~------------------------------ ----

STRUCTURE-FUNCTION ANALYSIS OF THREE WIDELY DISPERSED POINT MUTATIONS IN THE HORMONE-BINDING DOMAIN OF THE HUMAN A..J,,(f\ROGEN

RECEPTOR.

NELLY SABBAGHIAN Department of B iology

McGill Univers ity Montréa l, Québec

Hay 1994.

A thesis submi tted to the Faculty of Graduate studi es and Research in partial fulfillment of the requirements for the

degree of Haste! of Science.

Nelly Sabbaghian (c) 1994

Structurc-function analysis of mutations in the hUlnan androgen receptor

ThiS thes \ ~ carr J es a

tOt:.~.L of ,), crec\i ts

1

crerHt welght of 3'3 credits, frem a

requirt:-d for the Haster 's deqree.

Gra.dllate cr~ci ~ ts a.e e a measure of the t lme ass igned te a

give n tas!{ lr '"he qr,;tdlp,tE! program. They are based on the

consider-:>·. ~t'f" ~ .lt cl term of full-time qraduate work is

eqili ValE::I 1 ~,' _ ',0 16 crodits, depending on the intensity

of the pr.'1gram.

ii

ABSTRACT

Three point. mutations have been .round in the hormone­

olnding domain (HBD) of the human androgen receptor (hAR):

one in the N-terminal end [Ile663A3n in a family with

partial androgen insensitivlty syndrome (PAIS)]; on...: in the

middle, (Leu82.oVal in a family with PAIS); and one in the C­

terminal end (Pro9.o3Ser, in a family with complete AIS).

The positions 663 and 9.03 were the most terminal mutation

sites in the HBD found to date. The three mutant hARs have

been pr ev i ous ly char acter i zed b i ochemi cally in gen ital s k in

fibroblasts. In the family with the Leu820Val substitution,

the mother and the grandmother were found to be carriers for

the same mutation. To prove their pathogenicity, each of

the three mutat ions has been reproduced in an hAR e:-:press ion

vector that was transfected into COS-l cells. In COS-l

ce l1s, the complexes fr om Pr 0 9.0 3Ser and Leua 2 aVal had:

increased thermolability; increased dissociation rates;

decreased affinitYi and abnormal transactivation. There was

a hierarchy in the sever i ty of the mutations expressed in

kine+::ic and transactivation assays that correlated with the

severity of the cliplcal phenotype. The pathogenicity cf

the Pro903Ser and the Leu820Vai mutations was thereby

confirmed. In COS-l cells, the AR with Ile663Asn had normal

thermolability, normal dissociation rates, and normal

transactivation, but a decreased aH lnity. Although this

sequence al teration has only been found in a PAl S patient,

l ts pathogenic i ty is not cons idered to be proven. More

sens i t ive assays ar e needed for this purpose.

i i i

RESUME

TI: ois mutat i ons dans le r éeepteur androgène huma in ont

été identifiées dans trois familles atteintes par le

~yndrorne de l'insensibilité aux androgènes. La première,

(isoleucine663asparagine, trouvée dans une famille atteinte

de la forme partielle du syndrome) est située à l'extrémité

N-termi nale, l'autre (l eue i ne 8 20va li ne, trouvée dans une

famille atteinte par la forme partielle) au centre, et la

troisième (proline 903 serine, trouvée dans une famille avec

la forme complète) à l' extrémi té C-termi nale du doma ine de

liaison avec l'hormone. Le caractère biochimique du

récepteur androgène a été étudié auparavant dans les

fibroblastes géni taux des patients. Dans l'une des

familles, la mère et la grand-mère maternelle ont été

trouvées hétérozygotes pour le syndrome. Les tro is

mutat i ons ont été repr odui tes, sépar émen t, dans un vecteur

qui a été exp?:imé dans les cellules COS-l. Cette méthode a

été utilisée pour prouver leur pathoqénie. Dans les

cellules COS-l, les mutations Pro903Ser et Leu820Val se sont

manifestées par: une sensIbilité thermale élevée des

complexes hormones-récepteurs; des dissociatlons rapides des

complexes; une affinité affaiblie aux androgènes; et une

act i v i té de transcr ipt i on d imi nuée. Nous avons cons taté une

corrélation entre la sévér i té des mutat ions, démontI: ée par

les essais de liaison avec l'hormone et de l'activité de

transcr ipt i on, et le phénotype clin i que des pat lents. Cec i

a prouvé la pathogénie de ces deux mutat ions. Cependant, la

mutation à la position 663, exprimée dans les cellules COS-

iv

l, a produ i t un récepteur mu tant f orman t des comp 1 exes

stables avec une augmentation de température; des taux de

dissociation normaux; et une activité de transcription

normale, mais une affinité réduite. La pathogénie de cette

muta t i on n' a pas é té pro uvée. Des expér l ences plus

sensibles seralent nécessaires à cette fin.

