Running head: 2 Regulatory networks of AtBMI1 proteins 7 8 ......5 Myriam Calonje 6 Institute of...

1

Running head: 1

Regulatory networks of AtBMI1 proteins 2

3

Correspondence: 4

Myriam Calonje 5

Institute of Plant Biochemistry and Photosynthesis (IBVF-CSIC-University of Sevilla), 6

Avenida América Vespucio, 49, Isla de La Cartuja, 41092 Seville, Spain 7

Phone: +34 954489591 8

[email protected] 9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

Plant Physiology Preview. Published on November 9, 2016, as DOI:10.1104/pp.16.01259

Copyright 2016 by the American Society of Plant Biologists

www.plantphysiol.org on December 14, 2016 - Published by www.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.















http://www.plantphysiol.org/

http://www.plantphysiol.org





























2

The Arabidopsis Polycomb Repressive Complex 1 (PRC1) components 24

AtBMI1A, B and C impact gene networks throughout all stages of plant 25

development 26

Wiam Merini1*, Francisco J Romero-Campero2*, Angeles Gomez-Zambrano1, Yue 27

Zhou3, Franziska Turck3 and Myriam Calonje1 28

29 1Institute of Plant Biochemistry and Photosynthesis (IBVF-CSIC-University of Sevilla), 30

Seville, Spain 31 2Department of Computer Science and Artificial Intelligence, University of Sevilla, 32

Spain 33 3Max Planck Institute for Plant Breeding Research, Department of Plant Developmental 34

Biology, Carl-von-Linné-Weg 10, 50829 Köln, Germany 35 *Those authors contributed equally 36

Corresponding author email: [email protected] 37

38

Author contributions 39

W.M., A.G.Z. and Y.Z performed the experiments and W.M. and F.J.R.C. analyzed the 40

data. M.C. conceived and designed the study and M.C. and F.T. prepared the 41

manuscript. 42

43

Funding information 44

This work is supported by Marie Curie CIG Grant ID 333748 and BIO2013-44078-P 45

Grant from Ministerio de Economía y Competitividad (MINECO). F.T. and Y. Z. are 46

supported by core funding from the Max Planck Gesellschaft. 47

48

One-sentence Summary 49

Genome wide transcriptomic data in combination with H3K27me3 and protein 50 localization data unveiled the roles of the AtBMI1s and their possible relationship with 51 other PRC1 components 52 53




3

54

Abstract 55

PcG regulation in Arabidopsis is required to maintain cell differentiation and to allow 56

developmental phase transitions. This is achieved by the activity of three PRC2s and the 57

participation of a yet poorly defined PRC1. Previous results showed that apparent PRC1 58

components perform discrete roles during plant development, suggesting the existence 59

of PRC1 variants; however, it is not clear in how many processes these components 60

participate. We show that AtBMI1 proteins are required to promote all developmental 61

phase transitions and to control cell proliferation during organ growth and development, 62

expanding their proposed range of action. While AtBMI1 function during germination 63

is closely linked to B3 domain transcription factors VAL1/2 possibly in combination 64

with GT-box binding factors, other AtBMI1 regulatory networks require participation of 65

different factor combinations. Conversely, EMF1 and LHP1 bind many H3K27me3 66

positive genes upregulated in atbmi1a/b/c mutants; however, loss of their function 67

affects expression of a different subset, suggesting that even if EMF1, LHP1 and 68

AtBMI1 exist in a common PRC1 variant, their role in repression depends on the 69

functional context. 70

71

Introduction 72

The evolutionary conserved Polycomb Group (PcG) machinery plays a crucial 73

role in maintaining repression of genes that are not required during a specific cell fate 74

(Ringrose and Paro, 2004). PcG proteins form multiprotein complexes with different 75

histone modifying activities, including PcG repressive complex 2 (PRC2), which 76

possesses histone H3 lysine 27 (H3K27) tri-methyltransferase activity (Müller et al., 77

2002), and PRC1, which has histone H2A lysine 119 (H2AK119) E3 ubiquitin ligase 78

activity (Cao et al., 2005) as well as other non-enzymatic functions critical for 79

chromatin compaction (Francis et al., 2004). The combined activity of both complexes 80

is required for stable repression of target genes. 81

In Drosophila, single-copy genes encode the four core subunits of PRC2: 82

Suppressor of Zeste 12 [Su(z)12], Extra sex combs (Esc),p55, and the catalytic subunit 83

Enhancer of Zeste [E(z)] (Simon and Kingston, 2013). Arabidopsis thaliana 84

(Arabidopsis) has three E(z) homologs, CURLY LEAF (CLF), MEDEA (MEA) and 85




4

SWINGER (SWN) (Goodrich et al., 1997; Grossniklaus et al., 1998; Chanvivattana et 86

al., 2004) and three Su(z)12 homologs, EMBRYONIC FLOWER 2 (EMF2), 87

VERNALISATION 2 (VRN2) and FERTILISATION INDEPENDENT SEED 2 (FIS2) 88

(Luo et al., 1999; Gendall et al., 2001; Yoshida et al., 2001); while MULTIPLE 89

SUPPRESSOR OF IRA 1 (MSI1), which is one of the five p55 homologs in 90

Arabidopsis (Hennig et al., 2005), and the Esc homolog FERTILIZATION 91

INDEPENDENT ENDOSPERM (FIE) (Ohad et al., 1999) are common subunits to the 92

different possible PRC2s (Mozgova et al., 2015). 93

Drosophila PRC1 contains Polycomb (Pc), Polyhomeotic (Ph), Posterior sex 94

comb (Psc), and dRing1 (Shao et al., 1999; Peterson et al., 2004), each with multiple 95

homologs in vertebrates (Schwartz and Pirrotta, 2013). Furthermore, vertebrate PRC1 96

complexes exist in canonical or non-canonical forms. Canonical variants harbor 97

homologs to the four Drosophila core subunits (Schwartz and Pirrotta, 2013), while 98

non-canonical PRC1 complexes contain RING1A or RING1B and one of the six 99

different homologs of Drosophila Psc (PCGF) to form a H2A mono-ubiquitination 100

(H2Aub) module, along with additional subunits that further add specific biochemical 101

properties and genomic localization to the different variants (Schwartz and Pirrotta, 102

2013). In Arabidopsis, several pieces of evidence suggest a similar high degree of 103

complexity (Förderer et al., 2016). Two RING1 homologs, AtRING1A and AtRING1B, 104

and three Psc/PCGF homologs, AtBMI1A, AtBMI1B and AtBMI1C have been 105

characterized (Sanchez-Pulido et al., 2008; Xu and Shen, 2008; Bratzel et al., 2010; 106

Chen et al., 2010; Bratzel et al., 2012; Yang et al., 2013; Calonje, 2014). Plants with 107

mutations in these genes suggest a high degree of functional redundancy between 108

AtRING1 or AtBMI1 proteins, thus, it is not clear whether each paralog can regulate a 109

different subset of targets (Bratzel et al., 2010; Chen et al., 2010; Yang et al., 2013). 110

The analysis is complicated by the observation that several mutant alleles are knock-111

downs rather than null alleles and that phenotypes show a wide range of stochastic 112

variation among segregating siblings with “weak” and “strong” phenotypes (Bratzel et 113

al., 2010; Chen et al., 2010). 114

Two other plant-specific proteins have been related to PRC1, EMBRYONIC 115

FLOWER 1 (EMF1) mediating chromatin compaction (Calonje et al., 2008; Beh et al., 116

2012), and LIKE-HETEROCHROMATIN PROTEIN 1 (LHP1), which, as Drosphila 117

Pc, binds H3K27me3 marks through its chromodomain (Turck et al., 2007). Although 118




5

both proteins can interact with either AtRING1 or AtBMI1 (Bratzel et al., 2010; Chen et 119

al., 2010), recent reports showed that they also co-purify with PRC2 components 120

(Derkacheva et al., 2013; Liang et al., 2015); thus, it is not clear in which context they 121

carry out their functions. Additional proteins with chromatin related functions have 122

been shown to participate in PRC1 mediated repression of specific target genes, such as 123

the VIVIPAROUS 1 (VP1)/ ABCISIC ACID INSENSTIVE 3 (ABI3)-Like 1 and 2 124

proteins (VAL1/2) (Yang et al., 2013), ALFIN1-like proteins (ALs) (Molitor et al., 125

2014) and JMJ14 (Wang et al., 2014). 126

In plants, PcG repression maintains the differentiated state of the cells but also 127

orchestrates developmental phase transitions by controlling the establishment of new 128

cell identities. This likely requires different PRC1s but little is known about their 129

subunit composition. The repression of several seed maturation genes after germination 130

requires the AtBMI1 and AtRING1 proteins (Bratzel et al., 2010; Chen et al., 2010; 131

Yang et al., 2013) and a recent genome wide study showed gene networks regulated by 132

AtBMI1s and AtRING1s during the suppression of seed development in seedlings 133

(Wang et al., 2016). As these results were derived from the analysis of atring1a/b and 134

atbmi1a/b mutants developing a weak phenotype (Bratzel et al., 2010; Chen et al., 135

2010), their possible implication in other developmental processes or stages was not 136

unveiled. Conversely, the repression of flower homeotic genes in seedlings requires 137

EMF1 (Kim et al., 2012) and LHP1 (Gaudin et al., 2001) but their role in regulating 138

other processes is not clear. 139

In this work, by analyzing the transcriptome of single, strong double and triple 140

atbmi1 mutants we have identified a more comprehensive set of candidate genes 141

regulated by AtBMI1 proteins. Our results indicate that in addition to switching off the 142

seed maturation program after germination, AtBMI1s promote the transition from each 143

developmental phase to the next throughout development and furthermore control cell 144

proliferation during organ growth and development. By integrating transcriptomics 145

datasets with previously published data, we show that AtBMI1 and VAL1/2 act together 146

only in the regulation of seed maturation genes. Enrichment of cis-regulatory elements 147

at VAL1/2-dependent and -independent genes suggests that AtBMI1-mediated gene 148

repression requires different combinational modules always involving VAL related B3 149

domain factors. Conversely, while EMF1 and LHP1 occupy a considerable number of 150

genes upregulated in atbmi1a/b/c mutants, loss of their function does not impact the 151




6

expression of most but affects the expression of a different subset of genes. Together 152

these results suggest that the different PRC1 variants may differ in subunit composition 153

but also in the role that single components play all depending on the cis-regulatory 154

context. 155

156

Results 157

Genome-wide transcriptomic data analysis of atbmi1 mutants 158

Previous data have suggested that AtBMI1A and AtBMI1B are ubiquitously 159

expressed and act mostly redundantly throughout development (Bratzel et al., 2010), 160

whereas AtBMI1C, which is expressed in roots, endosperm and stamen, may have 161

functionally diverged since it cannot fully rescue atbmi1a/b defects when overexpressed 162

(Yang et al., 2013; Merini and Calonje, 2015); nevertheless, atbmi1a/c and atbmi1b/c 163

do not show phenotypic alterations (Yang et al., 2013), suggesting that loss of 164

AtBMI1C function is compensated by the other two AtBMI1s. Therefore, to gain 165

insight into the regulatory roles of AtBMI1s, we performed genome-wide transcriptome 166

analysis using RNA sequencing (RNA-seq) of wild type Col-0 (WT), atbmi1a, atbmi1b, 167

atbmi1a/b and atbmi1a/b/c mutants at 10 days after germination (DAG). Since 168

individual atbmi1a/b double mutants display a wide range of phenotypes (Bratzel et al., 169

2010), we chose to select the strong atbmi1a/b mutant phenotype for the analysis, which 170

differs from the atbmi1a/b/c phenotype mainly in the root [(Yang et al., 2013); 171

Supplemental Fig. S1]. The Tuxedo protocol (Trapnell et al., 2012) was used for 172

transcript assembly and differential expression analysis. All sequencing samples were of 173

high quality (Supplemental Fig. S2; Supplemental Table S1). Differentially expressed 174

genes were determined using stringent criteria consisting of a combination of fold 175

change >4 and a p-value <0.05. The number of genes scored as present in at least one of 176

our samples was 24,503, representing 72.96% of the entire Arabidopsis transcriptome. 177

We found less than 3-4% of the surveyed transcriptome affected in single mutants and 178

around 15% and 20% differentially expressed in strong atbmi1a/b double and 179

atbmi1a/b/c triple mutants, respectively (Fig. 1A; Supplemental Fig. S3). Principal 180

components analysis showed that the transcriptomes of WT, atbmi1a and atbmi1b 181

mutants clustered together, whereas the transcriptomes of atbmi1a/b and atbmi1a/b/c 182

mutants constituted two distant and distinct clusters, indicating not only differences to 183

the WT and single mutant group but also in between (Fig. 1B). In any case, we found a 184




7

considerable number of genes misregulated in the single mutants (Fig. 1C; 185

Supplemental Table S2) of which a majority were a subset of those affected in double 186

and triple mutants (Supplemental Fig. S4A,B). The number of up-regulated genes for 187

atbmi1a, atbmi1b, and atbmi1a/b was higher than down-regulated (Fig. 1C), which 188

might confirm the role of AtBMI1 proteins in transcriptional repression. However, 189

atbmi1a/b/c mutant showed higher number of down-regulated genes than upregulated 190

genes. This may be a consequence of the developmental stage of these mutants, in 191

which all organs are stuck in a seed maturation phase. Upregulation of some genes 192

within this context may have a stronger negative impact on gene expression. 193

Globally, the upregulated genes in the strong atbmi1a/b and atbmi1a/b/c mutants 194

(Supplemental Fig. S5A and Supplemental Fig. S6A) showed over-representation of 195

Gene Ontology (GO) terms associated with response to different stimuli (e.g. water 196

stress, temperature, hormones) and lipid metabolism (e.g. transport, biosynthesis, 197

storage); whereas the downregulated genes were enriched for GO terms related to 198

photosynthesis and metabolic processes (Supplemental Fig. S5B and Supplemental Fig. 199

S6B). This is consistent with the developmental fate of the mutants, which are trapped 200

in the seed maturation phase (Yang et al., 2013). During this phase, seeds acquire 201

desiccation tolerance and accumulate storage reserves, prevailing in the form of lipids 202

(Vicente-Carbajosa and Carbonero, 2005), while chloroplast structure is disrupted 203

(Delmas et al., 2013). 204

As PcG function is involved in the repression of master regulatory genes (Xiao 205

and Wagner, 2015), misregulation in the different atbmi1 mutants may be an indirect or 206

direct consequence of the loss of AtBMI1 function, or a mix of both. Conversely, a 207

considerable number of AtBMI1 direct target genes may not display altered expression 208

in absence of their upstream transcriptional activators, as has been reported for other 209

PcG loss of function mutants (Bouyer et al., 2011; Kim et al., 2012; Derkacheva et al., 210

2013). In any case, although the interrelationship between PRC1 and PRC2 is not clear 211

yet, the activity of both complexes is required for stable PcG-mediated repression; 212

therefore, selecting genes upregulated in atbmi1 mutants and H3K27me3 marked in WT 213

seedlings should enrich for a subset of candidate genes directly controlled by AtBMI1s. 214

Accordingly, we intersected genes upregulated in the different mutants with a set of 215

5360 H3K27me3 target genes previously identified in two independent analyses in 216

seedlings [Supplemental Table S3; (Bouyer et al., 2011; Kim et al., 2012)] to selected 217




8

upregulated H3K27me3 positive (up_K27) genes (Fig. 1D). The analysis showed 218

significant overlaps between H3K27me3 marked genes and upregulated genes in the 219

different mutants except for atbmi1b probably because it is a knock-down mutant 220

(Bratzel et al., 2010). The same analysis using downregulated genes showed non-221

significant overlaps in all cases excluding atbmi1a/b/c due to the high number of 222

downregulated genes in this mutant (Supplemental Fig. S7; Supplemental Table S3). 223

To determine whether there were AtBMI1A and AtBMI1B specific candidate 224

targets, we compared up_K27 genes in the single and double mutants (Fig. 2A). Their 225

number in the double mutant was considerably higher than in the single mutants, 226

illustrating a high degree of functional redundancy. Also, most of the up_K27 genes in 227

single mutants were included in the double mutants set of up_K27 genes; however, a 228

group of genes seemed to be exclusively upregulated in atbmi1a and atbmi1a/b or in 229

atbmi1b and atbmi1a/b (104 and 27 genes, respectively). Up_K27 genes in atbmi1a and 230

atbmi1a/b were expressed at very low levels in both single compared to the double 231

mutants (Fig. 2B), indicating redundant regulation by AtBMI1A and B. The atbmi1b 232

mutant shows some remnant expression of AtBMI1B possibly explaining higher 233

expression in atbmi1a vs atbmi1b and the greater number of affected genes in the 234

atbmi1a single mutant (Bratzel et al., 2010). Nevertheless, some genes were indeed 235

specifically sensitive to AtBMI1B being more affected in atbmi1b than atbmi1a and not 236

further increased in double mutants (Fig. 2B). 237

We next investigated the degree of redundancy between AtBMI1A/B and 238

AtBMI1C by comparing the genes up_K27 in atbmi1a/b and atbmi1a/b/c (Fig. 3A). 239

Clustering analysis showed that atbmi1a/b and atbmi1a/b/c shared 2/3 of the up_K27 240

genes (Cluster I, Supplemental Table S3) but the remaining 1/3 was genotype-specific 241

(Cluster II, atbmi1a/b/c specific and Cluster III, atbmi1a/b specific). The expression 242

pattern of genes in Cluster I fell into two distinct sub-groups. Cluster Ia included genes 243

that displayed a gradual increase of expression in double and triple mutants, suggesting 244

redundant regulation by AtBMI1A/B and by AtBMI1C (Fig. 3B and Supplemental Fig. 245

S8A). Cluster Ib contained genes whose regulation may depend exclusively on 246

AtBMI1A/B, as the loss of AtBMI1C function did not affect significantly their overall 247

expression levels (Fig. 3B and Supplemental Fig. S8A). Cluster II (Supplemental Table 248

S3) included genes exclusively upregulated in atbmi1a/b/c, indicating that these are 249

AtBMI1C specific targets or, alternatively, that AtBMI1C fully compensates the loss of 250




9

AtBMI1A/B function in regulating these genes (Fig. 3B and Supplemental Fig. S8A). 251

To discern between these two possibilities, we measured the levels of a subset of cluster 252

II genes in WT, atbmi1c single and atbmi1a/b/c mutants in whole seedlings and roots at 253

10 days after germination (DAG) by quantitative RT-PCR (qRT-PCR). As they were 254

not misexpressed in atbmi1c single mutants (Supplemental Fig. S8B), we concluded 255

that AtBMI1C compensates for the loss of AtBMI1A/B function in the regulation of 256

these genes. Finally, genes in Cluster III (Supplemental Table S3) were exclusively 257

upregulated in atbmi1a/b mutants, but not in atbmi1a/b/c (Fig. 3B and Supplemental 258

Fig. S8A). Although a priori unexpected, the result can be explained if the activation of 259

these genes requires a developmental stage that is not reached in atbmi1a/b/c. 260

All together these data indicated that AtBMI1A and B regulate genes 261

predominantly redundantly, whereas AtBMI1C affects only a subset of AtBMI1A/B 262

possible targets. 263

Deregulated developmental programs in atbmi1 mutants 264

AtBMI1 proteins were previously shown to participate in the regulation of several 265

seed maturation (Bratzel et al., 2010; Chen et al., 2010; Yang et al., 2013) and 266

germination related genes (Molitor et al., 2014). In addition, a recent transcriptome 267

analysis of atbmi1a/b weak phenotype confirmed the role of AtBMI1 function in 268

regulating seed development (Wang et al., 2016). When we compared the H3K27me3 269

upregulated genes in the atbmi1a/b weak (fold change ≥2, according to Wang et al. 270

