Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija...

13
Role of S-layer proteins in Role of S-layer proteins in probiotic activity probiotic activity of of Lactobacillus Lactobacillus strains strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković Laboratory for antibiotic, enzyme, probiotic and starter cultures technology Department of Biochemical Engineering Faculty of Food Technology and Biotechnology, University of Zagreb, Croatia The 2nd International Symposium „VERA JOHANIDES” BIOTECHNOLOGY IN CROATIA by 2020 Zagreb, May 10-11, 2013

Transcript of Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija...

Page 1: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

Role of S-layer proteins in probiotic activity Role of S-layer proteins in probiotic activity of of Lactobacillus Lactobacillus strainsstrains

Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković

Laboratory for antibiotic, enzyme, probiotic and starter cultures technology Department of Biochemical Engineering

Faculty of Food Technology and Biotechnology, University of Zagreb, Croatia

The 2nd International Symposium „VERA JOHANIDES”BIOTECHNOLOGY IN CROATIA by 2020

Zagreb, May 10-11, 2013

Page 2: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

Strategy for the selection of probiotic strains inLaboratory for antibiotics, enzymes, probiotics and starter cultures technology

(Šušković et al., 1992.)

Accurate taxonomic

identifications

Biosafety

Resistance to pH, gastric juicebile, pancreatic juice

(Antibiotic susceptibility)

Activity and viability

Adherence to intestinal epithelium/tissue

Antimicrobial activityAntagonism to pathogens

Stimulation immune response

Influencingmetabolic activities

General

Technological(production/processing)

Functionalaspects

GRAS (Generally Regarded As Safe, according US FDA) status of selected strains

PhD Thesis (Šušković, 1996)

PhD Thesis (Šušković, 1996)Master Thesis (Kos, 1995)PhD Thesis (Uroić, in progress)

PhD Thesis (Šušković, 1996)Master Thesis (Frece, 2003)PhD Thesis (Leboš Pavunc, 2012)

PhD Thesis (Kos, 2001)PhDThesis (Uroić, in progress )PhD Thesis (Beganović, 2008)

PhD Thesis (Šušković, 1996)PhD Thesis (Kos, 2001) PhD Thesis (Leboš Pavunc, 2012)

PhD Thesis (Frece, 2007)PhD Thesis (Beganović, 2008)PhD Thesis (Uroić, in progress)

BCCM confirmed taxonomic nomenclature of our 9 selected strains: Lactobacillus helveticus M92, L. plantarum L4, L. brevis D6, L. brevis ZG1, L. brevis SF9B, L. paraplantarum SF15B, L. fermentum A8, Enterococcus faecium L3, E. faecium A7…

Page 3: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

• monomolecular crystalline arrays composed of (glyco)proteins• located on external side of cell envelope • identified in different microorganisms from the domains of Bacteria and Archaea• detected in just a few strains among 117 know Lactobacillus species:

– lower MW : 25-71 kDa– highly basic proteins (pI = 9.35-10.4) – mostly non-glycosylated – signal peptide (N- terminal secretion signal ) typical for Sec pathway (25-30 AA)

S-layer

cell membrane

cell wall

S-layer present on the L. brevis D6 cell surfaceperformed by transmission electron microscopy (PhD in progress, Ksenija Uroić)

Characteristics of Lactobacillus S-layer proteins

Page 4: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

1. L. helveticus M922. L. plantarum L4S- DNA standard

1 2 S

PCR analysis with the specific primers ATGAAGAAAAATTTAAGAAT and

CACCGATCTTGTAGTA.

slpA gene (GenBank acession number HM140425)

Detection of S-layer proteins of Lactobacillus strains from Laboratory of antibiotics, enzymes, probiotics and starter cultures technology

S-layer proteins:1. L. paraplantarum SF15B 2. L. brevis D63. L. brevis ZG14. L. brevis SF9B

SDS-PAGE surface protein profiles

Page 5: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

L. helveticus M92 S-layer protein identified by SDS-PAGE coupled to LC-MS/MS

SlpA protein

Peptide sequences assigned to SlpA protein by Bioworks 3.2.