v

ACKNOWLEDGEHENTS

1 would like ta thank: Dr. Leonard Plnsky for qlvinq me

the opportunity to further my studies, and for hlS gUIdance

ln preparing this thesis; Dr. MorrIs Kautman, Dr. Mark

Triflro and Parsa Kazemi-Esfarjani for helpful discusslons;

Dr. Lenore Beitel for the help ln subcloning in the

baculov i r us plasmid; Rose Lumbr osa for techn ica l he Ip in

ampl if yi rig exon 1; Dana Shko Iny f or inter est i ng d iscuss Ions,

and moral support; Sylvie Bordet for glving me the interest

ta wori{ with one a f the mutant andr ùgen r eceptor si and

Carlos Alvarado for technical help ln transfections, .:Jnd

western blotting, and for his friendship.

vi

TABLE OF CONTENTS

Abstract ............ . . ..•..•.••• l i • •••••••• l l i Rés u mé . . . . . . . . . . .... .

Ack nowlegements ..... . . .......... v Abbrevlat Ions ....... . • ...•••• V 11 l

List of figurE'5 .... . •...••....• x i List nE tables ..... . · ........ xv i

1. 1 NTRODUCTI ON 1. Sterold hormones and their precursoIs .•......•..... 1 2. Superfaml1y of steroid receptors ................... 2

2 .1 A common ancestor gene ....•....•......•..... 3 3. structure-Eunction properties oE steroid receptors.5

3.1 The N-te]~mina1 domain ....................... 5 3.2 The DNA-binding domë.in ...................... 6

3.2.1 Dimerization subdomaln ...•........ 10 3.2.2 The hinge reglon .................. 11 3.2.3 Subcellular SR localization ....... 12

3 . 3 The ho r mon e - b l n d l n 9 d 0 ma ln. . . . . . . . . . . . . . ... 1 2 3.3.1 Hsp90-blnding and transcrlptional

repression ........................ 13 4. Androgen insensitlvity ...........•....•......•.... 14

4.1 Androgen hormone act ion ...•.....•.....•.... 14 4.2 Androge:n insensitivity syndromes ........... 16

4.2.1 Complete androgen insen:=;itivity ... 16 4.2.2 Partial androgen insensitivlty .... 17

4.1 Biochemical characterization of the hAR .... 18 4.4 Structure-functlon properties of the hAR ... 18 ~ . 5 Mut a t l 0 n sin the h AR . . . . . . . . . . . . . . . . . . • . . . . 2 4

5. ObjectIves ....•.......................•......•.... 29

II. MATERIALS AND METHODS 1. Ma ter i aIs ..................•.....••.•.••.....•.... 30

1.1 Families ..................•....•.....••.... 30 1.2 Primer synthesis ..........••.••••.....••... 30 1.3 Pr imary and secondary PCR .....•.......•.... 31 1.4 PurificatIon of DNA ........................ 31 1.5 Subcloning .....................••.......... 32 1.6 Sequencing ...............•••...••.....•.... 32 1.7 Exon 1 ampilfication and sequencing ........ 32 1.8 Tissue culture ...........••....••...•••••.. 32 1.9 Transfection ....................•.....•.... 33 1.10 Androgen--binding assays .•.•...••....••.... 33 1. l1 Growth hormone assay ...........•.......... 34 1.12 l3-galactosidase assays .................... 34 1.13 Western b10tting ...............•....••.... 34

1.13.1 Cel1 lysis and protein assay ..... 34 1.13.2 Gel electrophoresis .............. 35 1.1?3 Prote in transfer ................. 35

2 . He th od 5 • • • • • • • • • . • • • • . . . . • • . . . • • • • • • • • • • • • • • • •••• 3 5 2.1 Identification of mutatlons ..........••.... 36 2.2 Exon 1 ampllficatlon and sequencing ........ 36 2.3 Family studies •...........•....•••..•...... 36

VIi

2.4 Expresslon vectors....... ............ lG 2.4.1 pSVhl\Ro/BHEX ..................... lb

2.4.2 pMMTV-GH .......................... 37 2.5 Stte-directed mutagenesls .................. 17

2 . 5 . 1 P r 1 me r s . . . . . . . . . . . . . . . . . . .. . ..... J 9 2.5.2 Prlmary PCR •......•••..••..•••.•.. 3'1 2."'.3 Secondary PCR ............... '" .. 39

2.6 Purification of DNA fragments .............. 40 2.7 Subc1oning ................................. 40

2.7.1 RestrictIon endonuclf'élSe cllgest-Ion'IO 2.7.2 LlgatIon .......................... 42 2.7.3 Com~etent cells ................... 47 2.7.4 Transformatton and screenlng of

colonies .......................... 42 2 . 8 La r 9 e - s c a 1 e D N A a mp Il fic a t I on . . . . .......... 4 3 2.9 SequencIng ................................. 43 2.10 Tissue culture ............................ '13 2.11 Transfection .............................. 44 2.12 Cotransfectlon ............................ 44