2016; Supplemental Table S1) to those in atbmi1a/b strong phenotype mutants, we 271

found significantly more genes in the stronger mutant (Fig. 4A). Among the genes 272

upregulated in both datasets there were genes previously identified as AtBMI1 target 273

genes, like ABI3, and DELAY OF GERMINATION 1 (DOG1); however, other well-274

known AtBMI1 targets, such as FUSCA 3 (FUS3) or BABYBOOM (BBM) (Yang et al., 275

2013), were included only in atbmi1a/b strong dataset. A similar picture was obtained 276

comparing atbmi1a/b weak and atbmi1a/b/c datasets (Supplemental Fig. S9). Therefore, 277

to obtain a more comprehensive picture of the developmental processes regulated by 278

AtBMI1s, we examined the annotated developmental functions of up_K27 genes in 279

atbmi1a/b/c mutants, as they displayed the strongest developmental alterations. 280

Seed maturation and dormancy 281




10

Changes in the triple atbmi1a/b/c mutant uncovered additional genes involved in 282

seed maturation and abscisic acid (ABA) response, such as FUS3 and ABI4, and in seed 283

dormancy, like SOMNUS (SOM). Also, there were genes involved in regulating 284

carbohydrate and lipid metabolism, like WRINKLED 1 (WRI1) (Supplemental Fig. S9; 285

Supplemental Table S3). Most of these genes are switched off after germination in WT; 286

however, the ABIs are required for plant responses to various biotic and abiotic stresses 287

(Cutler et al., 2010), suggesting involvement of AtBMI1s in regulating responses to 288

environmental conditions. 289

Endosperm specific genes 290

Maturation genes were not the only seed genes upregulated in atbmi1a/b/c 291

mutants. We found upregulation of genes that are predominantly expressed in 292

endosperm and but not in the seed coat and vegetative tissues (Wolff et al., 2011). 293

Interestingly, among these were genes displaying a maternal [FLOWERING 294

WAGENINGEN (FWA), HOMEODOMAIN GLABROUS 8 (HDG8), and AtBMI1C] or 295

paternal [PICKLE RELATED 2 (PKR2), VARIANT IN METHYLATION 5 (VIM5), 296

AT2G21930 and AT3G49770] preferred expression in the endosperm (Supplemental 297

Fig. S9; Supplemental Table S3). 298

Meristem maintenance and cell proliferation related genes 299

The atbmi1a/b/c mutant also upregulated genes involved in meristem maintenance 300

and cell proliferation throughout plant life. Remarkably, two gene families with crucial 301

roles in these processes were upregulated in the mutants. The first encompassed the 302

PLETHORA (PLT) or AINTEGUMENTA-LIKE (AIL) genes. Six out of eight members 303

of this family were up_K27 in atbmi1a/b/c mutants (PLT1/2/3/5/7 and BBM) 304

(Supplemental Fig. S9 and Supplemental Fig. S10; Supplemental Table S3). Some of 305

these PLT genes have overlapping roles in regulating embryo patterning, shoot and root 306

apical meristem maintenance and organ primordia initiation (Horstman et al., 2014). 307

The second was the WUS homeobox-containing (WOX) gene family, which comprises 308

fourteen members (van der Graaff et al., 2009), among which WUS and 309

WOX2/3/4/5/8/9/11/12 were upregulated in atbmi1a/b/c mutants (Supplemental Fig. S9 310

and Supplemental Fig. S10; Supplemental Table S3). These factors promote cell 311

division and prevent premature cell differentiation, which are crucial processes required 312

for stem-cell maintenance and organ formation. In addition, we found upregulation of 313

other genes with related functions, for instance CUP SHAPED COTYLEDON 3 (CUC3) 314




11

and ENHANCER OF SHOOT REGENERATION 1 (ESR1) and the GROWTH 315

REGULATING FACTOR 5 (GRF5). 316

Root development specific genes 317

Apart from the genes involved in root meristem maintenance, we found in 318

atbmi1a/b/c upregulation of genes that play a crucial role in postembryonic root 319

development, as CEGENDUO (CEG), MAGPIE (MGP), INDOLE-3-ACETIC ACID 320

INDUCIBLE 30 (IAA30), the ROOT MERISTEM GROWTH FACTOR 2 (RGF2), and 321

the Class IIB NAC transcription factor SOMBRERO (SMB), underpinning the 322

importance of AtBMI1 function for root development (Supplemental Fig. S9; 323

Supplemental Table S3). 324

Other developmental genes 325

Among the up_K27 genes in atbmi1a/b/c mutants were genes involved in 326

regulating other developmental processes, such as gametophyte development, leaf 327

development and the flowering transition [e.g. KANADI 2 (KAN2), KNUCKLES (KNU), 328

DEVELOPMENT-RELATED PcG TARGET IN THE APEX 4 (DPA4), SEPALLATA 2 329

(SEP2), FLOWERING LOCUS C (FLC), MADS AFFECTING FLOWERING 4 (MAF4), 330

MAF5 and FACTOR PROMOTING FLOWERING 1 (FPF1)] (Supplemental Fig. S9; 331

Supplemental Table S3). 332

Secondary metabolic processes 333

In addition, atbmi1a/b/c mutants upregulated genes involved in secondary 334

metabolic processes like those involved in phenylpropanoid metabolism. Upregulated 335

genes involved in this pathway were CHALCONE SYNTHASE (CHS, TRANSPARENT 336

TESTA 4 (TT4), CHALCONE ISOMERASE (CHI, TT5), FLAVONOID 3’-337

HYDROXYLASE (F3’H, TT7), DIHYDROFLAVONOL 4-REDUCTASE (DFR), and 338

transcription factors (TFs) such as AtMYB90 (PRODUCTION OF ANTTHOCYANIN 339

PIGMENT 2 (PAP2)), AtMYB111 and AtMYB11 (Supplemental Fig. S9; Supplemental 340

Table S3). 341

In summary, AtBMI1 function in Arabidopsis is required to regulate more 342

developmental processes than previously thought. 343

Regulatory cross-talk between chromatin complexes 344




12

RNA-seq data revealed upregulation of several PcG or PcG-related genes in 345

atbmi1a/b/c mutants, like AtRING1A, AtRING1B, VAL1, VAL2, and VIN3. Conversely, 346

we did not find a significant change in the expression of CLF, SWN, MEA, EMF2, 347

VRN2, FIS2, MSI1, FIE, EMF1 and LHP1 (Supplemental Fig. S10). On the other hand, 348

the Trithorax Group (TrxG) genes ULTRAPETALA 1 (ULT1), ULT2 and PKR2 that act 349

antagonistically to PcG complexes were upregulated in atbmi1a/b/c mutants 350

(Supplemental Fig. S10). Misregulation of some of these chromatin factors could 351

contribute to the strongly altered expression pattern of atbmi1a/b/c mutants. 352

Several master regulators of the flowering program are downregulated in 353

atbmi1a/b/c mutants 354

Several MADS-box transcription factors required to specify floral meristem 355

identity or involved in floral organ development were downregulated in atbmi1a/b/c 356

mutants (Fig. 4B; Supplemental Table S2) [e.g. AGL42, SUPRESSOR OF CONSTANS 357

1 (SOC1), SEP3, SEP4, AGL24, SHORT VEGETATIVE PHASE (SVP)]; but also other 358

key regulatory flowering genes, such as, TEMPRANILLO 1 (TEM1) and several 359

SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPLs) (e.g. SPL2,3,4,8,12). In 360

addition, we found that some flowering factors that have basal expression levels in WT 361

seedlings at 10 DAG expressed at lower levels in atbmi1a/b/c [e.g. AGAMOUS (AG), 362

APETALA 3 (AP3), FLOWERING LOCUS T (FT); Fig. 4B]. The fact that the flowering 363

program seems to be more repressed in atbmi1a/b/c mutants than in WT seedlings 364

points to a requirement of AtBMI1 function for proper regulation of flower 365

development. 366

VAL1/2 and the AtBMI1s co-regulate a subset of potential AtBMI1 targets 367

VAL1/2 and AtBMI1 proteins are required for the initial repression of several 368

seed maturation genes after germination, such as FUS3, LEC1 and ABI3. Furthermore, 369

we previously showed that the VAL1/2 recruit AtBMI1 proteins to these genes; 370

accordingly, val1/2 and atbmi1a/b/c mutants display a very similar phenotype (Yang et 371

al., 2013). However, WUS is an AtBMI1 but not a VAL1/2 regulated gene, indicating 372

that there are also differences between those mutants (Yang et al., 2013). To determine 373

to which extent the VAL1/2 and AtBMI1 proteins act together in regulating gene 374

expression, we compared genes upregulated in val1/2 [(Suzuki et al., 2007); 375

Supplemental Table S2] and H3K27me3 marked in WT according to our dataset 376




13

(Supplemental Table S3) with up_K27 genes in atbmi1a/b/c (Fig. 5A). We found that 377

70% of val1/2 up_K27 genes were included in the up_K27 atbmi1a/b/c dataset; these 378

genes represented 1/3 of the genes up_K27 in atbmi1a/b/c, indicating that, despite the 379

fact that they co-regulate a considerable number of genes, AtBMI1 proteins clearly 380

perform functions independently of VAL1/2. 381

The VAL proteins (VAL1, 2 and 3) belong to a subfamily of plant-specific B3 382

domain containing proteins (Swaminathan et al., 2008) that is predicted to bind to 383

LEC2/ABI3/VP1 elements [also known as RY elements (CATGCA); (Suzuki et al., 384

2007)]; in fact, a recent report showed that a point mutation in a LEC2/ABI3/VP1 385

element located at the first intron of FLC prevents the epigenetic silencing of the gene 386

during vernalization (Qüesta et al., 2016). FLC is upregulated in val1/2 and atbmi1 387

mutants (Supplemental Table S2, S3). Therefore, we investigated whether this or other 388

cis-regulatory motifs were enriched at the promoter of AtBMI1/VAL1/2 co-regulated 389

genes. Indeed, we found enrichment of LEC2/ABI3/VP1 motifs but also of ABA 390

responsive elements (ABRE) [ACGT or G-box (Choi et al., 2000)] (Fig. 5A). ABRE/G-391

box elements are recognized by bZIP transcription factors such as ABI5 (Carles et al., 392

2002). LEC2/ABI3/VP1 and ABRE elements are clustered in the 5′ upstream regions of 393

genes regulated by ABI3/VP1 factors and ABA (Suzuki et al., 2005), and are required 394

for the correct expression of seed maturation genes (Santos-Mendoza et al., 2008). On 395

the other hand, the plant-specific trihelix DNA binding protein ARABIDOPSIS 6B-396

INTERACTING PROTEIN 1-LIKE 1 (ASIL1) that is involved in the repression of seed 397

maturation genes after germination binds GT-box elements (GTGATT and variations of 398

this) (Gao et al., 2009). These elements are closely associated with ABRE/G-box and 399

LEC2/ABI3/VP1 elements at the promoter of several seed maturation genes. 400

Furthermore, GT-box elements frequently overlap with ABRE/G-box elements, leading 401

to the proposal that ASIL1 represses embryonic genes by competing with the binding of 402

transcriptional activators (Gao et al., 2009). Therefore, we looked for co-occurrence of 403

both elements at the promoter of AtBMI1/VAL1/2 co-regulated genes. Co-occurrence 404

was indeed significant (Fig. 5B); moreover, both elements significantly overlapped at 405

the promoter of these genes (Fig. 5B). Therefore, the combination of LEC2/ABI3/VP1 406

and GT-box co-occurring with ABRE/G-box elements represents a landmark for the 407

subset of AtBMI1/VAL1/2 co-regulated genes. 408




14

Surprisingly, the LEC2/ABI3/VP1 elements were as highly over-represented at 409

promoter regions of genes exclusively up_K27 in atbmi1a/b/c, which suggests that their 410

repression may be functionally connected to other B3 domain transcription factors. The 411

specific combination of LEC2/ABI3/VP1 and ABRE/GT-box elements was not detected 412

in this group. Conversely, other motifs were enriched in the VAL1/2-independent 413

up_K27 subset, such as SQUAMOSA BINDING PROTEIN (SBP)-, ZAP1 (WRKY)-, 414

ALFIN1- and MYB-binding sites and a frequent Z-box promoter motif that is bound by a 415

new class of transcription factors, the Z-box BINDING FACTORS (ZBFs), whose roles 416

in regulating plant development have just started to be unraveled (Gangappa et al., 417

2013) (Fig. 5A). ALFIN1 elements are bound by plant-specific ALFIN1-like proteins 418

[AL1-7; (Lee et al., 2009)], which mediate gene repression (Wei et al., 2015) and 419

interact with AtRING1 and AtBMI1 (Molitor et al., 2014), supporting the existence of 420

other combinatorial modules involving B3 domain factors and diverse partners for 421

AtBMI1-mediated gene repression. 422

Regulatory networks of AtBMI1, EMF1 and LHP1 423

To investigate the functional relationship between AtBMI1 proteins and EMF1, 424

we compared direct EMF1 targets as previously determined through genome-wide 425

ChIP-chip analysis (Kim et al., 2012) with our WT_K27 gene dataset and with genes 426

with altered expression (up and downregulated) in atbmi1a/b/c mutants (Supplemental 427

Fig. S11A; Supplemental Table S4). Clustering analysis showed a subgroup of 786 428

overlapping genes, indicating that among the misexpressed genes in atbmi1a/b/c there is 429

a significant amount of EMF1 targets. Then, we determined the number of up_K27 430

genes in atbmi1a/b/c that were included in this subgroup (Fig. 6A). We found that half 431

of atbmi1a/b/c up_K27 genes were EMF1 targets, suggesting interplay of EMF1 and 432

AtBMI1 proteins in the regulation of a considerable number of genes. 433

There was little overlap between genes up_K27 in atbmi1a/b/c and emf1-2 [Fig. 434

6B; Supplemental Table S4; (Kim et al., 2010)]; furthermore, the majority of EMF1 435

target genes up_K27 in atbmi1a/b/c were not upregulated in emf1-2 mutants, which is 436

consistent with the previous observation that expression of only a small percentage of 437

EMF1 target genes is increased in emf1-2 mutants [(Kim et al., 2012); Fig. 6C]. LHP1 438

has been shown to co-localize with 85-90% of H3K27me3 marked sites in Arabidopsis 439

(Turck et al., 2007; Zhang et al., 2007; Engelhorn et al., 2012); consistent with this, 440

92.3% of our list of H3K27me3 marked genes (4949 out of 5360) were occupied by 441




15

LHP1 according to a recently published data set of LHP1 targets (Veluchamy et al., 442

2016); of these genes, 1406 significantly overlap with the genes misexpressed (up and 443

downregulated) in atbmi1a/b/c mutants (Supplemental Table 4; Supplemental Fig. 444

11B). Furthermore, we found that 93.9% of atbmi1a/b/c up_K27 genes were LHP1 445

targets (Fig. 6C), suggesting that AtBMI1 and LHP1 co-regulate a high number of 446

genes. However, when we compared H3K27me3 marked genes upregulated in lhp1 447

(fold change ≥2, according to Wang et al. 2016; Supplemental Table S3) with up_K27 448

atbmi1a/b/c genes (Fig. 6D) we found very little overlap, indicating that loss of LHP1 449

function has also little impact on the expression of AtBMI1 regulated genes. Loss of 450

LHP1 function, as loss of EMF1 function, mostly impacts the expression of genes 451

involved in reproductive development. These genes were not upregulated in atbmi1a/b/c 452

mutants and some were even repressed, suggesting that LHP1 and EMF1 play different 453

roles in their regulation. In conclusion, regulation is not correlated to the co-distribution 454

of EMF1 and LHP1 and likely also AtBMI1 proteins, at target genes. 455

456

Discussion 457

PcG regulation in Arabidopsis requires the activity of three different PRC2s, 458

which regulate different developmental stages and display partial target specificity, and 459

PRC1, whose identity and function is not yet well defined. Although several putative 460

subunits have been identified (Merini and Calonje, 2015), and some evidence suggested 461

the existence of different functional PRC1 variants (Yang et al., 2013; Calonje, 2014; 462

Wang et al., 2014; Merini and Calonje, 2015), little is known about their composition 463

and function. In this work, we integrated genome wide transcriptome data with 464

H3K27me3 and protein localization data in order to shed some light on the role of 465

different PRC1 components and their possible relationship throughout plant 466

development. 467

Functional redundancy among the AtBMI1s 468

The identification of three AtBMI1 paralogs in Arabidopsis raised the question of 469

whether they display functional divergence (Sanchez-Pulido et al., 2008). We found that 470

AtBMI1A and B display mainly redundant functions throughout development, although 471

a small number of genes were specifically sensitive to AtBMI1B. A splice variant is 472

annotated at the AtBMI1B locus [the Arabidopsis information resource (TAIR)], which 473

encodes a variant isoform without the amino-terminal RING finger domain 474




16

(Supplemental Fig. S12). It is possible that alternative roles of the variant protein 475

explain the observed differences in gene expression between atbmi1a and atbmi1b 476

mutants. Conversely, AtBMI1C regulates a subset of AtBMI1A/B targets. The fact that 477

ectopic expression of AtBMI1C in double mutants [(Yang et al., 2013); Supplemental 478

Table S2] cannot rescue atbmi1a/b defects in the aerial part of the seedling points to a 479

requirement of tissue specific factors for AtBMI1C mediated repression. Accordingly, 480

AtBMI1C acts redundantly to AtBMI1A/B in the regulation of a considerable number 481

of genes involved in root development. Differences in protein sequence between 482

AtBMI1C and AtBMI1A/B (Bratzel et al., 2010; Chen et al., 2010; Bratzel et al., 2012) 483

may have restricted the possibilities of AtBMI1C to interact with some factors and/or 484

favored interaction with others. Likewise, MEA cannot compensate the loss of CLF and 485

SWN function despite its ectopic expression in clf/swn double mutants (Farrona et al., 486

2011). In any case, AtBMI1A, AtBMI1B and in part AtBMI1C display functional 487

redundancy, indicating how important it is to ensure AtBMI1 function throughout 488

development. 489

Role of AtBMI1 function in plant development 490

Transcriptome analysis revealed that 20% of the surveyed transcriptome was 491

misregulated in atbmi1a/b/c mutants, a much higher percentage than the one reported 492

for other PcG mutants, including clf/swn (Bouyer et al., 2011; Kim et al., 2012; Wang et 493

al., 2016) thereby underlining the central role of AtBMI1s in gene regulation. To 494

determine AtBMI1 regulatory gene network, we focused on genes that were upregulated 495

in atbmi1 mutants and H3K27me3 marked in WT seedlings of the same age, even 496

though these genes may represent a subset of candidate AtBMI1 targets. Our analysis 497

supported a requirement of AtBMI1 function for the repression of the seed 498

maturation/dormancy program after germination (Bratzel et al., 2010; Chen et al., 2010; 499

Molitor et al., 2014; Wang et al., 2016); however, it also unveiled the crucial role of 500

these proteins in promoting the transition from one developmental phase to the next 501

throughout development (Fig. 7A). After embryogenesis, plants undergo the transition 502

from seed dormancy to germination that is antagonistically regulated by two hormones, 503

ABA and Gibberelins (GA) (Shu et al., 2016). During seed maturation, endogenous 504

ABA accumulates in the seed, inducing and maintaining seed dormancy. In contrast, 505

before the onset of germination endogenous ABA levels in the seed are down-regulated, 506

while the GA content is up-regulated. Among the upregulated genes in atbmi1a/b/c 507




17

mutants were genes involved in inducing ABA and/or inhibiting GA signaling (e.g. 508

