggested that biosynthesis of brassinosteriods is required for the induction of ZePSK1
during the late stage of TE differentiation.
Chlorate as An Inhibitor of PSK
Inhibitors of PSK should be useful to analyze the function of PSK. However specific inhibitors
of PSK have not yet been described. Therefore, we applied chlorate, a potent inhibitor of peptide
sulfation in animal cells (Baeuerle and Huttner, 1986), to suppress Tyr O-sulfation of PSK precursor,
that is indispensable for the biological activities of PSK and the binding of PSK to PSK receptor
(Matsubayashi et al., 1996; 1997; 2002; Matsubayashi and Sakagami, 1999; 2000). Chlorate
added at concentrations of more than 2 mM suppressed TE differentiation completely (Fig. 2B, D)
and cell division strongly (Fig. 2E). Administration of PSK at the concentrations above 1.0 × 10-8
M restored the chlorate-dependent inhibition of TE differentiation (Fig. 2C, F), but not cell division
(Fig. 2G). These results suggested that chlorate would be useful for analyzing roles of PSK in TE
differentiation, apart from its roles in cell division.
To investigate effect of chlorate on the tyrosine sulfation of PSK, PSK was purified from cell
suspensions cultured with or without chlorate and was subjected to immunodot blot assay using an
anti-sulfotyrosine monoclonal antibody called PSG2 (Hoffhines et al., 2006). The PSG2 binding
was significantly decreased in PSK fraction derived from culture treated with chlorate (Fig. 3),
suggesting that chlorate inhibits tyrosine sulfation of PSK in zinnia xylogenic culture.
Stage-Dependent PSK Functions
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 9: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/9.jpg)
The process of TE transdifferentiation of zinnia mesophyll cells is divided into three stages
(Fukuda, 1997): stage 1 (first 24 hour), during which mesophyll cells dedifferentiate to become
pluricompetent cells; stage 2 (next 24 hour), during which dedifferentiated cells restrict their
potency of differentiation to become the precursors of TEs via procambial cells; stage 3 (final 24-48
hour), during which TE precursors form secondary cell wall and execute programmed cell death.
Based on this categorization, we investigated stage-dependent PSK functions.
First, we characterized changes in responsiveness of cells to PSK with chlorate. Chlorate was
added at the start of culture and PSK was added at various times thereafter (Fig. 4A). PSK, when
added to the culture within the 24th h of culture, most effectively reversed the chlorate-induced
inhibition of TE differentiation, and thereafter the reversal effect of PSK decreased with time.
Similarly, we examined time of requirement for PSK in low cell density culture (5.0 × 103 cells
mL-1) (Fig. 4B). PSK was most effective in inducing TE differentiation when PSK was added at
the start of culture or at the 12th h of culture. TE differentiation was severely suppressed when
mesophyll cells were cultured for 36 h without exogenously supplied PSK. These results imply
that PSK is required for TE differentiation before the 24th h of culture.
Second, we investigated effects of PSK and chlorate on the accumulation of mRNAs for various
stage marker genes (Yamamoto et al., 1997; Demura et al., 2002). Transcripts for marker genes of
stage 1, ZePR (Zinnia elegans pathogenesis related protein), ZePI1 (Zinnia elegans proteinase
inhibitor 1), and ZePI2 (Zinnia elegans proteinase inhibitor 2) accumulated transiently between 12
and 36 h of culture (Fig. 5). In the presence of chlorate, ZePR, ZePI1, and ZePI2 continuously
accumulated at high level. On the contrary, administration of PSK suppressed the accumulations
of the ZePR, ZePI1, and ZePI2 transcripts. Accumulation of the ZePAL3 mRNA peaked at 24 h
and 72 h of culture (Fig. 5). Chlorate enhanced the accumulation of the ZePAL3 transcripts, which
was similar to that of the ZePR, ZePI1, and ZePI2 transcripts. Addition of PSK suppressed the
first peak of accumulation of the ZePAL3 transcripts but did not the second peak. These results
indicate that stress-related gene expression is suppressed preferentially in the presence of PSK.
This suppression occurred in the absence of auxin and cytokinin (Fig. 6A), suggesting that auxin
and cytokinin is not required for the suppression of stress response by PSK. The suppressive
effect was a little weaker in cultures with only auxin or only cytokinin than in culture with both
phytohormones or hormone-free culture (Fig. 6A). Besides the suppressive effect of PSK on stress
response, PSK also promoted TE differentiation in the presence of auxin and cytokinin (Fig. 6B),
suggesting that PSK stimulates TE differentiation via the suppression of stress response.
Chlorate treatment delayed the appearance of transcripts for stage 2 marker genes for 24 h,
including transcripts for TED3 (TE differentiation 3) and TED4 (TE differentiation 4) (Fig. 5).
However, it did not significantly affect peak transcript levels for these two genes. The
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 10: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/10.jpg)
chlorate-induced delay was reversed by exogenously supplied PSK. In contrast, chlorate almost
completely suppressed the accumulation of the ZCP4 mRNA, a stage 3 marker, and PSK restored
the chlorate-induced suppression.
Microarray Analysis
To study PSK function in detail, large-scale expression analysis was performed with zinnia
microarrays consisting of ~9000 genes (Demura et al., 2002). The cDNA populations for
hybridizations to the microarray were prepared from freshly isolated zinnia mesophyll cells
(indicated as 0 h cells) and cells cultured for 24 h in four different culture conditions; D medium
without PSK nor chlorate (indicated as Mock), with 1.0 x 10-7 M PSK (indicated as PSK), with 2
mM chlorate (indicated as KClO3), or with 2 mM chlorate and 1.0 x 10-7 M PSK (indicated as
KClO3 + PSK). Gene expression profiles were compared between Mock-treated and PSK-treated
cells and between chlorate-treated and chlorate+PSK-treated cells, and genes were identified as
being differentially expressed if the signal values deviated either positively or negatively two-fold
or more in both sets in two or three independent microarray experiments (Fig. 7).