S – low MW protein standard;1 – S-layer, purified by dialysis

S 1

Nano HPLCPeptide separation

(LC-MS/MS)

nESI linear ion trap-MS

Beganović et al., (2010) Journal of Proteomic Research, 9 (2): 677-688Beganović et al., (2011) Antonie van Leeuwenhoek, 100 (1): 43-53

Page 6: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

1. Adhesion of Lactobacillus strains to IPEC-1 cell line (porcine intestinal epithelial cells)

Lactobacillus strains are labeled by thymidine and the radioactivity of the samples was measured by liquid scintillation (L. helveticus M92 as reference strain)

Role of S-layer proteins in probiotic activity of Lactobacillus strains

Page 7: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

2. Inhibition of adhesion of enterotoxigenic Echerichia coli to IPEC-1 cell line by Lactobacillus strains

- - COMPETITIONCOMPETITION - -simultaneous addition of

Lactobacillus and E. coli ERL 2055

- - DISPLACMENTDISPLACMENT - -addition of Lactobacillus

after incubation of E. coli ERL 2055

- - EXCLUSIONEXCLUSION - -addition of Lactobacillus

before incubation of E. coli ERL 2055

Role of S-layer proteins in probiotic activity of Lactobacillus strains

Page 8: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

3. Imunomodulation mediated by Lactobacillus purified S- layer proteins

1 - L. brevis GRL12 - L. amylovorus GRL 11103 - L. amylovorus GRL 11114 - L. amylovorus GRL 11125 - L. helveticus M926 – L. plantarum D6

• Extraction of S-layers from Lactobacillus cell surface1 2 3 4 5 6

Role of S-layer proteins in probiotic activity of Lactobacillus strains

Page 9: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

Induction of IL-1, IL-6, IL-10, IL-12, TNF cytokines production in human monocyte-derived dendritic cells with Lactobacillus strains and purified

S-layer proteins - determined by cytokine specific ELISA

Page 10: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

Stimulation of HEK Blue cell lines -TLR2, TLR4, TLR5 and NOD2- with Lactobacillus strains and purified S-layer proteins

Page 11: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

Maturation of dendritic cells in response to Lactobacillus bacterial cells and purified S-layer proteins analysed by Flow Cytometric Analysis (FACS)

Bacteria/S-layer proteins induced expression of moDC maturation markers HLA class II, CD86 and CD83

Page 12: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

Biotechnological protocol in Laboratory for antibiotics, enzymes, probiotics and starter cultures technology,

for probiotic and starter culture production technology

Inoculation

Inoculum

Phenotypic characterisation probiotic strain / starter culture

Collection of lactic acid bacteria (ZBMK) over than 300 characterised LAB strainsCollection of lactic acid bacteria (ZBMK) over than 300 characterised LAB strains

GrowthGrowth

Nutrient medium removal

Wet biomass of probiotic / starter culture

LYOPHILIZATIONLYOPHILIZATION

Probiotic bacterium/ starter culture

Probiotic bacterium/ starter culture

functionality control

Growth medium

Sterilisation

Production process control: - microbiological control - genetic control

lyoprotectant addition

MIKROENCAPSULATIONMIKROENCAPSULATION

MICROENCAPSULATIONMICROENCAPSULATION

microbiological control genetic control

microbiological control genetic control

Page 13: Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković.

o National scientific project “Probiotics, prebiotics and functional starter cultures” No. 058- 1990-

2007

o International project SEE-ERA.NET PLUS: PSALAB No. 195/1

Project leader: PhD Jagoda Šušković, full prof.

o Collaborative project with research team of PhD Airi Palva, prof., University of Helsinki, Finland

SCIENTIFIC PROJECTS & COLLABORATIONS: