Role of the (p)ppGpp Synthase RSH, a RelA/SpoT Homolog, in ...

INFECTION AND IMMUNITY, May 2010, p. 1873–1883 Vol. 78, No. 50019-9567/10/$12.00 doi:10.1128/IAI.01439-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Role of the (p)ppGpp Synthase RSH, a RelA/SpoT Homolog, inStringent Response and Virulence of Staphylococcus aureus�

Tobias Geiger,1 Christiane Goerke,1 Michaela Fritz,1 Tina Schafer,2 Knut Ohlsen,2 Manuel Liebeke,3Michael Lalk,3 and Christiane Wolz1*

Interfaculty Institute of Microbiology and Infection Medicine, University of Tubingen, Tubingen,1 Institute forMolecular Infection Biology, University of Wurzburg, Wurzburg,2 and Institute of Pharmaceutical Biology,

Ernst-Moritz-Arndt University, Greifswald,3 Germany

Received 23 December 2009/Returned for modification 22 January 2010/Accepted 25 February 2010

In most bacteria, nutrient limitations provoke the stringent control through the rapid synthesis of the alarmonespppGpp and ppGpp. Little is known about the stringent control in the human pathogen Staphylococcus aureus, partlydue to the essentiality of the major (p)ppGpp synthase/hydrolase enzyme RSH (RelA/SpoT homolog). Here, we showthat mutants defective only in the synthase domain of RSH (rshsyn) are not impaired in growth under nutrient-richconditions. However, these mutants were more sensitive toward mupirocin and were impaired in survival whenessential amino acids were depleted from the medium. RSH is the major enzyme responsible for (p)ppGpp synthesisin response to amino acid deprivation (lack of Leu/Val) or mupirocin treatment. Transcriptional analysis showedthat the RSH-dependent stringent control in S. aureus is characterized by repression of genes whose products arepredicted to be involved in the translation machinery and by upregulation of genes coding for enzymes involved inamino acid metabolism and transport which are controlled by the repressor CodY. Amino acid starvation alsoprovoked stabilization of the RNAs coding for major virulence regulators, such as SaeRS and SarA, independentlyof RSH. In an animal model, the rshsyn mutant was shown to be less virulent than the wild type. Virulence could berestored by the introduction of a codY mutation into the rshsyn mutant. These results indicate that stringentconditions are present during infection and that RSH-dependent derepression of CodY-regulated genes is essentialfor virulence in S. aureus.

Staphylococcus aureus causes a variety of infections in hu-mans but also asymptomatically colonizes the nose of healthyindividuals. Gene expression must be closely coordinated toallow the pathogen to survive and/or multiply in different com-partments during infection and colonization. However, knowl-edge about growth conditions in vivo is still limited, and theinteraction of the regulatory circuits leading to metabolic ad-aptation and to differential expression of virulence factors isnot yet understood completely.

The stringent control is one of the first known and mostintensively studied global systems of gene regulation in bacte-ria (for previous reviews, see references 6, 8, 10, 18, 19, 25, 35,46, 48, 52, 56, and 57). It is provoked by the rapid synthesis ofthe alarmones pppGpp and ppGpp upon nutrient limitation.Alarmone synthesis is linked to many physiological pro-cesses involving rRNA degradation, gene activation/repres-sion, protein translation, enzyme activation, and replication.In many pathogenic bacteria, virulence, persistence, andhost interaction are also influenced through (p)ppGpp (18).(p)ppGpp is synthesized by cytoplasmic enzymes containinga conserved synthase domain first described in RelA andSpoT enzymes from proteobacteria. In most firmicutes, bi-functional Rel/SpoT homologs (RSHs), which constitute adistinct class of (p)ppGpp synthases (40, 56), are present. They

are composed of a C-terminal regulatory and an N-terminalenzymatic domain. Structural data indicate two conformationsof the enzyme corresponding to the known reciprocal activitystates, (p)ppGpp-hydrolase-OFF/(p)ppGpp-synthase-ON andhydrolase-ON/synthase-OFF (23). The C-terminal domain isprobably involved in the reciprocal regulation of the two cat-alytic activities, since truncation of the C-terminal domain en-hances the synthase activity of the enzyme (39). Recently,genes coding for additional small (p)ppGpp synthases wereidentified in most of the firmicutes (41).

Overall, there is now growing evidence that there are fun-damental differences in (p)ppGpp synthesis, regulation, andmolecular function between firmicutes and proteobacteria(56). For instance, in Escherichia coli, binding of (p)ppGpp tothe RNA polymerase in concert with the cofactor proteinDksA results in the inhibition of the rrn promoters. In fir-micutes, DksA is not present and (p)ppGpp does not appearto interact with RNA polymerase (RNAP) directly (27).(p)ppGpp synthesis reduces intracellular GTP levels, andthe GTP level in turn seems to directly influence promoteractivity in Bacillus subtilis. It was proposed that the nature ofthe nucleoside triphosphate (NTP) initiating transcriptiondetermines whether genes are under positive or negativestringent control (27, 28, 42, 50). For instance, some rrnpromoters of B. subtilis initiate with GTP, and a change inthe identity of the base at position �1 results in a loss ofregulation by (p)ppGpp and GTP.

The GTP level is also crucial for the repressive function ofthe metabolic regulator CodY, at least in some firmicutes (re-viewed in reference 47). In B. subtilis, the repressor function

* Corresponding author. Mailing address: Interfaculty Instituteof Microbiology and Infection Medicine, Universitat Tubingen, El-friede-Aulhorn-Strasse 6, 72076 Tubingen, Germany. Phone: 49-7071-2980187. Fax: 49-7071-295165. E-mail: [email protected].

� Published ahead of print on 8 March 2010.

1873

on February 4, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

of CodY is activated by GTP, which enhances the affinity ofCodY to a conserved binding motif in the promoter region oftarget genes (21). Thus, there is a direct link between stringentcontrol and CodY-mediated gene regulation: lowering of theGTP pool through the induction of stringent controls leads toderepression of CodY target genes (4, 24). However, GTP is anactive ligand for CodY in only some of the firmicutes. Forinstance, CodY from streptococci or lactococci appears not tointeract with GTP. Here, branched-chain amino acids arebound by CodY and constitute the primary signals for CodY-mediated gene repression (12, 20, 22, 33).

In S. aureus, CodY is a potent repressor of genes mainlyinvolved in nitrogen metabolism and transport. Virulence fac-tors are also regulated by CodY, mainly through CodY-depen-dent repression of the agr system (37, 45). There is strongevidence that isoleucine is the major ligand of CodY in S.aureus, since CodY target genes were derepressed in mediumlacking isoleucine (45).

Little information is available on stringent control in staph-ylococci. Interestingly, it could be shown that the RSH ho-molog is essential for survival in S. aureus (16). Thus, the lackof viable rsh mutants has hampered an in-depth analysis of thestringent response. However, staphylococci mount a stringentresponse that is characterized by the generation of (p)ppGppwhen treated with mupirocin to mimic isoleucine starvation(9). Mupirocin is a potent antimicrobial agent which inhibitsthe bacterial isoleucyl tRNA synthetase. RSH contains a typ-ical C-terminal domain which may sense the accumulation ofuncharged tRNA after amino acid deprivation, leading to ashift toward the synthase-ON/hydrolase-OFF conformation ofthe bifunctional enzyme (23). Microarray analysis revealed

that in S. aureus, mupirocin induces transcriptional changeswhich are similar to those observed in other bacteria, e.g., theupregulation of several classes of gene products, includingtransport proteins, virulence factors, regulatory molecules, andpeptidases (2). However, it is not clear whether all of thesechanges are due to (p)ppGpp synthesis.