As a result, transcript levels of 66 genes and 42 genes were downregulated and upregulated in the
presence of PSK, respectively (Fig. 7, Table S1, and Table S2). Expression patterns of these genes
were compared with the previous comprehensive microarray data on changes in transcript
accumulation during TE differentiation (Demura et al., 2002). Of the 66 genes downregulated by
PSK, 46 genes (46/66 = 69.7%) were clustered into group C, which mainly included genes induced
at stage 1 with a peak at the 24th h of culture (Fig. 7, Table S1). Functionally, 21 (21/66 = 31.8%)
of the 66 genes were classified as genes encoding stress-related proteins, including four putative
chitinases (Z1809, Z2220, Z2326, Z7553), seven enzymes involved in biosynthesis of
phenylpropanoids (Z293, Z7345, ZePAL6, Z5823, Z8452, Z8712, Z9331), a putative laccase
involved in the polymerization of lignin monomers (Z8815), three redox-related enzymes (Z5164,
Z7351, ZeGSAT), ACC synthase (Z1862), and defense-response genes (Z1987, Z5204, ZePR,
ZePI1, and ZePI2) (Table S1).
Seven cDNAs downregulated by PSK exhibited high degree of sequence similarities to putative
RLKs, which were classified to three different subfamilies; LRR-RLKs (Z1175, Z7149, Z8544,
Z8757), wall-associated kinase (Z6194), and S-locus RLK (Z2332). Of these genes, Z8544,
closely resembled rice LRR-RLK Xa21 involved in the disease resistance to Xanthomonas oryzae
pv. oryzae (Song et al., 1995). Z8757 showed a high degree of homology with the carrot PSK
receptor kinase DcPSKR (Matsubayashi et al., 2002). Zinnia microarray contained three cDNAs
(Z4541, Z8757, Z9214) with significant similarities to the PSK receptor kinase, of which Z8757
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 11: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/11.jpg)
was most preferentially expressed in zinnia xylogenic culture and potently downregulated by
exogenously supplied PSK. These data suggest that suppression of RLKs is involved in the
downregulation of stress response and negative feedback regulation of PSK signaling.
Genes downregulated by PSK also included genes involved in various cytological processes;
transcription (ZeHB8), transport (Z2631, Z3438, Z4657, Z6170, Z6277, Z7460), protein destination
(Z1947, Z2804, Z2715, Z5307, Z9251), cell wall metabolism and function (Z4367, Z6105, Z8790),
and lipid metabolism (Z1733, Z3304, Z3892).
Of the 42 genes upregulated in the presence of PSK, 31 genes (31/42 = 73.8%) belonged to group
A categorized by Demura et al. (2002) (Fig. 7, Table S2), of which mRNA levels were high in
freshly isolated cells (0 h cells) and decreased rapidly after the 24th h of culture. Of these 31
genes, 20 genes encoded proteins related to various chloroplast (plastid) functions including
photosynthesis, chlorophyll synthesis, carbon fixation and chloroplast protein synthesis. This
result suggests that PSK maintains chloroplast activity, which is related to the previous reports
showing promotion of chlorophyll content by PSK (Yamakawa et al., 1998; 1999). PSK also
promoted accumulation of transcripts for genes encoding nitrite transporters (Z144 and Z7443),
acid phosphatases (Z8691 and Z8692), receptor-like protein kinase (Z4539), signal recognition
particle subunit (Z6904), and glycosyl hydrolase (Z6245).
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 12: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/12.jpg)
Discussion
Chlorate as an inhibitor of PSK
We chose chlorate as an inhibitor of PSK because Tyr O-sulfation of PSK is essential for its
biological activity (Matsubayashi et al., 1996) and chlorate have been widely used as a potent
inhibitor of peptide sulfation in animal cells (Baeuerle and Huttner, 1986; Beinfeld, 1994; Maiti et
al., 1998; Farzan et al., 1999). In this study, we showed that chlorate completely inhibited TE
differentiation of zinnia mesophyll cells (Fig. 2) and suppressed tyrosine sulfation of PSK (Fig. 3).
The chlorate-induced inhibition of TE differentiation was recovered by exogenously supplied PSK
(Fig. 2). This reversal effect is specific for PSK since other phytohormones had no effect on the
suppression of TE differentiation by chlorate (Table S3). These results suggest that chlorate
inhibits tyrosine sulfation of PSK resulting in the suppression of TE differentiation. Chlorate
provides an advantage to investigate the roles of PSK. It is difficult to prepare enough amounts of
RNA for analysis from cultures at low cell densities, which have been used for highly sensitive
bioassay for PSK (Matsubayashi and Sakagami, 1996; Matsubayashi et al., 1999). Because
chlorate is effective for cells cultured at high cell densities, we can easily prepare RNA from
cultures in which active PSK is depleted by chlorate-treatment.
Chlorate is an inhibitor of ATP-sulfurylase, which catalyzes the synthesis of 5’-adenylylsulfate
from ATP and inorganic sulfate (Ulrich and Huber, 2001). 5’-adenylylsulfate was utilized for the
biosynthesis of Cys and 3’-phosphoadenosine-5'-phosphosulfate, a donor of Tyr O-sulfation
(Leustek et al., 2000). Because Hemmi et al. (2001) reported the requirement of glutathione,
which was biosynthesized from Cys, for TE differentiation of zinnia mesophyll cells, there is a
possibility that chlorate inhibits biosynthesis of Cys and glutathione, resulting in the inhibition of
TE differentiation. Cys, reduced form of glutathione, or glutathione disulfide, however, had no
reversal effect on the chlorate-induced suppression of TE differentiation (Table S3), suggesting that
chlorate-induced inhibition of TE differentiation did not result from the inhibition of Cys and
glutathione biosynthesis.
Chlorate is an analog of nitrate and reduced to toxic chlorite by nitrate reductase (Åberg, 1947;
Solomonson and Vennesland, 1972; Nakagawa and Yamashita, 1986). Chlorate have been used as
an herbicide and applied to isolate mutants that are defective in nitrate reduction (Oostindi and
Feenstra, 1973; Braaksma and Feenstra, 1982; Willkinson and Crawford, 1991; LaBrie et al., 1992;
Tsay et al., 1993; Lin and Cheng, 1997). Therefore, the toxic chlorite produced from chlorate by
nitrate reductase might inhibit TE differentiation. However, toxic effect of chlorate seems unlikely
from the following reasons; (1) zinnia culture medium contains nitrate at a concentration of 20 mM,
which is enough for nitrate to function as a potent competitive inhibitor of chlorate reduction
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 13: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/13.jpg)
(Solomonson and Vennesland, 1972; Nakagawa and Yamashita, 1986), (2) chlorate did not affect
viability of zinna cultured cells in the presence of nitrate at concentrations of more than 20 mM (Fig.
