Running head: Glucose 1-phosphate transport 2 · 221 achieved at approximately 1 mM glucose...

1

Running head: Glucose 1-phosphate transport 1

2

Author to whom correspondence should be sent: 3

4

Joerg Fettke 5

Institute of Biochemistry and Biology 6

Department of Plant Physiology 7

University of Potsdam 8

Karl-Liebknecht-Str. 24/25 9

Building 20 10

14476 Potsdam-Golm 11

Germany 12

13

Phone No: +49-331-977-2653 14

Fax No: +49-331-977-2512 15

Email: [email protected] 16

17

18

19

Journal research area: Biochemical processes and macromolecular structures 20

21

22

23

24

25

26

27

28

29

30

31

32

33

34

Plant Physiology Preview. Published on November 29, 2010, as DOI:10.1104/pp.110.168716

Copyright 2010 by the American Society of Plant Biologists

www.plantphysiol.orgon May 20, 2020 - Published by Downloaded from Copyright © 2010 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

Glucose 1-phosphate transport into protoplasts and chloroplasts from leaves of 35

Arabidopsis thaliana 36

37

Joerg Fettke1,2*, Irina Malinova2, Tanja Albrecht2, Mahdi Hejazi2, and Martin Steup2 38

39 1Mass Spectrometry of Biopolymers, University of Potsdam, 14476 Potsdam-Golm, Germany 40 2Department of Plant Physiology, University of Potsdam, 14476 Potsdam-Golm, Germany 41

42

43

44

45

46

47

48

49

50

51

52

53

54

55

56

57

58

59

60

61

62

63

64

65

66

67

68



3

Footnotes 69

70

This work was supported by the Deutsche Forschungsgemeinschaft - Sonderforschungs-71

bereich 429 ‚Molecular Physiology, Energetics, and Regulation of Primary Metabolism in 72

Plants’, Teilprojekt B2 (J.F. and M.S.). 73

74

75

76

*Corresponding author; email [email protected] 77

78

79

80

81

82

83

84

85

86

87

88

89

90

91

92

93

94

95

96

97

98

99

100

101

102



4

Abstract 103

104

Almost all glucosyl transfer reactions rely on glucose 1-phosphate that either immediately 105

acts as glucosyl donor or as substrate for the synthesis of the more widely used glucose 106

dinucleotides, ADPglucose or UDPglucose. In this communication, we have analyzed two 107

glucose 1-phosphate related processes: the carbon flux from externally supplied glucose 1-108

phosphate to starch by either mesophyll protoplasts or intact chloroplasts from Arabidopsis 109

thaliana. When intact protoplasts or chloroplasts are incubated with [U-14C]glucose 1-110

phosphate, starch is rapidly labelled. Incorporation into starch is unaffected by the addition of 111

unlabeled glucose 6-phosphate or glucose indicating a selective flux from glucose 1-112

phosphate to starch. However, illuminated protoplasts incorporate less 14C into starch when 113

unlabelled bicarbonate is supplied in addition to the 14C-labelled glucose 1-phosphate. 114

Mesophyll protoplasts incubated with [U-14C]glucose 1-phosphate incorporate 14C into the 115

plastidial pool of adenosine diphosphoglucose. Protoplasts prepared from leaves of mutants of 116

Arabidopsis thaliana that lack either the plastidial phosphorylase or the phosphoglucomutase 117

isozyme incorporate 14C derived from external glucose 1-phosphate into starch but 118

incorporation into starch is insignificant when protoplasts from a mutant possessing a highly 119

reduced ADPglucose pyrophosphorylase activity are studied. Thus, the path of assimilatory 120

starch biosynthesis initiated by extra-plastidial glucose 1-phosphate leads to the plastidial 121

pool of adenosine diphosphoglucose and at this intermediate it is fused with the Calvin cycle 122

driven route. Mutants lacking the plastidial phosphoglucomutase contain a small yet 123

significant amount of transitory starch. The starch granule morphology is similar to that of the 124

wild type control. 125

126

127

128

129

130

131

132

133

134

135



5

Introduction 136

The entire metabolism of eukaryotic cells consists of distinct reaction sequences within a 137

given compartment and the action of metabolite transporters that functionally interconnect the 138

various compartments. Similarly, transporters located at the interface between the cells and 139

the apoplastic space (i.e. in the cell membrane) permit an intercellular transport of metabolites 140

and thereby integrate metabolic processes that take place in various cells. Both metabolite-141

related enzymes and transporters can exert a second function as they also are capable of 142

integrating signalling paths and thereby transferring information on the metabolic status of the 143

cellular compartments or the entire cell (Smeekens 1998; Rolland et al. 2002). 144

A large group of metabolite transporters is functionally related to the metabolism of sugars or 145

sugar derivatives and some of them act within pathways that either synthesize or degrade 146

polysaccharides. Among the plant polysaccharides, quantitatively most important are the 147

plastidial starch and the apoplastic cell wall. Cell wall-related sugar transporters are mainly 148

located in the endoplasmic reticulum and transport mostly nucleotide sugars (Seifert 2004). 149

Starch-related transporters reside in the inner envelope membrane of plastids. A glucose 150

transporter of the envelope membrane has functionally been characterized (Weber et al. 151

2000). However, the quantitatively dominant product of the plastidial transitory starch 152

degradation is maltose which is exported into the cytosol by the recently identified maltose 153

transporter designated as MEX (maltose excess; Weise et al. 2004; Niittylä et al. 2004). Like 154

the other transporters listed below this transporter is located in the inner chloroplast envelope 155

membrane. As MEX deficient mutants from Arabidopsis thaliana contain exceptionally high 156

maltose levels and exhibit a massive starch excess phenotype as well as a strong retardation in 157

growth, MEX appears to exert an indispensable function within the starch-sucrose conversion 158

(Niittylä et al. 2004). 159

Other metabolite transporters of the chloroplast envelope membranes are functionally more 160

closely related to the reductive pentose phosphate cycle. Phosphate translocators mediate a 161

strict counter-exchange of phosphorylated sugars (or of 3-phosphoglycerate) and 162

orthophosphate. The triose-phosphate / phosphate translocator exports triose-phosphate (and, 163

to some extent, 3-phosphoglycerat) from the chloroplast into the cytosol mainly during the 164

light period (Schneider et al. 2002). The xylulose 5-phosphate / phosphate translocator has 165

been proposed to provide the plastidial pentose phosphate pathway with reduced carbon 166

compounds or reducing equivalents (Eicks et al. 2002; Weber 2004). Depending on 167

concentration gradients, the phosphoenolpyruvate / phosphate translocators (strongly 168

expressed in photosynthesis-competent cells of C4 plants) as well as the glucose 6-phosphate 169



6

/ phosphate translocators (prominent in heterotrophic cells) mediate the transport of the 170

respective phosphorylated metabolite between the plastid and the cytosol. For each of the two 171

translocators two genes have been identified that are differentially expressed in various 172

Arabidopsis organs (Weber 2004). Recently, evidence has been presented for the occurrence 173

of an evolutionary conserved plastidial ADPglucose exporter (Colleoni et al. 2010). However, 174

the current knowledge of the metabolite transporters is far from being complete as analysis of 175

the genome of Arabidopsis thaliana L. revealed that approximately 140 putative metabolite 176

transporters exist all of which are predicted to be located in the inner plastid envelope 177

membrane (Ferro et al. 2002; Schwacke et al. 2003). 178

None of the translocators described above is able to transport another important metabolite, 179

i.e. glucose 1-phosphate (Eicks et al. 2002; Kammerer et al. 1998). This glucose ester is a key 180

intermediate in several major carbon fluxes, such as starch, sucrose and cellulose 181

biosynthesis. In the current model of the photosynthesis-driven starch biosynthesis, the 182

plastidial phosphoglucomutase mediates the formation of glucose 1-phosphate from glucose 183

6-phosphate which is directly derived from a Calvin-cycle intermediate, fructose 6-phosphate. 184

By the action of ADPglucose pyrophosphorylase glucose 1-phosphate is then converted to 185

ADPglucose which is the general glucosyl donor for a variety of starch synthases. The 186

dominance of the ADPglucose-dependent path of starch biosynthesis concurs with the fact 187

that mutants from A. thaliana lacking the plastidial α-glucan phosphorylase isozyme (PHS1) 188

possess essentially the same starch content as wild type plants when grown under normal 189

conditions (Zeeman et al. 2004). However, transgenic potato plants underexpressing both the 190

plastidial and the cytosolic phosphoglucomutase unexpectedly possess transitory starch levels 191

similar to those of the wild type controls. These phenotypical features are considered to be 192

inconsistent with this model (Fernie et al. 2002) and, therefore, the carbon fluxes towards 193

starch appear to be more complex than often assumed. 194

Recently, we have shown that in heterotrophic tissues, such as potato tuber discs, glucose 1-195

phosphate is selectively taken up and, subsequently, enters two paths: It is metabolized via the 196

cytosolic phosphorylase by transferring the glucosyl residue to starch-related heteroglycans 197

(Fettke et al. 2008). Another portion of the imported glucose 1-phosphate directly enters the 198

amyloplasts and is converted to starch. Under normal conditions, this conversion which is 199

mainly mediated by the plastidial phosphorylase isozyme is not the dominant pathway of 200

reserve starch biosynthesis (Fettke et al. 2010). However, it offers an explanation of some 201

features of starch metabolism as observed in various mutants (see above) because this route 202



7

apparently does rely neither on the cytosolic nor the plastidial glucose 6-phosphate/glucose 1-203

phosphate interconversion. 204

Until now, the question remains whether or not this process operates also in autotrophic 205

tissues as any evidence for a transport of glucose 1-phosphate into both mesophyll protoplasts 206

and chloroplasts is lacking. 207

In this communication, we have studied the transport of glucose 1-phosphate into autotrophic 208

cells as well as possible implications of this process for the entire transitory starch 209

metabolism. 210

211

Results 212

213

Uptake and utilization of external glucose 1-phosphate by mesophyll protoplasts from 214

Arabidopsis thaliana L. 215

To study the uptake of glucose 1-phosphate by intact mesophyll protoplasts, short term 216

experiments were performed using varying concentrations of [U-14C]glucose 1-phosphate. 217

Following an incubation of 30 sec, the protoplasts were washed and the total 14C content of 218

the protoplasts was determined (Fig. 1A and 1B). Uptake of the 14C-labelled glucose 1-219

phosphate was clearly detectable at submicromolar concentrations and saturation was 220

achieved at approximately 1 mM glucose 1-phosphate. The apparent KM was estimated to be 221

413 µM. 222

In another series of short term uptake experiments, the protoplasts were incubated with either 223

200 µM or 400 µM [U-14C]glucose 1-phosphate and an equal concentration of unlabelled 224

glucose and glucose 6-phosphate, respectively. As a control, the unlabelled compound was 225

omitted (Figure 1C). Neither the presence of glucose nor that of glucose 6-phosphate did 226

affect the uptake of glucose 1-phosphate. Thus, the putative glucose 1-phosphate transporter 227

is selective for both the phosphorylated glucose (as it does not react with glucose) and the 228

anomeric position of the phosphate ester (as it does not act on glucose 6-phosphate). 229

230

In order to determine whether or not the imported glucose 1-phosphate is converted to starch 231

(as it is the case in heterotrophic potato tuber cells; Fettke et al. 2010), mesophyll protoplasts 232

from Arabidopsis leaves were incubated for 20 min with equimolar concentrations (20 mM 233

each) of [U-14C]glucose 1-phosphate or [U-14C]glucose. During incubation the protoplasts 234

were either illuminated or darkened. Following incubation, starch was isolated and the 14C 235

content was quantified. Incubation with glucose 1-phosphate results in a more than 10fold 236