2.12.1 Transactlvation dnd growth hormone assay .................... 45

2 . 1 3 An d r 0 9 e n - b i n d i n 9 as s a ys. . . . . . . . . . . . . . . . . . 4 6 2.13.1 Nonequi1ibrium dissociatlon r~te

cons tants ........................ 46 2.13.2 Thermol~bility ot complexes ...... 47 2.13.3 Apparent equillbrium dissociatIon

rate constants ................... 47 2.14 r3-ga1actosidase assay .................... 47 2.15 Western blotting ......................... 48

2.15.1 Cell lySlS and protein determination .................... 48

2.15.2 Discontlnuous SDS-PAGE ........... 49 2.15.3 Proteln transfer ................. 49

III. RESULTS 1. Identification of mutations ....................... 51 2. Fami1y studies .................................... 51

2.116588 (Leu820Va1) .......................... 51 2.2 1609/6003 (Pro903Ser) ...................... 57 2 . 3 6 0 5 (1 1 e 6 6 JAs n ) . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57

3. Site-directed mutagenesis ......................... 61 4. Androgen-binding assays ........................... b2

4.1 Genital skin fibroblasts ................... 62 4.2 Transfected COS-1 celIs .................... 61

4.2.1 Thermolab11ity .................... 64 4.2.2 Nonequilibrium dissociatlon rates.65 4.2.3 Apparent equi1ibrium dlssoclation

rate constants .................... 72 5. Transacrivation assays ............................ 76 6. Western blottlng .................................. 82 7. Exon 1 amplification and sequencing ............... 82

IV. DISCUSSION ....•..............•...................... 85 V. CONCLUS 1 ON .......•..•.••••....•...•......•.......... 95 VI. REFERENCES ..............................•........... 97

~----------------------- ------

vili

LIST OF ABBREVIATIONS

AI Androgen insensitivity

AIS Androgen insensitlvity syndrome

AMH Anti-Mullerian hormone

AR Androgen receptor

ARE Androgen response element

Asn As~aragine

Bmax Maximal binding capacity

CAlS Complete androgen insensitivity

CAT Chlorarnphenicol acetyl transferase

cDNA Complernentary deoxyribonucleic acid

COUP-TF Chicken ovalburnin upstream prornoter transcription

factor

DBD DNA-binding domain

DHT 5a-dihydrotestosterone

ER Estrogen receptor

ERE Estrogen response element

ERRl and ERR2 Estrogen related receptors 1 and 2

GAL4 Yeast transcription factor

GH Growth hormone

GR Glucocorticoid receptor

GRE Glucocorticoid response element

hAR Human androgen receptor

HBD Hormone-binding dornainhGR

hGR Human glucocorticoid receptor

hER Human estrogen receptor

lX

hHR Human mineralocortlcold receptor

hPR Human progesterone receptor

HRE Hormone response element

HSP Heat shock protein

Ile Isoleucine

Leu Leucine

HAIS Hild androgen insensitivity

MB Mibolerone

MHTV-LTR Mouse mammary tumour virus-long terminal repeat

MR Mineralocorticoid receptor

MT Methyltrienolone

NLl and NL2 Nuelear loealization signal 1 and 2

PAIS Partial androgen insensitivity

PB Probasin gene

PR Progesterone reeeptor

PSA Prostate specifie antigen

RAR Retinoic acid reeeptor

rAR Rat androgen reeeptor

SBMA Spinal bulbar muscular atrophy

Ser Serine

Slp Mouse sex limited protein

SR Steroid receptor

SVP Sevenup gene produet

T Testosterone

TR Thyroid hormone receptor

TK Thymidine kinase

TRE Thyroid hormone response element

x

Val Valine

VP16 Herpes virus protein

LIST OF FIGURES

Fig. 1: Biosynthetic pathway of steroid hormones from

cholesterol.

Fig. 2: structure-function organization of the nuc!ear

receptor superfamily (Wahli and Martinez 1991).

xi

Fig. 3: Proposed phylogenetic tree for the nuclear receptor

gene superfamily (Laudet et al., 1992),

Fig. 4: structure of the DNA-binding domain of the rat

glucocorticoid receptor and a variety of consensus

sequences of hormone response elements (Freedman

and Luisi 1993).

Fig. 5: 1 Formation of the internal genital tract in male and

female embryos (Wilson et al., 1981).

Fig. 6: Conversion of testosterone to 5Œ-dihydrotestosterone

by the enzyme 5Œ-reductase (Wilson et al., 1981).

Fig. 7: Formation of the external genital tract in male and

female embryos (Wilson et al., 1981).

Fig. 8: cDNA sequence and deduced amino acid sequences of

the rat and human androgen receptor (Chang et al.,

1988).

xii

Fig. 9: Exonic and modular structure-function organlzation

of the human androgen receptor (Pinsky et al.,

1992).

Fig. 10: Amino acid sequence homology among various steroid

receptors (Chang et al., 1988).

Fig. Il: Human androgen receptor expression vector (pSVhAR o )

(Brinkmann et al., 1989).

Fig. 12: Modified human androgen receptor expression vector

(pSVhARo/BHEX) .

Fig. 13: Human ~~owth hormone reporter cunstruct (pMMTV-GH)

(Prior et al., 1992).

Fig. 14: Steps for PCR mutagenesis (Higuchi 1990).

Fig. 15: Sequencing d~ta of the 11e663Asn mutation.

Fig. 16: Sequencing datd of the Leu820Val mutation.

Fig. 17: Sequencing data of the Pro903Ser mutation.

Fig. 18: Chemica1 structure of the amino acids involved in

the three mutations.

xiii

Fig. 19: Nucleotide sequence of exon 7 and locatIon of the

primers and HphI digestion sites in Leu820Val.

Fig. 20: Family study of 16588 (Leu820Val).

Fig. 21: Nucleotide sequence of exon 8 and location of the

primers and the abolished Bsp12861 site in

Pro903~er.

Fig. 22: Family study of 1609/6003 (Pro903Ser).

Fig. 23: Thermolabi1ity of complexes in COS-1 celis

transfected with the three mutat;ons separately.

Fig. 24: Thermolability of the three mutant and control

unliganded receptors expressed in CûS-1 cells.

Fig. 25: Dissociation assay of Pro903Ser and control in

transfected COS-l cells with mibolerone and methyl­

trienolone.

Fig. 26: Dissociation assay of control, Leu820Val, and

Ile663Asn in COS-l cells with mibolerone and methyl­

trienolone.

Fig. 27: Scatchard analysis of the three mutations in COS-l

cells with mibolerone.

xiv

Fig. 28: Scatchard analysis of the three mutatIons in COS-l

cells with methyltrienolone.

Fig. 29: Transactivation of pMMTV-GH in a cotransfection

assay in COS-1 cells with a control and the three

mutations (values corrected for transfection

efficiency) .

Fig. 30: Androgen-binding activity in COS-l cells cotrans­

fected with control and the th~ee mutati0ns with

pMMTV-GH in the 48-50 h group, 48 h group, and the

94-96 h group (values corrected for transfection

efficiency) .

Fig. 31: Transactivation of human growth hormone per unit

MB-binding activity of control and the three mutant

receptors.

Fig. 32: Western blot of proteins extracted from GSF of 605,

16588, and 6003.

Fig. 33: Mode1 for interactions of the progesterone receptor

with hormone and antihormone (Baniahmad and Tsai

1993).

Fig. 34: Amino acid sequence of the hinge region of the ruman

androgen, glucocorticoid, progesterone, and minera-

1ocorticoid receptors.

xv

LIST Ol? TABLES

Table 1: Various putative androgen response elements and the

consensus glucocorticoid response elements (Roche

et al., 1992; and Rennie et al., 1993).

Table 2: Summary of base and codon substitutions of the

three mutations with the biochemical phenotype of

the mutant androgen receptors and the clinical

phenotype of the patients.

Table 3: Mean nonequilibrium dissociation rate constants ~or

mibolerone, methyltrienolone, 5«- dihydrotesto~te­

rone, and testosterone in GSF ar.d ln COS-l r~lls

transfected with the control or mutant AR.

Table 4: Mean apparent equilibrium dissociation rate cons­

tants of the three mutant AR in COS-l cells with

mibolerone and methyltrienolone.

1

1. INTRODUCTION:

1. Steroid hormones and their precursors:

The biochemical beginning of the twentieth century was

marked by the discovery, isolation and synthesis of steroid

hormones. The field of steroid chemistry developed rapidly

from 1929 to the mid 1950s: this period has been called the

"golden age" of steroid research. Estrone, the first sex

hormone to be recognized, was isolated in 1929. By the end

of the fourth decade, the rest of the sex hormones were

discovered and synthesized. The major medical discoveries

in that period included: the us~ of cortisone in treatment

of rheumatoid arthritis, and the contraceptive quality of

progesterone (Gortler and Sturchiù 1992).

Cholesterol, the main biosynthetic precursor of steroid

hormones, i s a ub i qu i tous substance in eukaryotes, but is

absent in prokaryote~. Its basic structure is an isoprene

un i t (i sopentyl pyrophospha te), a 5-car bon cha in that is • formed from acetate. Condensation of four isoprene units

forms a substance called a terpene (squalene C30 ), then

cyclization and further modification of the latter produce

cho lestero 1 (C:a 7) • Crucial hydroxylation of cholesterol

produces the sterold hormones (Stryer 1988a), including: the

progestagens (progesterone), which prepare the lining of the

uterus for implantation of the ovumi mineralocorticoids

(aldosterone), which promote reabsorption of sodium and

chloride ions by the kidney to maintain blood volume and

blood pressure; glucocorticoids (cortisol), which promote

gluconeogenesis and degradation of fat and protein;

FUNCTION

DNA-binding

Ligand-binding

Dimerization

Nuc1ear localization

Transactivation

HSP90-binding

CI l'II

A/B

N __ ~~

-•••••••••• •••••••••

1 ••••••••• • •••••••• 1

F

E}-C ? .