S1), (3) chlorate added after the 12th h of culture had no effect on TE differentiation (Fig. S2).
The third observation implies that sufficient amount of 5’-adenylylsulfate may be synthesized by
ATP-sulfurylase by the 12th h of culture.
Roles of PSK in TE differentiation
It has been shown that endogenous PSK is required for transdifferentiation of zinnia mesophyll
cells into TEs (Matsubayashi et al., 1999). In the present study, we investigated functions of PSK
in TE differentiation and obtained the following results: (1) ZePSK1 transcripts accumulated in
response to wounding at the 24th h of culture, after which wound-induced genes were rapidly
downregulated (Fig. 1, Fig. 5); (2) the inhibition of active PSK biosynthesis by chlorate enhanced
expression of stress-related genes, which was significantly suppressed by exogenously supplied
PSK (Fig. 5); (3) microarray analysis identified various kinds of stress-response genes
downregulated in the presence of PSK (Table1); (4) the stress-response genes were downregulated
by the addition of PSK in the absence of auxin and cytokinin (Fig. 6). These results strongly
suggest involvement of PSK in the attenuation of stress response occurring in the early stage of TE
transdifferentiation. Although it remains to be identified which signaling pathway(s) of stress
response is downregulated, our microarray data imply that genes for phenylpropanoid biosynthesis
enzymes, chitinases, RLKs, and ACC synthase probably represent stress-response pathway
downstream of PSK. The suppression of PAL genes and an ACC synthase gene could result in the
downregulation of biosynthesis of salicyclic acid and ethylene, two potent signals mediating stress
response.
Effects of PSK and chlorate on stage-specific marker genes led to the conclusion that PSK is
required both for the entry into stage-2 and for the transition from stage-2 to stage-3. Chlorate
induced continuous stress-response gene expression, delayed stage-2 marker expression, and
suppressed stage-3 marker expression (Fig. 5). This data suggests that chlorate-treated cells are
delayed to enter into stage 2 and finally stopped before the transition from stage 2 to stage 3 with
stress response continuously activated. On the contrary, addition of PSK suppressed
stress-response genes, overcame chlorate-induced delay of stage-2 marker expression, and
recovered the suppression of stage-3 marker gene (Fig. 5). These results suggest that PSK is
essential for the progression of stage 2 and the entry into stage 3. The continuous stress response
might be incompatible with the entry into the final step of TE differentiation.
It is noteworthy that the second induction of ZePSK1 was dependent on the biosynthesis of
brassinosteroids, an essential factor for the transition from stage 2 to stage 3 (Iwasaki and Shibaoka
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 14: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/14.jpg)
1991; Yamamoto et al., 1997; 2001). Brassinosteroid-dependent induction of ZePSK1 evokes the
possibility that endogenous brassinosteroids induce biosynthesis of PSK, which acts cooperatively
with brassinosteroids during the transition from Stage 2 to Stage 3. Interestingly, expression of
three zinnia HD-Zip III Homeobox genes was induced by brassinosteroids during TE differentiation
(Ohashi-Ito et al. 2002). These transcriptional factors might function with brassinosteroids and
PSK during the entry into the final stage of TE differentiation.
PSK not only activates proliferation of cultured cells (Matsubayashi and Sakagami, 1996), but
also stimulates TE differentiation (Matsubayashi et al., 1999), somatic embryogenesis (Kobayashi
et al., 1999; Hanai et al., 2000a; Igasaki et al. 2003), and pollen germination (Chen et al., 2000).
To explain the multiple functions of PSK, Matsubayashi (2003) proposed a hypothesis that PSK
confers cellular competence to respond to signals such as auxin and cytokinin, which ultimately
determine cellular behavior. In this paper, we report that one of the downstream effects of PSK
action is the attenuation of stress response. The PSK-mediated suppression of stress response
might be a prerequisite for the acquisition of competence of redifferentiation and responsiveness to
signals such as auxin and cytokinin. As an alternative hypothesis, PSK might increase general
physiological and metabolic activity, resulting in the faster downregulation of stress response and
multifunctional effects of PSK. Detailed analysis of Arabidopsis PSK receptor AtPSKR1
indicated that PSK is required for cellular longevity and potential for growth (Matsubayashi et al.,
2006). Phenotypic analysis of triple mutant of AtPSKR1, AtPSKR2, and At1g72300, which
encodes a receptor of another tyrosine-sulfated peptide called PSY1, showed that PSK and PSY1
were involved in promotion of cellular proliferation and expansion, tissue repair after wounding,
and inhibition of premature senescence (Amano et al., 2007). Since the triple mutant of
PSK/PSY1 receptors did not exhibit any significant defect in xylem development, PSK and PSY1
might not be essential for xylem differentiation in planta. Instead, PSK may participate in tissue
repair and xylem regeneration after wounding. Our study suggests that PSK might promote the
formation of a bypass of regenerated xylem through the suppression of stress response during
vascular regeneration after wounding. Further analysis of PSK/PSY1 signaling will shed new
insight on the flexible ability of plant cells for growth and differentiation.
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 15: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/15.jpg)
MATERIALS AND METHODS
Cell Suspension Culture
Seeds of zinnia (Zinnia elegans L. cv. Canary bird) were purchased from Takii Shubyo (Kyoto,
Japan). Zinnia seedlings were grown on vermiculite at 25˚C under a daily 14-h light period. The
first true leaves of 14-day-old seedlings were used as the source material for isolation of mesophyll
cells.
