Biochimica et Biophysica Acta 1784 (2008) 1310–1318

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta

j ourna l homepage: www.e lsev ie r.com/ locate /bbapap

Role of the 88–97 loop in plasminogen activation by streptokinase probed throughsite-specific mutagenesis

Suman Yadav, Manish Datt, Balvinder Singh, Girish Sahni ⁎Institute of Microbial Technology (C.S.I.R), Sector 39-A, Chandigarh-160036, India

Abbreviations: μPG, microplasminogen; μPN, micralbumin; CD, circular dichroism; DEAE-Sepharose, diethyɛ-aminocaproic acid; EDC, N′-ethylcarbodiimide; HPGhuman plasmin; IBs, inclusion bodies; IPTG, isopropyl-kcat, rate of catalysis; Kd, equilibrium rate constant; Km

koff, rate of dissociation; kon, rate of association; MDS, mNHS, N-hydroxysuccinimide; NPGB, p-nitrophenyl p-gulike streptokinase; PAGE, polyacrylamide gel electrophosaline; RMSD, root mean square deviation; SAK, staphysulphate; SK, streptokinase; SOE-PCR, splicing overlapreaction; SPR, surface plasmon resonance; STI, soybeanplasminogen activator; UK, Urokinase⁎ Corresponding author. Fax: +91 172 2690585.

E-mail address: sahni@imtech.res.in (G. Sahni).

1570-9639/$ – see front matter © 2008 Elsevier B.V. Aldoi:10.1016/j.bbapap.2008.05.013

a b s t r a c t

a r t i c l e i n f o

Article history:

The role of a prominent su Received 6 February 2008Received in revised form 20 May 2008Accepted 20 May 2008Available online 6 June 2008

Keywords:StreptokinaseHuman plasminogen activationPlasminogen activatorProtein–protein interactionEnzyme–substrate interaction

rface-exposed loop (residues 88–97) in the α domain of streptokinase (SK), inhuman plasminogen (HPG) activation was explored through its selective mutagenesis and deletion studies.We first made a conformationally constrained derivative of the loop by the substitution of sequences knownto possess a strong propensity for β-turn formation. The mutant so formed (termed SK88–97-Beta Turn), whentested for co-factor activity against substrate HPG, after first forming a 1:1 molar complex with humanplasmin (HPN), showed a nearly 6-fold decreased co-factor activity compared to the wild-type, native SK. Themajor catalytic change was observed to be at the kcat level, with relatively minor changes in Km values againstHPG. Real-time binary interaction (i.e. the 1:1 complexation between SK, or its mutant/s, with HPG), andternary complexation studies (i.e. the docking of a substrate HPG molecule into the preformed SK–HPGcomplex) using Surface Plasmon Resonance were done. These studies revealed minor alterations in binarycomplex formation but the ternary interactions of the substitution and/or deletion mutants were found to bedecreased for full-length HPG compared to that for native SK.HPG. In contrast, their ternary interactions withthe isolated five-kringle domain unit of plasminogen (K1–5) showed Kd values comparable to that seen withthe native SK.HPG complex. Taking into consideration the overall alterations observed in catalytic levels aftersite-specific mutagenesis and complete loop deletion of the 88–97 loop, on the one hand, and its knownposition at the SK–HPG interface in the binary complex, suggests the importance of this loop. The presentresults suggest that the 88–97 loop of the α domain of SK contributes towards catalytic turn-over, eventhough its individual contribution towards enzyme–substrate affinity per se is minimal.

© 2008 Elsevier B.V. All rights reserved.

1. Introduction

Plasminogen activation is a key fibrinolytic step in hemostasis thatresults in the dissolution of blood clots [1,2]. The plasma protein HPGis a multi-domain protein that comprises a pre-activation peptide,followed by five-kringle domains, termed K1–5 from the N-terminusonwards, and a catalytic C-terminal serine protease domain [3]. Thephysiological plasminogen activators e.g. tissue plasminogen activator

oplasmin; BSA, bovine serumlaminoethyl-Sepharose; EACA,, human plasminogen; HPN,1-thio-β-D-galactopyranoside;, michaelis-menton constant;

olecular dynamics simulations;anidinobenzoate; nSK, native-resis; PBS, phosphate bufferedlokinase; SDS, sodium dodecylextension-polymerase chaintrypsin inhibitor; tPA, tissue

l rights reserved.

(tPA) and Urokinase (UK) are serine proteases, that directly cleaves thescissile peptide bond of HPG converting it into its active form, Plasmin(HPN). Some invasive human pathogens have also evolved PGactivators, such as Streptokinase (SK) and SAK [1,4]. These bacterialactivators, unlike the physiological activators, are not enzymes but areprotein “co-factors” that possess the ability to tightly bind to HPG (orits activated form, HPN), thus creating co-factor-protease binarycomplexes (SK.HPG or SK.HPN) that can catalytically convert other,substrate, molecules of HPG to the activated protease, plasmin [5,6].Amongst the clinically relevant HPG activators, SK, which is secretedby several species of β-hemolytic streptococci, has evoked keenscientific interest [7] because of its widespread use as an affordable“clot-buster” drug for the treatment of various circulatory disorders,including myocardial infarction [8]. Because of the ever-increasingincidence of cardiac maladies throughout the world, a major effort isbeing expended at elucidating detailed structure–function knowledgeon SK with a view to exploit this knowledge to evolve improvedthrombolytic protein drugs [9].

SK is a single polypeptide chain of 414 residues, organized intothree structurally similar, independently folding domains (termed α,β and γ) separated by two coiled coils [10,11]. SK forms a tightstoichiometric complex with either HPG or HPN, rapidly induces the

1311S. Yadav et al. / Biochimica et Biophysica Acta 1784 (2008) 1310–1318

formation of an active center in the zymogen and modifies thesubstrate specificity of the ‘partner’ plasmin active site (a non-specificprotease, when not complexed with SK, and a protease that cannot byitself activate HPG), and thereby acquires the ability to act almostexclusively on HPG as its protein substrate [1,12–14]. The molecularmechanism underlying this dramatic alteration in substrate specificityof plasmin upon SK binding has been intensely studied since it hasimplications with respect to both fundamental enzyme specificitymechanisms as well as for engineering of new target specificities inbio-medically useful reactions. The crystal structure of SK complexedwith μPN (the isolated catalytic domain of HPN, with which SK forms atight binary complex with nearly the same affinity as with full-lengthHPG; Ref. [15]), reveals that the domains of SK form a “three-sidedcrater” with the μPN situated at the bottom into which the substrate'scatalytic domain, bearing the scissile peptide bond to be cleaved, canpotentially dock [16]. In summary, the catalytic process in SK actioninvolves the proteolytic conversion of the macromolecular substrateto plasmin by an otherwise non-specific proteolytic active center thatis made highly substrate-specific through selective stereo-selectivedocking mediated by intermolecular enzyme–substrate contactswhich are not yet fully identified from the view of both protein‘partners’ taking part in the process.