8

higher incorporation as compared to glucose (Fig. 2A). Thus, the superior efficiency of the 237

glucose 1-phosphate dependent labelling of starch is not unique to heterotrophic cells (cf. 238

Fettke et al. 2010). Light stimulates the flux from both external glucose 1-phosphate and 239

glucose to starch but even in darkened protoplasts the glucose 1-phosphate-dependent 240

labelling of starch is higher than that of glucose in illuminated protoplasts. When comparing 241

the incorporation into starch in illuminated and darkened protoplasts, it should be noted that 242

in the dark starch biosynthesis via the ADPglucose pyrophosphorylase is inhibited (Hendriks 243

et al. 2003) and, in addition, net starch degradation is initiated. The onset of starch 244

mobilization, as observed under the conditions used, was analysed by 14C-labelling of 245

protoplasts in the light, transfer into the dark and determination of 14C -label of starch during 246

the dark phase (data not shown). Therefore, in darkened protoplasts the 14C-labelling of starch 247

equals the total incorporation minus the release of label due to starch degradation. 248

For a more detailed analysis of the glucose 1-phosphate dependent incorporation into starch, 249

Arabidopsis mesophyll protoplasts were incubated for 5 or 10 min with one of three mixtures 250

each of which contained [U-14C]glucose 1-phosphate (20 mM each) and, in addition, one of 251

three unlabelled compounds (orthophosphate, glucose or glucose 6-phosphate; 10 mM each). 252

As a control, an aliquot of the protoplast suspension was incubated with [U-14C]glucose 1-253

phosphate (20 mM) without adding any unlabelled compound. Protoplasts were illuminated 254

during incubation. The addition of any of the three unlabelled compounds increased the 255

glucose 1-phosphate dependent incorporation into starch but quantitatively the enhancement 256

differed depending upon the unlabelled compound. Glucose 6-phosphate was more effective 257

than glucose but orthophosphate was by far most efficient: it increased the labelling of starch 258

approximately 20fold as compared to the control (Fig. 2B). The stimulatory effect of 259

orthophosphate clearly excludes the possibility that the glucose 1-phosphate dependent 260

labelling of starch is due to a direct glucosyl transfer to the starch granules that is catalyzed by 261

a phosphorylase and takes place outside the intact protoplasts. In principle, any unnoticed 262

breakage of protoplasts could release both native starch granules and phosphorylase activity. 263

However, the phosphorylase-mediated glucosyl transfer to starch granules that occurs outside 264

the protoplasts would be inhibited by orthophosphate. As a control, protoplasts were 265

mechanically broken and the conversion of glucose 1-phosphate to starch within 10 min was 266

monitored to be less than 1 % as compared to that of the intact protoplasts (data not shown). 267

Furthermore, this type of starch labelling is not expected to be stimulated by light (Fig. 2B; 268

see also Fig. 3A). 269



9

During incubation, the glucose 1-phosphate dependent carbon flux to starch is far from being 270

constant as most of the 14C is incorporated into starch during the first 5 min of incubation and 271

the extension to 10 min results in only a very small increment of the labelling (Fig. 2B). At 272

the molecular level, this result is difficult to explain as the entire flux is based on a series of 273

reactions and includes a variety of components several of which could be limiting factors or 274

steps but are difficult to estimate. Of special relevance appears to be a possible limitation 275

exerted by the first step, i.e. the glucose 1-phosphate import, by the cytosolic orthophosphate 276

level. If so, the simultaneous addition of orthophosphate and glucose 1-phosphate would lead 277

to a higher cytosolic orthophosphate concentration which then would stimulate the import of 278

the glucose phosphate. 279

In order to analyse a possible interdependence of the transport of orthophosphate and of 280

glucose 1-phosphate more directly, two additional labelling experiments were performed. It 281

should be noted that in these experiments either the total label inside the protoplasts (Fig. 2C) 282

or the label released from the protoplasts into the medium (Fig. 2D) was monitored. In the 283

first experiment, protoplasts were incubated in mixtures containing 10 mM 284

[33P]orthophosphate and, in addition, either unlabelled glucose 1-phosphate or unlabelled 285

glucose (20 mM each). As a control, the incubation medium contained only 286

[33P]orthophosphate. Following the incubation for 5 min in the light, the protoplasts were 287

carefully washed to remove external 33P-label and the amount of 33P inside the protoplasts 288

was monitored (Fig. 2C). The addition of unlabeled glucose 1-phosphate decreased the 33P-289

label inside the protoplasts as compared to the control. By contrast, equimolar external 290

glucose did not affect the 33P content of the protoplasts. This result is consistent with the 291

assumption that external glucose 1-phosphate is imported into the cell via a glucose 1-292

phosphate /orthophosphate exchange that takes place at the plasmalemma and thereby 293

diminishes the orthophosphate-dependent prelabelling of the protoplasts. 294

In the second experiment, protoplasts were prelabelled by incubation with 295

[33P]orthophosphate for 10 min in the light. Subsequently, the residual external 296

orthophosphate was carefully removed by repeated washing steps and then the protoplast 297

suspension was divided into two equal parts that were incubated for 5 min in the light either 298

in the presence or in the absence (control) of 20 mM glucose 1-phosphate. Finally, the 299

protoplasts were pelleted by centrifugation and the 33P content in the supernatant was 300

monitored (Fig. 2D). External glucose 1-phosphate increased the release of orthophosphate 301

into the medium more than twofold as compared to the control. 302



10

In summary, both labelling experiments clearly indicate that the mesophyll protoplasts import 303

external glucose 1-phosphate by an antiport mechanism which utilizes orthophosphate as 304

counter-ion. 305

306

Utilization of external glucose 1-phosphate by isolated Arabidopsis chloroplasts 307

The results shown in Fig. 1 imply that glucose 1-phosphate is taken up by the cells and is 308

converted to starch. This raises the question whether or not glucose 1-phosphate directly enter 309

the chloroplasts were the starch synthesis takes place. Until now, glucose 1-phosphate has not 310

been reported to be imported into chloroplasts but indirect evidence for an uptake by non-311

green plastids has been published (potato tubers: Kosegarten and Mengel 1994; Naeem et al. 312

1997; wheat: Tetlow et al. 1996; soy bean: Coates and ap Rees, 1994). To answer the 313

question mentioned above, chloroplasts isolated from Arabidopsis leaves were incubated with 314

[U-14C]glucose 1-phosphate. As a control, an aliquot of the same chloroplast preparation was 315

mechanically broken by using a potter and, subsequently, the homogenate was then treated 316

identically. Isolated chloroplasts are able to take up glucose 1-phosphate and to convert it into 317

starch at a relatively high rate. This process requires, however, the intactness of the organelles 318

(Figure 3A). Thus, both the uptake of glucose 1-phosphate and the flux towards starch are 319

functional in isolated intact chloroplasts. 320

In an additional experiment, chloroplasts were incubated with a mixture of [U-14C]glucose 1-321

phosphate and (unlabelled) orthophosphate or with [U-14C]glucose 6-phosphate. As a control, 322

chloroplasts were incubated only with [U-14C]glucose 1-phosphate. For the three incubation 323

mixtures, the incorporation of 14C into starch was monitored (Figure 3B). In the presence of 324

both [U-14C]glucose 1-phosphate and orthophosphate, incorporation into starch is decreased 325

(but still exceeds that observed with glucose 6-phosphate) suggesting a glucose 1-phosphate / 326

orthophosphate antiport that is functional at the envelope membranes of the chloroplasts. 327

These data are further supported by the fact that simultaneous incubation of chloroplasts with 328 33P-labelled orthophosphate and unlabelled glucose 1-phosphate results in a decreased uptake 329

of orthophosphate as compared to the incubation only with 33P-labelled orthophosphate (data 330

not shown). This result is expected if the external glucose 1-phosphate is imported via an 331

exchange with internal orthophosphate. As the incubation of isolated chloroplast with 332

equimolar [U-14C]glucose 6-phosphate results in a minor labelling of starch (Fig. 3B), import 333

and plastidial metabolism of the two externally supplied glucose phosphate esters differ. 334

In another series of experiments isolated chloroplasts were incubated with either [U-335 14C]glucose 1-phosphate only or together with unlabelled glucose 6-phosphate or glucose 336



11

(16.67 mM each). 14C incorporation into starch was monitored after 10 min or 20 min of 337

incubation. Neither unlabelled glucose 6-phosphate nor free glucose did significantly affect 338

the incorporation of 14C into starch indicating a selective import of the anomeric glucose ester 339

into the chloroplast (Fig. 3C). 340

In summary, all the data shown in Fig. 3 indicate that mesophyll cells from leaves are capable 341

of importing glucose 1-phosphate from the cytosol into the chloroplast stroma. 342

343

Contribution of the plastidial α-glucan phosphorylase isozyme (AtPHS1) to the 344

conversion of glucose 1-phosphate to starch 345

Following the uptake into the chloroplasts, glucose 1-phosphate could be further metabolized 346

by two distinct starch synthesizing pathways: First, in a single reaction (that is mediated by 347

the plastidial α-glucan phosphorylase isozyme, AtPHS1) glucosyl residues could be 348

transferred directly to acceptor sites at the surface of native starch granules. Alternatively, it 349

could undergo a more complex sequence: first the conversion of glucose 1-phosphate to 350

ADPglucose via ADPglucose pyrophosphorylase (Lin et al. 1988) and, subsequently, the 351

glucosyl transfer from ADPglucose to glucans of the starch granule that is catalyzed by at 352

least five ADPglucose-dependent starch synthase isozymes. 353

In order to test the existence and/ or relevance of the PHS1-dependent path, Arabidopsis 354

insertion mutants were used that are deficient in the plastidial phosphorylase isozyme 355

(AtPHS1; Zeeman et al. 2004). The phosphorylase pattern from Arabidopsis wild type leaves 356

consists of four bands of activity all which strictly depend on glucose 1-phosphate (Figure 357

4A). In a glycogen-containing separation gel, the two slowly moving bands represent the 358

cytosolic phosphorylase isoform (AtPHS2) that exists in two states differing in the apparent 359

affinity toward the immobilized polyglucan (Fettke et al. 2005b). Similarly, the plastidial 360

phosphorylase isoform (AtPHS1) occurs in two distinct but faster moving bands (Fig. 4A). In 361

knock-out mutants lacking the plastidial phosphorylase these two bands are undetectable 362

suggesting that they are products of the same gene. The structural and functional implications 363

of the heterogeneity of AtPHS1 and AtPHS2 are unknown. 364

As compared to the wild-type control, mesophyll protoplasts from AtPHS1-deficient lines did 365

not differ in the glucose 1-phosphate dependent incorporation into starch (Fig. 4B). Therefore, 366

in mesophyll cells the direct glucosyl transfer to starch, as mediated by AtPHS1, appear to be 367

of no or minor relevance. By contrast, in potato tuber discs the conversion of glucose 1-368

phosphate into starch did reflect the level of the plastidial phosphorylase activity (Fettke et al. 369

2010). 370



12

371

ADPglucose-dependent 14C-incorporation into starch 372

As the plastidial glucose 1-phosphate pool is not noticeably used for any AtPHS1-mediated 373 14C-labelling of starch (Fig. 4B), we tested whether or not the conversion of glucose 1-374

phosphate to starch does include both the action of ADPglucose pyrophosphorylase and the 375

incorporation into the plastidial ADPglucose pool. If so, the activity of the Calvin cycle that 376

also feeds into this starch forming path is expected to affect the conversion of the externally 377

supplied glucose 1-phosphate towards starch. In order to test this possibility, we incubated 378

protoplasts with 10mM [U-14C]glucose 1-phosphate in either the presence or the absence of 379