Suspension culture of zinnia mesophyll cells was performed according to the procedure of
Sugiyama and Fukuda (1995). The culture medium was a slightly modified version of that
described by Fukuda and Komamine (1980). The culture medium for the induction of TE
differentiation (D medium) contained 0.1 mg L–1 NAA and 0.2 mg L–1 BA. For control
non-differentiation cultures, C0 medium that was free of NAA and BA, CB medium containing 0.2
mg L–1 BA, CN medium containing 0.1 mg L–1 NAA, and CP medium containing 0.1 mg L–1 NAA
and 0.001 mg L–1 BA was used instead of the D medium. Isolated mesophyll cells were cultured
at a density of 5.0 x 104 cells mL-1 unless otherwise stated.
TEs, divided cells, and dead cells, which are morphologically distinguishable, were counted
under a light microscope. The frequencies of TE differentiation and cell division were calculated as
the proportions of TEs and divided cells to the number of living cells, respectively. Cell viability
was calculated as the proportions of living cells and TEs to total cell number.
Culture of Leaf Pieces
Surface-sterilized first true leaves of 14-day-old seedlings were cut into small pieces with razor
blade after removing the midribs. Leaf pieces were transferred onto hormone-free C0 medium
gelled with 0.25% gellan gum in plastic dishes, and cultured in the dark at 27˚C.
PSK
PSK and unsulfated PSK were synthesized according to Matsubayashi et al. (1996).
Cloning of ZePSK1
Zinnia mesophyll cells were cultured in D medium and harvested after 24, 36, 48, 60 h in culture.
From a mixed sample of these cells, poly(A)+ RNA was prepared by use of FastTrack mRNA
Isolation Kit Ver 3.5 (Invitrogen). For 3’-RACE, first strand cDNA was reverse-transcribed from
poly(A)+ RNA with dT17-LL-BamA primer
(5’-GATTAGGATCCACTAATATCTTTTTTTTTTTTTTTTT-3’). A degenerate primer PSK-F2a
(5’-CAYACBGAYTAYATHTAYACICAR-3’) was designed for the amino acid sequence of PSK
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 16: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/16.jpg)
domain. cDNA fragments were amplified from first strand cDNA by PCR with primers, PSK-F2a
and LL-BamA. After agarose gel electrophoresis, DNA of 0.24 kbp in length was cloned into
pGEM-T-Easy vector (Promega).
On the basis of the nucleotide sequences of cDNA fragments obtained through 3’-RACE, two
reverse primers PSK-R3 (5’-CATGCATGTCTAGCTCATTATACAAC-3’) and PSK-R4
(5’-CGATAATTATCGATCATAAACGAG-3’) was designed for 5’-RACE. First strand cDNA was
synthesized from poly(A)+ RNA with PSK-R4, and subjected to dC-tailing reaction. PCR
amplification from dC-tailed cDNA was performed with two primers, PSK-R3 and polyG-AP
(5’-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3’) to yield DNA of 0.39 kbp. This
PCR product was cloned into pGEM-T-Easy vector (Promega).
RNA Gel Blot Analysis
Total RNA was isolated according to Ozeki et al. (1990). Twenty µg of total RNA was
separated by agarose gel electrophoresis and transferred to a positively charged nylon membrane
(Roche) and hybridized with digoxigenin-labelled antisense RNA probes. Hybridization signals
were visualized by the immunological method with anti-digoxigenin-AP Fab fragments (Roche)
according to the manufacturer’s instructions.
RT-PCR
Total RNA was extracted as described previously (Ozeki et al., 1990). After treatment with
RNase-free DNase I (Invitrogen), first strand cDNA was synthesized with Superscript II
(Invitrogen) according to the manufacturers’ instruction and was used as template for PCR using
primers, PSK-F0 (5’-ACACTCAACCACCACCATTT-3’) and PSK-R4, for 20 cycles. PCR
products were separated by agarose electrophoresis, transferred to a positively charged nylon
membrane (Roche) and hybridized with a digoxigenin-labelled antisense RNA probe.
Hybridization signals were visualized by the immunological method with anti-digoxigenin-AP Fab
fragments (Roche) according to the manufacturer’s instructions. As a control, 18S rRNA fragment
was amplified with 20 cycles using primers, TAGTAGGCCACTATCCTACCATCGA and
AATTCTAGAGCTAATACGTGCAACAAACCC.
Immunoblotting
Conditioned medium (200 mL) prepared from zinnia cell suspension cultures was buffered
(Tris-HCl at a final concentration of 20 mM at pH 8.0) and applied to a DEAE Sephadex column
(GE Healthcare) equilibrated with 20 mM Tris-HCl (pH 8.0). The column was washed with 3.0
ml of equilibration buffer and with 3.0 ml buffer containing 0.5 M KCl, and eluted with 1.0 ml
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 17: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/17.jpg)
buffer containing 2.0 M KCl. The eluate was desalted by dialysis (Spectra/Por MWCO, 1000),
lyophilized, and dissolved in 100 µL of water. This solution was diluted at the 5 or 25 fold and 2
µl aliquot of each diluted solution was dot-blotted on a PVDF membrane (Hybond-P, GE
Healthcare). The immunodetection of sulfotyrosine was performed with an anti-sulfotyrosine
monoclonal antibody, PSG2, as described in Hoffhines et al. (2006). The anti-sulfotyrosine
monoclonal antibody PSG2 or control IgG4λ monoclonal antibody was used as primary antibody at
50 ng mL-1 and horseradish peroxidase-conjugated anti-human IgG was used as the secondary
antibody. The antibody binding was detected using ECL Plus (GE Healthcare).
Microarray Analysis
Zinnia cDNA microarray analysis was performed according to Demura et al. (2002). In zinnia
microarray slides, PCR-amplified cDNAs were spotted twice on each slide for the reliability of
microarray analysis. Poly(A)+ RNA was isolated from fleshly isolated mesophyll cells (0 h cells)
and cells cultured for 24 h in four different culture conditions; D medium without PSK nor chlorate
(Mock), with 1.0 x 10-7 M PSK (PSK), with 2 mM chlorate (KClO3), or with 2 mM chlorate and 1.0
x 10-7 M PSK (KClO3 + PSK) using Fast Track RNA isolation kit (Invitrogen). Cy5-labelled
cDNA population was synthesized from 2 µg of poly(A)+ RNA using Super Script II (Invitrogen).
The hybridization to the microarray and scanning were performed according to Endo et al. (2002).