One of the most intriguing aspects of SK-mediated proteolysis isthe role of long-range protein–protein interactions between theenzyme (SK-plasmin) and its macromolecular substrate, which isstarkly exemplified by the observation that once the kringledomains are removed from the substrate, the activation rates ofthe catalytic domain of substrate – which continues to bear thescissile peptide bond – falls to less than 1–2% of that against thefull-length, native HPG. Thus, the mechanism of operation of SKseems to be mechanistically different from the viewpoint ofsubstrate recognition compared to other activators, such as UK ortPA, which display activation capabilities that are essentiallyunchanged upon removal of the kringle domains from thesubstrate. A loop in the central (β) domain of SK, the 250-loop,has been implicated in the interaction of the SK-plasmin activatorcomplex with the kringles of substrate HPG [17]. Other epitopes inSK that may be involved in the recognition of either the serineprotease (catalytic) domain of the substrate, or in addition to the250-loop with the kringle domains, have not been identified so far.Considering the large surfaces involved in the protein–proteininteractions between the activator enzyme and its macromolecularsubstrate in this system [1], it seems very likely that there are anumber of such sites that participate in the catalytic process. Theloop regions in proteins connecting secondary structures generallydemonstrate less regularity in their conformations, and though theloops do not generally contribute greatly to protein core stability,often they play significant functions related to their interactionswith other molecules. The crystal structure of SK reveals that eachof the three domains contains, depending on their flexibilityproperties, a number of both defined and undefined loops. The“three-sided valley” formed by the SK-plasmin(ogen) activatorcomplex around the HPN active site [16] suggested to us that the88–97 loop in the α domain is favorably positioned to interact withan incoming substrate molecule. In this paper, we report, for thefirst time, the involvement of this loop of SK in humanplasminogen activation.

2. Materials and methods

2.1. Reagents

Glu-plasminogen was either purchased from Roche Diagnostics,GmbH (Penzberg, Germany) or purified from human plasma byaffinity chromatography [18]. The T7 RNA polymerase promoter-basedexpression vector, pET-23d and Escherichia coli strain BL21 (DE3) were

products of Novagen Inc. (Madison, WI). Thermostable DNA poly-merase (Pfu) was obtained from Stratagene (La Jolla, CA), andrestriction endonucleases, T4 DNA ligase and other DNA modifyingenzymes were purchased from New England Biolabs (Beverly, MA).Oligonucleotide primers were supplied by Biobasic, Inc., Canada. TheQuikChangeÔ Site-Directed Mutagenesis Kit was acquired fromStratagene. Phenyl Agarose 6XL was procured from PrometicBiosciences Ltd., British Isles, and DEAE-Sepharose (fast-flow) fromPharmacia Biotech. Ltd., Uppsala, Sweden, Urokinase (UK), EACA,sodium cyanoborohydride and L-Lysine were purchased from SigmaChemical Co., St. Louis, USA. All other reagents used were of thehighest analytical grade available.

2.2. Design and construction of SK-loop mutants

A set of mutagenic and either standard upstream or down-stream primers corresponding to the ends of the SK gene, carryingunique restriction sites, were used in polymerase chain reactions togenerate DNA fragments having overlapping ends. The sequences ofthe mutagenic and flanking primers used for the various mutagen-esis experiments based on both splicing overlap extension-PCR(SOE-PCR) and QuickChange mutagenesis strategy are given inTable 1.

2.3. Expression and purification of nSK/SK-loop mutants

The SK constructs were expressed intracellularly in E. coli BL21(DE3) cells as inclusion bodies (IBs) under the control of the T7phage RNA polymerase promoter after induction with isopropyl-1-thio-β-D-galactopyranoside (IPTG) as described earlier [17,19,20].Briefly, the cells were pelleted after 6–7 h of induction at 40 °C, lysedthrough sonication, and the IBs were dissolved in 8 M urea, andprotein folded after rapid 10-fold dilution. Each sample was thenchromatographed on Phenyl Agarose followed by anion-exchangechromatography on DEAE-Sepharose®. SK proteins so purified weregenerally more than 95% pure, as analyzed by SDS-PAGE.

2.4. Energy minimization and molecular dynamics simulations ofSK/SK-loop mutants

The crystal structure of streptokinase was taken from protein databank (1BML) and the molecular dynamics simulations (MDS) for na-tive SK and the mutants, including SK88–97-Beta Turn and SK88–97-Ala

were carried out using the Sander module of AMBER 8 [21] softwarepackage with ff99 force field. Initial coordinates for the nativestreptokinase were taken from the published X-ray structure data,with the mutants being constructed by replacing appropriate aminoacid residues using software, PyMOL [22]. During energy minimiza-tion andmolecular dynamics, positional restraints with force constantof 100 kcal/mol-Å2 were applied on all the atoms in the structuresunder study, except those in the loop, as well as six flanking residueson both sides of the loop (82-AIQEQLIANVHSNDDYFEVIDF-103) so asto follow the conformational changes in the loop and flankingamino acid residues. The energy minimization was carried outusing 1000-steps of steepest descent and 2000-steps of conjugategradient methods to remove steric contacts in the structures, withtermination criterion of 0.05 kcal/mol-Å. These structures werethen heated for 30 ps to a final temperature of 300 K. The time-step was 1 fs and no cut-off was applied to Van der Waals' inter-actions. An algorithm of Hawkins, Cramer and Truhlar was used forpairwise Generalized Born solvation model [23]. The system wasequilibrated for 1000 ps before starting 1-ns trajectory. Data werecollected at 1.0-ps intervals. The equilibration part of the MDtrajectories was not used for data collection. During the simula-tions, the temperature of the system was held constant at 300 K byusing Langevin dynamics. The temperature and energies were

Table 1Oligonucleotide sequences used for the construction of SK 88–97 loop substitution and deletion mutants

Mutant SK 88–97 loop sequence Oligonucleotide sequence

Nsk 88-IANVHSNDDY-97 UP⁎ 5′ TGTTGAGGGGACGAATCAAGACATTAGTCTTAAATTTTTTGAAA 3′DP⁎ 5′ TAAGGGAGTAAACTGTACAGTATATTCCAC 3′

SK88–97-Beta Turn 88-PANAHSNSKY-97 5′ CAAGAACAATTGCCAGCTAACGCTCACAGTAACAGTAAGTATTTTGAGGTC 3′5′ GACCTCAAAATACTTACTGTTACTGTGAGCGTTAGCTGGCAATTGTTCTTG 3′

SKIV88,91PA 88-PANAHSNDDY-97 5′ CAGGAACAATTGCCGGCTAACGCTCACTCGAACGACG 3′5′ CGTCGTTCGAGTGAGCGTTAGCCGGCAATTGTTCCTG 3′

SKDD95,96SK 88-IANVHSNSKY-97 5′ GCTAACGTCCACTCGAACAGTAAGTACTTTGAGGTCATC 3′5′ GATGACCTCAAAGTACTTACTGTTCGAGTGGACGTTAGC 3′

SK88–97-Ala 88-AANAHSNAAY-97 a. 5′ CAGGAACAATTGGCCGCTAACXGCTCACTCGAACGACG 3′5′ CGTCGTTCGAGTGAGCGTTAGCGGCCAATTGTTCCTG 3′b. 5′ GCTCACTCGAACGCGGCGTACTTTGAGGTC 3′5′ GACCTCAAAGTACGCCGCGTTCGAGTGAGC 3′