Fig. 2: structure-function organization of the nuç1ear

receptor superfamily. A/B indicates the N-terminal

domain; C represents the D~A-binding domain anJ i8

subdivlded into the CI (first zinc-flnger) and the

Clr (second zinc-finger); D is the hinge reglon; E

represents the hormone-b1nding damain, F 15 present

in the ER, the RAR and others, but its functlon (if

any) 1s not known (Wahli and Martinez 1991).

androgens <testosterone), which

development of primary and

characteristics; and estrogens

2

are responsible for the

secondary male sexual

(estradiol), which are

responsible for the development of female secondary sex

characterlstics (Fig. 1).

2. Superfamily of steroid receptors:

In contrast to peptide hormone receptors that reside in

the cell membrane, steroid receptors (SRs) are found inside

the cell. Sorne SRs are predominantly cytoplasmic and others

are nuclear. They are distinct in their ability to act as

llgand-induced transcr iption regulators. SRs mediate the

action of steroid hormones by binding to their cognate

ligand, and translocating into the nucleus where they bind,

as dimers, to specifie DNA sequences called hormone response

elements (HREs), usually located ln the promoter region,

upstream of target genes. This process activates or

represses the genes in question.

The genes encoding the SRs are members of a large

nuclear receptor superfamily that comprises the receptors

for steroid hormones, thyroid hormones, retinoic acid and

vitamin 0 (Evans et al., 1992). Other protelns with similar

structural and functional characteristics are called "orphan

receptors" because their ligands are unknown (Laudet et al.,

1992). The chicken ovalbumin upstrea~ promoter

transcription factor (COUP-TF) is one such "orphan

receptor". It recognizes a promot~r sequence important in

the efficient transcription of the ovalbumin gene (O'Halley

et al., 1990), and structurally i t i5 related to three

Glucocorticoids (C21 )

Cholesterol (Cv)

l Pregnenolone (C11)

l Progestagens (C 21 )

Mineralocorticoids (C21)

Androgens (C I9)

l Estrogens

(Cu)

Fig. 1: A simplif:ed biosynthetic pathway of steroid hormones

from cholesterol. C=carbon molecule and the subscr ipt

numbers refer to the numbers of carbon molecules in

each substance (stryer 1988a).

3

or phan receptors found in two different species: the hurnan

estrogen-related receptors 1 and 2 (ERR1 and ERR2), and the

5evenup gene product (SVP) that i5 involved in phatoreceptor

cell formation during eye developrnent in Drosophila,

2.1 A common ancestor gene:

AlI the members of the superfamily have three

5 t r u ct ur a l do ma i n s : 1) an N - ter rn i na Ida ma in, var i ab lei n

length, that has been shown ta madulate transcr iptional

regulation in sorne cases; 2) a central hydrophilic domain

involved in DNA-bindingi and 3) a hydrophobie C-terminal

domain involved in ligand-binding (Fig. 2). Because of the

tr anser Ipt i onal regulatory property of these nuclear

reeeptars, sc i ent i s ts have been i nterested in the ir

evolutionary origin. Two hypotheses have been proposed: the

first assumes that the different domains have distinct

origins, and that the transcription factors arose from their

fusion; the second suggests a single precursor that acquired

complex functions with time (Amero et al., 1992). Studies

on sequence conservat i on in the DNA and ligand -bind i ng

domains led Laudet et al., (1992) to divide the members of

the superfarnily into three groups: 1) the retinoie acid

receptors (RARs) and the thyroid hormone receptors (TRs)i 2)

the "orphan receptors"; and 3) the SRs. Th 1 s was done by

constructing and comparing phylogenetic trees of the DNA­

binding, and the hormone-binding domains of 32 genes that

belong to the superfamlly, using the "Fitch least square"

method (Laudet et al., 1992) (Fig. 3).

<1

Fig. 3: Proposed phylogenetic tree for the nuclear receptor

genes superfamily based on the sequences encoding

the DNA-binding domain. The groups and the

subfaml1ies are lndlcated by brackets. The bar

represents a branch length of 10 units. The arrows

point ta human and Drosophila genes which cluster

together. AR, human androgen receptor; COUP,

chlcken ovalbumln upstream promoter; E75, Drosophi la

or phan receptori EARl, orphan receptori ECR, Droso­

phila ecdysone receptor; EGON, Drosophila orphan

receptor, ER, human estrogen receptor; ERR1, human

orphan receptori ERR2, human orphan receptori FTZ­

Fl, Drosophila orphan receptor; GR, human glucocor­

tlcoid receptori H2RIIBP, mouse orphan receptor;

HNF4, r.at or phan receptor; KNI, (knirps) Droso-

phila or phan receptori KNRL, Drosophlla knirps­

related or phan receptor i MR, human mlneralocortlcoid

'receptor i NGFIB, orphan receptor; PPAR, mouse or phan

receptori PR, human progesterone receptori RARA,

human retinolc acid receptor alpha; RARB, human

retinolc acid receptor beta; RARG, mouse retinoic

acid gamma; RXR, human orphan receptor; SVP, Droso­

phila orphan receptori TLL, tailless Drosophila

orphan receptori TR2, human orphan receptori THRA,

human thyroid hormone receptor alpha; THRAXA,

Xenopus thyroid hormone receptor alpha; THRB, human

thyroid hormone receptor betai USP, Drosophlla

ultrasplracle orphan receptori VDR, human vitamin D

receptor (Laudet et al., 1992).

Group Subramily

rC. THR-\ ! THR THR\X.-\ 1 THRB

"RARA [ t:RARB RAR 1 } RARG

EARl

! t E75~ EARl -1 PPAR

COLl»

cot"P

EAlU

TR1

IL-i r=RXR ) n ~K~ RU

t:SP }

L 'GF1B

IDiH t H>T<= ....-'lU

ER

1ER ERRl

ERlU

GR

l PR GR

...- AR m FI'Z.F]

IQIl

KSlU.

~ EGON K.'"1IVDR

VDR ~

ECR

5

3. structure-function properties of sterold receptors:

Based on the percentage of amino acid conservation, the

SR group i s further di vided into two subfami lies: the

glucoeortico id receptor

receptor (ER) sub family.

(GR) sUbfamily, and the estrogen

The GR 5ubfamily comprises the GR,

the androgen receptor (AR), the mlneralocorticoid receptor

(MR), and the progester one reee ptor (PR) (Green and Chambon

1988) •

The cDNA of the GR was the f irst SR to be cloned

(Hollenberg et al., 1985). Much effort was spent on

ident i fying the di f ferent funet ional doma i ns of the GR, and

this was attained by using mutational analyses (Giguère et

al. 1 1986) as descr ibed below.

3.1 The H-terminal domain:

The N-terminal domain of aIl SRs i5 encoded entirely by

exon 1. Its length varies from 25 amine acid! (vitamln D)

to 600 amino acids (MR) (Janne et al., 1993), and accounts

for most of the difference in the!r rnolecular weights. The

N-terrninal domain i5 aiso irnrnunogenic; several monoclonal

antibodies have been raised against portions of it. This

region of the SRs is cailed the transactivating domain since

it contains els-acting elements important in activating

transcription of reporter genes (Krozowski et aL, 1989).

In sorne SRs , this domain is rich in aeidic amino acids

(Br inkrnann et al., 1989). Ac id l c doma ins have been found ln

the yeast transcr iption factor GAL4 and the herpes v iIUS

protein VP16, where they functlon as "transcription

act i va tors" (Ptashne and Gann 1990) 1 presurnably by vi rt ue of

interaction with other proteins.

6

These regions have been

shawn to be lnvo) ved in prote i n-pr oteln i nteract ions.

In vi t:ro mutagenesis in the N-terminal domain of the

rAR revealed sequences that seemed necessary for

transcriptional activation. When coexpressed with wild-type

rARs, sorne delet ion mutants behaved as dominant-negative

regulators most probably by heterodimer formation (Pa1vimo

et a 1 . 1 1993).

3.2 The DHA-blndlng doma.ln:

The ONA-binding domain (DBO) of SRs and thyrold

receptors is made of 66 to 68 amino acids, and it possesses

the highest degree of amino acid conservation (Chang et al.,

1988). It is rich in cysteine residues and contains basic

amine acids. These features made the central part of the

receptors a good candidate for a DNA-bind Ing domain. Site­

directed mutagenesis in that area affected DNA-binding but

not hormone -bind! ng ab! l i ty (Ho llenberg et al. 1 1987). When

this region of 66 amino acids of the human ER (hER) was

replaced by that of the human GR (hGR), the chimaeric

receptor activated GR-respons ive genes upon stimulation by

estradiol (Green and Chambon 1987). This proved that the

spec 1 f ici ty for target genes was conferred by the ON A­

bind l nq domain. In the rat AR (rAR), the human AP (hAR),

the human PR (hPR), and the hGR, ten cystelne re~idues are

conserved and in the ER nine of ten cysteines are conserved

(Chang et aL, 1988). Eight cysteines appear to fold into

two "z inc- f Inger" str uctures wi th one zinc atom being

tetrahedra11y coordi:1ated ta four cysteines at the base of

each fi nger • This motif was f irst found

7

ln the

transcription factor TFIIIA from Xenopus, which 1s Involved

in the transcription of the 5S ribosornal RNA by binding to

DNA. TF! IIA -=:ontai ns nine consecutive "zinc-fingers": they

differ from those in SRs by the replacement of two cysteines

wi th two hist idin~s in each finger. 1 n the nuclear receptor

superfamily, the two "zinc-fingers" are encoded by d1fferent

exons, they are di fferent structurally and they fOIm a

single unit. The "z1nc-fingers" of TFIIIA contact the DNA

strand and function independently. Three dirnens10nal

informa t ion was obtained from nuclear magnetic resonance

(NHR) spectroscopy (Hard et al., 1990), and crystallographic

analysis (Luisi et a1., 1991) of the rat GR (rGR) (Fig. 4A)