Microarray experiments were done in three independent RNA samples derived from three
independent cultures. Gene expression profiles were compared between Mock-treated and
PSK-treated cells and between chlorate-treated and chlorate+PSK-treated cells, and genes were
identified as being differentially expressed if the signal values deviated either positively or
negatively two-fold or more in both comparisons (Mock vs. PSK and chlorate vs. chlorate+PSK) in
two or three independent microarray experiments.
Supplemental Data
The following materials are available in the online version of this article.
Supplemental Figure S1. Effects of KNO3 on TE differentiation, cell division, and viability in
the presence of KCl, KClO3, and PSK.
Supplemental Figure S2. Changes in the responsiveness of cells to KClO3 during xylogenic
culture.
Supplemental Table S1. Summary of genes downregulated by PSK.
Supplemental Table S2. Summary of genes upregulated by PSK.
Supplemental Table S3. Effects of Cys, glutathione, and phytohormones on the inhibition by
chlorate of TE differentiation.
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 18: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/18.jpg)
ACKNOWLEDGMENTS
We are grateful to Sumitomo Chemical (Takarazuka, Hyogo, Japan) for kindly supplying
uniconazole, Dr. Ryo Yamamoto (National Institute of Crop Science, Tsukuba, Japan) for useful
advice and discussion, and Dr. Yuichiro Watanabe for encouragement.
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 19: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/19.jpg)
LITERATURE CITED
Åberg B (1947) On the mechanism of the toxic action of chlorates and some related substances
upon young wheat plants. Ann R Agric Coll Sweden 15: 37-107
Amano Y, Tsubouchi H, Shinohara H, Ogawa M, Matsubayashi Y (2007) Tyrosine-sulfated
glycopepetide involved in cellular proliferation and expansion in Arabidopsis. Proc Natl Acad Sci
USA 104: 18333-18338
Baeuerle PA and Huttner WB (1986) Chlorate – A potent inhibitor of protein sulfation in intact
cells. Biochem Biophys Res Commun 141: 870-877
Beinfeld MC (1994) Inhibition of pro-cholecystokinin (CCK) sulfation by treatment with
sodium-chlorate alters its processing and decreases cellular content and secretion of CCK-8.
Neuropeptides 26: 195-200
Braaksma FJ, Feenstra WJ (1982) Isolation and characterization of nitrate reductase-deficient
mutants of Arabidopsis thaliana. Theor Appl Genet 64: 83-90
Chen YF, Matsubayashi Y, Sakagami Y (2000) Peptide growth factor phytosulfokine-alpha
contributes to the pollen population effect. Planta 211: 752-755
Demura T, Tashiro G, Horiguchi G, Kishimoto N, Kubo M, Matsuoka N, Minami A,
Nagata-Hiwatashi M, Nakamura K, Okamura Y, Sassa N, Suzuki S, Yazaki J, Kikuchi S,
Fukuda H (2002) Visualization by comprehensive microarray analysis of gene expression
programs during transdifferentiation of mesophyll cells into xylem cells. Proc Natl Acad Sci USA
99: 15794-15799
Endo M, Matsubara H, Kokubun T, Masuko H, Takahata Y, Tsuchiya T, Fukuda H, Demura
T, Watanabe M (2002) The advantages of cDNA microarray as an effective tool for identification
of reproductive organ-specific genes in a model legume, Lotus japonicus. FEBS Lett 514: 229-237
Farzan M, Mirzabekov T, Kolchinsky P, Wyatt R, Cayabyab M, Gerard NP, Gerard C,
Sodroski J, Choe H (1999) Tyrosine sulfation of the amino terminus of CCR5 facilitates HIV-1
entry. Cell 96: 666-676
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 20: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/20.jpg)
Fiers M, Golemiec E, Xu J, Van der Geest L, Heidstra R, Stiekema W, Liu CM (2005) The
14-amino acid CLV3, CLE19, and CLE40 peptides trigger consumption of the root meristem in
Arabidopsis through a CLAVATA2-dependent pathway. Plant Cell 17: 2542-2553
Fletcher JC, Brand U, Running MP, Simon R, Meyerowitz EM (1999) Signaling of cell fate
decisions by CLAVATA3 in Arabidopsis shoot meristems. Science 283: 1911-1914
Fukuda H (1997) Tracheary element differentiation. Plant Cell 9: 1147-1156
Fukuda H (2004) Signals that control plant vascular cell differentiation. Nature Rev Mol Cell Biol
5: 379-391
Fukuda H, Hirakawa Y, Sawa S (2007) Peptide signaling in vascular development. Curr Opin
Plant Biol 10: 477-482
Fukuda H, Komamine A (1980) Establishment of an experimental system for the study of
tracheary element differentiation from a single cell isolated from the mesophyll of Zinnia elegans.
Plant Physiol 65: 57-60
Hanai H, Matsuno T, Yamamoto M, Yamamoto M, Matsubayashi Y, Kobayashi T, Kamada H,
Sakagami Y (2000a) A secreted peptide growth factor, phytosulfokine, acting as a stimulatory
factor of carrot somatic embryo formation. Plant Cell Physiol 41: 27-32
Hanai H, Nakayama D, Yang HP, Matsubayashi Y, Hirota Y, Sakagami Y (2000b) Existence of
a plant tyrosylprotein sulfotransferase: novel plant enzyme catalyzing tyrosine O-sulfation of
preprophytosulfokine variants in vitro. FEBS Lett 470: 97-101�
Hara K, Kajita R, Torii KU, Bergmann DC, Kakimoto T (2007) The secretory peptide gene
EPF1 enforces the stomatal one-cell-spacing rule. Genes Dev 21: 1720-1725
Henmi K, Tsuboi S, Demura T, Fukuda H, Iwabuchi M, Ogawa K (2001) A possible role of
glutathione and glutathione disulfide in tracheary element differentiation in the cultured mesophyll
cells of Zinnia elegans. Plant Cell Physiol 42: 673-676
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 21: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/21.jpg)
Hoffhines AJ, Damoc E, Bridges KG, Leary JA, Moore KL (2006) Detection and purification of
tyrosine-sulfated proteins using a novel anti-sulfotyrosine monoclonal antibody. J Biol Chem 281:
37877-37887
Igasaki T, Akashi N, Ujino-Ihara T, Matsubayashi Y, Sakagami Y, Shinohara K (2003)
Phytosulfokine stimulates somatic embryogenesis in Cryptomeria japonica. Plant Cell Physiol 44:
1412-1416
Ito Y, Nakanomyo I, Motose H, Iwamoto K, Sawa S, Dohmae N, Fukuda H (2006)
Dodeca-CLE peptides as suppressors of plant stem cell differentiation. Science 313: 842-845
Iwasaki T and Shibaoka H (1991) Brassinosteroids act as regulators of tracheary-element
differentiation in isolated Zinnia mesophyll cells. Plant Cell Physiol 32: 1007-1014
Kinoshita A, Nakamura Y, Sasaki E, Kyozuka J, Fukuda H, Sawa S (2007) Gain-of-function
phenotypes of chemically synthetic CLAVATA3/ESR-related (CLE) peptides in Arabidopsis
thaliana and Oryza sativa. Plant Cell Physiol 48: 1821-1825
Kobayashi T, Eun CH, Hanai H, Matsubayashi Y, Sakagami Y, Kamada H (1999)
Phytosulphokine-alpha, a peptidyl plant growth factor, stimulates somatic embryogenesis in carrot.