SKN90A 88-IAAVHSNDDY-97 5′ CAAGAACAGTTGATCGCTGCTGTGCACAGTAACGACGAC 3′5′ GTCGTCGTTACTGTGCACAGCAGCGATCAACTGTTCTTG 3′

SKHS92,93AA 88-IANVAANDDY-97 5′ CAATTGATCGCTAATGTGGCTGCTAACGACGACTACTTTGAG 3′5′ CTCAAAGTAGTCGTCGTTAGCAGCCACATTAGCGATCAATTG 3′

SKY97A 88-IANVHSNDDA-97 5′ CACAGTAACGACGACGCCTTTGAGGTCATTGATTTTGCAAGC 3′5′ GCTTGCAAAATCAATGACCTCAAAGGCGTCGTCGTTACTGTG 3′

SKdel88–97 88-Δ-97 5′ GCCATTCAAGAGCAATTGTTCGAGGTCATTGATTTTGCAAGC 3′5′ GCTTGCAAAATCAATGACCTCGAACAATTGCTCTTGAATGGC 3′

The mutant primers shown above (sense primers are listed first, followed by antisense primers) were used for the construction of deletion and substitution mutations of the 88–97loop of α domain of SK. The substituted residues have been indicated in bold font and the corresponding new loop sequence is given against each mutant in the next column.⁎Indicates the Upstream and Downstream primers of the SK gene with unique restriction sites, which were used to re-clone the mutant PCR cassettes into the SK expression vector.

1312 S. Yadav et al. / Biochimica et Biophysica Acta 1784 (2008) 1310–1318

recorded every ps, and used for subsequent analysis, carried outusing AMBER 8 and VMD [24].

2.5. Circular dichroic analysis of nSK/SK-loop mutants

Far-UV CD spectra of SK/SK-loop mutants (concentrations around0.15 mg/ml in PBS, pH 7.2) were recorded on a Jasco-720 spectro-polarimeter. Measurements were carried out from 190–250 nm in a0.1 cm path length cuvette, and the appropriate buffer baseline wassubtracted from the protein spectra. The final spectrum analyzed wasan average of at least 10 scans.

2.6. Preparation of HPN and μPG

HPN, the active form of HPG, was prepared by digesting Glu-HPGwith UK covalently immobilized on agarose beads using a ratio of300 Plough units/mg HPG in 50 mM Tris.Cl, pH 8.0, 25 % (v/v) glyceroland 25 mM L-Lysine at 22 °C for 10 h [17,19].

Microplasminogen (μPG), the catalytic domain of human plasmi-nogen (residues Lys 539-Asn 791) which is devoid of all the kringles,was prepared by cleavage of HPG by HPN under alkaline conditions(0.1 N glycine/NaOH buffer, pH 10.5, using a 10:1 weight-ratio of HPGand HPN) at 30 °C. Microplasminogen was purified from the reactionmixture by passing through a Lys-Sepharose column (AmershamBiosciences, Sweden), followed by a Soybean-trypsin-inhibitor (STI)-agarose column to absorb HPN and µPN, as reported [17,25]. The flow-through was then subjected to molecular sieve chromatography, afterconcentration by ultrafiltration, on a column (16 mm×60 cm) ofSuperdex-75® (Amersham). The purity of µPG formed was analyzedby SDS-PAGE, which showed a single band moving at the positionexpected from its molecular size [25], and the identity confirmed byN-terminal Edman protein sequencing.

2.7. Functional characterization of SK-loop mutants

2.7.1. Plasminogen activation assayThe SK/SK-loop mutant derivatives were premixed with the

partner molecule having a preformed active site i.e with HPN so asto directly measure the co-factor activities of different activatorspecies. Catalytic amounts were withdrawn and added to a 100 μlcuvette containing 0.4 μM HPG and 0.5 mM Chromozym® PL (Tosyl-

glycyl-prolyl-lysine-4-nitranilide-acetate, Roche Diagnostics GmbH,Germany) in the assay buffer containing 50 mM Tris.Cl, pH 7.5 [26,27].The time-course of the different HPG activation reactions wasrecorded spectrophotometrically at 405 nm, and the progress curvesobtained from control reactions (containing HPG and same amountsof HPN, but no SK derivatives) were subtracted from the test reactions.The resultant curves so obtained were used to determine the rate ofHPG activation of the SK-loop mutants, relative to SK [27].

2.7.2. Determination of kinetic constants for HPG activator activityThe kinetics of HPG activation by HPN.SK/SK-loop mutant com-

plexes were measured by transferring suitable aliquots of preformedHPN.SK/SK-loop mutant complexes at concentration of 0.5 μM, to theassay cuvette containing different concentrations of substrate HPG[28] in the assay buffer (50 mM Tris.Cl buffer, pH 7.5) also contain-ing 0.5 mM chromogenic substrate. The generation of activator ac-tivity was monitored at 22 °C at 405 nm. The kinetic parameters forHPG activation were then calculated from inverse Lineweaver-Burkplots [27].

2.7.3. Esterolytic activation of equimolar HPG.SK/SK-loop complexesTo monitor the active site formation 7 μM HPG was added to an

assay cuvette containing 7.5 μM SK/SK-linker, 100 μM NPGB and10 mM sodium phosphate buffer, pH 7.5. The ‘burst’ of p-nitrophenolrelease due to acylation of active center was monitored at 410 nm as afunction of time at 22 °C [28–30].

2.8. Kinetic analysis of protein–protein interactions using surfaceplasmon resonance (SPR) technique

2.8.1. Binary interaction analysisAssociation and dissociation kinetics in real-time between HPG

and the SK/SK-loop mutants, referred to hereafter as binaryinteraction, were followed by SPR-based detection using the IAsysPlusÔ system (Cambridge, UK) [31,32] employing carboxy methyl-dextran (CMD) cuvettes and EDC-NHS chemistry according to themanufacturer's protocols (IAsys protocol 1.1). This was followed bythe immobilization of SK/SK-mutant/s to the activated CMD cuvette.Non-specifically bound SK/SK-mutant/s was then removed byrepeated washing with PBS followed by three washes with 10 mMHCl. The net response chosen for the immobilized SK/SK-mutant/s

Fig.1.Depiction of the 88–97 loop of streptokinase alpha domain. The coordinates of thecrystal structure of streptokinase [16] were taken from PDB (1BML). The figuregenerated using PyMol software, represents ribbon diagram of α domain of SKhighlighting the distance between the flanking residues viz. Ile88 and Tyr97 of 88–97loop. (I88-Y97=6.2 Å).

1313S. Yadav et al. / Biochimica et Biophysica Acta 1784 (2008) 1310–1318

onto the cuvette was 700–800 arc sec in all experiments. Experi-ments were performed at 25 °C in 10 mM PBS, pH 7.4 containing0.05% Tween 20 and 50 μM NPGB (binding buffer). The latter wasincluded in order to prevent HPN-mediated proteolysis, which wasshown to completely inhibit any degradation of the molecular speciesduring either binary or ternary (see below) complex formation[17,33].