and the ER (Rhodes and Klug 1993). Bath "zinc-f!ngers" are

characterized byan irregular loop (zinc atom at the base),

followed by an alpha helix, and an extended region. The two

alpha helices cross at the midpoint. Each "z1nc-flnger" has

a d1st i nct f unct1on; the N-termi nal "zinc- f inger" contacts

the ONA strand in the maj or groove through two amine ac ids

1 n the loop, and one in the alpha he 1 ix. 'l'he lat ter thr ee

amino acids form the P box (Carson-Jurica et al., 1990).

These amino ac1ds are involved in recognition of the

specifie HREs of each receptor. In the rat GR (rGR) they

are: glycine 458, serine 459, and valine 462. These amino

acids are conserved among the members of the GR subfamlly.

The C-termina l "z1nc-finger" 15 i nvol ved 1 n dimer i zation of

t wo reeeptor sand stab l1izat i on 0 f the structure. A

dimerlzation region was discovered in this "zlnc-finqer" and

was named the 0 box. This reglan 15 respons1ble for

8

li' 19. 4: (A) DNA -bind i ng domain 0 f the rat glucocortico id

receptor. Indicated residues and regions are based

on the crystal structure of the protein bound to a

GRE (Luisi et al., 1991). One module (indicated by

a brack et) consists of one loop and one u-helix

(region enclased by a sol id Une). Solid rectangles

r epresent res idues making speci f lc contacts wi th the

phosphates, whereas the open rectangles represent the

residues making nonspecific contacts. Solid and open

arrows indicate res idues that contact the bases at

specifie and nonspecific sites, respectively. The

asterisk indicates that the contact between Val 462

and the base is not at a nonspecific site. Solid

dots mark the res1dues Involved in dimer interface

interactions. The ami no acids that confer the

specificity ta HREs are shown in solid boxes; those

l nvol ved in half-s i te spac ing r equil ement are shown

in sol id circ les. The number 1 ne; scheme is based on

the full-length receptor. The smaU letters on the

N-terminus of the DNA-binding domain derive from

flanking sequences derivinq from the expression

plasmid used. The C-terminus end contains amino

acids represented by dashes (reviewd by Freedman and

Luisi 1993). (B) Idealized pal indromic response

elements of the GR, ER, TR and VDR. The n urnber i ng

convent ion used cons iders the dyad as or ig1n. Arrows

indicate the direction of the half-sites (Freedman

and Lui s i 19 9 3 ) .

(A)

MC~l.:le 1

(B)

1.""\':

Mcèl.:l' :

----.-.---.----- •• ---- L ~1rC:::Aï..\aQIG KIKKKïl<RA E • -~1;r· - _. - -=:~- -- - -~f5- - - - 510

~GG ïCA:lïG ACC~ "'ZC C AGi:). C ïC:G y

~ G Q 'j" C Air:.-:.yfc G j" CAl ""Z C CAC:::: ïlr.nn 'Z. C C A G ï 1

G l

N

9

determlning the spacing between the two recognition helices

in th~ N-terminal f1nger which 1s important to allow proper

proteln-protein contacts for optimal DNA-binding (Luisi et

a1., 1991).

The HREs are short imper fect pal indromic sequences,

they are c ls -act i ng and are class i fied as enhancers s ince

they function in different orientations and positions

(Carson-Jurica et a1., 1990). The GR shares similar HREs

w1th the PR and the AR: they are called GREs. They are

dlfferelit from the HREs of ER (EREs) and the TR (TREs). The

GREs and the EREs consensus sequences are made of two half­

sites that are separated by three nucleotides, whereas the

TREs' half-sites lack the separating nucleotides (Fig. 48).

A GRE was fi rst ident if ied ln the long terminal repeat 0 f

the mouse mammary tumour virus (HMTV-LTRi -201 to -69),

whlch also contains binding sites for NF1 (a transcription

factor). PR was capable of transactivating a

chloramphenicol acetyl transferase (CAT) gene from a

thymidine kinase (TK) gene promoter containing the 15 base

pair GRE consensus sequence (Strâhle et al., 1987).

HREs are usually located at various positions relative

te the transcription start site of target genes, near other

transcription factor-binding sites (Strâhle et al., 1988).

A synerglstic action was found between GREs and the

transcription factor-binding sites. When one GRE or ERE was

placed near the TATA box of a reporter gene~ distal prometer

elements being deleted, there was hc.rmone-dependent

transactivation with the respective hormone. However, when

one GRE was placed farther upstream of the TATA box, there

10

was no transactivation. The latter was restored by the

addition of another GRE or a CCAAT box, or NFl and SPl

binding sites.