J Exp Bot 50: 1123-1128
Kondo T, Sawa S, Kinoshita A, Mizuno S, Kakimoto T, Fukuda H, Sakagami Y (2006) A plant
peptide encoded by CLV3 identified by in situ MALDI TOF-MS analysis. Science 313: 845-848
LaBrie ST, Willkinson JQ, Tsay YF, Feldmann KA, Crawford NM (1992) Identification of two
tungstate-sensitive molybdenum cofactor mutants, chl2 and chl7, of Arabidopsis thaliana. Mol Gen
Genet 233: 169-176
Leustek T, Martin MN, Bick JA, Davies JP (2000) Pathways and regulation of sulfur metabolism
revealed through molecular and genetic studies. Annu. Rev. Plant Physiol Plant Mol Biol 51:
141-165
Lin Y, Cheung CL (1997) A chlorate-resistant mutant defective in the regulation of nitrate
reductase gene expression in Arabidopsis defines a new HY locus. Plant Cell 9: 21-35
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 22: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/22.jpg)
Lorbiecke R, Sauter M (2002) Comparative analysis of PSK peptide growth factor precursor
homologs. Plant Sci 163: 321-332
Maiti A, Maki G, Johnson P (1998) TNF-alpha induction of CD44-mediated leukocyte adhesion
by sulfation. Science 282: 941-943
Matsubayashi Y (2003) Ligand-receptor pairs in plant peptide signaling. J Cell Sci 116: 3863-3870
Matsubayashi Y, Sakagami Y (1996) Phytosulfokine, sulfated peptides that induce the
proliferation of single mesophyll cells of Asparagus officinalis L. Proc Natl Acad Sci USA 93:
7623-7627
Matsubayashi Y, Sakagami Y (1999) Characterization of specific binding sites for a mitogenic
sulfated peptide, phytosulfokine-alpha, in the plasma-membrane fraction derived from Oryza sativa
L. Eur J Biochem 262: 666-671
Matsubayashi Y, Sakagami Y (2000) 120-and 160-kDa receptors for endogenous mitogenic
peptide, phytosulfokine-alpha, in rice plasma membranes. J Biol Chem 275: 15520-15525
Matsubayashi Y, Hanai H, Hara O, Sakagami Y (1996) Active fragments and analogs of the
plant growth factor, phytosulfokine: Structure-activity relationships. Biochem Biophys Res
Commun 225: 209-214
Matsubayashi Y, Takagi L, Sakagami Y (1997) Phytosulfokine-alpha, a sulfated pentapeptide,
stimulates the proliferation of rice cells by means of specific high-and low-affinity binding sites.
Proc Natl Acad Sci USA 94: 13357-13362
Matsubayashi Y, Takagi L, Omura N, Morita A, Sakagami Y (1999) The endogenous sulfated
pentapeptide phytosulfokine-alpha stimulates tracheary element differentiation of isolated
mesophyll cells of zinnia. Plant Physiol 120: 1043-1048
Matsubayashi Y, Ogawa M, Morita A, Sakagami Y (2002) An LRR receptor kinase involved in
perception of a peptide plant hormone, phytosulfokine. Science 296: 1470-1472
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 23: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/23.jpg)
Matsubayashi Y, Ogawa M, Kihara H, Niwa M, Sakagami Y (2006) Disruption and
overexpression of Arabidopsis phytosulfokine receptor gene affects cellular longevity and potential
for growth. Plant Physiol 142: 45-53
Motose H, Fukuda H, Sugiyama M (2001a) Involvement of local intercellular communication in
the differentiation of zinnia mesophll cells into tracheary elements. Planta 213: 121-131
Motose H, Sugiyama M, Fukuda H (2001b) An arabinogalactan protein(s) is a key component of
a fraction that mediates local intercellular communication involved in tracheary element
differentiation of zinnia mesophyll cells. Plant Cell Physiol 42: 129-137
Motose H, Sugiyama M, Fukuda H (2004) A proteoglycan mediates inductive interaction during
plant vascular development. Nature 429: 873-878
Nakagawa H, Yamashita N (1986) Chlorate reducing activity of spinach nitrate reductase. Agric
Biol Chem 50: 1893-1894
Ohashi-Ito K, Demura T, Fukuda H (2002) Promotion of transcript accumulation of novel Zinnia
immature xylem-specific HD-Zip III homeobox genes by brassinosteroids. Plant Cell Physiol 43:
1146-1153
Oostindi FJ, Feenstra WJ (1973) Isolation and characterization of chlorate-resistant mutants of
Arabidopsis thaliana. Mutat Res 19: 175-185
Ozeki Y, Matsui K, Sakuta M, Matsuoka M, Ohashi Y, Kano-Murakami Y, Yamamoto N,
Tanaka Y (1990) Differential regulation of phenylalamine ammonia-lyase genes during
anthocyanin synthesis and by transfer effect in carrot suspension cultures. Physiol Plant 80: 379-387
Pearce G, Strydom D, Johnson S, Ryan CA (1991) A polypeptide from tomato leaves activates
the expression of proteinase inhibitor genes. Science 253: 895-898�
Pearce G, Moura DS, Stratmann J, Ryan CA (2001a) Production of multiple plant hormones
from a single polyprotein precursor. Nature 411: 817-820
Pearce G, Moura DS, Stratmann J, Ryan CA (2001b) RALF, a 5-kDa ubiquitous polypeptide in
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 24: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/24.jpg)
plants, arrests root growth and development. Proc Natl Acad Sci USA 98: 12843-12847
Pearce G, Ryan CA (2003) Systemic signaling in tomato plants for defense against herbivores:
Isolation and characterization of three novel defense-signaling glycopeptide hormones coded in a
single precursor gene. J Biol Chem 278: 30044-30050�
Roberts K, McCann MC (2000) Xylogenesis: the birth of a corpus. Curr Opin Plant Biol 3:
517-522
Schopfer CR, Nasrallah ME, Nasrallah JB (1999) The male determinant of self-incompatibility
in Brassica. Science 286: 1697-1700.