ABI3, ABI4, DOG1, PLT5, SOM) (Fig. 6A), indicating that AtBMI1 mediated 509

repression of these genes promotes this developmental transition. Following 510

germination, plants pass through a phase of vegetative growth that can be further 511

divided into a juvenile and an adult vegetative phase. The microRNA 156 (miR156) 512

regulates a subset of SPL transcription factors that have been shown to promote the 513

transition from juvenile to adult phase (Wu and Poethig, 2006); therefore, to allow 514

phase transition, miR156 levels need to decrease. Although our transcriptome analysis 515

could not detect mature miRNAs, it has been previously shown that pri-miR156 was 516

upregulated in atbmi1a/b mutants of all phenotypic severity (Pico et al., 2015); 517

accordingly, we found downregulation of several SPLs (e.g. SPL2/3/4/8/12) (Fig. 6A), 518

supporting that AtBMI1 function is required to allow this transition. Eventually, plants 519

experience the transition from vegetative to reproductive development. This transition 520

requires the repression of several flowering repressors such as FLC, MAF4/5 (Gu et al., 521

2013) and AGL15 (Fernandez et al., 2014), which are upregulated in double and triple 522

atbmi1 mutants (Fig. 7A). Consequently, flowering genes like FT, SOC1 and AGL24 523

were downregulated in atbmi1 mutants; therefore, AtBMI1 activity is also required to 524

switch from vegetative to reproductive development. 525

Furthermore, our data revealed the key role of AtBMI1 activity in controlling 526

stem cell niche specification and cell proliferation for a proper organ growth and 527

development via the repression of several master regulators (e.g. PLT and WOX genes) 528

(Fig. 7B), which is consistent with the wide spread acquisition of proliferating capacity 529

of atbmi1 strong mutants and the alterations in root, leaf and flower development 530

observed in different atbmi1 mutants (Bratzel et al., 2010; Yang et al., 2013). 531

Interplay of AtBMI1 with other PcG related factors 532

The function of AtBMI1 has been linked to the function of VAL1/2 proteins for 533

the regulation of several seed maturation genes (Yang et al., 2013). Here, we show that 534

VAL1/2 and AtBMI1s act together in the regulation of the seed maturation/dormancy 535

program; however, they do not seem to collaborate in the regulation of other 536

developmental processes. We found a specific enrichment of LEC2/ABI3/VP1 and 537

ABRE/G-box overlapping with GT-box cis-regulatory elements at the promoters of 538

genes co-regulated by AtBMI1 and VAL1/2 proteins. An enrichment of 539

LEC2/ABI3/VP1 and ABRE BINDING FACTOR 1 (ABF1) elements has been previously 540




18

reported at the promoter of genes upregulated in atbmi1a/b weak phenotype (Wang et 541

al., 2016). Genes co-regulated by ABI3/VP1-like proteins and ABA contain these 542

motifs at their promoters (Suzuki et al., 2005). Accordingly, ABI3 and ABI5 regulate 543

gene expression synergistically. Moreover, ABI3 interacts physically with ABI5, 544

thereby ABI3 is also recruited to the promoters of the target genes via protein-protein 545

interaction (Nakamura et al., 2001). A similar mechanism could be assumed for 546

repression in which the VAL1/2 proteins bind to LEC2/ABI3/VP1 and ASIL1 to the GT-547

box element, resulting in a direct competition with the transcriptional activators. The 548

binding of VAL1/2 and possibly ASIL1 proteins could recruit the AtBMI1s and the 549

other PcG proteins to establish chromatin modifications that maintain gene repression. 550

Whether ASIL1-mediated repression involves in vivo interaction with VAL and/or PcG 551

proteins remains to be investigated; however, in support of this, it has been shown that 552

EMF1 interacts with ASIL1 (named EIP7) in yeast two hybrid experiments (Park et al., 553

2011). 554

We also found an enrichment of LEC2/ABI3/VP1 elements, but not ABRE or GT-555

box elements, at the promoter of genes exclusively up_K27 in atbmi1a/b/c mutants, 556

suggesting an implication of B3 factors in the regulation of these genes as well. 557

Interestingly, two VAL1 splice variants have been identified through RNA sequencing 558

analysis: a full-length form and a truncated form lacking the plant homeodomain-like 559

domain (PHD-L) similar to VAL3, which also lacks the PHD-L domain (Schneider et 560

al., 2016). It is possible that truncated VAL1 and VAL3 target this group of genes, 561

explaining their lack of upregulation in val1/2 mutants. Alternatively, since the B3 562

superfamily encompasses other subfamilies, such as the AUXIN RESPONSE 563

FACTORS (ARF), the RELATED ABI3/VP1 (RAV) and the REPRODUCTIVE 564

MERISTEM (REM) subfamilies (Swaminathan et al., 2008), some uncharacterized 565

members of these might bind the LEC2/ABI3/VP1 element or a variation of it. In any 566

case, the promoters of the VAL1/2-independent genes are also enriched in other cis-567

regulatory elements such as ALFIN1 motifs that are recognized in Arabidopsis by the 568

ALs. Since the AL proteins interact with AtBMI1 proteins (Molitor et al., 2014), it is 569

likely that a combination of B3 and AL factors participates in the regulation of a subset 570

of these genes. 571

The relationship between AtBMI1 and EMF1 has been controversial. On one side, 572

mutants in both display a very different phenotype and misexpress different subsets of 573




19

PRC2 targets (Kim et al., 2010; Pu et al., 2013; Yang et al., 2013), which has led to 574

propose the existence of PRC1 variants (Calonje, 2014; Merini and Calonje, 2015); 575

however, they also co-regulated a subset of targets (e.g. ABI3, ABI4, FLC) and in vitro 576

they interact. Recent reports have shown that EMF1 co-purifies with PRC2 components 577

(Liang et al., 2015), questioning its exclusive association with PRC1. However, EMF1 578

co-localizes with only 45% of H3K27me3 marked genes showing a more narrow 579

distribution at target genes than H3K27me3 marks (Kim et al., 2012). Another putative 580

PRC1 component, LHP1, which broadly distributes across H3K27me3 marked sites 581

(Turck et al., 2007; Zhang et al., 2007; Engelhorn et al., 2012), also co-purifies with 582

PRC2 (Derkacheva et al., 2013; Liang et al., 2015) and interacts with AtBMI1 and 583

AtRING1 proteins in vitro (Xu and Shen, 2008; Bratzel et al., 2010). However, neither 584

EMF1 nor LHP1 seem to be PRC2 core components since they are required for 585

H3K27me3 marking of only a subset of PRC2 targets (Kim et al., 2012; Wang et al., 586

2016). 587

Interestingly, when we compared the H3K27me3 marked genes that were 588

upregulated in atbmi1a/b/c with K27_EMF1 direct targets, we found that 50% of the 589

upregulated genes in atbmi1 mutants were also EMF1 targets, suggesting that AtBMI1 590

and EMF1 could be in a complex and potentially both impact the expression of these 591

genes. Since LHP1 is at 93.9% of genes up_K27 in atbmi1a/b/c mutants, the same holds 592

true also for this PRC1 component. However, the little overlap between the genes 593

upregulated in atbmi1a/b/c and emf1-2 or lhp1 suggests a decisive role of AtBMI1 594

function in maintaining their repression. There were also genes exclusively upregulated 595

in emf1-2 or lhp1, the majority of which are involved in flower development and these 596

genes were not upregulated in atbmi1a/b/c mutants. An interesting possibility could be 597

that a PcG mechanism dependent on EMF1, LHP1 and PRC2 activities has evolved to 598

specifically regulate the flower developmental program, which is consistent with the 599

finding of these proteins co-purifying with PRC2 (Liang et al., 2015). 600

601

Conclusions 602

In summary, our data point to different PRC1 functional networks in which genes 603

may be regulated by AtBMI1 and/or EMF1 together with LHP1 and PRC2, and that 604

additional proteins are required to regulate distinct subsets of genes. This is the case of 605

VAL1/2 proteins in the seed development program, which built a network that 606




20

apparently also includes ABRE/GT-box binding factors (Fig. 7C). Furthermore, it seems 607

highly likely that other B3 domain transcription factors and ALs are part of AtBMI1-608

repressive circuits. In contrast, there seems little or no overlap in gene regulation by 609

AtBMI1 on the one side and EMF1 and LHP1 on the other, although these factors may 610

physically interact and be simultaneously present at target genes. 611

612

Materials and Methods 613

Plant material and growth conditions 614

Arabidopsis atbmi1a (N645041 line), atbmi1b (CS855837 line) atbmi1a/b and 615

atbmi1a/b/c (atbmi1c is a GT21221.Ds5.09.01.2006.jz07.348 line) mutants were 616

described previously (Bratzel et al., 2010; Yang et al., 2013). Segregation of “weak” 617

and “strong” atbmi1a/b phenotypes has been previously shown (Bratzel et al., 2010; 618

Pico et al., 2015). Plants were grown under long-day conditions at 21 °C on MS agar 619

plates containing 1.5% sucrose and 0.8% agar. Seedling samples were collected at 620

zeitgeber time 2. 621

Transcriptomic Analysis by RNA sequencing 622

The experimental design in our study consisted of two replicates for each genotype (WT 623

Col-0, atbmi1a, atbmi1b, atbmi1a/b and atbmi1a/b/c). RNA extraction was performed 624

using Qiagen-RNAesy mini-kit, following the manufacturer’s instruction. RNA 625

concentration and purity was tested using nanodrop-photometric quantification (Thermo 626

Scientific). Library preparation was carried out following the manufacturer’s 627

recommendations (TruSeq RNA Sample Prep Kit v2, Illumina). Sequencing of RNA 628

libraries was performed with the Illumina HiSeq 2000 sequencer, yielding an average of 629

approximately 15 million 100 bp long paired-end reads for each sample. The software 630

package FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) was used 631

for quality control. All sequencing samples were of high quality, and no preprocessing 632

of the reads was required to remove low-quality reads or read fragments (Supplemental 633

Fig. S2). The Arabidopsis thaliana Col-0 reference genome and annotation were 634

downloaded from the Phytozome database (TAIR10) (Goodstein et al., 2012). Mapping 635

of reads to the reference genome, transcript assembly, and differential expression were 636

performed with the software tools Bowtie, TopHat, and Cufflinks (Trapnell et al., 2012) 637

using default parameters producing a high percentage of concordant pair aligmnet rate 638




21

(Supplemental Table S1). The R package from Bioconductor CummeRbund 639

(http://www.bioconductor.org/) was used for subsequent analysis and graphical 640

representation of the results. Differentially expressed genes were selected as those 641

exhibiting an expression fold change greater than four when compared with the WT and 642

a p-value < 0.05. Venn diagrams comparing the different sets of differentially expressed 643

genes were generated with Venny 2.0.2 644

(http://bioinfogp.cnb.csic.es/tools/venny/index.html) and the significance of their 645

intersections with H3K27me3 marked genes was performed using Fisher’s exact test. 646

Gene ontology term enrichment was performed over the sets of differentially expressed 647

genes with the web-based tools AgriGO and ReViGO (Supek et al., 2011; Yu et al., 648

2012) and the R bioconductor package ClusterProfiler (Du et al., 2010) using Singular 649

Enrichment Analysis. 650

The clustering analysis was performed using the hierarchical algorithm implemented in 651

the R package cluster over normalized expression levels measured using FPKM. 652

Quantitative Real Time-PCR (qRT-PCR) 653

For qRT-PCR analysis, cDNAs were reverse-transcribed from total RNAs with 654

QuantiTect reverse transcription kit (Qiagen). qRT-PCRs were performed using Sensi 655

FAST SYBR & Fluorescein kit (Bioline) and an iQ5 Biorad system. Expression was 656

calculated relative to ACTIN. Primers used were as follow: 657

WOX9-RT-Fw (5ÁCTGTCGGAGGGTTTGAAGGTATC 3´); WOX9-RT-Rev 658

(5ÁGTGGTAGCGTAACAAATCTGAGTCT 3´); 659

WOX2-RT-Fw (5´GCTTACTTCAATCGCCTCCTCCACAA 3´); WOX2-RT-Rev 660

(5´GTCCGTTTCTCGTAGCCACCACTTG 3´); 661

SMB-RT-Fw (5ÁCGAATATCGCTTGGACGATAG 3´); SMB-RT-Rev 662

(5´GCTCTTGTTCTTGGTGAAATCC 3´); 663

ACT2-RT-Fw (5ĆACTTGCACCAAGCAGCATGAAGA 3´); ACT2-RT-Rev (5´ 664

AATGGAACCACCGATCCAGACACT 3´). 665

Motif and Transcription factor binding site enrichment analysis 666

Transcription Factor Binding Sites (TFBS) enrichment analysis was performed using 667

HOMER (Heinz et al. 2010) and the known TFBS sequences in plants from the 668

databases AGRIS (Davuluri et al., 2003), JASPAR (Sandelin et al., 2004) and AthaMap 669

(Steffens et al., 2004). The findMotifs.pl script was used with default parameters to 670




22

perform known and de-novo motif over-representation analysis for DNA sequences of 671

6, 7, 8 and 9 bp lengths. The target set consisted of all the gene promoters of interest. 672

The background used for the over-representation analysis consisted of all the gene 673

promoters annotated in the Arabidopsis TAIR10 genome. For the co-occurrence of the 674

ABRE and GT-box motifs, we first identify the locations of the ABRE motif at the 675

promoters and then extracted the DNA sequences 100bp upstream and downstream 676

from the center of the ABRE motif. We performed an enrichment analysis of the GT-677

box motif in these DNA sequences using the findMotifsGenome.pl HOMER script with 678

default parameters. The significance of the overlapping between motifs was performed 679

as an enrichment analysis of the DNA sequence resulting from the combination of both 680

motifs. DNA sequences used in these analyses were downloaded using the BioMart 681

functionality associated with Phytozome (Goodstein et al., 2012). Gene promoters were 682

defined as the 1000 bp DNA sequence upstream of the start codon of the corresponding 683

gene. 684

Data availability 685

The RNA-seq raw data generated in this study are publicly available from the GEO 686

database identified with accession number GSE83568 687

(http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?&acc=GSE83568). 688

689

Supplemental materials 690

Figure S1. Phenotypes of atbmi1a/b and atbmi1a/b/c mutants. 691

Figure S2. Boxplots representing the read quality scores (Illumina 1.5 encoding) per 692

base for the first replicate of all samples. 693

Figure S3. Correlation among differentially expressed genes in WT and the different 694

genotypes. 695

Figure S4. Altered gene expression in atbmi1 mutants. 696

Figure S5. Gene ontology (GO) enrichment analysis of up- and downregulated genes in 697

atbmi1a/b mutants. 698

Figure S6. Gene ontology (GO) enrichment analysis of up- and downregulated genes in 699

atbmi1a/b/c mutants. 700

Figure S7. Putative AtBMI1direct target genes. 701




23

Figure S8. Genes differentially expressed in atbmi1a/b and atbmi1a/b/c. 702

Figure S9. Different gene expression patterns of atbmi1a/b weak and atbmi1a/b/c 703

mutants. 704

Figure S10. Expression levels of different important developmental genes in WT and 705

atbmi1a/b/c mutants. 706

Figure S11. AtBMI1, EMF1 and LHP1 functional relationship. 707

Figure S12. AtBMI1B (At1g06770) splice variants. 708

Table S1. Number of reads and concurrent pair alignment rate per sequencing sample 709

Table S2. Up- and downregulated genes in atbmi1 mutants. 710

Table S3. Upregulated genes in atbmi1 and val1/2 mutants that are marked with 711

H3K27me3 marks in WT, and genes in cluster I, II and III after comparing genes 712

up_K27 in atbmi1a/b and atbmi1a/b/c. 713

Table S4. Upregulated genes in emf1-2 and lhp1 mutants that are marked with 714

H3K27me3 marks in WT. 715

716

Figure legends 717

Figure 1. Transcriptome analysis of WT and selected atbmi1 mutants at 10 DAG. 718

(A) Volcano plots representing differentially expressed genes in atbmi1 mutants 719

compared to WT according to a 4-fold change and a p-value of 0.05. Green color 720

indicates significantly upregulated genes and red color significantly downregulated 721

genes. (B) Principal Component Analysis of the transcriptomes showing that WT, 722

atbmi1a and atbmi1b cluster together, whereas atbmi1a/b and atbmi1a/b/c constitute 723

two distinct clusters. (C) Differentially expressed genes in the different genotypes, 724

where the number of up and down regulated genes is indicated. (D) Number of genes 725

that were upregulated in the different mutants and H3K27me3 marked in WT seedlings 726

of the same age (up_K27). 727

Figure 2. Genes regulated by AtBMI1A and AtBMI1B. (A) Venn diagram showing 728

the number of up_K27 genes that overlap among atbmi1a, atbmi1b and atbmi1a/b 729

mutants. All overlaps are significant with p-values lower than 2.2x10-16 and odds ratios 730

greater than 17 according to Fisher's Exact test (B) Expression of levels of genes that 731

were apparently specifically upregulated in atbmi1a or atbmi1b mutants in the different 732

genotypes. 733




24

Figure 3. Functional redundancy between AtBMI1A/B and AtBMI1C. (A) 734

Clustering analysis of genes up_K27 in atbmi1a/b and atbmi1a/b/c mutants. This is a 735

significant overlap with a p-value lower than 2.2x10-16 and an odds ratio greater than 21 736

according to Fisher's Exact test. (B) Expression levels in WT, atbmi1a/b and 737

atbmi1a/b/c of genes from the different clusters. The color code represents normalized 738

expression values measured in FPKM. 739

Figure 4. Different gene expression patterns of atbmi1a/b weak and strong mutants. 740

(A) Venn diagram showing overlap between the genes up_K27 in atbmi1a/b weak and 741

strong mutants. The overlap is significant with a p-value lower than 2.2x10-16 and an 742

odds ratio greater than 15 according to Fisher's Exact test. Some representative 743

transcription factors (TFs) in each dataset are indicated. TFs found in the two data sets 744

are highlighter in red. (B) Key flowering genes are downregulated in atbmi1a/b/c 745

mutants. The color code in upper panel represents normalized expression values 746

measured in FPKM. 747

Figure 5. Interplay of AtBMI1 proteins with VAL1/2 proteins. (A) Venn diagram 748

showing overlap between the genes up_K27 in atbmi1a/b/c and val1/2 mutants. 749

Sequence LOGOs of cis-regulatory elements enriched only in up_K27 atbmi1a/b/c and 750

in atbmi1a/b/c and val1/2 overlapping genes. (B) Co-occurrence and overlapping of 751

ABRE/G-box and GT-box at the promoter of AtBMI1/VAL1/2 co-regulated genes. P-752

values and percentage in targets and background are indicated. 753

Figure 6. AtBMI1, EMF1 and LHP1 regulatory networks. (A) Comparison of genes 754

H3K27me3 marked bound by EMF1 and misexpressed in atbmi1a/b/c and with genes 755

up_K27 in atbmi1a/b/c. (B) Venn diagram showing up_K27 genes in atbmi1a/b/c and 756

emf1-2. (C) Comparison of genes H3K27me3 marked bound by LHP1 and 757

misexpressed in atbmi1a/b/c and with genes up_K27 in atbmi1a/b/c. (D) Venn diagram 758

showing up_K27 genes in atbmi1a/b/c and lhp1. Some overlapping and non-759

overlapping representative genes are indicated. All these overlaps are significant (p-760

values and Fisher's Exact test results are indicated). 761

Figure 7. Role of AtBMI1 proteins in regulating plant development. (A) AtBMI1 762

proteins and PRC2 promote developmental phase transitions by the repression of key 763

regulatory genes. (B) AtBMI1 and PRC2 are required to control cell proliferation and 764

differentiation during organ growth and development through the repression of master 765




25

regulators. (C) PRC1 variants differing in component composition and biochemical 766

properties may collaborate with PRC2 activity in regulating phase transitions and 767

different developmental processes throughout plant development. VAL and ASIL1/2 or 768

AL1-7 proteins may recruit AtBMI1-containing complexes to target gene promoters by 769

binding the appropriate combination of cis-regulatory elements. 770

771

References 772

Beh LY, Colwell LJ, Francis NJ (2012) A core subunit of Polycomb repressive 773

complex 1 is broadly conserved in function but not primary sequence. Proc Natl 774

Acad Sci U S A 109: E1063-1071 775

Bouyer D, Roudier F, Heese M, Andersen ED, Gey D, Nowack MK, Goodrich J, 776

Renou J-P, Grini PE, Colot V, et al (2011) Polycomb repressive complex 2 777

controls the embryo-to-seedling phase transition. PLoS Genet 7: e1002014 778

Bratzel F, López-Torrejón G, Koch M, Del Pozo JC, Calonje M (2010) Keeping cell 779

identity in Arabidopsis requires PRC1 RING-finger homologs that catalyze H2A 780

monoubiquitination. Curr Biol CB 20: 1853–1859 781

Bratzel F, Yang C, Angelova A, López-Torrejón G, Koch M, del Pozo JC, Calonje 782

M (2012) Regulation of the new Arabidopsis imprinted gene AtBMI1C requires 783

the interplay of different epigenetic mechanisms. Mol Plant 5: 260–269 784

Calonje M (2014) PRC1 marks the difference in plant PcG repression. Mol Plant 7: 785

459–471 786

Calonje M, Sanchez R, Chen L, Sung ZR (2008) EMBRYONIC FLOWER1 787

participates in polycomb group-mediated AG gene silencing in Arabidopsis. 788

Plant Cell 20: 277–291 789

Cao R, Tsukada Y-I, Zhang Y (2005) Role of Bmi-1 and Ring1A in H2A 790

ubiquitylation and Hox gene silencing. Mol Cell 20: 845–854 791




26

Carles C, Bies-Etheve N, Aspart L, Léon-Kloosterziel KM, Koornneef M, 792

Echeverria M, Delseny M (2002) Regulation of Arabidopsis thaliana Em 793

genes: role of ABI5. Plant J Cell Mol Biol 30: 373–383 794

Chanvivattana Y, Bishopp A, Schubert D, Stock C, Moon Y-H, Sung ZR, 795

Goodrich J (2004) Interaction of Polycomb-group proteins controlling 796

flowering in Arabidopsis. Dev Camb Engl 131: 5263–5276 797

Chen D, Molitor A, Liu C, Shen W-H (2010) The Arabidopsis PRC1-like ring-finger 798

proteins are necessary for repression of embryonic traits during vegetative 799

growth. Cell Res 20: 1332–1344 800

Choi H, Hong J, Ha J, Kang J, Kim SY (2000) ABFs, a family of ABA-responsive 801

element binding factors. J Biol Chem 275: 1723–1730 802

Cutler SR, Rodriguez PL, Finkelstein RR, Abrams SR (2010) Abscisic acid: 803

emergence of a core signaling network. Annu Rev Plant Biol 61: 651–679 804

Davuluri RV, Sun H, Palaniswamy SK, Matthews N, Molina C, Kurtz M, 805

Grotewold E (2003) AGRIS: Arabidopsis gene regulatory information server, 806

an information resource of Arabidopsis cis-regulatory elements and transcription 807

factors. BMC Bioinformatics 4: 25 808

Delmas F, Sankaranarayanan S, Deb S, Widdup E, Bournonville C, Bollier N, 809

Northey JGB, McCourt P, Samuel MA (2013) ABI3 controls embryo 810

degreening through Mendel’s I locus. Proc Natl Acad Sci U S A 110: E3888-811

3894 812

Derkacheva M, Steinbach Y, Wildhaber T, Mozgová I, Mahrez W, Nanni P, 813

Bischof S, Gruissem W, Hennig L (2013) Arabidopsis MSI1 connects LHP1 to 814

PRC2 complexes. EMBO J 32: 2073–2085 815

Du Z, Zhou X, Ling Y, Zhang Z, Su Z (2010) agriGO: a GO analysis toolkit for the 816

agricultural community. Nucleic Acids Res 38: W64-70 817




27

Engelhorn J, Reimer JJ, Leuz I, Göbel U, Huettel B, Farrona S, Turck F (2012) 818

Development-related PcG target in the apex 4 controls leaf margin architecture 819

in Arabidopsis thaliana. Dev Camb Engl 139: 2566–2575 820

Farrona S, Thorpe FL, Engelhorn J, Adrian J, Dong X, Sarid-Krebs L, Goodrich 821

J, Turck F (2011) Tissue-specific expression of FLOWERING LOCUS T in 822

Arabidopsis is maintained independently of polycomb group protein repression. 823

Plant Cell 23: 3204–3214 824

Fernandez DE, Wang C-T, Zheng Y, Adamczyk BJ, Singhal R, Hall PK, Perry SE 825

(2014) The MADS-Domain Factors AGAMOUS-LIKE15 and AGAMOUS-826

LIKE18, along with SHORT VEGETATIVE PHASE and AGAMOUS-LIKE24, 827

Are Necessary to Block Floral Gene Expression during the Vegetative Phase. 828

Plant Physiol 165: 1591–1603 829

Förderer A, Zhou Y, Turck F (2016) The age of multiplexity: recruitment and 830

interactions of Polycomb complexes in plants. Curr Opin Plant Biol 29: 169–178 831

Francis NJ, Kingston RE, Woodcock CL (2004) Chromatin compaction by a 832

polycomb group protein complex. Science 306: 1574–1577 833

Gangappa SN, Srivastava AK, Maurya JP, Ram H, Chattopadhyay S (2013) Z-box 834

binding transcription factors (ZBFs): a new class of transcription factors in 835

Arabidopsis seedling development. Mol Plant 6: 1758–1768 836

Gao M-J, Lydiate DJ, Li X, Lui H, Gjetvaj B, Hegedus DD, Rozwadowski K (2009) 837

Repression of Seed Maturation Genes by a Trihelix Transcriptional Repressor in 838

Arabidopsis Seedlings. Plant Cell 21: 54–71 839

Gaudin V, Libault M, Pouteau S, Juul T, Zhao G, Lefebvre D, Grandjean O (2001) 840

Mutations in LIKE HETEROCHROMATIN PROTEIN 1 affect flowering time 841

and plant architecture in Arabidopsis. Dev Camb Engl 128: 4847–4858 842

Gendall AR, Levy YY, Wilson A, Dean C (2001) The VERNALIZATION 2 gene 843

mediates the epigenetic regulation of vernalization in Arabidopsis. Cell 107: 844

525–535 845




28

Goodrich J, Puangsomlee P, Martin M, Long D, Meyerowitz EM, Coupland G 846

(1997) A Polycomb-group gene regulates homeotic gene expression in 847

Arabidopsis. Nature 386: 44–51 848

Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, Mitros T, Dirks 849

W, Hellsten U, Putnam N, et al (2012) Phytozome: a comparative platform for 850

green plant genomics. Nucleic Acids Res 40: D1178-1186 851

van der Graaff E, Laux T, Rensing SA (2009) The WUS homeobox-containing 852

(WOX) protein family. Genome Biol 10: 248 853

Grossniklaus U, Vielle-Calzada JP, Hoeppner MA, Gagliano WB (1998) Maternal 854

control of embryogenesis by MEDEA, a polycomb group gene in Arabidopsis. 855

Science 280: 446–450 856

Gu X, Le C, Wang Y, Li Z, Jiang D, Wang Y, He Y (2013) Arabidopsis FLC clade 857

members form flowering-repressor complexes coordinating responses to 858

endogenous and environmental cues. Nat Commun 4: 1947 859

Hennig L, Bouveret R, Gruissem W (2005) MSI1-like proteins: an escort service for 860

chromatin assembly and remodeling complexes. Trends Cell Biol 15: 295–302 861

Horstman A, Willemsen V, Boutilier K, Heidstra R (2014) AINTEGUMENTA-862

LIKE proteins: hubs in a plethora of networks. Trends Plant Sci 19: 146–157 863

Kim SY, Lee J, Eshed-Williams L, Zilberman D, Sung ZR (2012) EMF1 and PRC2 864

cooperate to repress key regulators of Arabidopsis development. PLoS Genet 8: 865

e1002512 866

Kim SY, Zhu T, Sung ZR (2010) Epigenetic regulation of gene programs by EMF1 867

and EMF2 in Arabidopsis. Plant Physiol 152: 516–528 868

Lee WY, Lee D, Chung W-I, Kwon CS (2009) Arabidopsis ING and Alfin1-like 869

protein families localize to the nucleus and bind to H3K4me3/2 via plant 870

homeodomain fingers. Plant J Cell Mol Biol 58: 511–524 871

Liang SC, Hartwig B, Perera P, Mora-García S, de Leau E, Thornton H, de Alves 872

FL, Rapsilber J, Yang S, James GV, et al (2015) Kicking against the PRCs - 873




29

A Domesticated Transposase Antagonises Silencing Mediated by Polycomb 874

Group Proteins and Is an Accessory Component of Polycomb Repressive 875

Complex 2. PLoS Genet 11: e1005660 876

Luo M, Bilodeau P, Koltunow A, Dennis ES, Peacock WJ, Chaudhury AM (1999) 877

Genes controlling fertilization-independent seed development in Arabidopsis 878

thaliana. Proc Natl Acad Sci U S A 96: 296–301 879

Merini W, Calonje M (2015) PRC1 is taking the lead in PcG repression. Plant J Cell 880

Mol Biol. doi: 10.1111/tpj.12818 881

Molitor AM, Bu Z, Yu Y, Shen W-H (2014) Arabidopsis AL PHD-PRC1 complexes 882

promote seed germination through H3K4me3-to-H3K27me3 chromatin state 883

switch in repression of seed developmental genes. PLoS Genet 10: e1004091 884

Mozgova I, Köhler C, Hennig L (2015) Keeping the gate closed: functions of the 885

polycomb repressive complex PRC2 in development. Plant J Cell Mol Biol 83: 886

121–132 887

Müller J, Hart CM, Francis NJ, Vargas ML, Sengupta A, Wild B, Miller EL, 888

O’Connor MB, Kingston RE, Simon JA (2002) Histone methyltransferase 889

activity of a Drosophila Polycomb group repressor complex. Cell 111: 197–208 890

Nakamura S, Lynch TJ, Finkelstein RR (2001) Physical interactions between ABA 891

response loci of Arabidopsis. Plant J Cell Mol Biol 26: 627–635 892

Ohad N, Yadegari R, Margossian L, Hannon M, Michaeli D, Harada JJ, Goldberg 893

RB, Fischer RL (1999) Mutations in FIE, a WD polycomb group gene, allow 894

endosperm development without fertilization. Plant Cell 11: 407–416 895

Park H-Y, Lee S-Y, Seok H-Y, Kim S-H, Sung ZR, Moon Y-H (2011) EMF1 896

interacts with EIP1, EIP6 or EIP9 involved in the regulation of flowering time in 897

Arabidopsis. Plant Cell Physiol 52: 1376–1388 898

Peterson AJ, Mallin DR, Francis NJ, Ketel CS, Stamm J, Voeller RK, Kingston 899

RE, Simon JA (2004) Requirement for sex comb on midleg protein interactions 900

in Drosophila polycomb group repression. Genetics 167: 1225–1239 901




30

Pico S, Ortiz-Marchena MI, Merini W, Calonje M (2015) Deciphering the role of 902

Polycomb Repressive Complex 1 (PRC1) variants in regulating the acquisition 903

of flowering competence in Arabidopsis. Plant Physiol. doi: 904

10.1104/pp.15.00073 905

Pu L, Liu M-S, Kim SY, Chen L-FO, Fletcher JC, Sung ZR (2013) EMBRYONIC 906

FLOWER1 and ULTRAPETALA1 Act Antagonistically on Arabidopsis 907

Development and Stress Response. Plant Physiol 162: 812–830 908

Qüesta JI, Song J, Geraldo N, An H, Dean C (2016) Arabidopsis transcriptional 909

repressor VAL1 triggers Polycomb silencing at FLC during vernalization. 910

Science 353: 485–488 911

Ringrose L, Paro R (2004) Epigenetic regulation of cellular memory by the Polycomb 912

and Trithorax group proteins. Annu Rev Genet 38: 413–443 913

Sanchez-Pulido L, Devos D, Sung ZR, Calonje M (2008) RAWUL: a new ubiquitin-914

like domain in PRC1 ring finger proteins that unveils putative plant and worm 915

PRC1 orthologs. BMC Genomics 9: 308 916

Sandelin A, Alkema W, Engström P, Wasserman WW, Lenhard B (2004) JASPAR: 917

an open-access database for eukaryotic transcription factor binding profiles. 918

Nucleic Acids Res 32: D91-94 919

Santos-Mendoza M, Dubreucq B, Baud S, Parcy F, Caboche M, Lepiniec L (2008) 920

Deciphering gene regulatory networks that control seed development and 921

maturation in Arabidopsis. Plant J Cell Mol Biol 54: 608–620 922

Schneider A, Aghamirzaie D, Elmarakeby H, Poudel AN, Koo AJ, Heath LS, 923

Grene R, Collakova E (2016) Potential targets of VIVIPAROUS1/ABI3-924

LIKE1 (VAL1) repression in developing Arabidopsis thaliana embryos. Plant J 925

Cell Mol Biol 85: 305–319 926

Schwartz YB, Pirrotta V (2013) A new world of Polycombs: unexpected partnerships 927

and emerging functions. Nat Rev Genet 14: 853–864 928




31

Shao Z, Raible F, Mollaaghababa R, Guyon JR, Wu CT, Bender W, Kingston RE 929

(1999) Stabilization of chromatin structure by PRC1, a Polycomb complex. Cell 930

98: 37–46 931

Shu K, Liu X, Xie Q, He Z (2016) Two Faces of One Seed: Hormonal Regulation of 932

Dormancy and Germination. Mol Plant 9: 34–45 933

Simon JA, Kingston RE (2013) Occupying chromatin: Polycomb mechanisms for 934

getting to genomic targets, stopping transcriptional traffic, and staying put. Mol 935

Cell 49: 808–824 936

Steffens NO, Galuschka C, Schindler M, Bülow L, Hehl R (2004) AthaMap: an 937

online resource for in silico transcription factor binding sites in the Arabidopsis 938

thaliana genome. Nucleic Acids Res 32: D368-372 939

Supek F, Bošnjak M, Škunca N, Šmuc T (2011) REVIGO summarizes and visualizes 940

long lists of gene ontology terms. PloS One 6: e21800 941

Suzuki M, Ketterling MG, McCarty DR (2005) Quantitative statistical analysis of 942

cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of 943

Arabidopsis. Plant Physiol 139: 437–447 944

Suzuki M, Wang HH-Y, McCarty DR (2007) Repression of the LEAFY 945

COTYLEDON 1/B3 regulatory network in plant embryo development by 946

VP1/ABSCISIC ACID INSENSITIVE 3-LIKE B3 genes. Plant Physiol 143: 947

902–911 948

Swaminathan K, Peterson K, Jack T (2008) The plant B3 superfamily. Trends Plant 949

Sci 13: 647–655 950

Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg 951

SL, Rinn JL, Pachter L (2012) Differential gene and transcript expression 952

analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7: 953

562–578 954

Turck F, Roudier F, Farrona S, Martin-Magniette M-L, Guillaume E, Buisine N, 955

Gagnot S, Martienssen RA, Coupland G, Colot V (2007) Arabidopsis 956




32

TFL2/LHP1 specifically associates with genes marked by trimethylation of 957

histone H3 lysine 27. PLoS Genet 3: e86 958

Veluchamy A, Jégu T, Ariel F, Latrasse D, Mariappan KG, Kim S-K, Crespi M, 959

Hirt H, Bergounioux C, Raynaud C, et al (2016) LHP1 Regulates H3K27me3 960

Spreading and Shapes the Three-Dimensional Conformation of the Arabidopsis 961

Genome. PloS One 11: e0158936 962

Vicente-Carbajosa J, Carbonero P (2005) Seed maturation: developing an intrusive 963

phase to accomplish a quiescent state. Int J Dev Biol 49: 645–651 964

Wang H, Liu C, Cheng J, Liu J, Zhang L, He C, Shen W-H, Jin H, Xu L, Zhang Y 965

(2016) Arabidopsis Flower and Embryo Developmental Genes are Repressed in 966

Seedlings by Different Combinations of Polycomb Group Proteins in 967

Association with Distinct Sets of Cis-regulatory Elements. PLoS Genet 12: 968

e1005771 969

Wang Y, Gu X, Yuan W, Schmitz RJ, He Y (2014) Photoperiodic control of the floral 970

transition through a distinct polycomb repressive complex. Dev Cell 28: 727–971

736 972

Wei W, Zhang Y-Q, Tao J-J, Chen H-W, Li Q-T, Zhang W-K, Ma B, Lin Q, 973

Zhang J-S, Chen S-Y (2015) The Alfin-like homeodomain finger protein AL5 974

suppresses multiple negative factors to confer abiotic stress tolerance in 975

Arabidopsis. Plant J Cell Mol Biol 81: 871–883 976

Wolff P, Weinhofer I, Seguin J, Roszak P, Beisel C, Donoghue MTA, Spillane C, 977

Nordborg M, Rehmsmeier M, Köhler C (2011) High-resolution analysis of 978

parent-of-origin allelic expression in the Arabidopsis Endosperm. PLoS Genet 7: 979

e1002126 980

Wu G, Poethig RS (2006) Temporal regulation of shoot development in Arabidopsis 981

thaliana by miR156 and its target SPL3. Dev Camb Engl 133: 3539–3547 982

Xiao J, Wagner D (2015) Polycomb repression in the regulation of growth and 983

development in Arabidopsis. Curr Opin Plant Biol 23: 15–24 984




33

Xu L, Shen W-H (2008) Polycomb silencing of KNOX genes confines shoot stem cell 985

niches in Arabidopsis. Curr Biol CB 18: 1966–1971 986

Yang C, Bratzel F, Hohmann N, Koch M, Turck F, Calonje M (2013) VAL- and 987

AtBMI1-mediated H2Aub initiate the switch from embryonic to postgerminative 988

growth in Arabidopsis. Curr Biol CB 23: 1324–1329 989

Yoshida N, Yanai Y, Chen L, Kato Y, Hiratsuka J, Miwa T, Sung ZR, Takahashi S 990

(2001) EMBRYONIC FLOWER2, a novel polycomb group protein homolog, 991

mediates shoot development and flowering in Arabidopsis. Plant Cell 13: 2471–992

2481 993

Yu G, Wang L-G, Han Y, He Q-Y (2012) clusterProfiler: an R package for comparing 994

biological themes among gene clusters. Omics J Integr Biol 16: 284–287 995

Zhang X, Germann S, Blus BJ, Khorasanizadeh S, Gaudin V, Jacobsen SE (2007) 996

The Arabidopsis LHP1 protein colocalizes with histone H3 Lys27 997

trimethylation. Nat Struct Mol Biol 14: 869–871 998

999




Parsed CitationsBeh LY, Colwell LJ, Francis NJ (2012) A core subunit of Polycomb repressive complex 1 is broadly conserved in function but notprimary sequence. Proc Natl Acad Sci U S A 109: E1063-1071

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bouyer D, Roudier F, Heese M, Andersen ED, Gey D, Nowack MK, Goodrich J, Renou J-P, Grini PE, Colot V, et al (2011) Polycombrepressive complex 2 controls the embryo-to-seedling phase transition. PLoS Genet 7: e1002014


Bratzel F, López-Torrejón G, Koch M, Del Pozo JC, Calonje M (2010) Keeping cell identity in Arabidopsis requires PRC1 RING-finger homologs that catalyze H2A monoubiquitination. Curr Biol CB 20: 1853-1859


Bratzel F, Yang C, Angelova A, López-Torrejón G, Koch M, del Pozo JC, Calonje M (2012) Regulation of the new Arabidopsisimprinted gene AtBMI1C requires the interplay of different epigenetic mechanisms. Mol Plant 5: 260-269


Calonje M (2014) PRC1 marks the difference in plant PcG repression. Mol Plant 7: 459-471Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Calonje M, Sanchez R, Chen L, Sung ZR (2008) EMBRYONIC FLOWER1 participates in polycomb group-mediated AG genesilencing in Arabidopsis. Plant Cell 20: 277-291


Cao R, Tsukada Y-I, Zhang Y (2005) Role of Bmi-1 and Ring1A in H2A ubiquitylation and Hox gene silencing. Mol Cell 20: 845-854Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Carles C, Bies-Etheve N, Aspart L, Léon-Kloosterziel KM, Koornneef M, Echeverria M, Delseny M (2002) Regulation ofArabidopsis thaliana Em genes: role of ABI5. Plant J Cell Mol Biol 30: 373-383


Chanvivattana Y, Bishopp A, Schubert D, Stock C, Moon Y-H, Sung ZR, Goodrich J (2004) Interaction of Polycomb-group proteinscontrolling flowering in Arabidopsis. Dev Camb Engl 131: 5263-5276


Chen D, Molitor A, Liu C, Shen W-H (2010) The Arabidopsis PRC1-like ring-finger proteins are necessary for repression ofembryonic traits during vegetative growth. Cell Res 20: 1332-1344


Choi H, Hong J, Ha J, Kang J, Kim SY (2000) ABFs, a family of ABA-responsive element binding factors. J Biol Chem 275: 1723-1730Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Cutler SR, Rodriguez PL, Finkelstein RR, Abrams SR (2010) Abscisic acid: emergence of a core signaling network. Annu Rev PlantBiol 61: 651-679


Davuluri RV, Sun H, Palaniswamy SK, Matthews N, Molina C, Kurtz M, Grotewold E (2003) AGRIS: Arabidopsis gene regulatoryinformation server, an information resource of Arabidopsis cis-regulatory elements and transcription factors. BMC Bioinformatics4: 25


Delmas F, Sankaranarayanan S, Deb S, Widdup E, Bournonville C, Bollier N, Northey JGB, McCourt P, Samuel MA (2013) ABI3controls embryo degreening through Mendel's I locus. Proc Natl Acad Sci U S A 110: E3888-3894 www.plantphysiol.org on December 14, 2016 - Published by www.plantphysiol.orgDownloaded from

Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Beh LY%2C Colwell LJ%2C Francis NJ %282012%29 A core subunit of Polycomb repressive complex 1 is broadly conserved in function but not primary sequence%2E Proc Natl Acad Sci U S A 109%3A E1063%2D1071&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Beh LY, Colwell LJ, Francis NJ (2012) A core subunit of Polycomb repressive complex 1 is broadly conserved in function but not primary sequence. Proc Natl Acad Sci U S A 109: E1063-1071

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Beh&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A core subunit of Polycomb repressive complex 1 is broadly conserved in function but not primary sequence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A core subunit of Polycomb repressive complex 1 is broadly conserved in function but not primary sequence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Beh&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Bouyer D%2C Roudier F%2C Heese M%2C Andersen ED%2C Gey D%2C Nowack MK%2C Goodrich J%2C Renou J%2DP%2C Grini PE%2C Colot V%2C et al %282011%29 Polycomb repressive complex 2 controls the embryo%2Dto%2Dseedling phase transition%2E PLoS Genet 7%3A e1002014&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bouyer D, Roudier F, Heese M, Andersen ED, Gey D, Nowack MK, Goodrich J, Renou J-P, Grini PE, Colot V, et al (2011) Polycomb repressive complex 2 controls the embryo-to-seedling phase transition. PLoS Genet 7: e1002014

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bouyer&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Polycomb repressive complex 2 controls the embryo-to-seedling phase transition.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Polycomb repressive complex 2 controls the embryo-to-seedling phase transition.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bouyer&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Bratzel F%2C L�pez%2DTorrej�n G%2C Koch M%2C Del Pozo JC%2C Calonje M %282010%29 Keeping cell identity in Arabidopsis requires PRC1 RING%2Dfinger homologs that catalyze H2A monoubiquitination%2E Curr Biol CB 20%3A 1853%2D1859&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bratzel F, L�pez-Torrej�n G, Koch M, Del Pozo JC, Calonje M (2010) Keeping cell identity in Arabidopsis requires PRC1 RING-finger homologs that catalyze H2A monoubiquitination. Curr Biol CB 20: 1853-1859

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bratzel&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Keeping cell identity in Arabidopsis requires PRC1 RING-finger homologs that catalyze H2A monoubiquitination&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Keeping cell identity in Arabidopsis requires PRC1 RING-finger homologs that catalyze H2A monoubiquitination&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bratzel&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Bratzel F%2C Yang C%2C Angelova A%2C L�pez%2DTorrej�n G%2C Koch M%2C del Pozo JC%2C Calonje M %282012%29 Regulation of the new Arabidopsis imprinted gene AtBMI1C requires the interplay of different epigenetic mechanisms%2E Mol Plant 5%3A 260%2D269&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bratzel F, Yang C, Angelova A, L�pez-Torrej�n G, Koch M, del Pozo JC, Calonje M (2012) Regulation of the new Arabidopsis imprinted gene AtBMI1C requires the interplay of different epigenetic mechanisms. Mol Plant 5: 260-269

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bratzel&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of the new Arabidopsis imprinted gene AtBMI1C requires the interplay of different epigenetic mechanisms&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of the new Arabidopsis imprinted gene AtBMI1C requires the interplay of different epigenetic mechanisms&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bratzel&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Calonje M %282014%29 PRC1 marks the difference in plant PcG repression%2E Mol Plant 7%3A 459%2D471&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Calonje M (2014) PRC1 marks the difference in plant PcG repression. Mol Plant 7: 459-471

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Calonje&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=PRC1 marks the difference in plant PcG repression&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=PRC1 marks the difference in plant PcG repression&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Calonje&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Calonje M%2C Sanchez R%2C Chen L%2C Sung ZR %282008%29 EMBRYONIC FLOWER1 participates in polycomb group%2Dmediated AG gene silencing in Arabidopsis%2E Plant Cell 20%3A 277%2D291&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Calonje M, Sanchez R, Chen L, Sung ZR (2008) EMBRYONIC FLOWER1 participates in polycomb group-mediated AG gene silencing in Arabidopsis. Plant Cell 20: 277-291

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Calonje&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=EMBRYONIC FLOWER1 participates in polycomb group-mediated AG gene silencing in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=EMBRYONIC FLOWER1 participates in polycomb group-mediated AG gene silencing in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Calonje&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Cao R%2C Tsukada Y%2DI%2C Zhang Y %282005%29 Role of Bmi%2D1 and Ring1A in H2A ubiquitylation and Hox gene silencing%2E Mol Cell 20%3A 845%2D854&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cao R, Tsukada Y-I, Zhang Y (2005) Role of Bmi-1 and Ring1A in H2A ubiquitylation and Hox gene silencing. Mol Cell 20: 845-854

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Role of Bmi-1 and Ring1A in H2A ubiquitylation and Hox gene silencing&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Role of Bmi-1 and Ring1A in H2A ubiquitylation and Hox gene silencing&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cao&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Carles C%2C Bies%2DEtheve N%2C Aspart L%2C L�on%2DKloosterziel KM%2C Koornneef M%2C Echeverria M%2C Delseny M %282002%29 Regulation of Arabidopsis thaliana Em genes%3A role of ABI5%2E Plant J Cell Mol Biol 30%3A 373%2D383&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Carles C, Bies-Etheve N, Aspart L, L�on-Kloosterziel KM, Koornneef M, Echeverria M, Delseny M (2002) Regulation of Arabidopsis thaliana Em genes: role of ABI5. Plant J Cell Mol Biol 30: 373-383

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Carles&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of Arabidopsis thaliana Em genes: role of ABI5&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of Arabidopsis thaliana Em genes: role of ABI5&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Carles&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Chanvivattana Y%2C Bishopp A%2C Schubert D%2C Stock C%2C Moon Y%2DH%2C Sung ZR%2C Goodrich J %282004%29 Interaction of Polycomb%2Dgroup proteins controlling flowering in Arabidopsis%2E Dev Camb Engl 131%3A 5263%2D5276&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chanvivattana Y, Bishopp A, Schubert D, Stock C, Moon Y-H, Sung ZR, Goodrich J (2004) Interaction of Polycomb-group proteins controlling flowering in Arabidopsis. Dev Camb Engl 131: 5263-5276

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chanvivattana&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Interaction of Polycomb-group proteins controlling flowering in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Interaction of Polycomb-group proteins controlling flowering in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chanvivattana&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Chen D%2C Molitor A%2C Liu C%2C Shen W%2DH %282010%29 The Arabidopsis PRC1%2Dlike ring%2Dfinger proteins are necessary for repression of embryonic traits during vegetative growth%2E Cell Res 20%3A 1332%2D1344&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chen D, Molitor A, Liu C, Shen W-H (2010) The Arabidopsis PRC1-like ring-finger proteins are necessary for repression of embryonic traits during vegetative growth. Cell Res 20: 1332-1344

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis PRC1-like ring-finger proteins are necessary for repression of embryonic traits during vegetative growth&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis PRC1-like ring-finger proteins are necessary for repression of embryonic traits during vegetative growth&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chen&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Choi H%2C Hong J%2C Ha J%2C Kang J%2C Kim SY %282000%29 ABFs%2C a family of ABA%2Dresponsive element binding factors%2E J Biol Chem 275%3A 1723%2D1730&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Choi H, Hong J, Ha J, Kang J, Kim SY (2000) ABFs, a family of ABA-responsive element binding factors. J Biol Chem 275: 1723-1730

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Choi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ABFs, a family of ABA-responsive element binding factors&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ABFs, a family of ABA-responsive element binding factors&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Choi&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Cutler SR%2C Rodriguez PL%2C Finkelstein RR%2C Abrams SR %282010%29 Abscisic acid%3A emergence of a core signaling network%2E Annu Rev Plant Biol 61%3A 651%2D679&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cutler SR, Rodriguez PL, Finkelstein RR, Abrams SR (2010) Abscisic acid: emergence of a core signaling network. Annu Rev Plant Biol 61: 651-679

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cutler&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Abscisic acid: emergence of a core signaling network&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Abscisic acid: emergence of a core signaling network&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cutler&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Davuluri RV%2C Sun H%2C Palaniswamy SK%2C Matthews N%2C Molina C%2C Kurtz M%2C Grotewold E %282003%29 AGRIS%3A Arabidopsis gene regulatory information server%2C an information resource of Arabidopsis cis%2Dregulatory elements and transcription factors%2E BMC Bioinformatics 4%3A 25&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Davuluri RV, Sun H, Palaniswamy SK, Matthews N, Molina C, Kurtz M, Grotewold E (2003) AGRIS: Arabidopsis gene regulatory information server, an information resource of Arabidopsis cis-regulatory elements and transcription factors. BMC Bioinformatics 4: 25

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Davuluri&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=AGRIS: Arabidopsis gene regulatory information server, an information resource of Arabidopsis cis-regulatory elements and transcription factors.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=AGRIS: Arabidopsis gene regulatory information server, an information resource of Arabidopsis cis-regulatory elements and transcription factors.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Davuluri&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1




Derkacheva M, Steinbach Y, Wildhaber T, Mozgová I, Mahrez W, Nanni P, Bischof S, Gruissem W, Hennig L (2013) ArabidopsisMSI1 connects LHP1 to PRC2 complexes. EMBO J 32: 2073-2085


Du Z, Zhou X, Ling Y, Zhang Z, Su Z (2010) agriGO: a GO analysis toolkit for the agricultural community. Nucleic Acids Res 38: W64-70


Engelhorn J, Reimer JJ, Leuz I, Göbel U, Huettel B, Farrona S, Turck F (2012) Development-related PcG target in the apex 4controls leaf margin architecture in Arabidopsis thaliana. Dev Camb Engl 139: 2566-2575


Farrona S, Thorpe FL, Engelhorn J, Adrian J, Dong X, Sarid-Krebs L, Goodrich J, Turck F (2011) Tissue-specific expression ofFLOWERING LOCUS T in Arabidopsis is maintained independently of polycomb group protein repression. Plant Cell 23: 3204-3214


Fernandez DE, Wang C-T, Zheng Y, Adamczyk BJ, Singhal R, Hall PK, Perry SE (2014) The MADS-Domain Factors AGAMOUS-LIKE15 and AGAMOUS-LIKE18, along with SHORT VEGETATIVE PHASE and AGAMOUS-LIKE24, Are Necessary to Block FloralGene Expression during the Vegetative Phase. Plant Physiol 165: 1591-1603


Förderer A, Zhou Y, Turck F (2016) The age of multiplexity: recruitment and interactions of Polycomb complexes in plants. CurrOpin Plant Biol 29: 169-178


Francis NJ, Kingston RE, Woodcock CL (2004) Chromatin compaction by a polycomb group protein complex. Science 306: 1574-1577


Gangappa SN, Srivastava AK, Maurya JP, Ram H, Chattopadhyay S (2013) Z-box binding transcription factors (ZBFs): a new class oftranscription factors in Arabidopsis seedling development. Mol Plant 6: 1758-1768


Gao M-J, Lydiate DJ, Li X, Lui H, Gjetvaj B, Hegedus DD, Rozwadowski K (2009) Repression of Seed Maturation Genes by aTrihelix Transcriptional Repressor in Arabidopsis Seedlings. Plant Cell 21: 54-71


Gaudin V, Libault M, Pouteau S, Juul T, Zhao G, Lefebvre D, Grandjean O (2001) Mutations in LIKE HETEROCHROMATINPROTEIN 1 affect flowering time and plant architecture in Arabidopsis. Dev Camb Engl 128: 4847-4858


Gendall AR, Levy YY, Wilson A, Dean C (2001) The VERNALIZATION 2 gene mediates the epigenetic regulation of vernalization inArabidopsis. Cell 107: 525-535


Goodrich J, Puangsomlee P, Martin M, Long D, Meyerowitz EM, Coupland G (1997) A Polycomb-group gene regulates homeoticgene expression in Arabidopsis. Nature 386: 44-51


Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, Mitros T, Dirks W, Hellsten U, Putnam N, et al (2012) Phytozome:a comparative platform for green plant genomics. Nucleic Acids Res 40: D1178-1186

Pubmed: Author and Title www.plantphysiol.org on December 14, 2016 - Published by www.plantphysiol.orgDownloaded from


http://www.ncbi.nlm.nih.gov/pubmed?term=Delmas F%2C Sankaranarayanan S%2C Deb S%2C Widdup E%2C Bournonville C%2C Bollier N%2C Northey JGB%2C McCourt P%2C Samuel MA %282013%29 ABI3 controls embryo degreening through Mendel%27s I locus%2E Proc Natl Acad Sci U S A 110%3A E3888%2D3894&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Delmas F, Sankaranarayanan S, Deb S, Widdup E, Bournonville C, Bollier N, Northey JGB, McCourt P, Samuel MA (2013) ABI3 controls embryo degreening through Mendel's I locus. Proc Natl Acad Sci U S A 110: E3888-3894

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Delmas&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ABI3 controls embryo degreening through Mendel's I locus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ABI3 controls embryo degreening through Mendel's I locus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Delmas&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Derkacheva M%2C Steinbach Y%2C Wildhaber T%2C Mozgov� I%2C Mahrez W%2C Nanni P%2C Bischof S%2C Gruissem W%2C Hennig L %282013%29 Arabidopsis MSI1 connects LHP1 to PRC2 complexes%2E EMBO J 32%3A 2073%2D2085&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Derkacheva M, Steinbach Y, Wildhaber T, Mozgov� I, Mahrez W, Nanni P, Bischof S, Gruissem W, Hennig L (2013) Arabidopsis MSI1 connects LHP1 to PRC2 complexes. EMBO J 32: 2073-2085

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Derkacheva&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis MSI1 connects LHP1 to PRC2 complexes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis MSI1 connects LHP1 to PRC2 complexes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Derkacheva&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Du Z%2C Zhou X%2C Ling Y%2C Zhang Z%2C Su Z %282010%29 agriGO%3A a GO analysis toolkit for the agricultural community%2E Nucleic Acids Res 38%3A W64%2D70&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Du Z, Zhou X, Ling Y, Zhang Z, Su Z (2010) agriGO: a GO analysis toolkit for the agricultural community. Nucleic Acids Res 38: W64-70

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Du&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=agriGO: a GO analysis toolkit for the agricultural community&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=agriGO: a GO analysis toolkit for the agricultural community&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Du&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Engelhorn J%2C Reimer JJ%2C Leuz I%2C G�bel U%2C Huettel B%2C Farrona S%2C Turck F %282012%29 Development%2Drelated PcG target in the apex 4 controls leaf margin architecture in Arabidopsis thaliana%2E Dev Camb Engl 139%3A 2566%2D2575&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Engelhorn J, Reimer JJ, Leuz I, G�bel U, Huettel B, Farrona S, Turck F (2012) Development-related PcG target in the apex 4 controls leaf margin architecture in Arabidopsis thaliana. Dev Camb Engl 139: 2566-2575

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Engelhorn&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Development-related PcG target in the apex 4 controls leaf margin architecture in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Development-related PcG target in the apex 4 controls leaf margin architecture in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Engelhorn&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Farrona S%2C Thorpe FL%2C Engelhorn J%2C Adrian J%2C Dong X%2C Sarid%2DKrebs L%2C Goodrich J%2C Turck F %282011%29 Tissue%2Dspecific expression of FLOWERING LOCUS T in Arabidopsis is maintained independently of polycomb group protein repression%2E Plant Cell 23%3A 3204%2D3214&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Farrona S, Thorpe FL, Engelhorn J, Adrian J, Dong X, Sarid-Krebs L, Goodrich J, Turck F (2011) Tissue-specific expression of FLOWERING LOCUS T in Arabidopsis is maintained independently of polycomb group protein repression. Plant Cell 23: 3204-3214

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Farrona&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Tissue-specific expression of FLOWERING LOCUS T in Arabidopsis is maintained independently of polycomb group protein repression&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Tissue-specific expression of FLOWERING LOCUS T in Arabidopsis is maintained independently of polycomb group protein repression&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Farrona&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fernandez DE%2C Wang C%2DT%2C Zheng Y%2C Adamczyk BJ%2C Singhal R%2C Hall PK%2C Perry SE %282014%29 The MADS%2DDomain Factors AGAMOUS%2DLIKE15 and AGAMOUS%2DLIKE18%2C along with SHORT VEGETATIVE PHASE and AGAMOUS%2DLIKE24%2C Are Necessary to Block Floral Gene Expression during the Vegetative Phase%2E Plant Physiol 165%3A 1591%2D1603&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fernandez DE, Wang C-T, Zheng Y, Adamczyk BJ, Singhal R, Hall PK, Perry SE (2014) The MADS-Domain Factors AGAMOUS-LIKE15 and AGAMOUS-LIKE18, along with SHORT VEGETATIVE PHASE and AGAMOUS-LIKE24, Are Necessary to Block Floral Gene Expression during the Vegetative Phase. Plant Physiol 165: 1591-1603

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fernandez&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fernandez&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=F�rderer A%2C Zhou Y%2C Turck F %282016%29 The age of multiplexity%3A recruitment and interactions of Polycomb complexes in plants%2E Curr Opin Plant Biol 29%3A 169%2D178&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=F�rderer A, Zhou Y, Turck F (2016) The age of multiplexity: recruitment and interactions of Polycomb complexes in plants. Curr Opin Plant Biol 29: 169-178

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=F�rderer&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The age of multiplexity: recruitment and interactions of Polycomb complexes in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The age of multiplexity: recruitment and interactions of Polycomb complexes in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=F�rderer&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Francis NJ%2C Kingston RE%2C Woodcock CL %282004%29 Chromatin compaction by a polycomb group protein complex%2E Science 306%3A 1574%2D1577&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Francis NJ, Kingston RE, Woodcock CL (2004) Chromatin compaction by a polycomb group protein complex. Science 306: 1574-1577

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Francis&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Chromatin compaction by a polycomb group protein complex&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Chromatin compaction by a polycomb group protein complex&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Francis&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gangappa SN%2C Srivastava AK%2C Maurya JP%2C Ram H%2C Chattopadhyay S %282013%29 Z%2Dbox binding transcription factors %28ZBFs%29%3A a new class of transcription factors in Arabidopsis seedling development%2E Mol Plant 6%3A 1758%2D1768&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gangappa SN, Srivastava AK, Maurya JP, Ram H, Chattopadhyay S (2013) Z-box binding transcription factors (ZBFs): a new class of transcription factors in Arabidopsis seedling development. Mol Plant 6: 1758-1768

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gangappa&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Z-box binding transcription factors (ZBFs): a new class of transcription factors in Arabidopsis seedling development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Z-box binding transcription factors (ZBFs): a new class of transcription factors in Arabidopsis seedling development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gangappa&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gao M%2DJ%2C Lydiate DJ%2C Li X%2C Lui H%2C Gjetvaj B%2C Hegedus DD%2C Rozwadowski K %282009%29 Repression of Seed Maturation Genes by a Trihelix Transcriptional Repressor in Arabidopsis Seedlings%2E Plant Cell 21%3A 54%2D71&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gao M-J, Lydiate DJ, Li X, Lui H, Gjetvaj B, Hegedus DD, Rozwadowski K (2009) Repression of Seed Maturation Genes by a Trihelix Transcriptional Repressor in Arabidopsis Seedlings. Plant Cell 21: 54-71

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Repression of Seed Maturation Genes by a Trihelix Transcriptional Repressor in Arabidopsis Seedlings&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Repression of Seed Maturation Genes by a Trihelix Transcriptional Repressor in Arabidopsis Seedlings&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gao&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gaudin V%2C Libault M%2C Pouteau S%2C Juul T%2C Zhao G%2C Lefebvre D%2C Grandjean O %282001%29 Mutations in LIKE HETEROCHROMATIN PROTEIN 1 affect flowering time and plant architecture in Arabidopsis%2E Dev Camb Engl 128%3A 4847%2D4858&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gaudin V, Libault M, Pouteau S, Juul T, Zhao G, Lefebvre D, Grandjean O (2001) Mutations in LIKE HETEROCHROMATIN PROTEIN 1 affect flowering time and plant architecture in Arabidopsis. Dev Camb Engl 128: 4847-4858

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gaudin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mutations in LIKE HETEROCHROMATIN PROTEIN 1 affect flowering time and plant architecture in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mutations in LIKE HETEROCHROMATIN PROTEIN 1 affect flowering time and plant architecture in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gaudin&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gendall AR%2C Levy YY%2C Wilson A%2C Dean C %282001%29 The VERNALIZATION 2 gene mediates the epigenetic regulation of vernalization in Arabidopsis%2E Cell 107%3A 525%2D535&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gendall AR, Levy YY, Wilson A, Dean C (2001) The VERNALIZATION 2 gene mediates the epigenetic regulation of vernalization in Arabidopsis. Cell 107: 525-535

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gendall&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The VERNALIZATION 2 gene mediates the epigenetic regulation of vernalization in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The VERNALIZATION 2 gene mediates the epigenetic regulation of vernalization in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gendall&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Goodrich J%2C Puangsomlee P%2C Martin M%2C Long D%2C Meyerowitz EM%2C Coupland G %281997%29 A Polycomb%2Dgroup gene regulates homeotic gene expression in Arabidopsis%2E Nature 386%3A 44%2D51&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Goodrich J, Puangsomlee P, Martin M, Long D, Meyerowitz EM, Coupland G (1997) A Polycomb-group gene regulates homeotic gene expression in Arabidopsis. Nature 386: 44-51

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Goodrich&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A Polycomb-group gene regulates homeotic gene expression in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A Polycomb-group gene regulates homeotic gene expression in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Goodrich&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Goodstein DM%2C Shu S%2C Howson R%2C Neupane R%2C Hayes RD%2C Fazo J%2C Mitros T%2C Dirks W%2C Hellsten U%2C Putnam N%2C et al %282012%29 Phytozome%3A a comparative platform for green plant genomics%2E Nucleic Acids Res 40%3A D1178%2D1186&dopt=abstract



CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

van der Graaff E, Laux T, Rensing SA (2009) The WUS homeobox-containing (WOX) protein family. Genome Biol 10: 248Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Grossniklaus U, Vielle-Calzada JP, Hoeppner MA, Gagliano WB (1998) Maternal control of embryogenesis by MEDEA, a polycombgroup gene in Arabidopsis. Science 280: 446-450


Gu X, Le C, Wang Y, Li Z, Jiang D, Wang Y, He Y (2013) Arabidopsis FLC clade members form flowering-repressor complexescoordinating responses to endogenous and environmental cues. Nat Commun 4: 1947


Hennig L, Bouveret R, Gruissem W (2005) MSI1-like proteins: an escort service for chromatin assembly and remodelingcomplexes. Trends Cell Biol 15: 295-302


Horstman A, Willemsen V, Boutilier K, Heidstra R (2014) AINTEGUMENTA-LIKE proteins: hubs in a plethora of networks. TrendsPlant Sci 19: 146-157


Kim SY, Lee J, Eshed-Williams L, Zilberman D, Sung ZR (2012) EMF1 and PRC2 cooperate to repress key regulators of Arabidopsisdevelopment. PLoS Genet 8: e1002512


Kim SY, Zhu T, Sung ZR (2010) Epigenetic regulation of gene programs by EMF1 and EMF2 in Arabidopsis. Plant Physiol 152: 516-528


Lee WY, Lee D, Chung W-I, Kwon CS (2009) Arabidopsis ING and Alfin1-like protein families localize to the nucleus and bind toH3K4me3/2 via plant homeodomain fingers. Plant J Cell Mol Biol 58: 511-524


Liang SC, Hartwig B, Perera P, Mora-García S, de Leau E, Thornton H, de Alves FL, Rapsilber J, Yang S, James GV, et al (2015)Kicking against the PRCs - A Domesticated Transposase Antagonises Silencing Mediated by Polycomb Group Proteins and Is anAccessory Component of Polycomb Repressive Complex 2. PLoS Genet 11: e1005660


Luo M, Bilodeau P, Koltunow A, Dennis ES, Peacock WJ, Chaudhury AM (1999) Genes controlling fertilization-independent seeddevelopment in Arabidopsis thaliana. Proc Natl Acad Sci U S A 96: 296-301


Merini W, Calonje M (2015) PRC1 is taking the lead in PcG repression. Plant J Cell Mol Biol. doi: 10.1111/tpj.12818Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Molitor AM, Bu Z, Yu Y, Shen W-H (2014) Arabidopsis AL PHD-PRC1 complexes promote seed germination through H3K4me3-to-H3K27me3 chromatin state switch in repression of seed developmental genes. PLoS Genet 10: e1004091


Mozgova I, Köhler C, Hennig L (2015) Keeping the gate closed: functions of the polycomb repressive complex PRC2 indevelopment. Plant J Cell Mol Biol 83: 121-132


Müller J, Hart CM, Francis NJ, Vargas ML, Sengupta A, Wild B, Miller EL, O'Connor MB, Kingston RE, Simon JA (2002) Histone www.plantphysiol.org on December 14, 2016 - Published by www.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://search.crossref.org/?page=1&rows=2&q=Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, Mitros T, Dirks W, Hellsten U, Putnam N, et al (2012) Phytozome: a comparative platform for green plant genomics. Nucleic Acids Res 40: D1178-1186

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Goodstein&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phytozome: a comparative platform for green plant genomics&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phytozome: a comparative platform for green plant genomics&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Goodstein&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=van der Graaff E%2C Laux T%2C Rensing SA %282009%29 The WUS homeobox%2Dcontaining %28WOX%29 protein family%2E Genome Biol 10%3A 248&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=van der Graaff E, Laux T, Rensing SA (2009) The WUS homeobox-containing (WOX) protein family. Genome Biol 10: 248

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=van&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The WUS homeobox-containing (WOX) protein family.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The WUS homeobox-containing (WOX) protein family.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=van&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Grossniklaus U%2C Vielle%2DCalzada JP%2C Hoeppner MA%2C Gagliano WB %281998%29 Maternal control of embryogenesis by MEDEA%2C a polycomb group gene in Arabidopsis%2E Science 280%3A 446%2D450&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Grossniklaus U, Vielle-Calzada JP, Hoeppner MA, Gagliano WB (1998) Maternal control of embryogenesis by MEDEA, a polycomb group gene in Arabidopsis. Science 280: 446-450

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Grossniklaus&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Maternal control of embryogenesis by MEDEA, a polycomb group gene in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Maternal control of embryogenesis by MEDEA, a polycomb group gene in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Grossniklaus&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gu X%2C Le C%2C Wang Y%2C Li Z%2C Jiang D%2C Wang Y%2C He Y %282013%29 Arabidopsis FLC clade members form flowering%2Drepressor complexes coordinating responses to endogenous and environmental cues%2E Nat Commun 4%3A 1947&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gu X, Le C, Wang Y, Li Z, Jiang D, Wang Y, He Y (2013) Arabidopsis FLC clade members form flowering-repressor complexes coordinating responses to endogenous and environmental cues. Nat Commun 4: 1947

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis FLC clade members form flowering-repressor complexes coordinating responses to endogenous and environmental cues.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis FLC clade members form flowering-repressor complexes coordinating responses to endogenous and environmental cues.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gu&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hennig L%2C Bouveret R%2C Gruissem W %282005%29 MSI1%2Dlike proteins%3A an escort service for chromatin assembly and remodeling complexes%2E Trends Cell Biol 15%3A 295%2D302&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hennig L, Bouveret R, Gruissem W (2005) MSI1-like proteins: an escort service for chromatin assembly and remodeling complexes. Trends Cell Biol 15: 295-302

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hennig&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=MSI1-like proteins: an escort service for chromatin assembly and remodeling complexes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=MSI1-like proteins: an escort service for chromatin assembly and remodeling complexes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hennig&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Horstman A%2C Willemsen V%2C Boutilier K%2C Heidstra R %282014%29 AINTEGUMENTA%2DLIKE proteins%3A hubs in a plethora of networks%2E Trends Plant Sci 19%3A 146%2D157&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Horstman A, Willemsen V, Boutilier K, Heidstra R (2014) AINTEGUMENTA-LIKE proteins: hubs in a plethora of networks. Trends Plant Sci 19: 146-157

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Horstman&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=AINTEGUMENTA-LIKE proteins: hubs in a plethora of networks&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=AINTEGUMENTA-LIKE proteins: hubs in a plethora of networks&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Horstman&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kim SY%2C Lee J%2C Eshed%2DWilliams L%2C Zilberman D%2C Sung ZR %282012%29 EMF1 and PRC2 cooperate to repress key regulators of Arabidopsis development%2E PLoS Genet 8%3A e1002512&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kim SY, Lee J, Eshed-Williams L, Zilberman D, Sung ZR (2012) EMF1 and PRC2 cooperate to repress key regulators of Arabidopsis development. PLoS Genet 8: e1002512

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kim&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=EMF1 and PRC2 cooperate to repress key regulators of Arabidopsis development.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=EMF1 and PRC2 cooperate to repress key regulators of Arabidopsis development.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kim&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kim SY%2C Zhu T%2C Sung ZR %282010%29 Epigenetic regulation of gene programs by EMF1 and EMF2 in Arabidopsis%2E Plant Physiol 152%3A 516%2D528&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kim SY, Zhu T, Sung ZR (2010) Epigenetic regulation of gene programs by EMF1 and EMF2 in Arabidopsis. Plant Physiol 152: 516-528

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kim&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Epigenetic regulation of gene programs by EMF1 and EMF2 in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Epigenetic regulation of gene programs by EMF1 and EMF2 in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kim&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee WY%2C Lee D%2C Chung W%2DI%2C Kwon CS %282009%29 Arabidopsis ING and Alfin1%2Dlike protein families localize to the nucleus and bind to H3K4me3%2F2 via plant homeodomain fingers%2E Plant J Cell Mol Biol 58%3A 511%2D524&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lee WY, Lee D, Chung W-I, Kwon CS (2009) Arabidopsis ING and Alfin1-like protein families localize to the nucleus and bind to H3K4me3/2 via plant homeodomain fingers. Plant J Cell Mol Biol 58: 511-524

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis ING and Alfin1-like protein families localize to the nucleus and bind to H3K4me3/2 via plant homeodomain fingers&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis ING and Alfin1-like protein families localize to the nucleus and bind to H3K4me3/2 via plant homeodomain fingers&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Liang SC%2C Hartwig B%2C Perera P%2C Mora%2DGarc�a S%2C de Leau E%2C Thornton H%2C de Alves FL%2C Rapsilber J%2C Yang S%2C James GV%2C et al %282015%29 Kicking against the PRCs %2D A Domesticated Transposase Antagonises Silencing Mediated by Polycomb Group Proteins and Is an Accessory Component of Polycomb Repressive Complex 2%2E PLoS Genet 11%3A e1005660&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Liang SC, Hartwig B, Perera P, Mora-Garc�a S, de Leau E, Thornton H, de Alves FL, Rapsilber J, Yang S, James GV, et al (2015) Kicking against the PRCs - A Domesticated Transposase Antagonises Silencing Mediated by Polycomb Group Proteins and Is an Accessory Component of Polycomb Repressive Complex 2. PLoS Genet 11: e1005660

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Kicking against the PRCs - A Domesticated Transposase Antagonises Silencing Mediated by Polycomb Group Proteins and Is an Accessory Component of Polycomb Repressive Complex 2.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Kicking against the PRCs - A Domesticated Transposase Antagonises Silencing Mediated by Polycomb Group Proteins and Is an Accessory Component of Polycomb Repressive Complex 2.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liang&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Luo M%2C Bilodeau P%2C Koltunow A%2C Dennis ES%2C Peacock WJ%2C Chaudhury AM %281999%29 Genes controlling fertilization%2Dindependent seed development in Arabidopsis thaliana%2E Proc Natl Acad Sci U S A 96%3A 296%2D301&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Luo M, Bilodeau P, Koltunow A, Dennis ES, Peacock WJ, Chaudhury AM (1999) Genes controlling fertilization-independent seed development in Arabidopsis thaliana. Proc Natl Acad Sci U S A 96: 296-301

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Luo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genes controlling fertilization-independent seed development in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genes controlling fertilization-independent seed development in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Luo&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Merini W%2C Calonje M %282015%29 PRC1 is taking the lead in PcG repression%2E Plant J Cell Mol Biol%2E doi%3A 10%2E1111%2Ftpj%2E12818&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Merini W, Calonje M (2015) PRC1 is taking the lead in PcG repression. Plant J Cell Mol Biol. doi: 10.1111/tpj.12818

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Merini&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=PRC1 is taking the lead in PcG repression.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=PRC1 is taking the lead in PcG repression.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Merini&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Molitor AM%2C Bu Z%2C Yu Y%2C Shen W%2DH %282014%29 Arabidopsis AL PHD%2DPRC1 complexes promote seed germination through H3K4me3%2Dto%2DH3K27me3 chromatin state switch in repression of seed developmental genes%2E PLoS Genet 10%3A e1004091&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Molitor AM, Bu Z, Yu Y, Shen W-H (2014) Arabidopsis AL PHD-PRC1 complexes promote seed germination through H3K4me3-to-H3K27me3 chromatin state switch in repression of seed developmental genes. PLoS Genet 10: e1004091

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Molitor&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis AL PHD-PRC1 complexes promote seed germination through H3K4me3-to-H3K27me3 chromatin state switch in repression of seed developmental genes.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis AL PHD-PRC1 complexes promote seed germination through H3K4me3-to-H3K27me3 chromatin state switch in repression of seed developmental genes.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Molitor&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Mozgova I%2C K�hler C%2C Hennig L %282015%29 Keeping the gate closed%3A functions of the polycomb repressive complex PRC2 in development%2E Plant J Cell Mol Biol 83%3A 121%2D132&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mozgova I, K�hler C, Hennig L (2015) Keeping the gate closed: functions of the polycomb repressive complex PRC2 in development. Plant J Cell Mol Biol 83: 121-132

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mozgova&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Keeping the gate closed: functions of the polycomb repressive complex PRC2 in development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Keeping the gate closed: functions of the polycomb repressive complex PRC2 in development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mozgova&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1



methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111: 197-208Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nakamura S, Lynch TJ, Finkelstein RR (2001) Physical interactions between ABA response loci of Arabidopsis. Plant J Cell Mol Biol26: 627-635


Ohad N, Yadegari R, Margossian L, Hannon M, Michaeli D, Harada JJ, Goldberg RB, Fischer RL (1999) Mutations in FIE, a WDpolycomb group gene, allow endosperm development without fertilization. Plant Cell 11: 407-416


Park H-Y, Lee S-Y, Seok H-Y, Kim S-H, Sung ZR, Moon Y-H (2011) EMF1 interacts with EIP1, EIP6 or EIP9 involved in the regulationof flowering time in Arabidopsis. Plant Cell Physiol 52: 1376-1388


Peterson AJ, Mallin DR, Francis NJ, Ketel CS, Stamm J, Voeller RK, Kingston RE, Simon JA (2004) Requirement for sex comb onmidleg protein interactions in Drosophila polycomb group repression. Genetics 167: 1225-1239


Pico S, Ortiz-Marchena MI, Merini W, Calonje M (2015) Deciphering the role of Polycomb Repressive Complex 1 (PRC1) variants inregulating the acquisition of flowering competence in Arabidopsis. Plant Physiol. doi: 10.1104/pp.15.00073


Pu L, Liu M-S, Kim SY, Chen L-FO, Fletcher JC, Sung ZR (2013) EMBRYONIC FLOWER1 and ULTRAPETALA1 Act Antagonisticallyon Arabidopsis Development and Stress Response. Plant Physiol 162: 812-830


Qüesta JI, Song J, Geraldo N, An H, Dean C (2016) Arabidopsis transcriptional repressor VAL1 triggers Polycomb silencing at FLCduring vernalization. Science 353: 485-488


Ringrose L, Paro R (2004) Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu RevGenet 38: 413-443


Sanchez-Pulido L, Devos D, Sung ZR, Calonje M (2008) RAWUL: a new ubiquitin-like domain in PRC1 ring finger proteins thatunveils putative plant and worm PRC1 orthologs. BMC Genomics 9: 308


Sandelin A, Alkema W, Engström P, Wasserman WW, Lenhard B (2004) JASPAR: an open-access database for eukaryotictranscription factor binding profiles. Nucleic Acids Res 32: D91-94


Santos-Mendoza M, Dubreucq B, Baud S, Parcy F, Caboche M, Lepiniec L (2008) Deciphering gene regulatory networks thatcontrol seed development and maturation in Arabidopsis. Plant J Cell Mol Biol 54: 608-620