5mM unlabelled HCO3- . 14C-labelling of starch is significantly reduced by the addition of 380

unlabelled hydrogen carbonate (Table I). These results strongly suggest that the imported 381

glucose 1-phosphate and intermediates of the Calvin cycle enter the plastidial ADPglucose 382

pool and, subsequently, utilize the same reactions that transfer glucosyl residues to starch. 383

If so, incubation of protoplasts with [U-14C]glucose 1-phosphate should result in a 14C-384

labelling of ADPglucose. To test this prediction, we incubated protoplasts derived from wild-385

type leaves with [U-14C]glucose 1-phosphate for 10 or 20 min in the dark or in the light. At 386

intervals, aliquots of the incubation mixture were withdrawn and metabolic processes were 387

terminated by the addition of ethanol (final concentration 50% [v/v]) followed by heating. By 388

this treatment, proteins were denatured and metabolites were extracted. Subsequently, the 389

extracts were lyophilized, dissolved in water and were then reacted with a mixture of native 390

potato tuber starch and recombinant starch synthase III derived from A. thaliana. Following 391

careful washing, the 14C incorporation into native starch granules was monitored (Table IIa). 392

Due to the selectivity of the recombinant starch synthase, this method permits the 393

quantification of the 14C content of ADPglucose even in the presence of a large excess of [U-394 14C]glucose 1-phosphate. In addition, aliquots of the protoplast suspension were used to 395

monitor the incorporation into starch by the intact protoplasts during incubation with [U-396 14C]glucose 1-phosphate (Table IIb). 397

During illumination of protoplasts, import of [U-14C]glucose 1-phosphate results in 14C 398

incorporation into both starch and ADPglucose. Both processes require intactness of the 399

protoplasts. In the dark, almost no starch is labelled and, in addition, less 14C-ADPglucose is 400

formed (Table IIa and b). This result is not unexpected as the synthesis of ADPglucose via 401

ADPglucose pyrophosphorylase has been reported to be light dependent (Hendriks et al. 402

2003). 403

404



13

Starch synthesis in the Arabidopsis pgm1 mutant 405

The pgm1 mutant from A. thaliana that lacks a functional plastidial phosphoglucomutase is 406

incapable to perform a Calvin-cycle driven biosynthesis of assimilatory starch (Caspar et al. 407

1985). For a long time this mutant has been considered to lack any leaf starch. However, 408

some recently published data indicate that it does indeed contain starch although in very small 409

quantities (e.g. Niittylä et al. 2004; Munoz et al. 2005). This implies that, although to a far 410

lower extent, assimilatory starch can be formed by an additional, yet unknown path which 411

does not include the plastidial conversion of the Calvin cycle-derived glucose 6-phosphate to 412

glucose 1-phosphate. The import of glucose 1-phosphate into the chloroplast, as analysed in 413

this study, could be an essential step within this path. 414

To test this assumption, we prepared mesophyll protoplasts from the pgm1 mutant and 415

incubated the protoplasts with [U-14C]glucose 1-phosphate during illumination. For 416

comparison, protoplasts were isolated from leaves of two types of A. thaliana plants that had 417

been grown under essentially the same conditions and had been treated identically: wild type 418

plants and a mutant having a strongly reduced level of the ADPglucose pyrophosphorylase 419

activity (adg1; Lin et al. 1988). At intervals, aliquots of the three protoplast preparations were 420

withdrawn and, following the extraction of starch, the 14C content was monitored. In the pgm1 421

mutant 14C-label was clearly detectable in the starch fraction and the 14C incorporation 422

proceeded with time (Fig. 5A). Thus, 14C derived from the externally supplied glucose 1-423

phosphate was taken up by the protoplasts, imported into the chloroplast and was then 424

incorporated into starch even in the absence of a functional pPGM. However, labelling of 425

starch was lower as compared to the wild type control. By contrast, the mutant from A. 426

thaliana having a lower ADPglucose phosphorylase activity incorporated very little 14C into 427

starch and labelling was essentially unchanged during 5 to 20 min incubation (Fig. 5A). Thus, 428

the residual ADPglucose pyrophosphorylase activity of this mutant is insufficient to sustain 429

the carbon flux from externally supplied glucose 1-phosphate towards starch. 430

Regarding the pgm1 mutant, the in vivo flux from glucose 1-phosphate into the plastids is 431

minor and, therefore, unable to permit normal starch accumulation. At the end of the light 432

period, we monitored the leaf starch content to be 0.09 ± 0.006 mg glucose g FW-1 whereas 433

the Col-0 wild type plants, grown under the same conditions, contained 6.843 ± 0.427 mg 434

glucose g FW-1 ( n = 4). Despite the low starch content of the pgm1 mutant, we were able to 435

isolate native leaf starch granules (Fig.5C). Based SEM examination, the morphology of the 436

mutant-derived starch particles is similar to those obtained from wild type leaves (Fig. 5B; see 437

also Streb et al. 2009). 438



14

For several reasons, the relatively small contribution of the glucose 6-phosphate independent 439

flux to the total starch biosynthesis is not surprising: Firstly, in the cytosol glucose 1-440

phosphate is used in various (and, possibly, competing) reactions among which the formation 441

of UDPglucose is most prominent. Subsequently, UDPglucose is used for the biosynthesis of 442

sucrose and cell wall polysaccharides. Secondly, the total cellular content of glucose 1-443

phosphate is very low and undergoes only moderate changes throughout the light-dark cycle 444

(e.g. Schneider et al. 2002). Finally, provided an appropriate gradient is given an efficient 445

glucose 1-phosphate / phosphate antiporter located in the chloroplast envelope membrane(s), 446

will even lower the plastidial glucose 1-phosphate pool if mediating a bidirectional transport. 447

Thereby, the transporter will diminish the contribution of the Calvin-cycle-independent path 448

of starch biosynthesis. 449

450

Discussion 451

In this communication, we provide evidence that photosynthesis-competent mesophyll cells 452

from leaves of A. thaliana are capable of utilizing extracellular glucose 1-phosphate. 453

Following uptake, glucose 1-phosphate passes the plastidial envelope membranes and, finally, 454

the hexosyl residue is converted to starch. 455

Most of the experiments described here have been performed by using isolated mesophyll 456

protoplasts that, to some extent, are a non-physiological system possessing altered carbon 457

fluxes such as the re-synthesis of cell wall materials that may be favoured over other 458

biosynthetic paths. However, for the present study both isolation and treatment of protoplasts 459

had been carefully optimized. Under the conditions used, more than 85 % of the protoplasts 460

remained functional over a period of 24 h (data not shown). Nevertheless, control experiments 461

were included ensuring that the biochemical processes studied are restricted to intact 462

protoplasts. When using these precautions, functional protoplasts offer some unique 463

advantages as, in short term experiments, they permit a quantitative analysis of the uptake of 464

metabolites. For putative transporters, apparent Km and Vmax values can be determined which 465

is impossible if more physiological systems, such as leaf tissues, are applied. As an example, 466

due to both the geometry of leaf discs and the structural complexity of the apoplastic space 467

the uptake of a given metabolite into a cell is unavoidably superimposed (and largely 468

affected) by the diffusion of that compound to the vicinity of the respective cell and, 469

therefore, neither effective extracellular concentrations of the metabolite nor uptake rates can 470

be determined. 471



15

Based on the experiments described above we propose a schema of transitory starch 472

biosynthesis outlined in Fig. 6. 473

474

The transfer of glucosyl residues to non-reducing ends of native starch granules is mediated 475

by various isoforms of starch synthase (EC 2.4.1.21) that all utilize ADPglucose as donor. 476

The glucosyl donor is formed by the action of the ADPglucose pyrophosphorylase according 477

to the equation: ATP + glucose 1-phosphate ↔ ADPglucose + PPi 478

However, two distinct routes lead to the plastidial pool of glucose 1-phosphate. One is well 479

established and driven by the Calvin cycle intermediate, fructose 6-phosphate which, in a two 480

step reaction, is converted to glucose 6-phosphate (mediated by the plastidial hexose 481

phosphate isomerise (pPGI) and, subsequently, to glucose 1-phosphate (mediated by the 482

plastidial phosphoglucomutase, pPGM). In A. thaliana this route is by far dominant and, 483

therefore, mutants lacking either functional pPGI or pPGM are largely (but not completely) 484

impaired in the biosynthesis of assimilatory starch. A second path consists of the direct import 485

of glucose 1-phosphate into the chloroplast where it joins the pool of the hexosyl phosphate 486

used by ADPglucose pyrophosphorylase. However, the import of glucose 1-phosphate cannot 487

compensate the biosynthetic route derived from fructose 6-phosphate and, therefore, the 488

amount of native starch granules that is found in pPGM-deficient plants accounts for only 489

slightly more than 1 % as compared to the wild type (see above). 490

To some extent, the data reported here concur with the metabolism of glucose 1-phosphate as 491

described for heterotrophic tissues, such as potato tubers (Fettke et al. 2008; Fettke et al. 492

2010). Tuber parenchyma cells are capable of importing glucose 1-phosphate and incorporate 493

the glucosyl residues into starch. Evidence has been presented that this process includes the 494

action of two transporters located at the plasmalemma and the amyloplast envelope 495

membranes, respectively (Fettke et al. 2010). In addition, the imported glucose 1-phosphate 496

has been shown to be incorporated, via the cytosolic phosphorylase isozyme, into cytosolic 497

heteroglycans (Fettke et al. 2008). However, this reaction seems to be of minor relevance for 498

the carbon flux directed to starch as a reduced activity of the cytosolic phosphorylase did not 499

affect the [U-14C]glucose 1-phosphate dependent labelling of starch . Nevertheless, this 500

pathway could be involved in buffering the cytosolic glucose 1-phosphate pool. 501

Following the import of glucose 1-phosphate into the amyloplasts, the subsequent 502

incorporation into starch is mainly mediated by the plastidial phosphorylase isozyme (Pho1; 503

Fettke et al. 2010). By contrast, in mesophyll cells glucose 1-phosphate imported into the 504

chloroplast leads to the formation of ADPglucose which then acts as glucosyl donor for starch 505



16

synthases (Tab. II). These results are in agreement with the conclusion that in Arabidopsis 506

thaliana the plastidial phosphorylase is not essential for starch metabolism under normal 507

growth conditions (Zeeman et al. 2004). 508

In potato tubers the Pho1-dependent path seems to be of minor relevance under normal in vivo 509

conditions. Potato mutants lacking a functional plastidial phosphoglucomutase accumulate by 510

far less reserve starch as compared to wild type controls (Tauberger et al. 2000). 511

Similarly, Arabidopsis plants (and potato leaves as well) lacking a functional plastidial 512

phosphoglucomutase (Caspar et al. 1985) contain less starch than wild type leaves. These 513

mutants are capable of forming small amounts of leaf starch by a pathway that is not directly 514

linked to the functional Calvin cycle (Fig. 6; see also Streb et al. 2009). However, Solanum 515

tuberosum lines possessing an antisense repression of both the cytosolic and the plastidial 516

phosphoglucomutase unexpectedly exhibit a phenotype similar to the wild type (Fernie et al. 517

2002). Similarly, the sta5-1 mutant from Chlamydomonas reinhardtii that is reported to lack 518

the plastidial phosphoglucomutase accumulates 4 to 12% of the normal starch amounts (Van 519

den Koornhuyse et al. 1996). In all these cases an import of glucose 1-phosphate into the 520

plastid can, at least partially, compensate the blocked glucose 6-phosphate/glucose 1-521

phosphate conversion inside the plastid and, therefore, explains the described phenotypes. 522

For several reasons, it is not unexpected that the flux outlined above often permits only a 523

partial restoration of starch biosynthesis. The interconversion of the two glucose 524

monophosphates, as mediated by the phosphoglucomutase, has a thermodynamical 525

equilibrium of close to unity. However, the quantification of the two glucose esters in several 526

tissues indicates that the glucose 6-phosphate levels exceed those of the glucose 1-phosphate 527

and, therefore, strongly suggest that in vivo the phosphoglucomutase-mediated reaction is not 528

at equilibrium (Tarnowsky et al. 1964; Alpers 1968; Tetlow et al. 1998). Thus, the import of 529

glucose 1-phosphate into the plastids appears to be limited by the cytosolic concentration of 530

the substrate. Interestingly, in mutants lacking a functional phosphoglucomutase the glucose 531

6-phosphate content is increased ten-fold but that of glucose 1-phosphate is only slightly 532

higher as compared to the wild type controls (Kofler et al. 2000). Furthermore, recently 533

published data strongly indicate that the expression of metabolite transporters located at the 534

chloroplast envelope is affected by alterations in the central carbon metabolism. In pPGM 535

lacking mutants of A. thaliana, the plastidial transport activity for both glucose 6-phosphate 536

and phosphoglycerate is significantly increased (Kunz et al. 2010). Possibly, the flux from the 537

plastidial glucose 6-phosphate pool into the cytosol is enhanced which results in a faster 538

formation of glucose 1-phosphate by the cytosolic phosphoglucomutase activity. Furthermore, 539



17

alterations in the central carbon metabolism affect the expression of other transporters of the 540

chloroplast envelope as well. In wild type leaves, expression of glucose 6-phosphate 541

transporter is weak (Niewiadomski et al. 2005). However, for the plastidial glucose-6-542

phosphate/phosphate translocator mutants both a strongly increased expression of a second 543

isoform of this transporter (GPT2) and an enhanced transport rate have been reported (Kunz 544

et al. 2010). 545

In order to analyse the flexibility of the primary metabolism, two double mutants from A. 546

thaliana have been generated in our lab that lack both, the plastidial phosphorylase (PHS1) 547

and the ADPglucose pyrophosphorylase or AtPHS1 plus pPGM. Phenotypical analyses of 548

these mutants are in progress. 549

The uptake of glucose 1-phosphate by isolated chloroplasts from leaves of A. thaliana, as 550

shown in this study, appears to contradict a previous study performed with spinach 551

chloroplasts. In this study the conclusion was reached that externally supplied glucose 1-552

phosphate does not permit any significant starch biosynthesis (Quick et al. 1995). However, 553

in the study cited chloroplasts were isolated from spinach leaves that had been fed for several 554

days with glucose. It remains to be clarified whether or not the long-term feeding of the 555

spinach leaves with glucose affects the uptake and /or intrachloroplastidial metabolism of 556

glucose 1-phosphate. In our experiments the glucose 1-phosphate-dependent incorporation 557

into starch occurs at relatively high rate that exceeds the rate of the photosynthesis-dependent 558

starch synthesis (data not shown). 559

The glucose 1-phosphate dependent starch labelling in mesophyll protoplasts is much higher 560

than that observed during incubation with glucose (Fig. 2). Surprisingly, simultaneous 561

incubation of the protoplasts with [U-14C]glucose 1-phosphate and orthophosphate results in a 562

strongly increased labelling of starch. This enhancement suggests an efficient limitation of the 563

glucose 1-phosphate import by the cytosolic orthophosphate level. However, the simultaneous 564

incubation with [U-14C]glucose 1-phosphate and glucose or glucose 6-phosphate also results 565

in an enhanced labelling of starch. Currently, this effect is difficult to explain. It should, 566

however, be taken into consideration that metabolic paths are often superimposed by sugar-567

mediated signalling effects that alter carbon fluxes (see above). 568

Our results clearly demonstrate that glucose 1-phosphate is taken up and, subsequently, is 569

very efficiently metabolized by mesophyll protoplasts from A. thaliana. The direct 570

interconnection between the cytosolic and plastidial glucose 1-phosphate pools suggests so far 571

unnoticed intracellular carbon fluxes towards the plastidial starch that increase the flexibility 572

of the plant primary metabolism. In planta under normal conditions these pathway seems to 573



18

be of minor relevance but under some conditions (such as lower temperatures; Sato et al. 574

2008) or distinct mutations it enable the plant to balance those particular situations. It remains 575

to be clarified whether or not extracellular glucose 1-phosphate and its fast uptake by 576

autotrophic cells will also constitute an efficient intercellular carbon flux. 577

578

Materials and Methods 579

580

Plant Material 581

Arabidopsis thaliana L. plants (Col-0, Ws, pgm1, Atphs1-1, Atphs1-2) were grown in growth 582

chambers using either 12 h light [20°C] / 12 h dark [16°C] cycle or 14h light [22°C]/ 10h dark 583

[17°C]. Throughout the light / dark cycles, relative humidity was 60%. 584

585

Protoplast preparation 586

Mesophyll protoplasts were prepared from Arabidopsis plants grown for 3-4 weeks in soil. 587

Leaves (3-4 g each) that had been washed with water were transferred into 400 mM mannitol 588

dissolved in water. Following slicing (approximately 4mm thickness) the leaf material was 589

incubated for 3-3.5 h at 25°C under continuous gentle shaking in a incubation medium 590

consisting of 5 mM MES-KOH pH 5.6, 400 mM mannitol, 8 mM CaCl2, 1 % [w/v] cellulase 591

Onozuka R-10 (no. 16419; from Trichoderma vivide; Serva, Heidelberg, Germany), and 0.25 592

% [w/v] macerozyme R-10 (no. 28302; from Rhizopus sp.; Serva). Following incubation, 593

protoplasts were separated from the residual leaf material by filtration through a nylon mesh 594

(350µm). In the filtrate the protoplasts were pelleted by centrifugation (90 g for 12 min; RT). 595

After resuspending in the resuspension medium (5 mM MES-KOH pH 5.6, 400 mM 596

mannitol, 15 mM MgCl2) the protoplasts were washed three times with the same medium and 597

centrifugation (as above). Subsequently, the number of protoplasts was determined by using a 598

Thoma counting chamber (Thoma, Marienfeld, Germany) and the protoplast suspension was 599

diluted to 3x105 cells per mL (Gandhir and Khurana 2001) by using the resuspension 600

medium. The proportion of intact protoplast was determined by treatment with fluoresceine 601

diacetate (Larkin, 1976). For all experiments, protoplast preparations with an intactness of 602

more than 90% were used. 603

604

Labelling experiments 605

a) 14C incorporation into starch. The labelling experiments were performed by incubating 606

15 mL of the protoplast suspension with [U-14C]glucose 1-phosphate or [U-14C]glucose (final 607



19

concentration of 20 mM each; containing 111 kBq or 46.25 kBq; GE Healthcare, Freiburg, 608

Germany). Alternatively, the protoplasts (7.5 mL each) were incubated with [U-14C]glucose 609

1-phosphate (in each case: final concentration 20 mM; containing 37 kBq), [U-14C]glucose 1-610

phosphate plus unlabelled 10 mM glucose, [U-14C]glucose 1-phosphate plus unlabelled 10 611

mM glucose 6-phosphate, [U-14C]glucose 1-phosphate plus 10 mM unlabelled 612

orthophosphate. At intervals aliquots of the protoplast suspension were withdrawn, 613

immediately frozen in liquid nitrogen and stored at -80°C until use. Following thawing and 614

centrifugation (10,000 g for 12 min; 4°C) the pellets were resolved in 20 % [v/v] ethanol and 615

centrifuged (as above). The resulting pellets were resuspended in 80 % [v/v] ethanol and 616

decolourized at 70°C. The samples were centrifuged (as above) and the pellets were collected. 617

Following the addition of 1 mL water each, the suspensions were mixed and centrifuged (as 618

above). Subsequently, 500 µL 200 mM KOH was added to each pellet and the mixtures were 619

incubated for 1h at 95°C. Following neutralisation with 1 M acetic acid, the samples were 620

centrifuged (as above) and the 14C content of the supernatants was monitored by using a 621

liquid scintillation counter (Beckman Coulter, Krefeld, Germany). As revealed by treatment 622

with amyloglucosidase, more than 98% of the 14C-labelled material solubilized by KOH 623

consists of α-polyglucans and, therefore, this fraction is designated as starch. 624

625

b) Exchange experiments. 626

The orthophosphate related exchange was analyzed by two types of experiments. Throughout 627

both types of experiments, the protoplasts were illuminated (80 µmol s-1m-2; room 628

temperature). Type 1: Resuspended protoplasts (each 15 mL) were incubated for 5 min in the 629

presence of 10 mM (185 kBq) [33P]orthophosphate or in a mixture containing 10 mM 630

(185kBq) [33P]orthophosphate and 20 mM unlabelled glucose 1-phosphate. The protoplasts 631

were then repeatedly washed with resuspension medium until the total radioactivity in the 632

washing solution was below 100 dpm. The pelleted protoplasts were then resuspended in 1 633

mL water and the radioactivity was monitored using a liquid scintillation counter. Type 2: 634

Protoplasts (30 mL) were incubated for 10 min with 1.85 MBq [33P]orthophosphate (specific 635

activity 3000 Ci/mmol) and, subsequently, were washed three times with resuspension 636

medium. The protoplast suspension was then divided in two equal parts. One part was 637

incubated for 5 min in the presence of 20 mM unlabelled glucose 1-phosphate. The other part 638

(control) was incubated for 5 min in the absence of glucose 1-phosphate. Following 639

incubation the protoplasts were pelleted by centrifugation (90 g for 12 min) and in the 640

supernatant the 33P content was determined using a liquid scintillation counter. 641



20

642

c) Short term uptake experiments 643

For short time uptake experiments protoplasts (4 mL) were incubated with either glucose 1-644

phosphate, glucose 1-phosphate and glucose, or glucose 1-phosphate and glucose 6-phosphate 645

(concentration as indicated and 37 kBq [U-14C]glucose 1-phosphate was added) for 30 s at 646

room temperature and illumination. The protoplasts were then immediately centrifuged (90 g 647

for 3 min, 4°C) and the supernatant was discarded. The pelleted protoplasts were resuspended 648

in 8 mL resuspension medium and centrifuged again (90 g for 3 min, 4°C). This washing step 649

was repeated two times. Finally 1 mL water was added to the the pelleted protoplasts and the 650

total 14C content was quantified by liquid scintillation counting. 651

652

d) Quantification of 14C-ADPglucose 653

Protoplasts were incubated in a resuspension medium containing 1mM unlabelled glucose 1-654

phosphate and 74 kBq [U-14C]glucose 1-phosphate in the light or in the dark. In the later case, 655

protoplasts were pre-darkened for 1h. After 10 or 20min incubation, the entire suspension was 656

immediately frozen in liquid nitrogen. Following addition of ethanol (final concentration 50% 657

[v/v]), the suspension was heated (10min at 90°C). Following cooling and centrifugation 658

(10,000 g for 10min), each pellet was used for isolation of starch and monitoring of the 14C 659

content (see above). Each supernatant (containing soluble metabolites plus externally supplied 660

compounds) was lyophilised and was then dissolved in 3.5 mL water. 1.5 mL of each solution 661

was added to the reaction buffer (as final concentration, 40 mM Tricin pH 8.0, 1.6 mM 662

EDTA, 20 mM potassium acetat, 75 mM citrate, and 13 mg native potato tuber starch). The 663

glucosyl transfer from ADPglucose to the native starch granules was started by addition of 17 664

µg recombinant starch synthase III (AtSSIII) and was continued for 30 min at 30°C. 665

Subsequently 25µmol unlabelled ADPglucose and 5µg AtSSIII were added and the mixture 666

was incubated for an additional 1h. As controls, either the AtSSIII was omitted (negative 667

control) or, alternatively, 8.3 kBq [U-14C]ADPglucose (positive control) was added during 668

incubation. Finally the samples were centrifuged (14,000 g for 2 min) and the pelleted starch 669

was washed six times by resuspending in 1mL water each and centrifugation (as above). In 670

the pelleted starch the total 14C content was quantified by liquid scintillation counting. 671

672

Chloroplast isolation and labelling 673

Chloroplasts were prepared according to Shi et al. (2000) with minor modifications. 674

Approximately 2 g Arabidopsis leaves were harvested in the beginning of the light period, 675



21

freed of mid veins, cut into small slices and incubated in 50 mL precooled isolation buffer 676

containing 20 mM Tricine-NaOH pH 8.4, 300 mM sorbitol, 10 mM EDTA, 10 mM KCl, 0.25 677

% [w/v] BSA, 5 mM Na-ascorbate, and 5 mM DTE. The slices were homogenized two times 678

for three seconds each using a Waring Blendor and the resulting homogenate was filtered 679

through two layers Miracloth (Calbiochem-Novabiochem Corporation, LaJolla, CA, USA). 680

The filtrate was centrifuged (750 x g for 1 min; 4°C) and the pelleted chloroplasts were 681

resuspended in precooled isolation buffer (as above). The isolated chloroplasts were incubated 682

with [U-14C]glucose 1-phosphate (final concentration of 16.67 mM; containing 74 kBq; final 683

volume 4 mL). As controls the isolated chloroplasts were broken by using a potter and the 684

homogenate was incubated under otherwise identical conditions. Alternatively, the 685

chloroplasts were incubated with [U-14C]glucose 1-phosphate (16.67 mM; containing 74 kBq; 686

final volume 4 mL) or [U-14C]glucose 1-phosphate (16.67 mM; containing 74 kBq; final 687

volume 4 mL) plus unlabelled 6.67 mM orthophosphate or glucose 6-phosphate (16.67 mM; 688

containing 74 kBq; final volume 4 mL) or [U-14C]glucose 1-phosphate (16.67 mM; 689

containing 74 kBq; final volume 4 mL) plus unlabelled glucose (16.67mM) or [U-14C]glucose 690

1-phosphate (16.67 mM; containing 74 kBq; final volume 4 mL) plus unlabelled glucose 6-691

phosphate (16.67 mM). Throughout the experiments, the chloroplasts were illuminated (80 692

µmol s-1m-2; room temperature). At intervals, aliquots of the suspension were withdrawn and 693

immediately frozen in liquid nitrogen. Following thawing, the samples were centrifuged 694

(10,000 x g for 10 min; 4°C). The pellets were resuspended in 20 % [v/v] ethanol and were 695

centrifuged again (as above). The pellets were decolourized in 80 % [v/v] ethanol at 70°C (20 696

min). After the centrifugation (as above) the pellets were washed three times with 80 % [v/v] 697

ethanol. The resulting pellets were treated with 200 mM KOH for 1h at 95°C. Following 698

neutralisation with 1 M acetic acid, the samples were centrifuged and the 14C content in the 699

supernatant (i.e. starch; see above) was monitored. 700

701

Isolation of native starch granules 702

During the light period leaf material (35 g) from the pgm1 mutant plants was harvested and 703

was immediately frozen in liquid nitrogen. Following homogenization using a mortar, native 704

starch was isolated according to Ritte et al. (2000) with minor modification. Following a 705

passage through a percoll cushion (4,000 g for 5 min; 4 °C) the pelleted starch was washed 706

twice with extraction buffer (see Ritte et al. 2000) and resuspended in 200 µL of the same 707

buffer. Contaminating compounds were removed by adding an equal volume of 708

phenol:chloroform (v/v) mixture (1:1) to the starch suspension and centrifugation (9,000 x g 709



22

for 1 min). The aqueous phase containing the starch particles was mixed with 1 mL of 710

chloroform and centrifuged (as above). Subsequently the upper phase was centrifuged for 5 711

min at 13,000 x g and the pellet starch was collected. 712

Potato tuber starch was isolated according to Ritte et al. (2000). Potato tuber tissue (15-20 g) 713

was mixed with 50 mL buffer (20 mM Hepes/KOH, pH 7.5 and 0.05% Triton-X-100) and 714

was homogenized for 20 s using a Waring blender. The homogenate was passed through 715

nylon net (100 µm mesh width). In the filtrate, starch granules were allowed to settle for 20 716

min and the supernatant was discarded. The starch pellet was washed 5 times with water and 717

finally was lyophilized. SEM analyses of the native starch granules were performed after 718

coating with gold with a Quanta apparatus (Philips). 719

720 Extraction of buffer-soluble proteins 721

Leaf material was frozen in liquid nitrogen and homogenized using a mortar. Per 1 g of fresh 722

weight 1 mL precooled buffer A (100 mM HEPES-NaOH pH 7.5, 1 mM EDTA, 2 mM 723

dithioerythritol [DTE], 10 % [w/v] glycerol, and 0.5 mM phenylmethylsulfonyl fluoride) was 724

added. All subsequent steps were performed at 4°C. The resulting homogenates were 725

centrifuged (20,000 x g for 12 min) and the supernatants were passed through a nylon net 726

(range 60-100 µm). The filtrates were used for protein quantification and for native PAGE. 727

728

Quantification of proteins and starch 729

Buffer soluble proteins were quantified by using the microassay of Bradford (1976) with BSA 730

serving as standard. Leaf starch content was determined essentially as described by Abel et al. 731

(1996). Pooled leaf material from several plants was frozen in liquid nitrogen and 732

homogenized using a mortar. Samples (50 to 80 mg fresh weight of the homogenized frozen 733

material) were extracted two times with 1 mL 80 [v/v] ethanol for 20 min at 80°C. Insoluble 734

material was washed with 1 mL water and was then lyophilized. After resuspension in 0.5 mL 735

200 mM KOH and incubation at 95°C for 1h, the samples were neutralized by adding 1 M 736

acetic acid and centrifuged (10,000 g for 10 min). Aliquots of the supernatant (50 µL each) 737

were mixed with 50 µL amyloglucosidase solution (starch determination kit, R-Biopharm, 738

Darmstadt, Germany) and incubated at 50°C over night. The enzymatic quantification of 739

glucose was performed following the instructions of the manufacturer. 740

741

Native PAGE and activity staining 742

Native PAGE followed by phosphorylase activity staining was performed as described 743

elsewhere (Fettke et al. 2005a). 744



23

745

Cloning and expression of starch synthase III (AtSSIII; At1g11720) 746

RNA was isolated from 100 mg Arabidopsis leaves, harvested after 3 h illumination, by using 747

the total RNA purification Kit for plant material from Macherey-Nagel (Düren, Germany). 748

First strand cDNA from AtssIII was synthesized using the SuperScript II Reverse 749

Transcriptase (Invitrogen, Karlsruhe, Germany) following the manufacturer’s instructions and 750

the 3`primer (5`-3`:CTTGCGTGCAGAGTGATAGAGCTCAAGATA). Subsequently, the 751

cDNA served as template for the PCR reaction. Both, the EcoRI and XhoI linked primers 752

(5`forward primer (5`-3`): GAATCCGATGGAAGTGCTCAGAAAAGAAC and 3`reverse 753

primer (5`-3`): CTCGAGCTTGCGTGCAGAGTGATAGAGCTC) include the complete 754

cDNA except the predicted plastidial transit sequence (60 bp from the start). For amplification 755

of the 3.0 kb fragment, a Phusion Taq Polymerase (Finnzymes, Espoo, Finland) was applied. 756

In a 50 µl reaction volume, 2 µl from the reverse transcription reaction was used as template 757

(30 cycles; annealing temperature 49 °C; 60 sec for extension). Except were stated, the 758

instructions of the manufacturer were followed. The 3.0 kb AtssIII fragment was subcloned 759

into pGEM T-easy vector (Promega, Mannheim, Germany). Subsequently, the AtssIII 760

fragment was restricted by EcoRI/XhoI and ligated to the expression vector pET23b 761

(Novagen, Darmstadt, Germany). For heterologous expression, the AtssIII clone was 762

transformed into E. coli BL21 strain. E. coli cells were grown at 37 °C in 600 ml culture in 763

Luria-Bertani medium containing 100 µgml-1 ampicillin until a OD600 = 0.8 was reached. 764

Expression of the AtSSIII protein was then induced by isopropylthio-β-galactoside (final 765

concentration 0.1 mM; 4 h at 30 °C). Bacterial cells were collected by centrifugation (5,000 x 766

g for 10 min, 4°C), resuspended in 15 ml extraction buffer (20 mM sodium phosphate buffer, 767

pH 8.0, 500 mM NaCl, 20 mM imidazole, 2.5 mM dithioerythritol [DTE] and protease 768

inhibitor cocktail I; Calbiochem, Bad Soden, Germany), and were then broken by 769

ultrasonification (90 s short pulses). The homogenate was cleared by centrifugation (13, 000 x 770

g for 15 min; 4°C) and the supernatant was loaded on a HisTrap HP column (product no. 17-771

5319-01; GE Healthcare, Freiburg, Germany). Subsequently, the column was washed with 15 772

ml extraction buffer and the His-tagged AtSSIII protein was eluted stepwise by increasing 773

concentrations of imidazole (100-500 mM; in extraction buffer pH 8.0). AtSSIII protein 774

containing fractions were identified by western blotting using an anti-His-antibody (Qiagen, 775

Hilden, Germnay), pooled and concentrated by ultrafiltration (MWCO 30 kD; Amicon Ultra, 776

Millipore, Schwalbach, Germany). Subsequently, the purified AtSSIII preparation was 777

equilibrated with a buffer containing 50 mM Hepes-NaOH, pH 7.5, 1mM EDTA and 2 mM 778



24

DTE. Aliquots of the protein preparation were frozen in liquid nitrogen and were stored at -779

80°C. 780

781

Acknowledgments 782

The authors thank Ms Ulrike Krause for excellent assistance, Ms Henrike Brust and Ms 783

Kerstin Pusch for assistance with the recombinant starch synthase III experiments and John 784

Lunn (Max-Planck-Institut of Molecular Plant Physiology, Potsdam-Golm, Germany) for 785

kindly providing the ADPglucose pyrophosphorylase from E. coli. The authors are indebted 786

to Professor Dr. K. Hausmann (Free University of Berlin) for his support of the SEM analyses 787

of the starch granules. 788

789

References 790

791

Abel, G. J., Springer, F., Willmitzer, L., and Kossmann, J. (1996) Cloning and functional 792

analysis of a cDNA encoding a novel 139 kDa starch synthase from potato (Solanum 793

tuberosum L.). Plant J. 10: 981–91. 794

795

Alpers, J. B. (1968) Studies on phosphomutases. Effects of 1,3-diphosphoglycerate on 796

phosphoglucomutase. J. Biol. Chem. 243: 1698-1704. 797

798

Bradford, M. M. (1976) A rapid and sensitive method for the quantification of microgram 799

quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-54. 800

801

Caspar, T., Huber, S. C., and Somerville, C. (1985) Alterations in growth, photosynthesis, 802

and respiration in a starchless mutant of Arabidopsis thaliana (L.) deficient in chloroplast 803

phosphoglucomutase activity. Plant Physiol. 79: 11-7. 804

805

Coates, S. A., ap Rees, T. (1994) Metabolism of glucose monophosphates by leucoplasts and 806

amyloplasts from soybean suspension cultures. Phytochemistry 35: 881-883. 807

808

Colleoni C., Linka, M., Deschamps, P., Handford, M. G., Dupree, P., Weber, A. P. M., 809

and Ball, S. (2010). Phylogenetic and biochemical evidence supports the recruitment of an 810

ADP-glucose translocator for the export of photosynthate during plastid endosymbiosis. Mol 811

Biol Evol. 27: 2691-2701. 812



25

813

Eicks, M., Maurion, V., Knappe, S., Flügge, U-.I., and Fischer, K. (2002) The plastidic 814

pentose phosphate translocator represents a link between the cytosolic and the plastidic 815

pentose phosphate pathways in plants. Plant Physiol. 128: 512-22. 816

817

Fernie, A. R., Swiedrych, A., Tauberger, E., Lytovchenko, A., Trethewey, R. N., and 818

Willmitzer, L. (2002) Potato plants exhibiting combined antisense repression of cytosolic 819

and plastidial isoforms of phosphoglucomutase surprisingly approximate wild type with 820

respect to the rate of starch synthesis. Plant Physiol. Biochem. 40: 921-7. 821

822

Ferro, M., Salvi, D., Riviere-Rolland, H., Vermat, T., Seigneurin-Berny, D., Grunwald, 823

D., Garin, J., Joyard, J., and Rolland, N. (2002) Integral membrane proteins of the 824

chloroplast envelope: identification and subcellular localization of new transporters. Proc. 825

Natl. Acad. Sci. USA 99: 11487-92. 826

827

Fettke, J., Albrecht, T., Hejazi, M., Mahlow, S., Nakamura, Y., and Steup, M. (2010) 828

Glucose 1-phosphate is efficiently taken up by potato (Solanum tuberosum) tuber parenchyma 829

cells and converted to reserve starch granules. New Phytol. 185: 663-75. 830

831

Fettke, J., Eckermann, N., Tiessen, A., Geigenberger, P., and Steup, M. (2005b) 832

Identification, subcellular localization and biochemical characterization of water-soluble 833

heteroglycans (SHG) in the leaves of Arabidopsis thaliana L.: distinct SHG reside in the 834

cytosol and in the apoplast. Plant J. 43: 568-85. 835

836

Fettke, J., Nunes-Nesi, A., Alpers, J., Szkop, M., Fernie, A. R., and Steup, M. (2008) 837

Alterations in cytosolic glucose phosphate metabolism affect structural features and 838

biochemical properties of starch-related heteroglycans. Plant Physiol. 148: 1614-29. 839

840

Hendriks, J.H., Kolbe, A., Gibon, Y., Stitt, M., and Geigenberger, P. (2003) ADP-glucose 841

pyrophosphorylase is activated by posttranslational redox-modification in responce to light 842

and to sugars in leaves of Arabidopsis and other plant species. Plant Physiol. 133: 838-49. 843

844



26

Kammerer, B., Fischer, K., Hilpert, B., Schubert, S., Gutensohn, M., Weber, A., and 845

Flügge, U-.I. (1998) Molecular characterization of a carbon transporter in plastids from 846

heterotrophic tissues: the glucose 6-phosphate / phosphate antiporter. Plant Cell 10: 105-17. 847

848

Kofler H., Häusler, R.E., Schulz, B., Gröner, F., Flügge U.-I., and Weber, A. (2000) 849

Molecular characterisation of a new mutant allele of the plastid phosphoglucomutase in 850

Arabidopsis, and complementation of the mutant with the wild-type cDNA. Mol Gen Genet 851

263: 978-86. 852

853

Kosegarten, H., Mengel, K. (1994) Evidence for a glucose 1-phosphate translocator in 854

storage tissue amyloplasts of potato (Solanum tuberosum L.) suspension-cultured cells. 855

Physiol. Plant. 91: 111-120. 856

857

Kunz, H.H., Häusler, R.E., Fettke, J., Herbst, K., Niewiadomski, P., Gierth, M., Bell, K., 858

Steup, M., Flügge, U.-I., Schneider, A. (2010) The role of plastidial glucose-6-859

phosphate/phosphate translocators in vegetative tissues of Arabidopsis thaliana mutants 860

impaired in starch biosynthesis. Plant Biol. 12 (Suppl. 1): 115-128. 861

862

Larkin, R. J. (1976) Purification and viability determinations of plant protoplasts. Planta 863

128: 213-6. 864

865

Lin, T. –P., Caspar, T., Somerville, C., and Preiss, J. (1988) Isolation and characterisation 866

of a starchless mutant of Arabidopsis thaliana (L.) lacking ADP-glucose pyrophosphorylase 867

activity. Plant Physiol. 86: 1131-5. 868

869

Munoz, F. J., Baroja-Fernandez, E., Moran-Zorzano, M. T., Viale, A. M., Etxeberria, E., 870

Alonso-Casajus, N., and Pozueta-Romero, J. (2005) Sucrose synthase controls both 871

intracellular ADP glucose levels and transitory starch biosynthesis in source leaves. Plant 872

Cell Physiol. 46: 1366-76. 873

874

Naeem, M., Tetlow, I. J., Emes, M. J. (1997) Starch synthesis in amyloplasts purified from 875

developing potato tubers. Plant J. 11: 1095-1103. 876

877



27

Niewiadomski, P., Knappe, S., Geimer, S., Fischer, K., Schulz, B., Unte, U. S.. Rosso, M. 878

G., Ache, P., Flügge, U-. I., and Schneider, A. (2005) The Arabidopsis plastidic glucose 6-879

phosphate/phosphate translocator GPT1 is essential for pollen maturation and embryo sac 880

development. Plant Cell 17: 760-75. 881

882

Niittylä, T., Messerli, G., Trevisan, M., Chen, J., Smith, A. M., and Zeeman, S. C. (2004) 883

A previously unknown maltose transporter essential for starch degradation in leaves. Science 884

303: 87-9. 885

886

Quick, W. P., Scheibe, R., and Neuhaus, H. E. (1995) Induction of hexose-phosphate 887

translocator activity in spinach chloroplasts. Plant Physiol. 109: 113-21. 888

889

Ritte, G., Eckermann, N., Haebel, S., Lorberth, R., and Steup, M. (2000) 890

Compartmentation of the starch-related R1 protein in higher plants. Starch 52: 179-85. 891

892

Rolland, F., Moore, B., and Sheen, J. (2002) Sugar sensing and signaling in plants. Plant 893

Cell 14: S185-S205. 894

895

Satoh H, Shibahara K, Tokunaga T, Nishi A, Tasaki M, Hwang SK, Okita TW, Kaneko 896

N, Fujita N, Hosaka Y, Sato A, Utsumi Y, Ohdan T, Nakamura Y. 2008. Mutation of the 897

plastidial alpha-glucan phosphorylase gene in rice affects the synthesis and structure of starch 898

in the endosperm. Plant Cell 20: 1833-1849. 899

900

Schneider, A., Häusler, R. E., Kolukisaoglu, U., Kunze, R., van der Graaff, E., 901

Schwacke, R., Catoni, E., Desimone, M., and Flügge, U-. I. (2002) An Arabidopsis 902

thaliana knock-out mutant of the chloroplast triose phosphate/phosphate translocator is 903

severely compromised only when starch synthesis, but not starch mobilisation is abolished. 904

Plant J. 32: 685-99. 905

906

Schwacke, R., Schneider, A., van der Graaf, E., Fischer, K., Catoni, E., Desimone, M., 907

Frommer, W.B., Flügge, U-.I., and Kunze, R. (2003) ARAMEMNON, a novel database for 908

Arabidopsis integral membrane proteins. Plant Physiol. 131: 16-26. 909

910



28

Seifert, G. J. (2004) Nucleotide sugar interconversions and cell wall biosynthesis: how to 911

bring the inside to the outside. Curr. Opin. Plant Biol. 7: 277-84. 912

913

Shi, L.-X., Lorkovic, Z. J., Oelmüller, R., and Schröder, W. P. (2000) The low molecular 914

mass PsbW protein is involved in the stabilization of the dimeric photosystem II complex in 915

Arabidopsis thaliana. J. Biol. Chem. 275: 37945-50. 916

917

Smeekens, S. (1998) Sugar regulation of gene expression in plants. Curr. Opin. Plant Biol. 1: 918

230-4. 919

920

Streb, S., Egli, B., Eicke, S., and Zeeman, S. C. (2009) The debate on the pathway of starch 921

synthesis: a closer look at low-starch mutants lacking plastidial phosphoglucomutase supports 922

the chloroplast-localized pathway. Plant Physiol. 151: 1769-72. 923

924

Tarnowsky, W., Kittler, M., and Hilz, H. (1964) Die Wirkung von Cortisol auf die 925

Umwandlung von Hexose Phosphaten in Glycogen. Biochem. Z. 341: 45-63. 926

927

Tauberger, E., Fernie, A. R., Emmermann, M., Renz, A., Kossmann, J., Willmitzer, L., 928

and Trethewey, R.N. (2000) Antisense inhibition of plastidial phosphoglucomutase provides 929

compelling evidence that potato tubers amyloplasts import carbon from the cytosol in the 930

form of glucose-6-phosphate. Plant J. 23: 43-53. 931

932

Tetlow, I. J., Blissett, K. J., and Emes, M. J. (1998) Metabolite pools during starch 933

synthesis and carbohydrate oxidation in amyloplasts isolated from wheat endosperm. Planta 934

204: 100-8. 935

936

Tetlow, I. J., Bowsher, C. G., Emes, M. J. (1996) Reconstitution of the hexose phosphate 937

translocator from the envelope membranes of wheat endosperm amyloplasts. Biochem. J. 319: 938

717-723. 939

940

Van den Koornhuyse, N., Libbessart, N., Dulrue, B., Zabawinski, C., Decq, A., Iglesias, 941

A., Cartoni, A., Preiss, J., and Ball, S. (1996) Control of starch composition and structure 942

through substrate supply in the monocellular alga Chlamydomonas reinhardtii. J. Biol. Chem. 943

271: 16281-7. 944



29

945

Weber, A. P. M. (2004) Solute transporters as connecting elements between cytosol and 946

plastid stroma. Curr. Opin. Plant Biol. 7: 247-53. 947

948

Weber, A., Servaites, J. C., Geiger, D. R., Kofler, H., Hille, D., Gröner, F., Hebbeker, U., 949

and Flügge, U-.I. (2000) Identification, purification, and molecular cloning of a putative 950

plastidic glucose translocator. Plant Cell 12: 787-801. 951

952

Weise, S. E., Weber, A. P. M., and Sharkey, T. D. (2004) Maltose is the major form of 953

carbon exported from chloroplasts at night. Planta 218: 474-82. 954

955

Zeeman, S. C., Thorneycroft, D., Schupp, N., Chapple, A., Weck, M., Dunstan, H., 956

Haldimann, P., Bechtold, N., Smith, A. M., and Smith, S. M. (2004) Plastidial alpha-957

glucan phosphorylase is not required for starch degradation in Arabidopsis leaves but has a 958

role in the tolerance of abiotic stress. Plant Physiol. 135: 849-58. 959

960

Figure Legends 961

962

Fig. 1 Uptake of external glucose 1-phosphate by Arabidopsis mesophyll protoplasts. 963

(A+B) Short term uptake using varying concentratons of glucose 1-phosphate. Protoplasts 964

were incubated for 30s with [U-14C]glucose 1-phosphate (concentrations as indicated), 965

washed and the 14C label inside the protoplasts was determined. The Michealis-Menten (A) 966

and the Lineweaver-Burk (B) plots are given. The mean of two independently performed 967

experiments (two replicas each) and the SD (n=4) are given. 968

(C) Selectivity of glucose 1-phosphate uptake by protoplasts. After 30s incubation of the 969

protoplasts with 200 or 400 µM [U-14C]glucose 1-phosphate, [U-14C]glucose 1-phosphate and 970

equal concentration of glucose or glucose 6-phosphate the protoplasts were washed and the 971

total 14C content of the protoplasts was determined. The mean of three independent 972

experiments and SD are given. 973

974

Fig. 2 Utilization of external glucose 1-phosphate by mesophyll protoplasts from A. 975

thaliana. 976

(A) Glucose or glucose 1-phosphate dependent incorporation into starch. Protoplasts were 977

incubated for 20 min with either [U-14C]glucose 1-phosphate (G1P; 20 mM) or [U-978



30

14C]glucose (Glc; 20 mM) in the light or in the dark. Subsequently, starch was isolated and 979

the 14C-glucosyl incorporation was monitored. The mean of two independently performed 980

experiments (three replicas each) and the SD are given. 981

(B) Glucose 1-phosphate uptake and utilization by mesophyll protoplasts. Protoplasts were 982

incubated with [U-14C]glucose 1-phosphate (G1P; 20 mM), [U-14C]glucose 1-phosphate (20 983

mM) plus unlabelled glucose (10 mM; G1P/Glc), [U-14C]glucose 1-phosphate (20 mM) plus 984

unlabelled glucose 6-phosphate (10 mM; G1P/G6P) or with [U-14C]glucose 1-phosphate (20 985

mM) plus unlabelled orthophosphate (10 mM; G1P/Pi) for 5 or 10 min in the light. 986

Subsequently, starch was isolated and the 14C-glucosyl incorporation was determined. The 987

mean of three independently performed experiments and SD are given. 988

(C+D) Counter-exchange of glucose 1-phosphate and orthophosphate. In C protoplasts were 989

incubated for 5 min in the light with [33P]orthophosphate (10 mM; Pi), [33P]orthophosphate 990

(10 mM) and unlabelled glucose 1-phosphate (20 mM; Pi/G1P) or [33P]orthophosphate (10 991

mM) and unlabelled glucose (20 mM; Pi/Glc). The protoplasts were then washed until no 33P- 992

label could be detected in the washing solution. The 33P content of the protoplasts was 993

monitored. The mean of two independently performed experiments (two replicas each) and 994

the SD (n=4) are given. In D protoplasts were incubated for 10 min in the light with 995

[33P]orthophosphate (10 mM). Following removal of the residual external 33P-label by 996

washing, the protoplast suspension was separated into two equal parts. To one part unlabelled 997

glucose 1-phosphate (20 mM) was added (+G1P). In the other part (control) glucose 1-998

phosphate was omitted (-G1P). After 5 min illumination the protoplasts of both aliquots were 999

pelleted and the 33P content in the supernatant was determined. A typical experiment out of 1000

two independently performed experiments (each 3 replicas) and SD is given. 1001

1002

Fig. 3 Glucose 1-phosphate dependent incorporation into starch by chloroplasts from A. 1003

thaliana. 1004

(A) Chloroplasts isolated from wild type plants were incubated with [U-14C]glucose 1-1005

phosphate (16.67 mM) in the light. As a control, chloroplasts were broken using a potter and 1006

were otherwise treated identically. After incubation the starch was extracted and the 14C 1007

content was monitored. The mean of two independently performed experiments (two replicas 1008

each) and the SD (n=4) are given. intact – intact chloroplasts; broken – mechanically 1009

disintegrated chloroplasts were incubated. 1010

(B) Selectivity of the glucose 1-phosphate dependent incorporation into starch. Illuminated 1011

chloroplasts were incubated with [U-14C]glucose 1-phosphate (16.67 mM each) or [U-1012



31

14C]glucose 1-phosphate plus unlabelled orthophosphate (6.67 mM) or [U-14C]glucose 6-1013

phosphate (16.67 mM each). After isolation of the starch, the 14C-glucosyl incorporation was 1014

determined. The mean of two independently performed experiments (two replicas each) and 1015

the SD (n=4) are given. G1P – incubation with [U-14C]glucose 1-phosphate; G1P/Pi – 1016

incubation with [U-14C]glucose 1-phosphate and unlabelled orthophosphate; G6P – 1017

incubation with [U-14C]glucose 6-phosphate. 1018

(C) The glucose 1-phosphate dependent incorporation into starch is unaffected by the addition 1019

of unlabelled glucose 6-phosphate or glucose. Illuminated chloroplasts were incubated with 1020

[U-14C]glucose 1-phosphate (16.67 mM each) only (G1P), with [U-14C]glucose 1-phosphate 1021

plus unlabelled glucose 6-phosphate (16.67 mM each; G1P/G6P) or with [U-14C]glucose 1-1022

phosphate plus unlabelled glucose (16.67 mM each; G1P/Glc). Following 10 or 20 min 1023

incubation, starch was isolated and the content of 14C was quantified. The mean of two 1024

independently performed experiments (two relicas each) and the SD (n=4) are given. 1025

1026

Fig. 4 Impact of the plastidial phosphorylase isozyme on the incorporation into starch 1027

during glucose 1-phosphate incubation. 1028

(A) Phosphorylase pattern as revealed by native PAGE. Leaves were harvested during the 1029

light period. Buffer-soluble proteins were extracted from Arabidopsis wild type or AtPHS1 1030

knock-out plants. To each lane, 20 µg protein was applied. The separation gel contained 0.4 1031

% [w/v] glycogen. Following electrophoresis, the separation gel was equilibrated, incubated 1032

and stained. I – slowly migrating cytosolic phosphorylase (AtPHS2); II – fast migrating 1033

cytosolic phosphorylase (AtPHS2); III – slowly migrating plastidial phosphorylase (AtPHS1); 1034

IV – fast migrating plastidial phosphorylase (AtPHS1) 1035

(B) Impact of the plastidial phosphorylase (AtPHS1) on the glucose 1-phosphate dependent 1036

labelling of starch in Arabidopsis mesophyll protoplasts. Protoplasts from wild type (wt) or 1037

plastidial phosphorylase knock-out plants (lines Atphs1-1 and Atphs1-2) were incubated with 1038

[U-14C]glucose 1-phosphate (20mM). At intervals aliquots of the protoplast suspension were 1039

withdrawn and the incorporation of [U-14C]glucosyl residues into starch was monitored. The 1040

mean of two independently performed experiments (two replicas each) and the SD (n=4) is 1041

given. 1042

1043

Fig. 5 Starch synthesis in pgm1 mutants. 1044

(A) Protoplasts were isolated from leaves of wild type plants (wt), a mutant lacking the 1045

plastidial phosphoglucomutase activity (pgm1) or having a reduced activity of the 1046



32

ADPglucose pyrophosphorylase (adg1) and were incubated with [U-14C]glucose 1-phosphate 1047

(20 mM) in the light. Subsequently, starch was extracted and the 14C-glucosyl incorporation 1048

into the starch was determined. The data represented the mean of three incubations and the 1049

SD. 1050

(B+C) Native starch granules isolated from leaves of wild type plants (wt; B) and the pgm1 1051

mutant (C) as analysed by SEM. The bar is equivalent to 20µm. 1052

1053

Fig. 6 Proposed carbon fluxes in Arabidopsis leaves. 1054

G1P – glucose 1-phosphate; G6P – glucose 6-phosphate; F6P – fructose 6-phosphate; TP – 1055

triose phosphate; ADPG – ADPglucose; SS – starch synthases; AGPase – ADPglucose 1056

pyrophosphorylase; pPGM – plastidial phosphoglucomutase 1057

1058

Tables 1059

1060

Table I 14C incorporation into starch using glucose 1-phosphate in presents of unlabelled 1061

hydrogen carbonate. Protoplasts were incubated in presents or absence of 5mM HCO3- for 1062

for 30 and 60min, respectively. Protoplasts were illuminated throughout the incubation. The 1063

starch was isolated and the 14C incorporation was monitored. Values are given as nmol glc 1064

mL-1 (n=3; SD). 1065

1066

Incubation time [min] 5 mM HCO3- no HCO3- added 30 1.05 ± 0.04 1.72 ± 0.02 60 4.42 ± 0.07 6.17 ± 0.10

1067

1068

Table II Incorporation of 14C-ADPglucose formed by ADPglucose pyrophosphorylase 1069

into starch via starchsynthase III. Protoplasts were incubated with 1mM [U-14C]glucose 1-1070

phosphate in the light or dark. After 30 and 60min incubation the metabolites were extracted 1071

and the incorporation of formed 14C-ADPglucose into starch via starchsynthase III was 1072

monitored (a). As controls, the starchsynthase III was omitted (minus SSIII) or 14C-labelled 1073

ADPglucose were added to the reaction mixture (plus ADPglucose). In addition from the 1074

protoplasts the starch was isolated and the 14C incorporation during [U-14C]glucose 1-1075

phosphate incubation was monitored (b). One experiment out of two is shown (n=3, SD). 1076

1077

a) pmol ADPglucose mL-1 10min 20min



33

light 25.79 ± 1.36 28.69 ± 0.67 dark 1.50 ± 0.12 1.67 ± 0.02

plus ADPglucose 98039.81 ± 27.56 minus SSIII 0.48 ± 0.21

b) nmol glc mL-1 incorporated into starch light 0.097 ± 0.008 0.313 ± 0.011 dark 0.013 ± 0.009 0.017 ± 0.0012

1078



0

0,1

0,2

0,3

0,4

0,5

0,6

G1P G1P/Glc G1P/G6P

200µM

400µM

C

Upta

ke

(nm

ol

G1P

mL

-1per

30s)

0

2

4

6

8

10

12

-1 4 9 14 19

mM-1

Up

take

Velo

city-1

[n

mo

lG

1P

mL

-1

per

30s]-1

0

0,2

0,4

0,6

0,8

1

1,2

0 500 1000 1500 2000

µM

Up

take

Velo

city

[n

mo

lG

1P

mL

-1

per

30s]

A

B

Upta

ke

Velo

cit

y(n

mol

G1P

mL

-1per

30s)

[µM]

[µM-1]

Upta

ke

Velo

cit

y-1

(nm

ol

G1P

mL

-1per

30s)-

1

Fig. 1. Uptake of external glucose 1-phosphate by Arabidopsis mesophyll protoplasts.

(A+B) Short term uptake using varying concentratons of glucose 1-phosphate. Protoplasts

were incubated for 30s with [U-14

C]glucose 1-phosphate (concentrations as indicated),

washed and the14

C-label inside the protoplasts was determined. The Michealis-Menten (A)

and the Lineweaver-Burk (B) plots are given. The mean of two independently performed

experiments (two replicas each) and the SD (n=4) are given.