Here, we characterize the stringent control elicited by the(p)ppGpp synthase RSH of S. aureus, which is responsible for(p)ppGpp synthesis upon amino acid deprivation. We showthat RSH synthase activity is required for derepression ofgenes of the CodY regulon and for the repression of genesinvolved in the translation machinery after amino acid limita-tion. A mutant defective in RSH synthase activity was lessvirulent in a murine model of kidney infection than the wildtype (WT) or the codY rsh double mutant.

MATERIALS AND METHODS

Strains and growth conditions. Strains and plasmids are listed in Table 1. S.aureus strains were grown in CYPG medium (10 g/liter Casamino acids, 10 g/literyeast extract, 5 g/liter NaCl, 0.5% glucose, and 0.06 M phosphoglycerate) (43), inB medium (7), or in a chemically defined medium (CDM) (45). For strainscarrying resistance genes, antibiotics were used only in precultures at the follow-ing concentrations: erythromycin, 10 �g/ml, and tetracycline, 5 �g/ml. Bacteriafrom an overnight culture were diluted to an initial optical density at 600 nm(OD600) of 0.05 in fresh medium and grown with shaking (220 rpm) at 37°C tothe desired growth phase. For downshift experiments, strains were grown incomplete CDM, including leucine/valine (Leu/Val), to an OD600 of 0.5. Thecultures were filtered over a 0.22-�m filter with vacuum and washed twice withsterile phosphate-buffered saline (PBS), and bacteria were resuspended in anequal volume of CDM medium with or without Leu/Val and grown for another30 min.

Determination of MICs and MBCs. Bacteria were grown in Mueller-Hintonbroth to the exponential growth phase (OD600 of 0.5, corresponding to 5 � 108

TABLE 1. Strains and plasmids

Strain or plasmid Description Reference/Source

StrainsEscherichia coli

TOP10 Competent E. coli for plasmid transformation Invitrogen

S. aureusRN4220 Restriction-deficient S. aureus strain, r� 29CYL316 RN4220(pYL112�19), L54 int gene, r� 30HG001 RN1 (derived from 8325) with rsbU restored, previously named RN1HG 45Newman Wild type 14RN4220-21 RN4220 codY::tet(M) 45RN4220-55 RN4220 with rsh gene under Pspac control in the chromosome, ermC This workNewman-21 Newman codY::tet(M) 45Newman-86 Newman rshsyn (nucleotides 942 to 950 deleted) This workNewman-55 Newman with rsh gene under Pspac control in the chromosome, ermC This workHG001-21 HG001 codY::tet(M) 45HG001-86 HG001 rshsyn (nucleotides 942 to 950 deleted) This workHG001-55 HG001 with rsh gene under Pspac control in the chromosome, ermC This workHG001-86-21 HG001 rshsyn (nucleotides 942 to 950 deleted), codY::tet(M) mutant This work

PlasmidspCR2.1 Cloning vector InvitrogenpMUTIN4 Integrative vector including the IPTG-inducible promoter Pspac, Apr Emr 51pKOR1 AHT-inducible suicide mutagenesis vector 3pCL84 Single-copy integration vector, att site for chromosomal integration in geh 30pCG55 pMUTIN with integration of a 942-bp rsh fragment for conditional mutagenesis This workpCG86 pKOR1 with mutated rsh synthase domain (nucleotides 942 to 950 deleted) This workpCG199 pCL84 with rsh for complementation This work

1874 GEIGER ET AL. INFECT. IMMUN.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

bacteria/ml). Ten microliters of a 1:100 dilution of the culture were mixed with80 �l of Mueller-Hinton broth and 10 �l of mupirocin (0.001 to 10 �g/ml) inmicrotiter plates. Plates were incubated at 37°C for 24 h and 48 h. The MIC wasdefined as the lowest concentration where no turbidity could be monitored.Bactericidal activity was determined by plating the dilutions at which no turbiditywas detected. The minimal bactericidal concentration (MBC) was defined as theminimal concentration at which no colonies could be recovered. MICs towardvancomycin and ciprofloxacin were determined using an Etest as described bythe manufacturer (AB-Biodisk, Solna, Sweden).

Construction of mutant strains and complementation. A conditional rsh mu-tant was generated using the pMUTIN4 vector (51). With this system, condi-tional mutants can be obtained by integrating the vector upstream of the targetgene, which falls under the control of the isopropyl-�-D-thiogalactopyranoside(IPTG)-inducible promoter Pspac carried by pMUTIN4. For this purpose, a942-bp internal fragment of the rsh gene containing the native ribosomal bindingsite was amplified from strain Newman by employing the primers listed in Table2. The amplicon was cloned into the EcoRI/BamHI restriction sites of pMUTIN4to yield pCG55. The vector was transferred into the restriction-deficient strainRN4220 under IPTG induction. Since the vector cannot replicate in Gram-positive bacteria, pMUTIN4 inserts into the chromosome via a single crossoverevent by erythromycin selection. The conditional rsh mutant strain (RN4220-55)obtained was verified by PCR and pulsed-field gel electrophoresis (PFGE). Themutation was transduced into S. aureus strain Newman or HG001 using �11lysates of strain RN4220-55 (Table 1). Transductants were verified by PCR andPFGE.

The markerless rshsyn mutant was obtained using the pKOR1 system (3). Adeletion in the synthase domain of rsh was introduced by overlapping PCRemploying the primers listed in Table 2. The amplicon obtained was moved intopKOR1 using the Gateway cloning system (Invitrogen). The resulting plasmid(pCG86) was verified and transformed into RN4220, from which it was trans-duced into the different S. aureus strains. Mutagenesis was performed as de-

scribed previously (3). Mutation of the synthase domain of RSH in strainsHG001 and Newman was verified by sequence analysis, and the mutants weredesignated HG001-86 and Newman-86, respectively (Table 1).

For complementation, the rsh gene along with a 960-bp upstream region wasamplified with the oligonucleotides listed in Table 2 and cloned into the pCR2.1cloning vector (Invitrogen). The insert was subcloned into the EcoRI site of theintegration vector pCL84, yielding plasmid pCG199. The plasmid was used totransform strain CYL316, from which it was transduced into the rshsyn mutantstrains (Table 1).

RNA isolation, Northern blot analysis, and determination of transcript sta-bility. RNA isolation and Northern blot analysis were performed as describedpreviously (20). Briefly, bacteria were lysed in 1 ml of Trizol reagent (InvitrogenLife Technologies, Karlsruhe, Germany) with 0.5 ml of zirconia-silica beads(0.1-mm diameter) in a high-speed homogenizer (Savant Instruments, Farming-dale, NY). RNA was isolated as described in the instructions provided by themanufacturer of Trizol. Digoxigenin (DIG)-labeled probes for the detection ofspecific transcripts were generated using a DIG-labeling PCR kit following themanufacturer’s instructions (Roche Biochemicals). Oligonucleotides used forprobe generation were as described previously (36, 45) or are listed in Table 2.

For determination of transcript stabilities, strains were grown and shifted inCDM with and without Leu/Val as described above. Rifampin (500 �g/ml) wasadded to the cultures for the times indicated in Fig. 8B. At the different timepoints, RNAs were isolated and Northern blot analyses were performed asdescribed above.

Quantitative measurement of the intracellular GTP and (p)ppGpp pools. S.aureus wild-type strain HG001 and its isogenic mutants were grown in CDM toan OD600 of 0.5. Cells were shifted to CDM containing 0.5 �g/ml mupirocin orto CDM without Leu/Val as described above. Samples for intracellular metab-olite analysis were harvested directly before and 30 min after shift by fastfiltration over a 0.22-�m sterile filter with vacuum. Cells were washed andquenched, and metabolites were extracted as described recently (13, 39a). De-

TABLE 2. Oligonucleotides

Purpose and description Template Namea Sequenceb

MutagenesisConditional rsh mutant Newman EcoRIrsh-1151U AAAAGAATTCGTACCTAAATCATTGTTTAAGGCG

Newman BamHIrsh-2080L TTTAGGATCCTCGGTTTCCATAACGTAT

rsh synthase mutant Newman attB1rsh-U GGGGACAAGTTTGTACAAAAAAGCAGGCTATTAGGCGGTATCGTAGT

Newman rshSyndel2-L TCCATTTGGACCTACTACTGTAGTATGCAACAAATTTTGTTTAGGCATT

Newman rsh-2147U CAGTAGTAGGTCCAAATGGANewman attB2rsh1-L GGGGACCACTTTGTACAAGAAAGCTGGGTGCTGCG

AATAAATCATCTT

Complementationrsh with upstream region Newman EcoRIrsh-215U CTAGGAATTCTTGGATAAAGTCACAATT

Newman KpnIrsh-L CCCCCGGTACCCTTTGTACAACTACTTTCATATTTTGCACCT

Construction of hybridizationprobes

infB Newman infBDIG-U ACCAACTTCAAATCCTGATCNewman infBDIG-L TGTAATTTCAACAGGCGTTG

guaC Newman guaCDIG-U AACATATGCAAAATTCAGGCNewman guaCDIG-L GATGCACCAAATCTAATTGA

rpsL Newman rpsLDIG-U ACCACAAAAACGTGGTGTATGTACTNewman rpsLDIG-L ACACCTGGTAAGTCTCTTACACGTC

tsf Newman tsfDIG-U GTAGAAACTAAAGGTAACGACNewman tsfDIG-L ATATTTAGGGTTGATTGCAG

SAOUHSC_02923 Newman SA02923DIG-U GTAAAGCCCAACCAACAGGTNewman SA02923DIG-L TCATCGTAGGTTTAACAGCA

sar Newman sarDIG-U CAATGATTGCTTTGAGTTGTNewman sarDIG-L CGTTTATTTACTCGACTCAA

a U, upper primer; L, lower primer.b Artificial restriction sites are underlined.

VOL. 78, 2010 STRINGENT RESPONSE IN STAPHYLOCOCCUS AUREUS 1875


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

tection of nucleotides was performed by ion-pairing liquid chromatography–massspectrometry (IP-LC-MS) (13). Quantification of compounds was done by re-ferring to the internal standard Br-ATP in all samples. Identification and cali-bration curves for all metabolites were achieved by measuring pure standardcompounds, with the exception of pppGpp, for which no chemical standard wascommercially available. For this, the precise mass of pppGpp was calculated andcompared with the mass found ([M � H�]calculated � 681.911 versus [M �H�]detected � 681.910). Quantification of pppGpp was done by adopting thecalibration values from ppGpp, due to the analogous structure. The results of theintracellular metabolite measurements represent the means of 4 biological rep-licates and were normalized to the cellular dry weight.

Detection of (p)ppGpp accumulation in S. aureus cells. The cells were grownin a modified low-phosphate CDM (0.4 mM phosphate, buffered at a pH of 7.2with 40 mM MOPS [morpholinepropanesulfonic acid]) to an OD600 of 0.5, atwhich point [32P]H3PO4 (50 �Ci/ml) was added to the cultures. After 3 h ofgrowth, the cells were shifted into CDM containing 0.5 �g/ml mupirocin or intoCDM with and without Leu/Val for an additional 30 min. For the shift experi-ments, the bacteria were filtered using a 0.22-�m sterile filter with vacuum,washed twice with sterile 1% PBS, and resuspended in the appropriate medium.For the extraction of nucleotides, 200 �l ice-cold 2 M formic acid was added perml of culture, followed by incubation for 30 min on ice. The bacteria were lysedwith 0.5 ml of zirconia-silica beads (0.1-mm diameter) in a high-speed homog-enizer, and the extracts were centrifuged at 12,000 � g for 5 min at 4°C. An equalvolume of phenol-chloroform-isoamyl alcohol (50:49:1 [vol/vol/vol]) saturatedwith deionized water was added to the resulting supernatant. The mixture wasagitated and centrifuged at 12,000 � g for 5 min at 4°C. Ten microliters of theresulting supernatant were spotted onto a polyethyleneimine-cellulose thin-layersheet (Macherey&Nagel). For the one-dimensional thin-layer chromatography(TLC) analysis, 1.2 M KH2PO4 (pH 3.5) was used as the chromatographicsolvent.

Mouse infection studies. Female BALB/c mice (16 to 18 g) were purchasedfrom Charles River (Sulzfeld, Germany), housed in polypropylene cages, andgiven food and water ad libitum. S. aureus isolates were cultured for 18 h in Bmedium, washed three times with sterile PBS, and suspended in sterile PBS to3 � 107 CFU/100 �l. As a control, selected dilutions were plated on B agar. Micewere inoculated with 100 �l of S. aureus via the tail vein. Control mice weretreated with sterile PBS. Ten mice were used for each strain. Five days afterchallenge, kidneys were aseptically harvested and used for CFU enumerationand histological analysis, respectively. For the CFU count, organs of 7 mice werehomogenized in 3 ml of PBS using Dispomix (Bio-Budget Technologies GmbH,Krefeld, Germany). Serial dilutions of the organ homogenates were cultured onmannitol salt-phenol red agar plates for at least 48 h at 37°C. CFU were calcu-lated as CFU/organ. The statistical significance of the bacterial load was deter-mined using a Mann Whitney test.

For thin sections of kidney tissues, the kidneys of intravenously (i.v.) infectedmice were removed, embedded in O.C.T Tissue Tek (Vogel, Gießen, Germany),and shock frozen in liquid nitrogen. Five-micrometer cryosections were thinsliced, mounted on Superfrost slides (Langenbrinck, Emmendingen, Germany),and stored at �80°C until use. For staphylococcal protein A staining, slides weredried and subsequently fixed with prechilled acetone for 5 min. Endogenousperoxidase was blocked with 30% H2O2/methanol for 5 min. Slides were incu-

bated with rabbit IgG (Dianova, Hamburg, Germany) (11 mg/ml) diluted 1:100in 10% fetal calf serum (FCS)–PBS, followed by incubation with a peroxidase-coupled goat anti-rabbit IgG (Fab)2 fragment (Dianova) diluted 1:100 in 10%FCS. As substrate, 0.1% diaminobenzidine–tetrahydrochloride (AppliChem,Darmstadt, Germany) dissolved in PBS was used. Tissue was counterstained withMayer’s hematoxylin (Merck, Darmstadt, Germany). Slides were embedded inRoti-Histokitt (Carl-Roth, Karlsruhe, Germany) and dried overnight. Imageswere captured with an Olympus BX51 microscope equipped with a digital DP71camera, and images were processed using CellB software (Olympus, Leinfelden,Germany).