Solomonson LP, Vennesland B (1972) Nitrate reductase and chlorate toxicity in Chlorella vulgaris
Beijerinck. Plant Physiol 50: 421-424
Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, Gardner J, Wang B, Zhai WX, Zhu
LH, Fauquet C, Ronald P (1995) A receptor kinase-like protein encoded by the rice disease
resistance gene, Xa 21. Science 270: 1804-1806
Stuart R, Street HE (1969) Studies on the growth in culture of plant cells. IV. The initiation of
division in suspensions of stationary-phase cells of Acer Pseudoplatanus L. J Exp Bot 20: 556-571
Sugiyama M, Fukuda H (1995) Zinnia mesophyll culture system to study xylogenesis. In K
Lindsey, eds, Plant Tissue Culture Manual, Supplement 5, Kluwer Academic Publishers, Dordrecht,
pp H2 1-15
Takayama S, Shiba H, Iwano M, Shimosato H, Che FS, Kai N, Watanabe M, Suzuki G, Hinata
K, Isogai A (2000) The pollen determinant of self-incompatibility in Brassica campestris. Proc Natl
Acad Sci USA 97: 1920-1925.
Tsay YF, Schroeder JI, Feldmann KA, Crawford NM (1993) The herbicide sensitivity gene
CHL1 of Arabidopsis encodes a nitrate-inducible nitrate transporter. Cell 72: 705-713
Ullrich TC, Huber R (2001) The complex structures of ATP sulfurylase with thiosulfate, ADP and
chlorate reveal new insights in inhibitory effects and the catalytic cycle. J Mol Biol 313: 1117-1125
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 25: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/25.jpg)
Willkinson JQ, Crawford NM (1991) Identification of the Arabidopsis CHL3 gene as the nitrate
reductase structural gene NIA2. Plant Cell 3: 461-471
Yamakawa S, Matsubayashi Y, Sakagami Y, Kamada H, Satoh S (1998) Promotion by a
peptidyl growth factor, phytosulfokine, of chlorophyll formation in etiolated cotyledon of cucumber.
Biosci Biotech Biochem 62: 2441-2443
Yamakawa S, Matsubayashi Y, Sakagami Y, Kamada H, Satoh S (1999) Promotive effects of
the peptidyl plant growth factor, phytosulfokine-alpha, on the growth and chlorophyll content of
Arabidopsis seedlings under high night-time temperature conditions. Biosci Biotech Biochem 63:
2240-2243
Yamamoto R, Demura T, Fukuda H (1997) Brassinosteroids induce entry into the final stage of
tracheary element differentiation in cultured Zinnia cells. Plant Cell Physiol 38: 980-983
Yamamoto R, Fujioka S, Demura T, Takatsuto S, Yoshida S, Fukuda H (2001) Brassinosteroid
levels increase drastically prior to morphogenesis of tracheary elements. Plant Physiol 125: 556-563
Yang H, Matsubayashi Y, Nakamura K, Sakagami Y (1999) Oryza sativa PSK gene encodes a
precursor of phytosulfokine-alpha, a sulfated peptide growth factor found in plants. Proc Natl Acad
Sci USA 96: 13560-13565
Yang H, Matsubayashi Y, Nakamura K, Sakagami Y (2001) Diversity of Arabidopsis genes
encoding precursors for phytosulfokine, a peptide growth factor. Plant Physiol 127: 842-851
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 26: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/26.jpg)
Figure legends
Figure 1. Structure and expression of ZePSK1. A, nucleotide and deduced amino acid sequences
of ZePSK1 cDNA. The deduced amino acid sequence with single letter abbreviations are shown
below the nucleotide sequence of ZePSK1. The potential N terminal signal sequence is underlined
and the PSK sequence is underscored with double lines. The Asp residue near PSK sequence is
printed in bold and the dibasic pairs (putative processing sites) are printed in italic. The nucleotide
sequence reported in this paper has been submitted to the DDBJ under accession number AB089283.
B, amino acid sequence comparison of PSK precursors. Single letter abbreviations for amino acid
residues are used. Gaps are shown as dashes (-). Sequence motif is according to Lorbieche and
Sauter (2002). C, D, E, and F, expression pattern of ZePSK1. C, zinnia mesophyll cells were
cultured in D medium or CN medium and collected at every 12 h. Total RNAs were isolated and
subjected to RT-PCR of ZePSK1 and 18S rRNA. D, effect of auxin and cytokinin on the
expression of ZePSK1. Zinnia mesophyll cells were cultured in C0, CB, CN, Cp, and D medium.
Total RNAs were isolated from zinnia cells cultured for 24, 48, and 72 h for RT-PCR analysis of
ZePSK1 and 18S rRNA. E, effect of wounding on the expression of ZePSK1. First true leaves
were cut into small pieces and cultured for 24 h on hormone-free medium. Total RNA was
isolated from leaf pieces cultured for 12 h and 24 h, and subjected to RT-PCR of ZePSK1 and 18S
rRNA. F, effects of uniconazole and brassinolide on the expression of ZePSK1. Isolated
mesophyll cells were cultured for 48 h, 60 h, and 72 h in D medium without uniconazole nor
brassinolide (D) or D medium with 5 µM uniconazole (U) or with 5 µM uniconazole and 10 nM
brassinolide (UB). Total RNA was isolated for the expression analysis of ZePSK1 and 18S rRNA
by RT-PCR.