Schneider A, Aghamirzaie D, Elmarakeby H, Poudel AN, Koo AJ, Heath LS, Grene R, Collakova E (2016) Potential targets ofVIVIPAROUS1/ABI3-LIKE1 (VAL1) repression in developing Arabidopsis thaliana embryos. Plant J Cell Mol Biol 85: 305-319


Schwartz YB, Pirrotta V (2013) A new world of Polycombs: unexpected partnerships and emerging functions. Nat Rev Genet 14:853-864

Pubmed: Author and Title www.plantphysiol.org on December 14, 2016 - Published by www.plantphysiol.orgDownloaded from


http://www.ncbi.nlm.nih.gov/pubmed?term=M�ller J%2C Hart CM%2C Francis NJ%2C Vargas ML%2C Sengupta A%2C Wild B%2C Miller EL%2C O%27Connor MB%2C Kingston RE%2C Simon JA %282002%29 Histone methyltransferase activity of a Drosophila Polycomb group repressor complex%2E Cell 111%3A 197%2D208&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=M�ller J, Hart CM, Francis NJ, Vargas ML, Sengupta A, Wild B, Miller EL, O'Connor MB, Kingston RE, Simon JA (2002) Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111: 197-208

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=M�ller&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Histone methyltransferase activity of a Drosophila Polycomb group repressor complex&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Histone methyltransferase activity of a Drosophila Polycomb group repressor complex&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=M�ller&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Nakamura S%2C Lynch TJ%2C Finkelstein RR %282001%29 Physical interactions between ABA response loci of Arabidopsis%2E Plant J Cell Mol Biol 26%3A 627%2D635&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nakamura S, Lynch TJ, Finkelstein RR (2001) Physical interactions between ABA response loci of Arabidopsis. Plant J Cell Mol Biol 26: 627-635

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nakamura&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Physical interactions between ABA response loci of Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Physical interactions between ABA response loci of Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nakamura&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ohad N%2C Yadegari R%2C Margossian L%2C Hannon M%2C Michaeli D%2C Harada JJ%2C Goldberg RB%2C Fischer RL %281999%29 Mutations in FIE%2C a WD polycomb group gene%2C allow endosperm development without fertilization%2E Plant Cell 11%3A 407%2D416&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ohad N, Yadegari R, Margossian L, Hannon M, Michaeli D, Harada JJ, Goldberg RB, Fischer RL (1999) Mutations in FIE, a WD polycomb group gene, allow endosperm development without fertilization. Plant Cell 11: 407-416

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ohad&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mutations in FIE, a WD polycomb group gene, allow endosperm development without fertilization&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mutations in FIE, a WD polycomb group gene, allow endosperm development without fertilization&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ohad&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Park H%2DY%2C Lee S%2DY%2C Seok H%2DY%2C Kim S%2DH%2C Sung ZR%2C Moon Y%2DH %282011%29 EMF1 interacts with EIP1%2C EIP6 or EIP9 involved in the regulation of flowering time in Arabidopsis%2E Plant Cell Physiol 52%3A 1376%2D1388&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Park H-Y, Lee S-Y, Seok H-Y, Kim S-H, Sung ZR, Moon Y-H (2011) EMF1 interacts with EIP1, EIP6 or EIP9 involved in the regulation of flowering time in Arabidopsis. Plant Cell Physiol 52: 1376-1388

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Park&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Park&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Peterson AJ%2C Mallin DR%2C Francis NJ%2C Ketel CS%2C Stamm J%2C Voeller RK%2C Kingston RE%2C Simon JA %282004%29 Requirement for sex comb on midleg protein interactions in Drosophila polycomb group repression%2E Genetics 167%3A 1225%2D1239&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Peterson AJ, Mallin DR, Francis NJ, Ketel CS, Stamm J, Voeller RK, Kingston RE, Simon JA (2004) Requirement for sex comb on midleg protein interactions in Drosophila polycomb group repression. Genetics 167: 1225-1239

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Peterson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Requirement for sex comb on midleg protein interactions in Drosophila polycomb group repression&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Requirement for sex comb on midleg protein interactions in Drosophila polycomb group repression&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Peterson&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Pico S%2C Ortiz%2DMarchena MI%2C Merini W%2C Calonje M %282015%29 Deciphering the role of Polycomb Repressive Complex 1 %28PRC1%29 variants in regulating the acquisition of flowering competence in Arabidopsis%2E Plant Physiol%2E doi%3A 10%2E1104%2Fpp%2E15%2E00073&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pico S, Ortiz-Marchena MI, Merini W, Calonje M (2015) Deciphering the role of Polycomb Repressive Complex 1 (PRC1) variants in regulating the acquisition of flowering competence in Arabidopsis. Plant Physiol. doi: 10.1104/pp.15.00073

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pico&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Deciphering the role of Polycomb Repressive Complex 1 (PRC1) variants in regulating the acquisition of flowering competence in Arabidopsis.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Deciphering the role of Polycomb Repressive Complex 1 (PRC1) variants in regulating the acquisition of flowering competence in Arabidopsis.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pico&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Pu L%2C Liu M%2DS%2C Kim SY%2C Chen L%2DFO%2C Fletcher JC%2C Sung ZR %282013%29 EMBRYONIC FLOWER1 and ULTRAPETALA1 Act Antagonistically on Arabidopsis Development and Stress Response%2E Plant Physiol 162%3A 812%2D830&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pu L, Liu M-S, Kim SY, Chen L-FO, Fletcher JC, Sung ZR (2013) EMBRYONIC FLOWER1 and ULTRAPETALA1 Act Antagonistically on Arabidopsis Development and Stress Response. Plant Physiol 162: 812-830

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=EMBRYONIC FLOWER1 and ULTRAPETALA1 Act Antagonistically on Arabidopsis Development and Stress Response&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=EMBRYONIC FLOWER1 and ULTRAPETALA1 Act Antagonistically on Arabidopsis Development and Stress Response&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pu&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Q�esta JI%2C Song J%2C Geraldo N%2C An H%2C Dean C %282016%29 Arabidopsis transcriptional repressor VAL1 triggers Polycomb silencing at FLC during vernalization%2E Science 353%3A 485%2D488&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Q�esta JI, Song J, Geraldo N, An H, Dean C (2016) Arabidopsis transcriptional repressor VAL1 triggers Polycomb silencing at FLC during vernalization. Science 353: 485-488

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Q�esta&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis transcriptional repressor VAL1 triggers Polycomb silencing at FLC during vernalization&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis transcriptional repressor VAL1 triggers Polycomb silencing at FLC during vernalization&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Q�esta&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ringrose L%2C Paro R %282004%29 Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins%2E Annu Rev Genet 38%3A 413%2D443&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ringrose L, Paro R (2004) Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu Rev Genet 38: 413-443

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ringrose&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ringrose&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Sanchez%2DPulido L%2C Devos D%2C Sung ZR%2C Calonje M %282008%29 RAWUL%3A a new ubiquitin%2Dlike domain in PRC1 ring finger proteins that unveils putative plant and worm PRC1 orthologs%2E BMC Genomics 9%3A 308&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sanchez-Pulido L, Devos D, Sung ZR, Calonje M (2008) RAWUL: a new ubiquitin-like domain in PRC1 ring finger proteins that unveils putative plant and worm PRC1 orthologs. BMC Genomics 9: 308

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sanchez-Pulido&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=RAWUL: a new ubiquitin-like domain in PRC1 ring finger proteins that unveils putative plant and worm PRC1 orthologs.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=RAWUL: a new ubiquitin-like domain in PRC1 ring finger proteins that unveils putative plant and worm PRC1 orthologs.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sanchez-Pulido&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Sandelin A%2C Alkema W%2C Engstr�m P%2C Wasserman WW%2C Lenhard B %282004%29 JASPAR%3A an open%2Daccess database for eukaryotic transcription factor binding profiles%2E Nucleic Acids Res 32%3A D91%2D94&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sandelin A, Alkema W, Engstr�m P, Wasserman WW, Lenhard B (2004) JASPAR: an open-access database for eukaryotic transcription factor binding profiles. Nucleic Acids Res 32: D91-94

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sandelin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=JASPAR: an open-access database for eukaryotic transcription factor binding profiles&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=JASPAR: an open-access database for eukaryotic transcription factor binding profiles&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sandelin&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Santos%2DMendoza M%2C Dubreucq B%2C Baud S%2C Parcy F%2C Caboche M%2C Lepiniec L %282008%29 Deciphering gene regulatory networks that control seed development and maturation in Arabidopsis%2E Plant J Cell Mol Biol 54%3A 608%2D620&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Santos-Mendoza M, Dubreucq B, Baud S, Parcy F, Caboche M, Lepiniec L (2008) Deciphering gene regulatory networks that control seed development and maturation in Arabidopsis. Plant J Cell Mol Biol 54: 608-620

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Santos-Mendoza&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Deciphering gene regulatory networks that control seed development and maturation in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Deciphering gene regulatory networks that control seed development and maturation in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Santos-Mendoza&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Schneider A%2C Aghamirzaie D%2C Elmarakeby H%2C Poudel AN%2C Koo AJ%2C Heath LS%2C Grene R%2C Collakova E %282016%29 Potential targets of VIVIPAROUS1%2FABI3%2DLIKE1 %28VAL1%29 repression in developing Arabidopsis thaliana embryos%2E Plant J Cell Mol Biol 85%3A 305%2D319&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schneider A, Aghamirzaie D, Elmarakeby H, Poudel AN, Koo AJ, Heath LS, Grene R, Collakova E (2016) Potential targets of VIVIPAROUS1/ABI3-LIKE1 (VAL1) repression in developing Arabidopsis thaliana embryos. Plant J Cell Mol Biol 85: 305-319

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schneider&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Potential targets of VIVIPAROUS1/ABI3-LIKE1 (VAL1) repression in developing Arabidopsis thaliana embryos&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Potential targets of VIVIPAROUS1/ABI3-LIKE1 (VAL1) repression in developing Arabidopsis thaliana embryos&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schneider&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Schwartz YB%2C Pirrotta V %282013%29 A new world of Polycombs%3A unexpected partnerships and emerging functions%2E Nat Rev Genet 14%3A 853%2D864&dopt=abstract



CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Shao Z, Raible F, Mollaaghababa R, Guyon JR, Wu CT, Bender W, Kingston RE (1999) Stabilization of chromatin structure by PRC1,a Polycomb complex. Cell 98: 37-46


Shu K, Liu X, Xie Q, He Z (2016) Two Faces of One Seed: Hormonal Regulation of Dormancy and Germination. Mol Plant 9: 34-45Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Simon JA, Kingston RE (2013) Occupying chromatin: Polycomb mechanisms for getting to genomic targets, stopping transcriptionaltraffic, and staying put. Mol Cell 49: 808-824


Steffens NO, Galuschka C, Schindler M, Bülow L, Hehl R (2004) AthaMap: an online resource for in silico transcription factorbinding sites in the Arabidopsis thaliana genome. Nucleic Acids Res 32: D368-372


Supek F, Bošnjak M, Škunca N, Šmuc T (2011) REVIGO summarizes and visualizes long lists of gene ontology terms. PloS One 6:e21800


Suzuki M, Ketterling MG, McCarty DR (2005) Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- andCBF/DREB1-regulated genes of Arabidopsis. Plant Physiol 139: 437-447


Suzuki M, Wang HH-Y, McCarty DR (2007) Repression of the LEAFY COTYLEDON 1/B3 regulatory network in plant embryodevelopment by VP1/ABSCISIC ACID INSENSITIVE 3-LIKE B3 genes. Plant Physiol 143: 902-911


Swaminathan K, Peterson K, Jack T (2008) The plant B3 superfamily. Trends Plant Sci 13: 647-655Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL, Pachter L (2012) Differential geneand transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7: 562-578


Turck F, Roudier F, Farrona S, Martin-Magniette M-L, Guillaume E, Buisine N, Gagnot S, Martienssen RA, Coupland G, Colot V(2007) Arabidopsis TFL2/LHP1 specifically associates with genes marked by trimethylation of histone H3 lysine 27. PLoS Genet 3:e86


Veluchamy A, Jégu T, Ariel F, Latrasse D, Mariappan KG, Kim S-K, Crespi M, Hirt H, Bergounioux C, Raynaud C, et al (2016) LHP1Regulates H3K27me3 Spreading and Shapes the Three-Dimensional Conformation of the Arabidopsis Genome. PloS One 11:e0158936


Vicente-Carbajosa J, Carbonero P (2005) Seed maturation: developing an intrusive phase to accomplish a quiescent state. Int JDev Biol 49: 645-651


Wang H, Liu C, Cheng J, Liu J, Zhang L, He C, Shen W-H, Jin H, Xu L, Zhang Y (2016) Arabidopsis Flower and EmbryoDevelopmental Genes are Repressed in Seedlings by Different Combinations of Polycomb Group Proteins in Association withDistinct Sets of Cis-regulatory Elements. PLoS Genet 12: e1005771

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.org on December 14, 2016 - Published by www.plantphysiol.orgDownloaded from


http://search.crossref.org/?page=1&rows=2&q=Schwartz YB, Pirrotta V (2013) A new world of Polycombs: unexpected partnerships and emerging functions. Nat Rev Genet 14: 853-864

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schwartz&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A new world of Polycombs: unexpected partnerships and emerging functions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A new world of Polycombs: unexpected partnerships and emerging functions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schwartz&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Shao Z%2C Raible F%2C Mollaaghababa R%2C Guyon JR%2C Wu CT%2C Bender W%2C Kingston RE %281999%29 Stabilization of chromatin structure by PRC1%2C a Polycomb complex%2E Cell 98%3A 37%2D46&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shao Z, Raible F, Mollaaghababa R, Guyon JR, Wu CT, Bender W, Kingston RE (1999) Stabilization of chromatin structure by PRC1, a Polycomb complex. Cell 98: 37-46

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shao&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shao&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Shu K%2C Liu X%2C Xie Q%2C He Z %282016%29 Two Faces of One Seed%3A Hormonal Regulation of Dormancy and Germination%2E Mol Plant 9%3A 34%2D45&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shu K, Liu X, Xie Q, He Z (2016) Two Faces of One Seed: Hormonal Regulation of Dormancy and Germination. Mol Plant 9: 34-45

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Two Faces of One Seed: Hormonal Regulation of Dormancy and Germination&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Two Faces of One Seed: Hormonal Regulation of Dormancy and Germination&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shu&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Simon JA%2C Kingston RE %282013%29 Occupying chromatin%3A Polycomb mechanisms for getting to genomic targets%2C stopping transcriptional traffic%2C and staying put%2E Mol Cell 49%3A 808%2D824&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Simon JA, Kingston RE (2013) Occupying chromatin: Polycomb mechanisms for getting to genomic targets, stopping transcriptional traffic, and staying put. Mol Cell 49: 808-824

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Simon&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Occupying chromatin: Polycomb mechanisms for getting to genomic targets, stopping transcriptional traffic, and staying put&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Occupying chromatin: Polycomb mechanisms for getting to genomic targets, stopping transcriptional traffic, and staying put&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Simon&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Steffens NO%2C Galuschka C%2C Schindler M%2C B�low L%2C Hehl R %282004%29 AthaMap%3A an online resource for in silico transcription factor binding sites in the Arabidopsis thaliana genome%2E Nucleic Acids Res 32%3A D368%2D372&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Steffens NO, Galuschka C, Schindler M, B�low L, Hehl R (2004) AthaMap: an online resource for in silico transcription factor binding sites in the Arabidopsis thaliana genome. Nucleic Acids Res 32: D368-372

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Steffens&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=AthaMap: an online resource for in silico transcription factor binding sites in the Arabidopsis thaliana genome&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=AthaMap: an online resource for in silico transcription factor binding sites in the Arabidopsis thaliana genome&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Steffens&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Supek F%2C Bo?njak M%2C ?kunca N%2C ?muc T %282011%29 REVIGO summarizes and visualizes long lists of gene ontology terms%2E PloS One 6%3A e21800&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Supek F, Bo?njak M, ?kunca N, ?muc T (2011) REVIGO summarizes and visualizes long lists of gene ontology terms. PloS One 6: e21800

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Supek&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=REVIGO summarizes and visualizes long lists of gene ontology terms.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=REVIGO summarizes and visualizes long lists of gene ontology terms.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Supek&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Suzuki M%2C Ketterling MG%2C McCarty DR %282005%29 Quantitative statistical analysis of cis%2Dregulatory sequences in ABA%2FVP1%2D and CBF%2FDREB1%2Dregulated genes of Arabidopsis%2E Plant Physiol 139%3A 437%2D447&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Suzuki M, Ketterling MG, McCarty DR (2005) Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis. Plant Physiol 139: 437-447

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Suzuki&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Suzuki&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Suzuki M%2C Wang HH%2DY%2C McCarty DR %282007%29 Repression of the LEAFY COTYLEDON 1%2FB3 regulatory network in plant embryo development by VP1%2FABSCISIC ACID INSENSITIVE 3%2DLIKE B3 genes%2E Plant Physiol 143%3A 902%2D911&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Suzuki M, Wang HH-Y, McCarty DR (2007) Repression of the LEAFY COTYLEDON 1/B3 regulatory network in plant embryo development by VP1/ABSCISIC ACID INSENSITIVE 3-LIKE B3 genes. Plant Physiol 143: 902-911

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Suzuki&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Repression of the LEAFY COTYLEDON 1/B3 regulatory network in plant embryo development by VP1/ABSCISIC ACID INSENSITIVE 3-LIKE B3 genes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Repression of the LEAFY COTYLEDON 1/B3 regulatory network in plant embryo development by VP1/ABSCISIC ACID INSENSITIVE 3-LIKE B3 genes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Suzuki&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Swaminathan K%2C Peterson K%2C Jack T %282008%29 The plant B3 superfamily%2E Trends Plant Sci 13%3A 647%2D655&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Swaminathan K, Peterson K, Jack T (2008) The plant B3 superfamily. Trends Plant Sci 13: 647-655

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Swaminathan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The plant B3 superfamily&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The plant B3 superfamily&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Swaminathan&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Trapnell C%2C Roberts A%2C Goff L%2C Pertea G%2C Kim D%2C Kelley DR%2C Pimentel H%2C Salzberg SL%2C Rinn JL%2C Pachter L %282012%29 Differential gene and transcript expression analysis of RNA%2Dseq experiments with TopHat and Cufflinks%2E Nat Protoc 7%3A 562%2D578&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL, Pachter L (2012) Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7: 562-578

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Trapnell&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Trapnell&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Turck F%2C Roudier F%2C Farrona S%2C Martin%2DMagniette M%2DL%2C Guillaume E%2C Buisine N%2C Gagnot S%2C Martienssen RA%2C Coupland G%2C Colot V %282007%29 Arabidopsis TFL2%2FLHP1 specifically associates with genes marked by trimethylation of histone H3 lysine 27%2E PLoS Genet 3%3A e86&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Turck F, Roudier F, Farrona S, Martin-Magniette M-L, Guillaume E, Buisine N, Gagnot S, Martienssen RA, Coupland G, Colot V (2007) Arabidopsis TFL2/LHP1 specifically associates with genes marked by trimethylation of histone H3 lysine 27. PLoS Genet 3: e86

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Turck&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis TFL2/LHP1 specifically associates with genes marked by trimethylation of histone H3 lysine 27.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis TFL2/LHP1 specifically associates with genes marked by trimethylation of histone H3 lysine 27.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Turck&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Veluchamy A%2C J�gu T%2C Ariel F%2C Latrasse D%2C Mariappan KG%2C Kim S%2DK%2C Crespi M%2C Hirt H%2C Bergounioux C%2C Raynaud C%2C et al %282016%29 LHP1 Regulates H3K27me3 Spreading and Shapes the Three%2DDimensional Conformation of the Arabidopsis Genome%2E PloS One 11%3A e0158936&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Veluchamy A, J�gu T, Ariel F, Latrasse D, Mariappan KG, Kim S-K, Crespi M, Hirt H, Bergounioux C, Raynaud C, et al (2016) LHP1 Regulates H3K27me3 Spreading and Shapes the Three-Dimensional Conformation of the Arabidopsis Genome. PloS One 11: e0158936