RESULTS

Hydrolase activity determines the essentiality of RSH in S.aureus. In each of the sequenced S. aureus genomes, threegenes with significant homology to the (p)ppGpp synthase do-main of RelA from E. coli can be identified. SAOUHSC_02811and SAOUHSC_00942 code for small proteins with a putative(p)ppGpp synthase domain only; due to sequence homologywith proteins characterized in Streptococcus mutans (32), theseare designated relP and relQ, respectively. SAOUHSC_01742shows a high degree of homology to (p)ppGpp synthases ofother firmicutes, as well as to both the N-terminal and C-terminal domains of RelA and SpoT from E. coli. In accor-dance with the nomenclature used in recent reviews (46, 56),we will refer to this enzyme as RSH. Previous attempts todisrupt the rsh gene in S. aureus failed, indicating that RSH isessential for growth and/or survival in this organism (16).Therefore, we first constructed conditional mutants using thepMUTIN4 vector system. pMUTIN4 is a suicide vector thatallows a gene in the chromosome to be connected to theIPTG-inducible Pspac promoter (51). A 5 rsh fragment wascloned into pMUTIN4 and transformed into S. aureus. Theplasmid integrated into the chromosomal rsh gene, creating aPspac-rsh fusion in which rsh transcription can be controlled byIPTG. As expected, the conditional mutant strains were notable to grow without the addition of IPTG to the medium,supporting the essentiality of the rsh gene product for thegrowth of S. aureus (Fig. 1). An IPTG dose-dependent increaseof the growth rate could be observed (Fig. 1A).

Based on results obtained by analyzing (p)ppGpp synthasesin proteobacteria, we hypothesized that in the RSH enzyme,the hydrolase domain but not the synthase domain is important

FIG. 1. (A) Growth of conditional rsh mutant (HG001-55) in CYPG medium with increasing concentrations of the inducer IPTG. (B) Growthof strain HG001 (circle), the rshsyn mutant (square), and the conditional rsh mutant (triangle) in CYPG without IPTG.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

for viability. E. coli exhibits the bifunctional enzyme SpoT witha (p)ppGpp synthase and a hydrolase domain and the mono-functional enzyme RelA with synthase activity only. It wasshown that it is impossible to obtain a spoT mutant in a relA-positive background (58). This indicates that the hydrolaseactivity of SpoT is essential to degrade the otherwise RelA-dependent toxic accumulation of (p)ppGpp in the cell. Toobtain an rshsyn mutant, we deleted conserved residues atamino acid (aa) positions 308 to 310 (SAOUHSC_01742) ofthe synthase domain of RSH. For RSHSeq of Streptococcusdysgalactiae subsp. equisimilis, it could be shown that mutationof any of these residues leads to defective synthase but intacthydrolase activity of the enzyme (23).

Deletions of the amino acids YQS in the native chromo-somal rsh gene of S. aureus could be readily achieved usingmarkerless chromosomal mutagenesis as described previously(3). In contrast to the conditional rsh mutants, the rshsyn mu-tants showed no growth defect in complex medium (Fig. 1B) orin CDM (data not shown). Thus, the observation that deletionmutants of rsh are not viable in S. aureus is due to the missinghydrolase activity of RSH. The most plausible explanation is

that RSH is required to detoxify molecules synthesized byalternative (p)ppGpp synthases like RelP or RelQ.

RSH is the major enzyme of (p)ppGpp synthesis provokedby amino acid deprivation. We aimed to analyze whether andunder which conditions RSH contributes to (p)ppGpp synthe-sis in S. aureus. RSH contains a typical C-terminal domainwhich may sense the accumulation of uncharged tRNA afteramino acid deprivation, leading to a shift toward synthase-ON/hydrolase-OFF conformation of the bifunctional enzyme (23).The stringent response was induced by mupirocin in bacteriagrown to mid-exponential growth phase in complex medium.Alternatively, bacteria grown in CDM were transferred intoCDM lacking leucine and valine. Both amino acids were nec-essary for optimal growth of S. aureus, and downshift of thestrain into medium lacking these amino acids resulted in im-mediate growth inhibition. After induction of the stringentresponse, nucleotides were detected in cell extracts by TLC(Fig. 2A and B) and by LC-MS (Fig. 2C). With both methods,the alarmones pppGpp and ppGpp were detectable in the wildtype under stringent conditions, with higher concentrations ofpppGpp than of ppGpp. The addition of mupirocin elicited a

FIG. 2. RSH-dependent (p)ppGpp synthesis after amino acid deprivation. (A and B) 32P-labeled nucleotides of formic acid extracts of S. aureuswere detected by thin-layer chromatography. Strain HG001 (WT) and the rshsyn mutant were grown to exponential phase, followed by the additionof mupirocin (0.5 �g/ml) (A) or by Leu/Val starvation (B). (C) Measurement of intracellular nucleotide pool by LC-MS of S. aureus extracts before(zero minutes [0]) and 30 min after mupirocin (0.5 �g/ml) treatment or Leu/Val downshift (�Leu/Val). The level of significance was determinedby the two-sided Student’s t test (P 0.05).



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

higher (p)ppGpp synthesis rate than did Leu/Val deprivation.In contrast, neither of the inducing conditions resulted in anincrease of (p)ppGpp in the rshsyn mutant. This confirmed thehypothesis that the synthase domain is indeed nonfunctional inthe rshsyn mutant. A slight spot corresponding to ppGpp wasdetectable in the rshsyn mutant by TLC analysis. In LC-MS, aweak signal of ppGpp was also detectable in the rsh mutantunder stringent conditions, which might be derived from theactivity of RelP and/or RelQ.

As expected, a significant decrease in GTP levels was ob-served after the induction of both stringent conditions in thewild type only and was thus clearly related to the pppGppsynthase activity of RSH.

The nucleotide analysis showed that RSH is the major en-zyme responsible for the stringent response under amino acid-limited conditions induced by either the addition of mupirocinor Leu/Val deprivation. The response is characterized by syn-thesis of (p)ppGpp and a decrease of the intracellular GTPpool.

RSH synthase is important for adaptation to mupirocintreatment and Leu/Val deprivation. Since RSH is clearly re-sponsible for (p)ppGpp synthesis under conditions of aminoacid deprivation, it was of interest whether the growth of thershsyn mutant was affected under such conditions. First, wetested resistance toward mupirocin. Mupirocin acts as a potentinhibitor of Ile-tRNA synthetase and, as such, mimics isoleu-cine starvation. rshsyn mutants of strains Newman and HG001,respectively, were both shown to be more sensitive towardmupirocin than the wild types, with up to 4-fold decreases ofthe MICs and MBCs (Table 3). There was no difference be-tween the rshsyn mutants and the wild types with regard tosensitivity toward other classes of antibiotics (vancomycin andciprofloxacin) not involved in amino acid availability (data notshown).

We next monitored growth in CDM lacking single aminoacids. Without Leu/Val, S. aureus strains were strongly inhib-ited in growth. To test whether RSH is important for survivalunder these conditions, CFU were determined at the timepoints indicated in Fig. 3. In medium lacking Leu/Val, thershsyn mutant showed a significant reduction of CFU/ml com-pared to the growth of the wild type after 24 h; whereas a slightincrease in CFU was observed for the wild type, only 4% ofinoculated mutant bacteria were reculturable. Of note, therewas no significant drop in the OD600 after 24 h for the rshsyn

mutant. This indicates that RSH-dependent (p)ppGpp synthe-sis is required for bacterial survival under conditions of nutri-ent limitation.

RSH-dependent repression of target genes after Leu/Valdeprivation. Mupirocin treatment and Leu/Val deprivation re-sulted in the stringent response as indicated by (p)ppGpp syn-thesis via RSH. This is most probably accompanied by a spe-cific modulation of the transcription of at least some genes. Weselected a subset of genes which are hallmarks of the stringentcontrol in other bacteria (15, 26) and were shown in microarrayanalysis to be repressed in S. aureus after the addition ofmupirocin (2). We chose to induce the stringent response viaLeu/Val deprivation since this may be a more physiologicalcondition than mupirocin treatment. Northern blot analysisrevealed that transcription of infB (coding for translation ini-tiation factor IF-2), guaC (coding for GMP reductase), rpsL(coding for ribosomal protein S12), and tsf (coding for trans-lation elongation factor Ts) was markedly decreased after 30min of Leu/Val deprivation in the wild type but not in the rshsyn

mutant (Fig. 4). The integration of a complete rsh gene into thechromosome of the rshsyn mutant restored the wild-type phe-notype (Fig. 4, last lane). Thus, repression of the selectedgenes after Leu/Val downshift is clearly dependent on RSHsynthase activity.

RSH-dependent activation of CodY-repressed genes afterLeu/Val deprivation. An interaction between CodY and thestringent response was shown in several other firmicutes (4, 24,33). In S. aureus, several of the genes which were found to berepressed by CodY (45) also appeared to be upregulated aftermupirocin treatment (2). For further analysis, we selected 4operons of the CodY regulon which are preceded by apredicted CodY binding motif: the prototypic ilvDBC-leuABC-ilvA operon and ilvE coding for enzymes essentialfor branched-chain amino acid biosynthesis, brnQ1 codingfor a branched-chain amino acid permease, and SAOUHSC_02932 coding for a putative amino acid permease. All 4 operonswere clearly upregulated after Leu/Val deprivation in the wildtype and the rsh-complemented strain but not in the rshsyn mutantstrain (Fig. 5).

The ongoing repression of the selected genes in the rshsyn

mutant is clearly CodY dependent since, in a codY mutant, as well

FIG. 3. Growth and survival of strain HG001 (square) and thershsyn mutant (triangle) after amino acid deprivation. Bacteria weregrown in CDM to exponential phase (OD600 � 0.5) and shifted intomedium with (closed symbols) and without Leu/Val (open symbols).CFU were determined at indicated time points. Values are expressedin relation to the initial CFU before shifting the bacteria.

TABLE 3. MICs and MBCs of mupirocina

Strain24 h 48 h

MIC MBC MIC MBC

Newman 0.32 0.625 0.32 0.625Newman rshsyn 0.08 0.32 0.16 0.32HG001 0.32 0.625 0.625 1.25HG001 rshsyn 0.08 0.32 0.32 0.32

a Results (�g/ml) are the means of three independent experiments. MIC andMBC were determined in microtiter plates after incubation for 24 h and 48 h at37°C.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

as in a codY rshsyn double mutant, these genes are derepressedunder all conditions (shown for SAOUHSC_02932) (Fig. 6). Incontrast, RSH-repressed genes appeared to be independent ofthe CodY background, as exemplified by the results for infB.

RSH-independent effects of mupirocin and Leu/Val depri-vation on virulence regulators. In other pathogens, it wasshown that the stringent control is tightly linked with otherregulatory pathways involved in virulence gene expression (18).Thus, we extended our analysis to include the influence of thestringent control on the expression of major virulence regula-tors, namely, the regulatory RNA III encoded in the quorumsensing system agr, the two-component system saePQRS, andthe transcription factor sarA. All three virulence regulatorsappeared to be upregulated in the wild type and in rshsyn

mutants after mupirocin treatment for 30 min (Fig. 7). The

FIG. 4. RSH-dependent repression of target genes. Strain HG001(WT), the rshsyn mutant, and the mutant complemented with rsh inte-grated into the chromosome (compl) were grown in CDM to theexponential growth phase (OD600 � 0.5), followed by further incuba-tion in medium with (�) or without (�) Leu/Val. RNA was hybridizedwith digoxigenin-labeled PCR fragments. The 16S rRNA detected inthe ethidium bromide-stained gels as a loading control is indicated atthe bottom.

FIG. 5. RSH-dependent upregulation of target genes. Strain HG001(WT), the rshsyn mutant, and the complemented mutant (compl) weregrown in CDM to the exponential growth phase (OD600 � 0.5), followedby further incubation in medium with (�) or without (�) Leu/Val. RNAwas hybridized with digoxigenin-labeled PCR fragments. The 16S rRNAdetected in the ethidium bromide-stained gels as a loading control isindicated at the bottom.

FIG. 6. RSH interaction with CodY regulation. Strain HG001(WT), the rshsyn mutant, the complemented rshsyn mutant (compl), thecodY mutant, and rshsyn codY double mutants were grown in CDM tothe exponential growth phase (OD600 � 0.5), followed by furtherincubation in medium with (�) or without (�) Leu/Val. RNA washybridized with digoxigenin-labeled PCR fragments. The 16S rRNAdetected in the ethidium bromide-stained gels as a loading control isindicated at the bottom.

FIG. 7. RSH-independent influence of mupirocin on virulenceregulators. Strain HG001, strain Newman, and their correspondingrshsyn mutants were grown in CYPG to the exponential growthphase (OD600 � 0.5), followed by the addition of mupirocin (0.5�g/ml) for 30 min. RNA was hybridized with digoxigenin-labeledPCR fragments. The 16S rRNA detected in the ethidium bromide-stained gels as a loading control is indicated at the bottom.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

elevated levels of transcription of sarA after mupirocin treat-ment were even more pronounced in the rshsyn mutants. Theseresults indicate that the stimulating effects of mupirocin onvirulence regulatory loci are largely independent of (p)ppGppsynthesis via RSH.

We next analyzed whether induction of the stringent re-sponse via Leu/Val deprivation has an effect similar to that ofmupirocin addition (Fig. 8A). In fact, enhanced sarA and saetranscription was observed in the wild type, as well as in the rshmutant, after shifting the bacteria into medium lacking Leu/Val for 30 min.

We hypothesized that the rsh-independent effects on sae andsarA transcript levels under stringent conditions may be due totranscript stabilization rather than to promoter activation.Therefore, we determined transcript stabilities by treatmentwith rifampin, an antibiotic which inhibits the de novo synthesisof RNA. Strains at the exponential growth phase were shiftedinto medium with and without Leu/Val or mupirocin andgrown for a further 30 min. Then, rifampin (500 �g/ml) wasadded to the cultures for the times indicated in Fig. 8B.

We could confirm that, for instance, the sarA-encoding tran-scripts are stabilized after Leu/Val downshift (Fig. 8B). Asimilar stabilization of transcripts was observed after mupiro-cin treatment (data not shown), which is consistent with theresults of Anderson et al. (2).

Interaction of rsh and codY for virulence of S. aureus in ananimal model. The role of the RSH-mediated stringent re-sponse and CodY regulation for virulence was investigated ina hematogenic kidney abscess model with S. aureus HG001, thershsyn mutant, a codY deletion mutant, and an rshsyn codYdouble mutant (Fig. 9). Mice were challenged with 3 � 107

CFU via the tail vein. The body weight of the mice was fol-lowed over time, and bacterial loads in kidneys were deter-mined 5 days after infection. Our analysis revealed a signifi-cantly lower virulence of the rshsyn mutant than of the wild type(P 0.01). In contrast, there was no significant differencebetween the virulence of the codY mutant or the codY rshsyn

double mutant compared to that of the wild type. Similarly,body weight decreased significantly (P 0.01) in mice chal-

lenged with the wild type, in contrast to those challenged withthe rshsyn mutant (data not shown). Histological analysis ofmice challenged with the wild type or the codY rshsyn doublemutant showed localized bacteria and infiltrated polymorpho-nuclear leukocytes in the renal cortex and also in the medulla/papilla of the kidney (Fig. 10A and B). In both cases, the tissueshows typical signs of hematogenous (pyelo) nephritis. In micechallenged with the rshsyn mutant, the bacterial load was belowthe detection limit and no polymorphonuclear neutrophilicleukocyte infiltration was observed (Fig. 10C).

DISCUSSION

In the work presented here, we could confirm previous ob-servations (16) that the bifunctional enzyme RSH is essentialfor the growth of S. aureus. This is a peculiarity of S. aureussince, in other firmicutes, rsh mutants are viable and have beenemployed to decipher the basic mechanisms of the stringentcontrol in those organisms (1, 4, 26, 31, 38, 49, 54). The essen-tiality of RSH in S. aureus is due to its hydrolase activity, sincemutants in which only the synthase domain of RSH was inac-tivated remain viable. This led to the hypothesis that other(p)ppGpp synthases in addition to RSH are active in S. aureus

FIG. 8. RSH-independent influence of Leu/Val downshift on virulence regulators is due to enhanced transcript stability. (A) Strain HG001(WT) and the rshsyn mutant were grown in CDM to the exponential growth phase (OD600 � 0.5), followed by further incubation in medium with(�) or without (�) Leu/Val. (B) Bacteria were grown as described for panel A, followed by the addition of rifampin (500 �g/ml) for the indicatedtimes (min). RNA was hybridized with digoxigenin-labeled PCR fragments. The 16S rRNA detected in the ethidium bromide-stained gels as aloading control is indicated at the bottom.

FIG. 9. Role of RSH in kidney infection model. BALB/c mice (n �5) were inoculated with 3 � 107 CFU of S. aureus strain HG001 (WT),the rshsyn mutant, a codY mutant, or a codY rshsyn double mutant.Bacterial loads in the kidneys were determined as CFU/organ. The barin each column represents the median CFU count per kidney.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

and that RSH is required to hydrolyze these molecules toprevent a toxic accumulation. (p)ppGpp is probably synthe-sized by one or both of two additional enzymes (RelP andRelQ) with putative (p)ppGpp synthase activity encoded in thegenome of S. aureus. They are highly homologous to enzymesalready shown to contribute to (p)ppGpp synthesis in otherorganisms (32, 41) However, RSH is clearly the main enzymerequired for (p)ppGpp synthesis after amino acid deprivationin S. aureus. This could be shown by the addition of mupirocinor by shifting bacterial cultures into medium lacking Leu/Val.Both conditions resulted in detectable synthesis of pppGppand ppGpp within 30 min of induction in the wild type but notin the rshsyn mutant. Under these conditions, the small proteinsRelP and RelQ do not contribute significantly to the stringentresponse. However, it is conceivable that they are responsiblefor the baseline level of ppGpp observed in the rshsyn mutant(Fig. 2) and that they are important under different stressconditions.

In contrast to rsh deletion strains, the RSH synthase mutantsof S. aureus strain HG001 or Newman, respectively, were notimpaired in growth under nutrient-rich conditions. However,the RSH synthase mutants certainly showed a higher sensitivitytoward mupirocin than the wild type, similar to relA mutants ofE. coli (5) or Streptococcus pneumoniae (26). One could spec-

ulate that the upregulation of genes involved in isoleucinebiosynthesis observed in the wild type but not in the rshsyn

mutant results in an increased intracellular isoleucine level.Isoleucine can antagonize mupirocin, thereby increasing theMIC of mupirocin in S. aureus (55). Additionally, the rshsyn

mutant was not able to survive conditions of amino acid de-privation, indicated by a decrease of CFU. The lethality of thershsyn mutant during amino acid limitation may be due to theinability of the strain to stop replication. It was proposed byWang et al. (53) that rapid replication arrest mediated by(p)ppGpp helps to maintain genomic stability by preventingdeleterious consequences associated with continuous replica-tion in starved cells.

We employed the rshsyn mutants to gain insights into thestringent response to amino acid starvation in S. aureus. Weshow that mupirocin and Leu/Val deprivation have a similarimpact on the mRNA levels of most of the genes analyzed.Only part of the response is mediated via RSH-driven(p)ppGpp synthesis since, for instance, higher levels of mRNAencoding major virulence regulators (RNA III, SaeRS, and SarA)were seen in the wild type, as well as in the rshsyn mutants, aftermupirocin treatment (Fig. 7). These effects are probably due tostabilization of the transcripts under conditions in which trans-lation is impaired. It was proposed that ribosome stalling after

FIG. 10. Thin sections of hematoxylin and eosin-stained mouse kidney tissues 5 days after i.v. challenge with WT S. aureus (A), the rshsyn codYmutant (B), or the rshsyn mutant (C). Bacteria appear brown due to peroxidase-labeled protein A. Microabscesses in the kidney were detected inthe cortex (A1 and B1, arrows) and medulla (A2 and B2). Magnification of abscesses of the medulla is shown in panels A3 and B3. Polymor-phonuclear neutrophilic leukocyte infiltration of the renal pelvis is indicated in panel B2 (arrow). In kidneys of mice challenged with the rshsynmutant (C1 and C2), the bacterial load was below the detection limit and no signs of infection were detectable.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

binding of uncharged tRNA to the A site affects the lifetime ofbacterial mRNA. Ribosomes associated with mRNA act asprotective barriers and influence the susceptibility of mRNA toRNase attack (11). These ribosomes mask internal endonucle-ase cleavage sites and, additionally, blockade the 5 end, whichcan impede access to internal endonuclease cleavage sites.Transcript stabilization after mupirocin treatment seems toaffect different mRNA species to different degrees (2) and mayhave a regulatory function. Whether higher mRNA levels ofthe regulatory loci are paralleled by increased protein expres-sion and higher target gene expression remains to be deter-mined.

Besides the RSH synthase-independent effects on transcriptstabilization, amino acid deprivation also results in RSH syn-thase-driven (p)ppGpp synthesis, which is accompanied by re-pression of genes involved in ribosomal turnover and transla-tion and activation of genes involved in amino acid metabolismand transport. This coordinated gene expression probably al-lows the pathogen to adapt to starvation environments, such asthose encountered during certain stages of infection. In otherpathogens, (p)ppGpp-dependent activation of virulence genesis mediated by regulatory proteins, such as Sigma factors ortranscription factors (4, 17, 24, 33, 44, 46). Here, we focused onthe analysis of genes belonging to the previously characterizedCodY regulon of S. aureus (45). Stringent conditions evoked byLeu/Val deprivation clearly resulted in the derepression ofCodY-regulated genes in S. aureus. For these genes, mutationof codY has an opposing and dominant effect compared to thatof rsh mutation. In line with the assumption that induction ofthe stringent control results in derepression of CodY targetgenes, a codY rshsyn double mutant expressed CodY targetgenes under noninduced conditions.

Analysis of CodY in several firmicutes has shown that bind-ing of branched-chain amino acids and/or GTP to CodY resultsin the repression of target gene promoters. In S. aureus, adecreased GTP pool was observed under stringent conditions(Fig. 2C). For B. subtilis (21, 34) and Listeria monocytogenes(4), a direct link between the GTP drop and derepression ofCodY target genes was demonstrated. Whether stringent con-ditions also influence the intracellular isoleucine pool remainsto be determined. Previously, we showed that isoleucine isnecessary and sufficient for the repression of CodY targetgenes in S. aureus (45). Of note, in S. mutans, there was also aclear link between the stringent response and CodY which wasshown to be independent of variations in the GTP level.