After equilibrating the cuvette with binding buffer, varyingconcentrations of full-length HPG were added and each bindingresponse was monitored during the ‘association’ phase. Subse-quently, the cuvette was washed with binding buffer and the‘dissociation’ phase was recorded. Following each cycle of analysis,the cuvette was regenerated by washing with 10 mM HCl, andbaseline was re-established with binding buffer. In parallel, in thecontrol cell of the dual channel cuvette, activated CMD alone wastaken as a negative control for the binding studies. The data wereanalyzed after subtraction of the corresponding non-specific refrac-tive index component(s), and the kinetic constants were calculatedfrom the sensorgrams by non-linear fittings of association anddissociation curves using the software FASTfit™, supplied by themanufacturer. The dissociation rate constant (koff) was calculatedfrom the average of four dissociation curves obtained at saturatingconcentration of ligate. The equilibrium dissociation constant (Kd)was then calculated from the extent of association of monophasiccurve [34,35].

2.8.2. Ternary interaction analysisSPR-based biosensor was also used to measure the rate and

equilibrium dissociation constants describing interactions betweensoluble ligate (HPG, μPG or K1–5) and SK/SK-loop mutants–HPGcomplex, a situation simulating substrate binding to binary complexand hereafter called as ternary interaction, essentially as described indetail previously [17,36]. Briefly, after binary complex formation onthe SPR cuvette, varying concentrations of either ‘ternary’ HPG (0.1–1.0 μM) or μPG (1–8 μM) or K1–5 (1–6 μM) were then added tomonitor the binding by recording the association phase. Subse-quently, the cuvette was washed with binding buffer and thedissociation phase was recorded. After each cycle of analysis, theoriginal baseline was re-established by stripping off the undisso-ciated ‘ternary’ ligate with 2.5 mM EACA [17,37]. In experimentswhere μPG was used as the soluble ternary ligate, 1 mM EACA wasfound to be sufficient to strip off the undissociated μPG, whilewashing with binding buffer alone resulted in incomplete regenera-tion of baseline. Association and dissociation ‘phases’ at varyingligate (HPG, μPG and K1–5) concentrations were analyzed aftersubtraction of the corresponding non-specific refractive indexcomponent(s), and the kinetic constants were calculated from thesensorgrams by non-linear fittings of association and dissociationcurves using the software FASTfit™.

3. Results and discussion

3.1. Design and expression of substitution mutants of the 88–97 loop ofSK

Fig. 1 shows the structure of the α domain of SK obtained fromcrystal coordinates of the SK-microplasmin(ogen) complex [16]showing the surface-exposed loop 88–97 in the α domain. To explorethe role of this loop in enzyme–substrate interactions, we sought tofirst alter the loop's conformation and mobility using site-directedmutagenesis. However, since the possibility, as suggested by the X-raydata, did exist that too drastic an alteration in the structure of theloop – such as loop deletion – might affect the 1:1 partner interactionof SK with HPG/HPN, we chose to mutate the loop at limited sites tobegin with. These substitution mutants were designed in the loopwith minimally altered primary structural changes which were likely

to induce only local, limited structural alterations within the loop.Accordingly, we first planned a mutant SK in which the nativesequence of the 88–97 loop was to be substituted with twotetrapeptide sequences that have earlier been shown to increase thepropensities for formation of type I β-turns, namely Pro-Ala-Asn-Alafrom high-potential iron protein from Chromatium species, and Asn-Ser-Lys-Tyr from bovine α-chymotrypsin [38]. This mutant, termedSK88–97-Beta Turn, carries two β-turns by virtue of four simultaneoussubstitutions, namely Ile-88 and Val-89, being altered to Pro and Ala,respectively, and Asp-95 and Asp-96, being altered to Ser and Lys,respectively. ‘Control’ substitutions with single beta-turn-inducingalterations at either end of the loop viz. SKIV88,91PA and SKDD95,96SK,were also planned. In parallel, an alanine-substitution mutant of thecorresponding residues altered in SK88–97-Beta Turn was also generated(termed SK88–97-Ala).

Prior to the actual construction of the various mutants, weevaluated whether the sequence alterations would not generate anygeneralized structural destabilization of the α domain of SK. Themolecular dynamics analysis of the different substitution mutants ofthe loop (see Fig. 2) revealed, only localized conformational changesin SK88–97-Beta Turn, where the 88–97 loop, likely due to theintroduction of β-turns at both the ends simultaneously, was seento move away from the concavity of the substrate-binding pocketand oriented itself more towards the main ‘body’ of SK. In contrast,the mutants of this loop, bearing individual (single) beta-turnmutants, or the alanine-substitution mutant (SK88–97-Ala), displayedstructural configurations that were native-like wherein they areseen to protrude towards the substrate-binding pocket of theactivator complex. Furthermore, the nearly overlapping structuresof the 88–97 loop of nSK, obtained before and after minimization,suggest that the minimization process, by itself, did not introduceany structural changes inadvertently.

Further, when the molecular dynamics data were analyzed forany increased propensity for beta-turn formation, in case of themutant SK88–97-Beta Turn only could one distinctively see that theintroduction of a Pro residue in place of Ile-88 (SKIV88,91PA) resulted

Fig. 2. The superimposed 88–97 loop region of the nSK and substitution mutants aftermolecular dynamics simulations. The nSK and the loop mutants were energy-minimized (see the ‘Materials and methods’ section for details), and the averagestructure from the production run of molecular dynamics using AMBER8 software isshown in the figure. The proteins superimposed are nSK before minimization (cyan),nSK after minimization (green), SK88–97-Ala (yellow) and SK88–97-Beta Turn (blue). Thefigure clearly depicts local changes in the conformation of 88–97 loop compared to thenative, while the remaining structure superimposes almost completely.

Fig. 3. Molecular dynamics analysis of the 88–97 loop of Streptokinase and its mutants.The molecular dynamics data of the 88–97 loop mutants show the occurrence of turnconformation for each residue in the loop (88–97) during the course of MD simulation.The residues in the primary structure of the SK sequence are indicated as single letterson the X-axis; residues in parentheses are the respective mutations, while the relativepropensity of occurrence of turn conformation (of the 1000 simulated structures, savedafter every 1 ps) for the corresponding residues is shown on the Y-axis. The differentmutants have been represented as different line + symbol form, nSK (●), SKIV88,91PA (■),SKDD95,96SK (w), SK88–97-Beta Turn (▽) and SK88–97-Ala (▲). This comparative figure showsthat the overall β-turn conformation of 88–97 loop has increased only in the mutantSK88–97-Beta Turn (two β-turns at either end of loop) while in the other mutants it hasremained almost native-like.

1314 S. Yadav et al. / Biochimica et Biophysica Acta 1784 (2008) 1310–1318

in change in conformation of the preceding residues (Leu-87 andGln-86) from helix to turn. Moreover, the substitution of the two Aspresidues (residue numbers 95–96) with serine and lysine (in mutantSKDD95,96SK) resulted in a further increased propensity for turn con-formation as compared to the native, as shown in Fig. 3, whichdepicts the relative frequency of turn conformation for each residuein both mutant and the native structure in the dynamics trajectory.The loops, generally, are anchored from both the ends, and thus theirconformational space is limited as enforced by the flankingsecondary structural elements. Thus, any conformational change ina loop at one end can potentially have an effect on the other end ofthe loop so that the loop balances its overall conformation andmaintains the necessary contact points — either intramolecular orintermolecular. This phenomenon can be easily observed by perusal ofFig. 3 where the individual β-turn mutants of the 88–97 loop actuallyshow a decreased turn propensity at the N-terminal end, whilesimultaneously increasing the turn propensity at the other end of theloop such that the loop does not exhibit any significant change inoverall conformation. It is thus worth noting that only when the turn-inducing mutations were introduced simultaneously at both the endsof the loop (SK88–97-Beta Turn) did the conformational change in the loopget highly pronounced. Also, it is evident that the mutant SK88–97-Ala,with alanine substitutions at both ends, exhibits a distinctly subduedoverall turn propensity probably as alanine residues have a tendencyfor helix formation. In summary, the molecular dynamics calculationsclearly indicate that the overall turn conformation of the amino acidresidues in the 88–97 loop of SK was significantly increased only afterthe introduction of two simultaneous beta-turns, as a result ofwhich, itwas considered fairly likely, the mobility of this loop would besignificantly constrained.

All the SK mutants examined above through molecular dynamicswere then constructed using the QuikChangeÔ Site-Directed Muta-genesis Kit and expressed under a T7 RNA polymerase promoter-based expression vector for SK, pET-23 (d)-SK [20]. The purifiedmutant proteins were then individually examined for their ability toactivate human plasminogen by standard assays using catalyticamounts of each activator protein which was pre-complexed withequimolar HPN. The activity profiles (time-course) for progressive

plasmin generation and consequent chromogenic substrate hydro-lysis were then obtained spectrophotometrically, and are shown inFig. 4. These activity profiles reveal that the two-turn mutants, butnot SKIV88,91PA and SKDD95,96SK (wherein only one turn was sought tobe introduced in each mutant), showed a nearly six-fold drop in theHPG activator activity compared to that of native SK. The decrease inactivity in SK88–97-Beta Turn could be argued to be due to aperturbation in the interactions of the side chains of the residuesbeing mutated with the incoming substrate, on the one hand ormight have resulted due to the introduction of the two β-turns ateither ends of the loop causing a reduced availability of the side-chain moieties of other residues of the loop for potential interactionswith substrate, if the loop were indeed participating in enzyme–substrate interactions.

However, the fact that the alanine-substituted mutant (SK88–97Ala)showed native-like HPG activation capabilities suggests that in thebeta-turnmutant the conformation of the loop itself is affected, ratherthan an effect resulting from an altered interaction between HPG andthe side-chain residues per se. That this is not speculation was provenby examining the functional properties of several other alanine-substitution mutants of the loop, namely SKN90A, SKHS92,93AA andSKY97A (Table 1). These mutants were purified and then checked forsubstrate activation. The results observed clearly showed that all thepoint mutants had absolutely native-like activity (Table 2). The overallresults obtained with the various alanine-substitution mutants of theloop strongly suggest that the side chains of the loop residues per se arenot directly contributive to the functionality of the protein, but it islikely that the overall structural configuration and/or flexibility char-acteristics of the loop that ismore crucial for substrate processing. Thisobservation is rationalized by the results of theMDS studies that showthe markedly pronounced change in the conformation of the 88–97loop in SK88–97-Beta Turn, where the loop is seen to have moved towardsthe interior of themolecule rather that protruding out in the substrate-binding pocket, unlike the other loop mutants where the loopconformations are comparable to nSK (Fig. 2).

Fig. 4. Activation of substrate HPG by SK and SK-loop mutants. The figure showsprogress curves for substrate HPG activation by catalytic amounts of activatorcomplexes of nSK or individual SK-loop mutants with HPN. An equimolar complex ofpreformed HPN.SK/SK-loop mutant complex in catalytic amounts (0.1 nM) wastransferred to assay cuvettes containing substrate HPG (0.4 μM) in the assay buffer(50 mM Tris.Cl, pH 7.5) also containing 0.5 mM chromogenic peptide substrate asdescribed under ‘Materials and methods’. The generation of activator activity wasmonitored at 22 °C at 405 nm. The figure shows the time-course of activation of HPG by0.1 nM of nSK.HPN (n), SK88–97-Ala.HPN (q), SK88–97-Beta Turn.HPN (p), and at 0.5 nMconcentration of SKdel88–97.HPN (l) as the activity is relatively low.

1315S. Yadav et al. / Biochimica et Biophysica Acta 1784 (2008) 1310–1318

In order to further confirm this conclusion, we thought that anappropriate strategy would be to completely delete the loop, and thenexamine the functional properties of the resultant mutant.

3.2. Expression and characterization of SK 88–97 loop-deletion construct

A deletion mutant of the 88–97 loop (termed SKdel88–97) wasaccordingly constructed in which the residues encompassing the loopwere deleted using SOE-PCR, and the resultant cDNAwas expressed inE. coli, and the proteinwas purified following the procedures describedearlier. Thismutantwas then examined for its co-factor activity againstsubstrate plasminogen after 1:1 complexation with HPN as describedin “Materials and methods” as before. The activity profiles (time-course) obtained are shown in Fig. 4. The results obtained clearlydemonstrate that the specific activity for HPG activation associatedwith SKdel88–97 was appreciably reduced compared to that of nSK(approximately 25-fold lower). Such a drastic drop in activity, providedit was not accompanied by any major conformational alteration of theSK fold, would strongly argue in favour of a direct involvement of theSK 88–97 loop in an important catalytic step. However, another

Table 2Steady-state kinetics parameters for HPG activation by equimolar complexes of SK/SK-loop mutants and HPN

Activator species Km

(μM)kcat(min−1)

kcat/Km

(min−1/μM)

nSK 0.5±0.1 11±0.5 22SKIV88,91PA 0.4.5±0.05 14±1 30SKDD95,96SK 0.5±0.05 8±0.2 16SK88–97-Beta Turn 1±0.1 3.5±0.5 3.5SK88–97-Ala 0.45±0.05 11±0.4 24SKN90A 0.4±0.1 11±0.5 27SKHS92,93AA 0.45±0.1 11±0.5 24SKY97A 0.5±0.1 10±0.5 20SKdel88–97 3.5±0.5 0.45±0.05 0.13

Preformed HPN.SK/SK-loop mutant complex(es) were transferred to assay cuvettescontaining different concentrations of substrate HPG (0.2–2 μM) in an assay buffer(50 mM Tris.Cl, pH 7.5) also containing 0.5 mM chromogenic substrate. The generationof activator activity was monitored at 22 °C at 405 nm, and data analyzed.

possibility was that the complete deletion of the loop affected thepartner interaction between SK and HPG, and this also contributed tothe observed drastic change in activity of the mutant. In order toexamine this further, we carried out physico-chemical analyses of theloop deletion and substitution mutants.

3.3. Structural characterization of loop substitution and deletion mutants

The various substitution and deletion mutants described above,including the onewith complete 88–97 loop deletion (SKdel88–97) werethen examined for the retention or absence of a native-like fold usingfar-UV CD spectroscopy as the structural probe. The CD spectra ofnative SK expressed in E. coli (nSK), taken as a control, was observed tobe essentially indistinguishable from that of both the mutants (Fig. 5),thus indicating that the loop deletion did not result in any observablelarge-scale alteration of the secondary structures present in theproteins.