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Veluchamy&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=LHP1 Regulates H3K27me3 Spreading and Shapes the Three-Dimensional Conformation of the Arabidopsis Genome.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=LHP1 Regulates H3K27me3 Spreading and Shapes the Three-Dimensional Conformation of the Arabidopsis Genome.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Veluchamy&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Vicente%2DCarbajosa J%2C Carbonero P %282005%29 Seed maturation%3A developing an intrusive phase to accomplish a quiescent state%2E Int J Dev Biol 49%3A 645%2D651&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Vicente-Carbajosa J, Carbonero P (2005) Seed maturation: developing an intrusive phase to accomplish a quiescent state. Int J Dev Biol 49: 645-651

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Vicente-Carbajosa&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Seed maturation: developing an intrusive phase to accomplish a quiescent state&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Seed maturation: developing an intrusive phase to accomplish a quiescent state&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Vicente-Carbajosa&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang H%2C Liu C%2C Cheng J%2C Liu J%2C Zhang L%2C He C%2C Shen W%2DH%2C Jin H%2C Xu L%2C Zhang Y %282016%29 Arabidopsis Flower and Embryo Developmental Genes are Repressed in Seedlings by Different Combinations of Polycomb Group Proteins in Association with Distinct Sets of Cis%2Dregulatory Elements%2E PLoS Genet 12%3A e1005771&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang H, Liu C, Cheng J, Liu J, Zhang L, He C, Shen W-H, Jin H, Xu L, Zhang Y (2016) Arabidopsis Flower and Embryo Developmental Genes are Repressed in Seedlings by Different Combinations of Polycomb Group Proteins in Association with Distinct Sets of Cis-regulatory Elements. PLoS Genet 12: e1005771

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis Flower and Embryo Developmental Genes are Repressed in Seedlings by Different Combinations of Polycomb Group Proteins in Association with Distinct Sets of Cis-regulatory Elements.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis Flower and Embryo Developmental Genes are Repressed in Seedlings by Different Combinations of Polycomb Group Proteins in Association with Distinct Sets of Cis-regulatory Elements.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1



Wang Y, Gu X, Yuan W, Schmitz RJ, He Y (2014) Photoperiodic control of the floral transition through a distinct polycombrepressive complex. Dev Cell 28: 727-736


Wei W, Zhang Y-Q, Tao J-J, Chen H-W, Li Q-T, Zhang W-K, Ma B, Lin Q, Zhang J-S, Chen S-Y (2015) The Alfin-like homeodomainfinger protein AL5 suppresses multiple negative factors to confer abiotic stress tolerance in Arabidopsis. Plant J Cell Mol Biol 81:871-883


Wolff P, Weinhofer I, Seguin J, Roszak P, Beisel C, Donoghue MTA, Spillane C, Nordborg M, Rehmsmeier M, Köhler C (2011) High-resolution analysis of parent-of-origin allelic expression in the Arabidopsis Endosperm. PLoS Genet 7: e1002126


Wu G, Poethig RS (2006) Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3. DevCamb Engl 133: 3539-3547


Xiao J, Wagner D (2015) Polycomb repression in the regulation of growth and development in Arabidopsis. Curr Opin Plant Biol 23:15-24


Xu L, Shen W-H (2008) Polycomb silencing of KNOX genes confines shoot stem cell niches in Arabidopsis. Curr Biol CB 18: 1966-1971


Yang C, Bratzel F, Hohmann N, Koch M, Turck F, Calonje M (2013) VAL- and AtBMI1-mediated H2Aub initiate the switch fromembryonic to postgerminative growth in Arabidopsis. Curr Biol CB 23: 1324-1329


Yoshida N, Yanai Y, Chen L, Kato Y, Hiratsuka J, Miwa T, Sung ZR, Takahashi S (2001) EMBRYONIC FLOWER2, a novel polycombgroup protein homolog, mediates shoot development and flowering in Arabidopsis. Plant Cell 13: 2471-2481


Yu G, Wang L-G, Han Y, He Q-Y (2012) clusterProfiler: an R package for comparing biological themes among gene clusters. OmicsJ Integr Biol 16: 284-287


Zhang X, Germann S, Blus BJ, Khorasanizadeh S, Gaudin V, Jacobsen SE (2007) The Arabidopsis LHP1 protein colocalizes withhistone H3 Lys27 trimethylation. Nat Struct Mol Biol 14: 869-871



http://www.ncbi.nlm.nih.gov/pubmed?term=Wang Y%2C Gu X%2C Yuan W%2C Schmitz RJ%2C He Y %282014%29 Photoperiodic control of the floral transition through a distinct polycomb repressive complex%2E Dev Cell 28%3A 727%2D736&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang Y, Gu X, Yuan W, Schmitz RJ, He Y (2014) Photoperiodic control of the floral transition through a distinct polycomb repressive complex. Dev Cell 28: 727-736

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Photoperiodic control of the floral transition through a distinct polycomb repressive complex&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Photoperiodic control of the floral transition through a distinct polycomb repressive complex&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wei W%2C Zhang Y%2DQ%2C Tao J%2DJ%2C Chen H%2DW%2C Li Q%2DT%2C Zhang W%2DK%2C Ma B%2C Lin Q%2C Zhang J%2DS%2C Chen S%2DY %282015%29 The Alfin%2Dlike homeodomain finger protein AL5 suppresses multiple negative factors to confer abiotic stress tolerance in Arabidopsis%2E Plant J Cell Mol Biol 81%3A 871%2D883&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wei W, Zhang Y-Q, Tao J-J, Chen H-W, Li Q-T, Zhang W-K, Ma B, Lin Q, Zhang J-S, Chen S-Y (2015) The Alfin-like homeodomain finger protein AL5 suppresses multiple negative factors to confer abiotic stress tolerance in Arabidopsis. Plant J Cell Mol Biol 81: 871-883

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wei&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Alfin-like homeodomain finger protein AL5 suppresses multiple negative factors to confer abiotic stress tolerance in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Alfin-like homeodomain finger protein AL5 suppresses multiple negative factors to confer abiotic stress tolerance in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wei&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wolff P%2C Weinhofer I%2C Seguin J%2C Roszak P%2C Beisel C%2C Donoghue MTA%2C Spillane C%2C Nordborg M%2C Rehmsmeier M%2C K�hler C %282011%29 High%2Dresolution analysis of parent%2Dof%2Dorigin allelic expression in the Arabidopsis Endosperm%2E PLoS Genet 7%3A e1002126&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wolff P, Weinhofer I, Seguin J, Roszak P, Beisel C, Donoghue MTA, Spillane C, Nordborg M, Rehmsmeier M, K�hler C (2011) High-resolution analysis of parent-of-origin allelic expression in the Arabidopsis Endosperm. PLoS Genet 7: e1002126

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wolff&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=High-resolution analysis of parent-of-origin allelic expression in the Arabidopsis Endosperm.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=High-resolution analysis of parent-of-origin allelic expression in the Arabidopsis Endosperm.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wolff&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wu G%2C Poethig RS %282006%29 Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3%2E Dev Camb Engl 133%3A 3539%2D3547&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wu G, Poethig RS (2006) Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3. Dev Camb Engl 133: 3539-3547

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wu&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Xiao J%2C Wagner D %282015%29 Polycomb repression in the regulation of growth and development in Arabidopsis%2E Curr Opin Plant Biol 23%3A 15%2D24&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Xiao J, Wagner D (2015) Polycomb repression in the regulation of growth and development in Arabidopsis. Curr Opin Plant Biol 23: 15-24

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Xiao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Polycomb repression in the regulation of growth and development in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Polycomb repression in the regulation of growth and development in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Xiao&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Xu L%2C Shen W%2DH %282008%29 Polycomb silencing of KNOX genes confines shoot stem cell niches in Arabidopsis%2E Curr Biol CB 18%3A 1966%2D1971&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Xu L, Shen W-H (2008) Polycomb silencing of KNOX genes confines shoot stem cell niches in Arabidopsis. Curr Biol CB 18: 1966-1971

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Xu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Polycomb silencing of KNOX genes confines shoot stem cell niches in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Polycomb silencing of KNOX genes confines shoot stem cell niches in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Xu&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yang C%2C Bratzel F%2C Hohmann N%2C Koch M%2C Turck F%2C Calonje M %282013%29 VAL%2D and AtBMI1%2Dmediated H2Aub initiate the switch from embryonic to postgerminative growth in Arabidopsis%2E Curr Biol CB 23%3A 1324%2D1329&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yang C, Bratzel F, Hohmann N, Koch M, Turck F, Calonje M (2013) VAL- and AtBMI1-mediated H2Aub initiate the switch from embryonic to postgerminative growth in Arabidopsis. Curr Biol CB 23: 1324-1329

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=VAL- and AtBMI1-mediated H2Aub initiate the switch from embryonic to postgerminative growth in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=VAL- and AtBMI1-mediated H2Aub initiate the switch from embryonic to postgerminative growth in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yoshida N%2C Yanai Y%2C Chen L%2C Kato Y%2C Hiratsuka J%2C Miwa T%2C Sung ZR%2C Takahashi S %282001%29 EMBRYONIC FLOWER2%2C a novel polycomb group protein homolog%2C mediates shoot development and flowering in Arabidopsis%2E Plant Cell 13%3A 2471%2D2481&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yoshida N, Yanai Y, Chen L, Kato Y, Hiratsuka J, Miwa T, Sung ZR, Takahashi S (2001) EMBRYONIC FLOWER2, a novel polycomb group protein homolog, mediates shoot development and flowering in Arabidopsis. Plant Cell 13: 2471-2481

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yoshida&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yoshida&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yu G%2C Wang L%2DG%2C Han Y%2C He Q%2DY %282012%29 clusterProfiler%3A an R package for comparing biological themes among gene clusters%2E Omics J Integr Biol 16%3A 284%2D287&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yu G, Wang L-G, Han Y, He Q-Y (2012) clusterProfiler: an R package for comparing biological themes among gene clusters. Omics J Integr Biol 16: 284-287

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=clusterProfiler: an R package for comparing biological themes among gene clusters&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=clusterProfiler: an R package for comparing biological themes among gene clusters&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yu&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang X%2C Germann S%2C Blus BJ%2C Khorasanizadeh S%2C Gaudin V%2C Jacobsen SE %282007%29 The Arabidopsis LHP1 protein colocalizes with histone H3 Lys27 trimethylation%2E Nat Struct Mol Biol 14%3A 869%2D871&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhang X, Germann S, Blus BJ, Khorasanizadeh S, Gaudin V, Jacobsen SE (2007) The Arabidopsis LHP1 protein colocalizes with histone H3 Lys27 trimethylation. Nat Struct Mol Biol 14: 869-871

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis LHP1 protein colocalizes with histone H3 Lys27 trimethylation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis LHP1 protein colocalizes with histone H3 Lys27 trimethylation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1



B C

D

A

Figure S1. Phenotypes of atbmi1a/b and atbmi1a/b/c mutants. (A) WT seedling at 10 DAG. (B) atbmi1a/b mutants at 10 DAG. (C) atbmi1a/b/c mutants at 10 DAG. Bars, 2 mm.

Figure S2. Boxplots representing the read quality scores (Illumina 1.5 encoding) per base for the first replicate of all samples. The quality scores for each base in the reads remained within the green area indicating a high sequencing quality. The common decrease in quality at the end of the reads is observed. Nevertheless, the quality never enters the problematic red area.

Table S1. Number of reads and concurrent pair alignment rate per sequencing sample. On average the number of reads per sample is approximately 15 million and the average concurrent pair alignment rate is greater than 95.%. This indicates a high read sequencing quality and the lack of sample contamination.

atbm

i1a

atbm

i1b

atbm

i1b

atbmi1a WT WT

atbm

i1a/

b

atbm

i1a/

b/c

atbm

i1a/

b/c

atbmi1a/b WT WT

Genes Genes Genes

Figure S3. Correlation among differentially expressed genes in WT and the different genotypes. Scatter plots comparing gene expression levels in the different mutants against WT, single atbmi1a against atbmi1b, and atbmi1a/b against atbmi1a/b/c.

A B

332

947

1693 93

20

69

29

15

4 64

33 21

17

70 14

616

982

742 72

39

163

87

98

32 165

16 5

42

31 149

up in atbmi1a/b up in atbmi1b

up in atbmi1a up in atbmi1a/b/c

down in atbmi1a/b down in atbmi1b

down in atbmi1a down in atbmi1a/b/c

Figure S4. Altered gene expression in atbmi1 mutants. (A) Venn diagram showing the number of genes up- and (B) downregulated that overlap among the different genotypes.

GO of genes upregulated in atbmi1a/b

GO of genes downregulated in atbmi1a/b

A

B

Figure S5. Gene ontology (GO) enrichment analysis of up- and downregulated genes in atbmi1a/b mutants. Distribution of enriched GO terms into the different “biological process” categories as defined by TAIR. p-values are indicated.

GO of genes upregulated in atbmi1a/b/c

GO of genes downregulated in atbmi1a/b/c

A

B

Figure S6. Gene ontology (GO) enrichment analysis of up- and downregulated genes in atbmi1a/b/c mutants. Distribution of enriched GO terms into the different “biological process” categories as defined by TAIR. p-values are indicated.

398 196 5164 526 145 5215

1387 766 4594 765 1397 4595

K27 in WT (5360)

K27 in WT (5360)

K27 in WT (5360)

K27 in WT (5360)

up in atbmi1a up in atbmi1b

up in atbmi1a/b up in atbmi1a/b/c

Figure S7. Putative AtBMI1direct target genes. (A) Venn diagrams showing the number of genes that were upregulated (up) in the different mutants and H3K27me3 marked (K27) in WT seedlings of the same age. All these overlaps are significant with p-values lower than 1.2 x10-6 and odds ratios greater 1.5 according to Fisher’s Exact test except in the case of the atbmi1b mutant, which is probably because it is a knock-down mutant. (B) Venn diagrams showing the number of genes that were downregulated (down) in the different mutants and H3K27me3 marked (K27) in WT seedlings of the same age. All these overlaps are non-significant with p-values higher than 0.4231 and odds ratios lower than 1.044 according to Fisher’s Exact test except in the case of the atbmi1abc mutant, which is probably because the developmental stage of the mutant.

152 45 5315 325

68

5292

1243 246 5114 726 2210 4635

K27 in WT (5360)

K27 in WT (5360)

K27 in WT (5360)

K27 in WT (5360)

down in atbmi1a down in atbmi1b

down in atbmi1a/b down in atbmi1a/b/c

A

B

p-value,1.241e-06 odds ratio 1.5

p-value,0.567 odds ratio 0.98





p-value,1 odds ratio 0.75


A

B

Figure S8. Genes differentially expressed in atbmi1a/b and atbmi1a/b/c. (A) Expression levels of several genes from the different clusters in WT seedlings and the different mutants. (B) qRT-PCR analysis of WOX2, WOX9 and SMB expression levels y whole seedlings and roots of WT, atbmi1c and atbmi1a/b/c mutants. Quantifications are relative to ACTIN levels. Error bars of three independent measurements are indicated.

0

0,0002

0,0004

0,0006

0,0008SMB

0

0,005

0,01

0,015

0,02

0,025WOX9

0

0,02

0,04

0,06

0,08

Rela

tive

mRN

A

WOX2

atbmi1a/b/c seedlings atbmi1c seedlings WT seedlings

WT roots atbmi1c roots

Expr

essi

on L

evel

(F

PKM

)

Cluster III Cluster II Cluster Ib Cluster Ia

atbmi1a atbmi1a/b atbmi1b WT Col atbmi1a/b/c

PLT5

FUS3

AGL15

WRI1

WOX8

FLC

MAF4

MAF5

WOX4

WOX5

FPF1

SMB

STIMPY

WOX2

FTM1

WRKY29

WRKY38

MYB78

MYB84

GL3

up_K27 in atbmi1a/b weak

(281)

up_K27 in atbmi1a/b/c

(765)

155 126 610

TF Family Name Representative Gene ABI3VP1 ABI3, FUS3

AP2-EREBP ABI4, AIL2/BBM, AIL3/PLT1, AIL4/PLT2, AIL5/CHO1, AIL6/PLT3, AIL7, ESR1, Rap2.6L, WRI1

bHLH MEE8 bZIP DPBF2

C2C2-Gata MNP, GATA-19 C2H2 MGP, SRS4, ZFP10, GIS, RBE, KNU

G2-like KAN2 GRF GRF5

Homeobox WOX4, WOX3, FWA, HDG8, WOX11, WOX12, WOX2, WOX5, WOX8, WOX9, WUS

HSF HSFB4 MADS SEP2, AGL13, FLC, AGL15, MAF4, MAF5

MYB PAP2, MYB62, MYB101, MYB26, MYB15, PFG2, MYB40, MYB111, MYB53, MYB90, MYB15

NAC ANAC015, CUC3, SMB RAV DPA4

WRKY WRKY23, WRKY8, WRKY48 ZF-HD AtHB28

TF Family Name

Representative Gene

ABI3VP1 ABI3 AP2-EREBP SNZ, SHINE2

C2H2 SRS4, SRS2 Homeobox WOX5, HDG4

MADS PHE1, AGL15, MAF4

MYB MYB47 NAC NARS1 REM REM1

WRKY WRKY28

Figure S9. Different gene expression patterns of atbmi1a/b weak and atbmi1a/b/c mutants. Venn diagram showing overlapping between the genes up_K27 in atbmi1a/b weak and atbmi1a/b/c mutants. The overlap is significant with a p-value lower than 2.2x10-16 and an odds ratio greater than 17 according to Fisher's Exact test. Some representative transcription factors (TFs) in each dataset are indicated. TFs found in the two data sets are highlighter in red.

PLT gene family

WOX gene family

CHROMATIN Factors

PcG- related

TrxG- related

Figure S10. Expression levels of different important developmental genes in WT and atbmi1a/b/c mutants. Transcript levels of genes from PLT and WOX gene families and chromatin related factors belonging to the PcG and TrxG families.

K27_ EMF1 Bound (2489)

Misexpressed in atbmi1a/b/c

(5097)

786 1703 4311

p-value < 2.2e-16 odds ratio 1.51

Misexpressed in atbmi1a/b/c

(5097)

K27_ LHP1 Bound (4949)

1406 3545 3691

A

B

Figure S11. AtBMI1, EMF1 and LHP1 functional relationship. (A) Clustering analysis of genes misexpressed (up and downregulated) in atbmi1a/b/c and H3K27me3 marked genes bound by EMF1. (B) Clustering analysis of genes misexpressed (up and downregulated) in atbmi1a/b/c and H3K27me3 marked genes bound by LHP1. These overlaps are significant (p-values and Fisher's Exact test results are indicated).

p-value < 2.2e-16 odds ratio 1.37

At1g06770.1 (AtBMI1B)

At1g06770.2

Figure S12. Schematic representation of AtBMI1B (At1g06770) splice variants (left) and predicted protein sequence comparison (right). Light boxes indicate untranslated regions, blue boxes exons, and black lines introns.

Running head: 2 Regulatory networks of AtBMI1 proteins 7 8 ......5 Myriam Calonje 6 Institute of...

Documents

Transcript of Running head: 2 Regulatory networks of AtBMI1 proteins 7 8 ......5 Myriam Calonje 6 Institute of...