A regulatory link between the stringent control and CodYduring infection was recently demonstrated for L. monocyto-genes (4), with results very similar to those for S. aureus. Inboth organisms, an rsh mutant was clearly attenuated in ananimal model of infection, whereas additional codY mutationrestored virulence in both organisms. Thus, the attenuation ofthe rsh mutant could be due at least in part to ongoing repres-sion of CodY-regulated genes under condition which wouldresult in derepression in the wild type. The expression of thesegenes is obviously relevant for virulence. In the model appliedhere, the bacteria are usually efficiently cleared within thebloodstream. Some bacteria can reach the kidney, where theymultiply and persist. One may assume that the bacteria thereencounter an amino acid limitation which evokes the stringentcontrol. Under such conditions, (p)ppGpp may be essential not

only for growth but also for survival. The survival of the rshsyn

mutant under in vivo conditions may be diminished, as wasshown in vitro, under conditions of amino acid deprivation.

ACKNOWLEDGMENTS

We thank Vittoria Bisanzio for excellent technical assistance.The work was supported by grants to C.W. and K.O. from the

Deutsche Forschungsgemeinschaft TR34. M. Liebeke was the recipi-ent of a fellowship from the Alfried Krupp von Bohlen und Halbach-Stiftung Foundation Functional Genomics Approach in Infection Bi-ology program.

REFERENCES

1. Abranches, J., A. R. Martinez, J. K. Kajfasz, V. Chavez, D. A. Garsin, andJ. A. Lemos. 2009. The molecular alarmone (p)ppGpp mediates stress re-sponses, vancomycin tolerance, and virulence in Enterococcus faecalis. J.Bacteriol. 191:2248–2256.

2. Anderson, K. L., C. Roberts, T. Disz, V. Vonstein, K. Hwang, R. Overbeek,P. D. Olson, S. J. Projan, and P. M. Dunman. 2006. Characterization of theStaphylococcus aureus heat shock, cold shock, stringent, and SOS responsesand their effects on log-phase mRNA turnover. J. Bacteriol. 188:6739–6756.

3. Bae, T., and O. Schneewind. 2006. Allelic replacement in Staphylococcusaureus with inducible counter-selection. Plasmid 55:58–63.

4. Bennett, H. J., D. M. Pearce, S. Glenn, C. M. Taylor, M. Kuhn, A. L.Sonenshein, P. W. Andrew, and I. S. Roberts. 2007. Characterization of relAand codY mutants of Listeria monocytogenes: identification of the CodYregulon and its role in virulence. Mol. Microbiol. 63:1453–1467.

5. Beyer, D., H. P. Kroll, R. Endermann, G. Schiffer, S. Siegel, M. Bauser, J.Pohlmann, M. Brands, K. Ziegelbauer, D. Haebich, C. Eymann, and H.Brotz-Oesterhelt. 2004. New class of bacterial phenylalanyl-tRNA synthetaseinhibitors with high potency and broad-spectrum activity. Antimicrob.Agents Chemother. 48:525–532.

6. Braeken, K., M. Moris, R. Daniels, J. Vanderleyden, and J. Michiels. 2006.New horizons for (p)ppGpp in bacterial and plant physiology. Trends Mi-crobiol. 14:45–54.

7. Bruckner, R. 1997. Gene replacement in Staphylococcus carnosus andStaphylococcus xylosus. FEMS Microbiology Lett. 151:1–8.

8. Cashel, M. 1975. Regulation of bacterial ppGpp and pppGpp. Annu. Rev.Microbiol. 29:301–318.

9. Cassels, R., B. Oliva, and D. Knowles. 1995. Occurrence of the regulatorynucleotides ppGpp and pppGpp following induction of the stringent re-sponse in staphylococci. J. Bacteriol. 177:5161–5165.

10. Chatterji, D., and A. K. Ojha. 2001. Revisiting the stringent response, ppGppand starvation signaling. Curr. Opin. Microbiol. 4:160–165.

11. Deana, A., and J. G. Belasco. 2005. Lost in translation: the influence ofribosomes on bacterial mRNA decay. Genes Dev. 19:2526–2533.

12. den Hengst, C. D., P. Curley, R. Larsen, G. Buist, A. Nauta, D. van Sinderen,O. P. Kuipers, and J. Kok. 2005. Probing direct interactions between CodYand the oppD promoter of Lactococcus lactis. J. Bacteriol. 187:512–521.

13. Donat, S., K. Streker, T. Schirmeister, S. Rakette, T. Stehle, M. Liebeke, M.Lalk, and K. Ohlsen. 2009. Transcriptome and functional analysis of theeukaryotic-type serine/threonine kinase PknB in Staphylococcus aureus. J.Bacteriol. 191:4056–4069.

14. Duthie, E. S., and L. L. Lorenz. 1952. Staphylococcal coagulase: mode ofaction and antigenicity. J. Gen. Microbiol. 6:95–107.

15. Eymann, C., G. Homuth, C. Scharf, and M. Hecker. 2002. Bacillus subtilisfunctional genomics: global characterization of the stringent response byproteome and transcriptome analysis. J. Bacteriol. 184:2500–2520.

16. Gentry, D., T. Li, M. Rosenberg, and D. McDevitt. 2000. The rel gene isessential for in vitro growth of Staphylococcus aureus. J. Bacteriol. 182:4995–4997.

17. Gentry, D. R., V. J. Hernandez, L. H. Nguyen, D. B. Jensen, and M. Cashel.1993. Synthesis of the stationary-phase sigma factor sigma s is positivelyregulated by ppGpp. J. Bacteriol. 175:7982–7989.

18. Godfrey, H. P., J. V. Bugrysheva, and F. C. Cabello. 2002. The role of thestringent response in the pathogenesis of bacterial infections. Trends Micro-biol. 10:349–351.

19. Gralla, J. D. 2005. Escherichia coli ribosomal RNA transcription: regulatoryroles for ppGpp, NTPs, architectural proteins and a polymerase-bindingprotein. Mol. Microbiol. 55:973–977.

20. Guedon, E., P. Serror, S. D. Ehrlich, P. Renault, and C. Delorme. 2001.Pleiotropic transcriptional repressor CodY senses the intracellular pool ofbranched-chain amino acids in Lactococcus lactis. Mol. Microbiol. 40:1227–1239.

21. Handke, L. D., R. P. Shivers, and A. L. Sonenshein. 2008. Interaction ofBacillus subtilis CodY with GTP. J. Bacteriol. 190:798–806.

22. Hendriksen, W. T., H. J. Bootsma, S. Estevao, T. Hoogenboezem, A. de Jong,R. de Groot, O. P. Kuipers, and P. W. Hermans. 2008. CodY of Streptococcus



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

pneumoniae: link between nutritional gene regulation and colonization. J.Bacteriol. 190:590–601.

23. Hogg, T., U. Mechold, H. Malke, M. Cashel, and R. Hilgenfeld. 2004. Con-formational antagonism between opposing active sites in a bifunctionalRelA/SpoT homolog modulates (p)ppGpp metabolism during the stringentresponse. Cell 117:57–68.

24. Inaoka, T., and K. Ochi. 2002. RelA protein is involved in induction ofgenetic competence in certain Bacillus subtilis strains by moderating the levelof intracellular GTP. J. Bacteriol. 184:3923–3930.

25. Jain, V., M. Kumar, and D. Chatterji. 2006. ppGpp: stringent response andsurvival. J. Microbiol. 44:1–10.

26. Kazmierczak, K. M., K. J. Wayne, A. Rechtsteiner, and M. E. Winkler. 2009.Roles of rel in stringent response, global regulation and virulence of serotype2 Streptococcus pneumoniae D39. Mol. Microbiol. 72:590–611.

27. Krasny, L., and R. L. Gourse. 2004. An alternative strategy for bacterialribosome synthesis: Bacillus subtilis rRNA transcription regulation. EMBO J.23:4473–4483.

28. Krasny, L., H. Tiserova, J. Jonak, D. Rejman, and H. Sanderova. 2008. Theidentity of the transcription �1 position is crucial for changes in geneexpression in response to amino acid starvation in Bacillus subtilis. Mol.Microbiol. 69:42–54.