3.4. Biochemical characterization of 88–97 loop mutants

In order to further characterize the mutants with respect to theiraltered characteristics for the activation of human plasminogen, anddecipher the exact step during catalysis, we determined the steady-state kinetic constants for the co-factor activities generated by themutants after complexation with equimolar HPN. Their HPG acti-vation capability was then studied spectrophotometrically (seeMaterials and methods for details) against varying concentrationsof substrate HPG. The data obtained are summarized in Table 2. Thesteady-state kinetics results indicate that although the alanine-substitution mutant (SK88–97-Ala) retained native-like activity, themutant with two beta-turn promoting substitutions in the 88–97loop (SK88–97-Beta Turn) had its catalytic efficiency reduced by almost6-fold compared to nSK. This suggests that the two turns, together,had probably caused only a very limited, local structural change (Fig.2), one which could not be detected by CD. At the same time, anysuch structural or functional alteration was absent in the ‘single-turn’ mutants, namely SKIV88,91PA and SKDD95,96SK, as well as the ala-substituted mutant, SK88–97-Ala (Fig. 2). Clearly, this suggests thatonly once a certain ‘minimal’ level of structural perturbation withinthe loop occurs – such as the simultaneous introduction of two beta-turn promoting sequences – that a functionally altered interactionwith substrate becomes evident. Once, however, the complete loop is

Fig. 5. Far-UV CD spectra of SK/SK-loop mutants. The CD spectrawere determined in thewavelength range of 195–250 nm in a 0.1 cm path length cuvette. Each spectrumwas amean of 10 scans. The CD spectra shown are: nSK (■), SK88–97-Beta Turn (●) and SKdel88–97

(○). The CD spectra of the substitution and deletion mutant were similar to nSK.

Table 3Binary interactions of SK/SK-loop mutants with partner HPG

Ligand kon (×107) (M−1 s−1) koff (×10−2) (s−1) Kd (×10−9) (M)

nSK 1.8±0.2 3±1 2±0.5SK88–97-Beta Turn 2±0.1 4±0.5 2±0.5SKdel88–97 0.15±0.05 2±0.7 13±2

Association and dissociation rate constants and equilibrium dissociation constants ofinteraction between SK/SK-loop mutants immobilized on CMD cuvette with variedconcentration of partner HPG were determined using FASTfitÔ program to the bindingdata obtained using IAsys biosensor.

1316 S. Yadav et al. / Biochimica et Biophysica Acta 1784 (2008) 1310–1318

deleted, the functional role of the loop in terms of substrate turn-over becomes much more pronounced.

The loop mutants were next examined for their ability to makean active binary complex as indicated by their ability to open theactive site in partner HPG (via Pathway I) using the active siteacylating agent, NPGB. NPGB has been previously used to titrate theactive site formation in the SK.HPG complex [28–30]. Neither SK norHPG alone gives the ‘burst’ observed at 410 nm, but only when thetwo are mixed in equimolar proportions they gave a characteristicburst. This burst is associated with rapid NPGB hydrolysis, observeddue to the formation of a “virgin” SK.HPG activator complex andconsequent acylation of the active site. The SKdel88–97 mutantshowed slight lag in opening of the active site compared with theother mutants which completely behaved in a closely native-likemode (Fig. 6), suggesting that the SK88–97-Beta Turn mutant forms astable and active binary complex with the partner molecule despitethe introduction of the two beta-turns into the loop. However, thecomplete loop deletion seems to have slightly perturbed thisphenomenon as observed by the lag in its activation kinetics. Thisobservation suggests that despite a drastic functional effect, thismutant has preserved a capability to form a complex with partnerHPG albeit with a slower kinetics. Thus, the drastic change in activitythat was observed with the complete loop deletion could be anadditive effect of both a somewhat weaker complexation withpartner PN and a specific loss of interaction with substrate HPG,whereas in SK88–97-Beta Turn, the operative effect likely is solely due toan altered substrate–enzyme interaction.

3.5. Surface plasmon resonance-based comparative analysis of thebinary interaction of SK/SK-loop mutants with HPG

In order to elucidate the interaction of SK/SK-loop mutants withpartner HPG, a relatively more direct, physico-chemical approach,SPR was adopted [31,32]. We first studied the real-time interactionsbetween the various constructs of SK and partner HPG (to form the1:1 activator complex) in the presence of the inhibitor NPGB [39,40],essentially as described earlier [17,36]. Briefly, the SK/SK-loopmutant/s were immobilized on CMD cuvettes using an EDC-NHSchemistry, and their interaction with varying concentrations of HPGwas then examined in real-time (see “Materials and methods” fordetails).

Fig. 6. Generation of active site in the equimolar HPG.SK/SK-loop complexes. Active sitetitration of HPG on complexing with SK or SK-loop mutants was observed using theactive site acylating agent, NPGB. The generation of “NPGB burst” was monitored at410 nm at 22 °C, as described under Materials and methods. The figure shows progresscurves of NPGB hydrolysis by nSK.HPG (■), SK88–97 Beta Turn.HPG (●), SK88–97-Ala.HPG (▲)and SKdell88–97.HPG (▼).

The kinetic parameters so obtained for the binary interactions(Table 3) showed that the affinity of the loop mutants was notsignificantly different from that of nSK–HPG interactions. Of all themutants, only the complete loop-deletion mutant SKdel88–97 showeda 7-fold increase in Kd values, while the other substitution mutantsshowed affinity that was essentially native-like. Thus, only when the88–97 loop was drastically altered did it affect the partner HPG/HPNbinding, while the loop's other relatively ‘gentler’ substitutions didnot affect the mutants' capability for forming stable binarycomplexes with partner HPG compared to nSK, leading to theconclusion that the change in co-factor activities exhibited by themcould be due to their altered substrate interactions.

3.6. Ternary interactions of the binary complex of SK/SK-loop mutantswith HPG and truncated substrate ligands μPG and K1–5

To further validate the conclusions of the steady-state kineticsdescribed above, ternary interactions were also studied using SPR,essentially as described in detail elsewhere [Ref. [17,36]; see also,Materials and methods for details]. In the past, this technique hasbeen effectively utilized to study ternary interactions between SK–HPG and macromolecular substrate ligands, such as full-length HPG,the isolated catalytic domain of HPG, and the isolated, five-kringledomains of the substrate (which, like the catalytically active sub-strates, can also ‘dock’ into the SK–HPG active site) [17,36]. Briefly,different SK constructs were individually immobilized on CMDcuvettes, followed by exposure to a high concentration of HPG in thepresence of the inhibitor NPGB (to prevent activation of the SK–HPGcomplex). The binary complex was made at 100 nM concentration,that was 50-fold above the reported Kd values for the binarycomplex (Table 3). Once stable baselines indicative of binary complexformation were achieved, docking studies of substrate in the ternarymode – either HPG, μPG or kringle domains (K1–5) – were carriedout. The affinity of the binary complex for the ternary analytes, μPGand K1–5, was comparatively weak as compared with the affinity ofHPG, so these two molecules were studied at a relatively higherconcentration range [17].