Figure 2. Inhibition of TE differentiation by chlorate and its reversal by PSK. A, B, and C,
photographs of cells cultured for 96 h in D medium containing 2 mM KCl (A), 2 mM KClO3 and
200 nM unsulfated PSK (B), 2 mM KClO3 and 200 nM PSK (C). Bar = 50 µm. D and E, effects
of chlorate on TE differentiation and cell division. KCl or KClO3 were added at the start of culture
at various concentrations indicated in horizontal axis. F and G, PSK overcame chlorate-induced
inhibition of TE differentiation. 2 mM KClO3 and various concentrations of PSK were added at
the start of culture. Frequencies of TE differentiation (D and F) and cell division (E and G) were
determined at the 96th h of culture. Data represent averages and SD of three replicates.
Figure 3. Inhibition of tyrosine sulfation of PSK by chlorate. PSK was purified from
conditioned medium of cell suspensions cultured for 72 h in D medium (D) or D medium
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 27: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/27.jpg)
containing 2 mM KClO3 (KClO3) or 2 mM KClO3 + 200 nM PSK (KClO3 + PSK). Tyrosine
sulfation of PSK was detected by immunoblot assay using an anti-sulfotyrosine monoclonal
antibody, PSG2.
Figure 4. Changes in the responsiveness of cells to PSK and chlorate during xylogenic culture.
A, KClO3 at 2 mM was added to cell suspensions at the start of culture, and then PSK or unsulfated
PSK (OH-PSK) were added at various times thereafter indicated on horizontal axis at the
concentration of 200 nM. Frequencies of TE differentiation were determined at the 96th h of
culture. B, Effect on TE differentiation of PSK added at various times to low-density culture.
Cells were cultured at 5.0 × 103 cells mL-1 and supplied with PSK at a concentration of 100 nM at
various times of culture indicated in this panel. OH-PSK was administrated at a concentration of
100 nM at the start of culture. Frequencies of TE differentiation were determined at various times
indicated on horizontal axis. Data represent averages and SD of three replicates.
Figure 5. Effects of chlorate and PSK on marker gene expression. Total RNA was isolated from
zinnia cells cultured for indicated periods in D medium (D) or D medium containing 2 mM KClO3
(KClO3) or 2 mM KClO3 + 200 nM PSK (KClO3 + PSK). RNA gel blot hybridization was
performed with digoxigenin-labelled antisense probes for ZePR, ZePI1, ZePI2, PAL3, TED3, TED4,
and ZCP4.
Figure 6. Effect of auxin and cytokinin on the suppression of stress response genes. A, Zinnia
mesophyll cells were cultured in 4 different media; hormone-free medium (C0), medium with
cytokinin (CB), medium with auxin (CN), or medium with cytokinin and auxin (D), in the absence or
presence (+ PSK) of 200 nM PSK. Total RNA was isolated from cells cultured for 24 h. RNA
gel blot hybridization was performed with digoxigenin-labelled antisense probes for ZePR, ZePI1,
ZePI2, and ZePAL3. B, effect of PSK on TE differentiation in the presence of auxin and cytokinin.
Cells were cultured in D medium in the absence (D) or presence (D + PSK) of 200 nM PSK.
Frequencies of TE differentiation were determined at the 60th h of culture. Data represent
averages and SD of three replicates (P-value <0.01 in the Student’s t-test).
Figure 7. Summary of microarray analysis. A and B, expression pattern of genes downregulated
(A) or upregulated (B) by PSK. Fleshly isolated mesophyll cells were cultured for 24 h in D
medium without PSK nor KClO3 (Mock), with 200 nM PSK (PSK), with 2 mM KClO3 (KClO3), or
with 200 nM PSK and 2 mM KClO3 (PSK + KClO3). Poly (A)+ RNA was prepared from 0 h cells
and cells cultured in Mock, PSK, KClO3, and PSK + KClO3 for microarray analysis. C and D,
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 28: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/28.jpg)
clustering of genes downregulated (C) or upregulated (D) by PSK according to the classification
described in E. E, schematic expression patterns of six different groups of genes during TE
differentiation described in Demura et al. (2002).
Figure S1. Effects of KNO3 on TE differentiation, cell division, and viability in the presence of
KCl, KClO3, and PSK. 2 mM KCl (indicated as KCl), 2 mM KClO3 (KClO3), or 2 mM KClO3
and 200 nM PSK (KClO3 + PSK) was added at the start of culture to the medium containing various
concentrations of KNO3. The frequencies of TE differentiation, the frequencies of cell division,
and viability were determined at the 96th h of culture. Data represent averages and SD of three
replicates.
Figure S2. Changes in the responsiveness of cells to KClO3 during xylogenic culture. KClO3 at
2 mM was added to cell suspensions at various times of culture. Frequencies of TE differentiation
were determined at the 96th h of culture. Data represent averages and SD of three replicates.
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 29: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/29.jpg)
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 30: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/30.jpg)
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 31: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/31.jpg)
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 32: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/32.jpg)
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 33: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/33.jpg)
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 34: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/34.jpg)
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.
![Page 35: Running head: Roles of PSK in TE differentiation Corresponding](https://reader031.fdocuments.us/reader031/viewer/2022020705/61fb7f722e268c58cd5ee04c/html5/thumbnails/35.jpg)
ABD
E
UnclassifiedB
E
A
CD
UnclassifiedC D
�
�
�
�
�
�
�
�
� � � � �
����
����
����
����
����
����
����
���
���
����
�����
� � � � �
A B
E
0
2
4
6
8
0
2
10
4
6
8
Nor
mal
ized
inte
nsity
Nor
mal
ized
inte
nsity
Nor
mal
ized
inte
nsity
0 24 48 72 96
A
B
C
D
E
www.plantphysiol.orgon January 29, 2019 - Published by Downloaded from Copyright © 2009 American Society of Plant Biologists. All rights reserved.