29. Kreiswirth, B. N., S. Lofdahl, M. J. Betley, M. O’Reilly, P. M. Schlievert,M. S. Bergdoll, and R. P. Novick. 1983. The toxic shock syndrome exotoxinstructural gene is not detectably transmitted by a prophage. Nature 305:709–712.

30. Lee, C. Y., S. L. Buranen, and Z. H. Ye. 1991. Construction of single-copyintegration vectors for Staphylococcus aureus. Gene 103:101–105.

31. Lemos, J. A., T. A. Brown, Jr., and R. A. Burne. 2004. Effects of RelA on keyvirulence properties of planktonic and biofilm populations of Streptococcusmutans. Infect. Immun. 72:1431–1440.

32. Lemos, J. A., V. K. Lin, M. M. Nascimento, J. Abranches, and R. A. Burne.2007. Three gene products govern (p)ppGpp production by Streptococcusmutans. Mol. Microbiol. 65:1568–1581.

33. Lemos, J. A., M. M. Nascimento, V. K. Lin, J. Abranches, and R. A. Burne.2008. Global regulation by (p)ppGpp and CodY in Streptococcus mutans. J.Bacteriol. 190:5291–5299.

34. Levdikov, V. M., E. Blagova, V. L. Colledge, A. A. Lebedev, D. C. Williamson,A. L. Sonenshein, and A. J. Wilkinson. 2009. Structural rearrangementaccompanying ligand binding in the GAF domain of CodY from Bacillussubtilis. J. Mol. Biol. 390:1007–1018.

35. Magnusson, L. U., A. Farewell, and T. Nystrom. 2005. ppGpp: a globalregulator in Escherichia coli. Trends Microbiol. 13:236–242.

36. Mainiero, M., C. Goerke, T. Geiger, C. Gonser, S. Herbert, and C. Wolz.2010. Differential target gene activation by the Staphylococcus aureus two-component system saeRS. J. Bacteriol. 192:613–623.

37. Majerczyk, C. D., M. R. Sadykov, T. T. Luong, C. Lee, G. A. Somerville, andA. L. Sonenshein. 2008. Staphylococcus aureus CodY negatively regulatesvirulence gene expression. J. Bacteriol. 190:2257–2265.

38. Mechold, U., M. Cashel, K. Steiner, D. Gentry, and H. Malke. 1996. Func-tional analysis of a relA/spoT gene homolog from Streptococcus equisimilis. J.Bacteriol. 178:1401–1411.

39. Mechold, U., H. Murphy, L. Brown, and M. Cashel. 2002. Intramolecularregulation of the opposing (p)ppGpp catalytic activities of Rel(Seq), theRel/Spo enzyme from Streptococcus equisimilis. J. Bacteriol. 184:2878–2888.

39a.Mayer, H., M. Liebeke, and M. Lalk. 2010. A protocol for the investigation

of the intracellular Staphylococcus aureus metabolome. Anal. Biochem.[Epub ahead of print.] doi:10.1016/j.ab.2010.03.003.

40. Mittenhuber, G. 2001. Comparative genomics and evolution of genes encod-ing bacterial (p)ppGpp synthetases/hydrolases (the Rel, RelA and SpoTproteins). J. Mol. Microbiol. Biotechnol. 3:585–600.

41. Nanamiya, H., K. Kasai, A. Nozawa, C. S. Yun, T. Narisawa, K. Murakami,Y. Natori, F. Kawamura, and Y. Tozawa. 2008. Identification and functionalanalysis of novel (p)ppGpp synthetase genes in Bacillus subtilis. Mol. Micro-biol. 67:291–304.

42. Natori, Y., K. Tagami, K. Murakami, S. Yoshida, O. Tanigawa, Y. Moh, K.Masuda, T. Wada, S. Suzuki, H. Nanamiya, Y. Tozawa, and F. Kawamura.2009. Transcription activity of individual rrn operons in Bacillus subtilismutants deficient in (p)ppGpp synthetase genes, relA, yjbM, and ywaC. J.Bacteriol. 191:4555–4561.

43. Novick, R. P. 1991. Genetic systems in staphylococci. Methods Enzymol.204:587–636.

44. Pizarro-Cerda, J., and K. Tedin. 2004. The bacterial signal molecule, ppGpp,regulates Salmonella virulence gene expression. Mol. Microbiol. 52:1827–1844.

45. Pohl, K., P. Francois, L. Stenz, F. Schlink, T. Geiger, S. Herbert, C. Goerke,J. Schrenzel, and C. Wolz. 2009. CodY in Staphylococcus aureus: a regulatorylink between metabolism and virulence gene expression. J. Bacteriol. 191:2953–2963.

46. Potrykus, K., and M. Cashel. 2008. (p)ppGpp: still magical? Annu. Rev.Microbiol. 62:35–51.

47. Sonenshein, A. L. 2005. CodY, a global regulator of stationary phase andvirulence in Gram-positive bacteria. Curr. Opin. Microbiol. 8:203–207.

48. Srivatsan, A., and J. D. Wang. 2008. Control of bacterial transcription,translation and replication by (p)ppGpp. Curr. Opin. Microbiol. 11:100–105.

49. Steiner, K., and H. Malke. 2000. Life in protein-rich environments: therelA-independent response of Streptococcus pyogenes to amino acid starva-tion. Mol. Microbiol. 38:1004–1016.

50. Tojo, S., T. Satomura, K. Kumamoto, K. Hirooka, and Y. Fujita. 2008.Molecular mechanisms underlying the positive stringent response of theBacillus subtilis ilv-leu operon, involved in the biosynthesis of branched-chainamino acids. J. Bacteriol. 190:6134–6147.

51. Vagner, V., E. Dervyn, and S. D. Ehrlich. 1998. A vector for systematic geneinactivation in Bacillus subtilis. Microbiology 144(Pt. 11):3097–3104.

52. Wagner, R. 2002. Regulation of ribosomal RNA synthesis in E. coli: effectsof the global regulator guanosine tetraphosphate (ppGpp). J. Mol. Micro-biol. Biotechnol. 4:331–340.

53. Wang, J. D., G. M. Sanders, and A. D. Grossman. 2007. Nutritional controlof elongation of DNA replication by (p)ppGpp. Cell 128:865–875.

54. Wendrich, T. M., and M. A. Marahiel. 1997. Cloning and characterization ofa relA/spoT homologue from Bacillus subtilis. Mol. Microbiol. 26:65–79.

55. Wilson, J. M., B. Oliva, R. Cassels, P. J. O’hanlon, and I. Chopra. 1995.Sb-205952, a novel semisynthetic monic acid analog with at least two modesof action. Antimicrob. Agents Chemother. 39:1925–1933.

56. Wolz, C., T. Geiger, and C. Goerke. 2010. The synthesis and function of thealarmone (p)ppGpp in firmicutes. Int. J. Med. Microbiol. 300:142–147.

57. Wu, J., and J. Xie. 2009. Magic spot: (p)ppGpp. J. Cell. Physiol. 220:297–302.58. Xiao, H., M. Kalman, K. Ikehara, S. Zemel, G. Glaser, and M. Cashel. 1991.

Residual guanosine 3,5-bispyrophosphate synthetic activity of relA nullmutants can be eliminated by spoT null mutations. J. Biol. Chem. 266:5980–5990.

Editor: A. J. Baumler



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Role of the (p)ppGpp Synthase RSH, a RelA/SpoT Homolog, in ...

Documents

Transcript of Role of the (p)ppGpp Synthase RSH, a RelA/SpoT Homolog, in ...