The real-time binding parameters of the preformed binarycomplexes of the loop-deleted mutants immobilized on to thecuvette surfaces for ternary complexation with substrate were foundto be markedly reduced compared to the case of SK.HPG (Table 4),which also shows the respective rates of association (kon), rates ofdissociation (koff) and equilibrium dissociation constants (Kd). Theseresults clearly indicate that for HPG as analyte, the binary SKdel88–97.HPG complex exhibited a nearly 5-fold increased Kd compared tonative SK.HPG, while the mutant SK88–97-Beta Turn also showedsignificant decrease in affinity for HPG. When these ternary interac-tions were examined using μPG as the ‘substrate’ (ternary ligate), theloop mutant SK88–97-Beta Turn showed a clear three-fold affinity drop,while in case of SKdel88–97 a nearly 11-fold decrease in affinity wasevident. Thus, these data are strongly in consonance with theconclusions of the steady-state kinetic experiments presented above,which indicated that the 88–97 loop of SK likely interacts primarilywith the serine protease (catalytic) domain of substrate. Interestingly,

Table 4Ternary interaction of binary complex SK/SK-loop mutants with analytes HPG, μPG and K1–5

Activator species HPG μPG K1–5

kon (×106)(M−1 s−1)

koff (×10−2)(s−1)

Kd (×10−9)(M)

kon (×103)(M−1 s−1)

koff (×10−2)(s−1)

Kd (×10−6)(M)

kon (×105)(M−1 s−1)

koff (×10−2)(s−1)

Kd (×10−6)(M)

Nsk 1.4±0.1 4±1 30±5 14±2 2±0.5 1.2±0.4 2.7±0.1 8.1±0.3 0.3±0.1SK88–97-Beta Turn 0.8±0.4 4±0.6 45±5 6±1 3±1 4.5±0.5 2.3±0.4 6.4±0.5 0.3±0.04SKdel88–97 0.5±0.1 6±1 120±30 3.7±0.3 4.5±1 13.3±2 2.4±0.2 10±1 0.3±0.1

Equilibrium dissociation constants of interaction between SK/SK-loop mutants. HPG immobilized on CMD cuvette with different derivatives of HPG as ternary analyte/s at variedconcentrations were determined.

1317S. Yadav et al. / Biochimica et Biophysica Acta 1784 (2008) 1310–1318

when the contiguous kringle domain unit, K1–5, was used as theanalyte, the ternary interaction of the loop mutants with this ligandwas found to be essentially indistinguishable from that of native SK.HPG. The selective diminution in affinity for μPG at the ternarycomplexation stage, but not with K1–5, clearly supports the conclusionthat the deletion of the 88–97 loop in SK adversely affects the ability ofthe activator complex to capture the catalytic domain of substrate. Eventhough it has been proposed that theα domain could be important forthe optimal functioning of the SK.HPN activator complex, likelythrough interaction with the substrate, nothing substantive could bededuced in an unambiguous manner as to which region or ‘epitope’ inthe domain actually interacts with the substrate.

The observations being reported in the present paper thus assumesignificance since a discrete region in the N-terminal domain of SK hasbeen demonstrated for the first time to play a direct role in theinteraction of SK specifically with the macromolecular substrate. Theloop in Staphylokinase (SAK) equivalent to the 88–97 loop of SK is a 6-residue, smaller loop; two of the loop's residues have been suggested tobe involved in 1:1 interaction with HPG [41]. However, in comparison,the 88–97 loop, perhaps because of its location at the SK–HPG interface,seems also to be involved in ternary complexationwith µPG apart fromits involvement in binary complexation, a feature that is consistent withthe fact that this loop is far more accessible to the solvent than the SAKloop [16]. The present study thus suggests that that unlike thecorresponding loop in SAK, the larger, 88–97 loop in SK has evolved adual functionality that probably involves interacting specifically withthe catalytic domain of the substrate during the early steps in catalysisapart from participation in binary complex formation. The study thushighlights the contribution of the relatively subtle structural configura-tion of the 88–97 loop, which, when perturbed by the simultaneoussubstitution of the two loop-endswith twoβ-turns, results in decreasedfunctionality of SK without any effect on the binary interactions of themolecule. Notably, neither the individual beta-turn mutants of the loop(SKIV88,91PA or SKDD95,96SK), nor themany Ala-substitutedmutants of thecorresponding residues (SK88–97-Ala), were seen to cause any markedchange in the overall β-turn propensity by MDS. The observation thatthis cleanly co-relates with a lack of any functional alteration in thesesubstitutionmutants lends credence to thenotion that the loop's rigidityis the underlying cause for altered function. However, the fact that onlyminimal changes, at best, are observed in either theKmvalues forHPGorthe ternary Kd values by SPR for the functionally altered mutantssuggests that the loop movement is probably a critical feature incatalysis rather than a static role in substrate binding or dockingphenomenon. It is not unlikely that several substrate-interacting sites(with the 88–97 loop and the 250-loop of SK being only two of suchsites) co-operate together in holding the substrate at the active site,some holding the catalytic domain and the others interacting with thekringles of substrate HPG, thereby stabilizing the ternary complex, and –

once the substrate is converted to product after scissile peptide cleavagein the former – rapidly participating in the release of the product as avirtue of their in-built flexibility characteristics. One approach toexperimentally validate this scenario is to examine the synergy/additivity, during catalysis, of all such substrate-interacting sitesincluding the 88–97 loop, by quantitatively comparing the functional

behavior of single-site, double-site and higher-order mutants of SK.Indeed, preliminary results from such studies (R. Aneja, S. Yadav and G.Sahni; unpublished observations) validate this mechanistic hypothesisof SK action.

Acknowledgements

The authors thank Ms Paramjit Kaur for her expert technicalassistance, and the Blood Bank, Govt. Medical College, Chandigarh forthe human plasma. This work was supported by grants from theCouncil of Scientific and Industrial Research, and the Department ofBiotechnology, Govt. of India.

References

[1] M.A. Parry, X.C. Zhang, I. Bode, Molecular mechanisms of plasminogen activation:bacterial cofactors provide clues, Trends Biochem. Sci. 25 (2000) 53–59.

[2] H.R. Lijnen, Elements of the fibrinolytic system, Ann. N. Y. Acad. Sci. 36 (2001)226–236.

[3] P. Wallen, B. Wiman, Characterization of human plasminogen. I. On therelationship between different molecular forms of plasminogen demonstratedin plasma and found in purified preparations, Biochim. Biophys. Acta 221 (1970)20–30.

[4] D. Collen, Staphylokinase: a potent, uniquely fibrin-selective thrombolytic agent,Nat. Med 4 (1998) 279–284.

[5] F.J. Castellino, Recent advances in the chemistry of the fibrinolytic system, Chem.Rev. 81 (1981) 431–446.

[6] C.T. Esmon, T. Mather, Switching serine protease specificity, Nat. Struct. Biol. 5(1998) 933–937.

[7] ISIS-3 (Third International Study of Infarct Survival) Collaborative Group, Arandomized comparison of streptokinase vs tissue plasminogen activator vsanistreplase and of aspirin plus heparin vs aspirin alone among 41229 cases ofsuspected acute myocardial infarction, Lancet 339 (1992) 753–770.

[8] P.E. Battershill, P. Benfield, K.L. Goa, Streptokinase. A review of its pharmacologyand therapeutic efficacy in acute myocardial infarction in older patients, DrugsAging 4 (1994) 83–86.

[9] V.J. Marder, Recombinant streptokinase: opportunity for an improved agent, BloodCoagul. Fibrinolysis 4 (1993) 1039–1040.

[10] F. Conejero-Lara, J. Parrado, A.I. Azuaga, R.A. Smith, C.P. Ponting, C.M. Dobson,Thermal stability of the three domains of streptokinase studied by circulardichroism and nuclear magnetic resonance, Protein Sci. 5 (1996) 2583–2591.