(C) Specificity of glucose 1-phosphate uptake by protoplasts. After 30s incubation of the

protoplasts with 200 or 400 µM [U-14

C]glucose 1-phosphate, [U-14

C]glucose 1-phosphate and

equal concentration of glucose or glucose 6-phosphate the protoplasts were washed and the

total14

C-content of the protoplasts was determined. The mean of three independent

experiments and SD are given.



0

2,5

5

light dark

G1P

Glc

0

50

100

5 min 10 min

G1P

G1P/Glc

G1P/G6P

G1P/Pi

0

100

200

300

400

Pi

Pi / G1P

Pi / Glc

0

100

200

300

400

500

+ G1P

- G1P

nm

ol

glc

mL

-1

A

nm

ol

glc

mL

-1

B

nm

ol

Pi

mL

-1

Bq

C D

F i g . 2 . U t i l i z a t i o n o f e x t e r n a l g l u c o s e 1 - p h o s p h a t e b y A r a b i d o p s i s m e s o p h y l l p r o t o p l a s t s .

( A ) G l u c o s e o r g l u c o s e 1 - p h o s p h a t e d e p e n d e n t i n c o r p o r a t i o n i n t o s t a r c h . P r o t o p l a s t s w e r e

i n c u b a t e d f o r 2 0 m i n w i t h e i t h e r [ U -1 4

C ] g l u c o s e 1 - p h o s p h a t e ( G 1 P ; 2 0 m M ) o r [ U -

1 4

C ] g l u c o s e ( G l c ; 2 0 m M ) i n t h e l i g h t o r i n t h e d a r k . S u b s e q u e n t l y , s t a r c h w a s i s o l a t e d a n d

t h e1 4

C - g l u c o s y l i n c o r p o r a t i o n w a s m o n i t o r e d . T h e m e a n o f t w o i n d e p e n d e n t l y p e r f o r m e d

e x p e r i m e n t s ( t h r e e r e p l i c a s e a c h ) a n d t h e S D a r e g i v e n .

( B ) G l u c o s e 1 - p h o s p h a t e u p t a k e a n d u t i l i z a t i o n b y m e s o p h y l l p r o t o p l a s t s . P r o t o p l a s t s w e r e

i n c u b a t e d w i t h [ U -1 4

C ] g l u c o s e 1 - p h o s p h a t e ( G 1 P ; 2 0 m M ) , [ U -1 4

C ] g l u c o s e 1 - p h o s p h a t e ( 2 0

m M ) p l u s u n l a b e l e d g l u c o s e ( 1 0 m M ; G 1 P / G l c ) , [ U -1 4

C ] g l u c o s e 1 - p h o s p h a t e ( 2 0 m M ) p l u s

u n l a b e l e d g l u c o s e 6 - p h o s p h a t e ( 1 0 m M ; G 1 P / G 6 P ) o r w i t h [ U -1 4

C ] g l u c o s e 1 - p h o s p h a t e ( 2 0

m M ) p l u s u n l a b e l e d o r t h o p h o s p h a t e ( 1 0 m M ; G 1 P / P i ) f o r 5 o r 1 0 m i n i n t h e l i g h t .

S u b s e q u e n t l y , s t a r c h w a s i s o l a t e d a n d t h e1 4

C - g l u c o s y l i n c o r p o r a t i o n w a s d e t e r m i n e d . T h e

m e a n o f t h r e e i n d e p e n d e n t l y p e r f o r m e d e x p e r i m e n t s a n d S D a r e g i v e n .

( C + D ) C o u n t e r - e x c h a n g e o f g l u c o s e 1 - p h o s p h a t e a n d o r t h o p h o s p h a t e . I n C p r o t o p l a s t s w e r e

i n c u b a t e d f o r 5 m i n i n t h e l i g h t w i t h3 3

P - o r t h o p h o s p h a t e ( 1 0 m M ; P i ) ,3 3

P - o r t h o p h o s p h a t e ( 1 0

m M ) a n d u n l a b e l e d g l u c o s e 1 - p h o s p h a t e ( 2 0 m M ; P i / G 1 P ) o r3 3

P - o r t h o p h o s p h a t e ( 1 0 m M )

a n d u n l a b e l e d g l u c o s e ( 2 0 m M ; P i / G l c ) . T h e p r o t o p l a s t s w e r e t h e n w a s h e d u n t i l n o3 3

P - l a b e l

c o u l d b e d e t e c t e d i n t h e w a s h i n g s o l u t i o n . T h e3 3

P - c o n t e n t o f t h e p r o t o p l a s t s w a s m o n i t o r e d .

T h e m e a n o f t w o i n d e p e n d e n t l y p e r f o r m e d e x p e r i m e n t s ( t w o r e p l i c a s e a c h ) a n d t h e S D ( n = 4 )

a r e g i v e n . I n D p r o t o p l a s t s w e r e i n c u b a t e d f o r 1 0 m i n i n t h e l i g h t w i t h3 3

P - o r t h o p h o s p h a t e ( 1 0

m M ) . F o l l o w i n g r e m o v a l o f t h e r e s i d u a l e x t e r n a l3 3

P - l a b e l b y w a s h i n g , t h e p r o t o p l a s t

s u s p e n s i o n w a s s e p a r a t e d i n t o t w o e q u a l p a r t s . T o o n e p a r t u n l a b e l e d g l u c o s e 1 - p h o s p h a t e ( 2 0

m M ) w a s a d d e d ( + G 1 P ) . I n t h e o t h e r p a r t ( c o n t r o l ) g l u c o s e 1 - p h o s p h a t e w a s o m i t t e d ( - G 1 P ) .

A f t e r 5 m i n i l l u m i n a t i o n t h e p r o t o p l a s t s o f b o t h a l i q u o t s w e r e p e l l e t e d a n d t h e3 3

P - c o n t e n t i n

t h e s u p e r n a t a n t w a s d e t e r m i n e d . A t y p i c a l e x p e r i m e n t o u t o f t w o i n d e p e n d e n t l y p e r f o r m e d

e x p e r i m e n t s ( e a c h 3 r e p l i c a s ) a n d S D i s g i v e n .



0

5

10

15

20

15 min 30 min

intact

broken

nm

ol

glc

mL

-1

A

0

2

4

6

8

10

12

14

16

10 min 20 min

G1P

G1P/Pi

G6P

nm

ol

glc

mL

-1

B

0

2

4

6

8

10

12

14

10 min 20 min

G1P

G1P/G6P

G1P/Glc

C

nm

ol

glc

mL

-1

Fig. 3 Glucose 1-phosphate dependent incorporation into starch by chloroplasts from

(A)

(B)

(C)

A. thaliana.

Chloroplasts isolated from wild type plants were incubated with [U- C]glucose 1-phosphate (16.67 mM) in the light. As

a control, chloroplasts were broken using a potter and were otherwise treated identically. After incubation the starch was

extracted and the C-content was monitored. The mean of two independently performed experiments (two replicas each) and

the SD (n=4) are given. intact - intact chloroplasts; broken - mechanically disintegrated chloroplasts were incubated.

Selectivity of the glucose 1-phosphate dependent incorporation into starch. Illuminated chloroplasts were incubated with

[U- C]glucose 1-phosphate (16.67 mM each) or [U- C]glucose 1-phosphate plus unlabeled orthophosphate (6.67 mM) or

[U- C]glucose 6-phosphate (16.67 mM each). After isolation of the starch, the C-glucosyl incorporation was determined.

The mean of two independently performed experiments (two replicas each) and the SD (n=4) are given. G1P - incubation

with [U- C]glucose 1-phosphate; G1P/Pi - incubation with [U- C]glucose 1-phosphate and unlabeled orthophosphate; G6P-

incubation with [U- C]glucose 6-phosphate. The glucose 1-phosphate dependent incorporation into starch is unaffected

by the addition of unlabeled glucose 6-phosphate or glucose. Illuminated chloroplasts were incubated with

[U- C]glucose 1-phosphate (16.67 mM each) only (G1P), with [U- C]glucose 1-phosphate plus unlabelled

glucose 6-phosphate (16.67 mM each; G1P/G6P) or with [U- C]glucose 1-phosphate plus unlabelled glucose (16.67 mM each;

G1P/Glc). Following 10 or 20 min incubation, starch was isolated and the content of C was quantified. The mean of two

independently performed experiments (two relicas each) and the SD (n=4) are given.

14

14

14 14

14 14

14 14

14

14 14

14

14



wt Atphs1-1 Atphs1-2

I

II

III

IV

0

1000

2000

3000

5 min 15 min

wt (ws)

Pho1-1

Pho1-2

nm

ol

glc

mL

-1

BA

wt

Atphs1

Atphs2

Fig. 4. Impact of the plastidial phosphorylase isozyme on the incorporation into starch

during glucose 1-phosphate incubation.

(A) Phosphorylase pattern as revealed by native PAGE. Leaves were harvested during the

light period. Buffer-soluble proteins were extracted from Arabidopsis wild type or AtPHS1

knock-out plants. To each lane, 20 µg protein was applied. The separation gel contained 0.4

% [w/v] glycogen. Following electrophoresis, the separation gel was equilibrated, incubated

and stained as in (A). I – slowly migrating cytosolic phosphorylase (AtPHS2); II – fast

migrating cytosolic phosphorylase (AtPHS2); III – slowly migrating plastidial phosphorylase

(AtPHS1); IV – fast migrating plastidial phosphorylase (AtPHS1)

(B) Impact of the plastidial phosphorylase (AtPHS1) on the glucose 1-phosphate-dependent

labelling of starch in Arabidopsis mesophyll protoplasts. Protoplasts from wild type (wt) or

plastidial phosphorylase knock-out plants (lines Atphs1-1 and Atphs1-2) were incubated with

[U-14

C]glucose 1-phosphate (20mM). At intervals aliquots of the protoplast suspension were

withdrawn and the incorporation of [U-14

C]glucosyl residues into starch was monitored. The

mean of two independently performed experiments (two replicas each) and the SD (n=4) is

given.



0

5

10

5 min 10 min 20 min

wt

p-pgm

adg1

nm

ol

glc

mL

-1

A

B C

Fig. 5 Starch synthesis in pgm1 mutants.

(A)

(B+C) B C

Protoplasts were isolated from leaves of wild type plants (wt), a mutant lacking the plastidial

phosphoglucomutase activity (pgm1) or having a reduced activity of the ADPglucose pyrophosphorylase (adg1)

and were incubated with [U- C]glucose 1-phosphate (20 mM) in the light. Subsequently, starch was extracted

and the C-glucosyl incorporation into the starch was determined. The data represented the mean of three

incubations and the SD.

Native starch granules isolated from leaves of wild type plants (wt; ) and the pgm1 mutant ( ) as

analysed by SEM. The bar is equivalent to 20µm.

14

14



Chloroplast

G1P

Starch

ADPGSS

AGPase

G6P

pPGM

G1P

Cytosol

G1P

Calvin cycle

F6P TP

TP

Fig. 6 Proposed carbon fluxes in Arabidopsis leaves.

G1P – glucose 1-phosphate; G6P – glucose 6-phosphate; F6P – fructose 6-phosphate; TP –

triose phosphate; ADPG – ADPglucose; SS – starch synthases; AGPase – ADPglucose

pyrophosphorylase; pPGM – plastidial phosphoglucomutase



Running head: Glucose 1-phosphate transport 2 · 221 achieved at approximately 1 mM glucose...

Documents

Transcript of Running head: Glucose 1-phosphate transport 2 · 221 achieved at approximately 1 mM glucose...