[11] J. Parrado, F. Conejero-Lara, R.A. Smith, J.M. Marshall, C.P. Ponting, C.M. Dobson,The domain organization of streptokinase: nuclear magnetic resonance, circulardichroism, and functional characterization of proteolytic fragments, Protein Sci. 5(1996) 693–704.

[12] G. Markus, W.C. Werkheiser, The interaction of streptokinase with plasminogen.Functional properties of the activated enzyme, J. Biol. Chem. 239 (1964)2637–2643.

[13] L. Summaria, B. Hsieh, K.C. Robbins, The specific mechanism of activation ofhuman plasminogen to plasmin, J. Biol. Chem. 242 (1967) 4279–4283.

[14] D. Nihalani, G. Sahni, Streptokinase contains two independent plasminogen-binding sites, Biochem. Biophys. Res. Commun. 217 (1995) 1245–1254.

[15] G.Y. Shi, B.I. Change, D.H. Wu, Y.M. Ha, H.L. Wu, Activation of human and bovineplasminogens by the microplasmin and streptokinase complex, Thromb. Res. 58(1990) 317–329.

[16] X. Wang, X. Lin, J.A. Loy, J. Tang, X.C. Zhang, Crystal structure of the catalyticdomain of human plasmin complexed with streptokinase, Science 281 (1998)1662–1665.

[17] J. Dhar, A.H. Pande, V. Sundram, J.S. Nanda, S.C. Mande, G. Sahni, Involvement of anine-residue loop of streptokinase in the generation of macromolecular substratespecificity by the activator complex through interaction with substrate kringledomains, J. Biol. Chem. 277 (2002) 13257–13267.

[18] D.G. Deutsch, E.T. Mertz, Plasminogen: purification from human plasma by affinitychromatography, Science 170 (1970) 1095–1096.

[19] D. Nihalani, G.P.S. Raghava, G. Sahni, Mapping of the plasminogen binding site ofstreptokinase with short synthetic peptides, Protein Sci. 6 (1997) 1284–1292.

1318 S. Yadav et al. / Biochimica et Biophysica Acta 1784 (2008) 1310–1318

[20] V. Sundram, Structure–function studies of streptokinase, PhD thesis, JawaharlalNehru University, New Delhi, India, 2002.

[21] D.A. Case, T.A. Darden, T.E. Cheatham III, C.L. Simmerling, J.Wang, R.E. Duke, R. Luo,K.M. Merz, B. Wang, D.A. Pearlman, M. Crowley, S. Brozell, V. Tsui, H. Gohlke, J.Mongan, V. Hornak, G. Cui, P. Beroza, C. Schafmeister, J.W. Caldwell, W.S. Ross, P.A.Kollman, AMBER 8, University of California, San Francisco, 2004.

[22] W.L. DeLano, The PyMOL Molecular Graphics System, DeLano Scientific, SanCarlos, CA, USA. http://www.pymol.org, 2002.

[23] G.D. Hawkins, C.J. Cramer, D.G. Truhlar, Pairwise solute descreening of solutecharges from a dielectric medium, Chem. Phys. Lett. 246 (1995) 122–129.

[24] W. Humphrey, A. Dalke, K. Schulten, VMD — visual molecular dynamics, J. Molec.Graphics 14 (1996) 33–38.

[25] G.Y. Shi, H.L. Wu, Isolation and characterization of microplasminogen. A lowmolecular weight form of plasminogen, J. Biol. Chem. 263 (1988) 17071–17075.

[26] K.W. Jackson, N. Esmon, J. Tang, Streptokinase and staphylokinase, MethodsEnzymol. 80 (1981) 387–394.

[27] R.C. Wohl, L. Summaria, K.C. Robbins, Kinetics of activation of human plasminogenby different activator species at pH 7.4 and 37 degrees C, J. Biol. Chem. 255 (1980)2005–2013.

[28] T. Chase Jr., E. Shaw, Comparison of the esterase activities of trypsin, plasmin, andthrombin on guanidinobenzoate esters, titration of the enzymes, Biochemistry 8(1969) 2212–2224.

[29] D.K. McClintock, P.H. Bell, The mechanism of activation of human plasminogen bystreptokinase, Biochem. Biophys. Res. Commun. 43 (1971) 694–702.

[30] R.C. Wohl, Interference of active site specific reagents in plasminogen–strepto-kinase active site formation, Biochemistry 23 (1984) 3799–3804.

[31] R. Cush, J.M. Cronin, W.J. Stewart, C.H. Maule, J. Molloy, N.J. Goddard, The resonantmirror: a novel optical biosensor for direct sensing of biomolecular interactions.Part I: principle of operation and associated instrumentation, Biosensors &Bioelectronics 8 (1993) 347–354.

[32] P.E. Buckle, R.J. Davies, T. Kinning, D. Yeung, P.R. Edwards, D. Pollard-Knight, C.R.Lowe, The resonant mirror: a novel optical biosensor for direct sensing ofbiomolecular interactions Part II: applications, Biosensors & Bioelectronics 8(1993) 365–370.

[33] F. Conejero-Lara, J. Parrado, A.I. Azuaga, C.M. Dobson, C.P. Ponting, Analysis of theinteractions between streptokinase domains and human plasminogen, Protein Sci.7 (1998) 2190–2199.

[34] D.G. Myszka, Kinetic analysis of macromolecular interactions using surfaceplasmon resonance biosensors, Curr. Opin. Biotechnol. 8 (1997) 50–57.

[35] T.A. Morton, D.G. Myszka, I.M. Chaiken, Interpreting complex binding kineticsfrom optical biosensors: a comparison of analysis by linearization, the integratedrate equation, and numerical integration, Anal. Biochem. 227 (1995) 176–185.

[36] V. Sundram, J.S. Nanda, K. Rajagopal, J. Dhar, A. Chaudhary, G. Sahni, Domaintruncation studies reveal that the streptokinase–plasmin activator complexutilizes long range protein–protein interactions with macromolecular substrateto maximize catalytic turnover, J. Biol. Chem. 278 (2003) 30569–30577.

[37] L.F. Lin, A. Houng, G.L. Reed, Epsilon amino caproic acid inhibits streptokinase–plasminogen activator complex formation and substrate binding through kringle-dependent mechanisms, Biochemistry 39 (2000) 4740–4745.

[38] P.Y. Chou, G.D. Fasman, Beta-turns in proteins, J. Mol. Biol. 115 (1977) 135–175.[39] J.A. Loy, X. Lin, M. Schenone, F.J. Castellino, X.C. Zhang, J. Tang, Domain interactions

between streptokinase and humanplasminogen, Biochemistry 40 (2001) 14686–14695.[40] R.C. Wohl, L. Arzadon, L. Summaria, K.C. Robbins, Comparison of the esterase and

human plasminogen activator activities of various activated forms of humanplasminogen and their equimolar streptokinase complexes, J. Biol. Chem. 252(1977) 1141–1147.

[41] M.A. Parry, C. Fernandez-Catalan, A. Bergner, R. Huber, K.P. Hopfner, B. Schlott,K.H. Guhrs, W. Bode, The ternary microplasmin–staphylokinase–microplasmincomplex is a proteinase–cofactor–substrate complex in action, Nat. Struct. Biol. 5(1998) 917–923.