The Involvement of nonrecept~,.,.. factors with HREs was

also demonstrated by Pearce and Yamamoto (1993). A

composite GRE has been discovered upstream of the prollferln

gene (member of the mouse prolactin-qrowth hormone family)

(Mordacq and Linzer, 1989). 1 t conferred repress ion by

glucocortico Ids, and was shown to be occupied by GR in

footprinting experiments. This region was named "plfg" by

Diamond et a1., (1990), and the "composite speciflcity

domain" by Pearce and Yamamoto (1993). The latter group

formed chimeric constructs: 1) The GR N-termlndl domain was

linked ta the DBD and HBD of MRi 2) The N-termlnal of the MR

was Ilnked ta the DBD and HBD of the GR. The first

construct repressed expression of a reporter gene in vitro

in the presence of heterodimers of cJun-cFos (subunlts of

the transcription factor APl), enhanced transactivation with

cJun homodime1:s, and lacked activity ~dth the absence of

APl. The second construct failed te repress transactivatlon

given the same conditions for GR-induced repression. They

concluded that the N-terminal domain distlngulshes GR from

MR wlth respect to represslon of cFos-cJun activlty at

"plfg" •

Speclflclty of androgen action will be discussed in

section 4.4.

3.2.1 Dlaerizatlon subdomalns:

The dyad symmetry of the HREs predicted potential dimer

11

formation by the SRs. Use of gel retardat ion assays and

monoclonal antibodies to GR and p~ showed that both

receptors bind the consensus GRE specifically, and that the

receptors first bind the 3' half-site and then the 5· half­

site. The binding of the first thus faeilitates the binding

of the second receptor. This led to the postulate that the

SR's DNA-binding proeess is cooperative and that the

receptors are in a dimer form (Tsai et al., 1988; Luisi et

al., 1991). The existence of two sedimentation coefficients

of the activated (DNA-binding state) ER, indicated the

existence of a monomer and a dimer form of the receptor

respectively (Notides et al., 197 A). A dimerization

subdomain in the mouse ER was found within a region in Its

hormone-binding domain (Fawell et al., 1990). The amine

acids ln that region are eonserved among the nuelear

reeeptor superfamily; they form a hydrophobie cluster that

resembles the "Leucine zipper" motif. This motif 1s a

heptameric repeat of leucine (or equivalent amina aeids sueh

as valine, methionine, and isoleucine), farming an

amphipathie alpha helix (Fawell et al., 1990).

3.2.2 The hlnge region:

The ONA-binding domain and the hormone-binding damain

are separated by a short sequence of amino aeids that

cantains turns and coi l'S. It is called the hinge region

beeause It is thought that it facilitates the folding of the

two domains onto each other (Krazowski et al., 1989). The

amine acid sequence in thls region is not conserved among

the members of the superfamily. Recently, a mutation has

12

been found in this region of the c-erbA-f3 TR gene in a

family with a generalized thyroid hormone resistance (Behr

et al., 1992).

3.2.3 Subcellular SR localization:

Most un11ganded SRs are thought to be located ln the

cytoplasm. Upon hormone administration the hormone-receptor

complexes move to the nucleus where they bind HREs. Picard

and Yamamoto (1987) found two nuclear locallzation signaIs

in the rGR: NLI and NL2. This group fused different deleted

rGRs to tt"te E. col i B-galactos idase gene, and used them to

transfect COS 7 and CV-l cells (two afr1can green monkey

kidney cells). The fusion proteins were detected by

immunofluorescence us1ng antibodies d1rected against B­

ga1actosidase or the N-terminal domain of the rGR. NL1 was

loca1ized in the C-termina1 end of the DNA-binding domain

(hinge region). 1 t 15 lys ine-r ich and has 50\ homology w1 th

the SV40 large T-ant1gen nuclear localization signal

(Ka1deron et al., 1984). In hAR this sequence 1s located

between codon 629 and 634 (Lys-Leu-Lys-Lys-Leu-Gly)

(revi~wed by Jenster et a1., 1991). NL2 was loca11zed in

the HBD, but its sequence has not been identified.

4.2 7he hor.ane-bindlng domaln:

The hormone-binding domain (HBD) 1s located in the C­

terminal portion of the SRs. It is re1atively rich in

hydrophobie amine ac1ds that are presumably invo1ved ln

forming a steroid-binding pocket. Comparative stud1es of

the members of the GR subfamily revealed 50 ta 54% overall

13

s imilar: i ty in th 1 s reg i on, and four conserved subreg ions

containing 65 to 100% homology (Chang et al., 1988).

Methionine res idues are present dense1y in this domain, a

characteristic of aIl SRs.

Besides its ligand-binding activity, the HBD plays an

important role in: dimerization (3.2.1), nuclear

locallzation (3.2.3), the binding of heat shock protelns

(3.3.1), and transactivation (3.3.1).

3.3.1 Hsp90-binding and transcriptional repression:

GRs is01ated from cytos01 preparations of hypotonie

cell 1ysates sediment as large complexes of 8S-95 on a

sucrose gradient. The receptors seem ta be associated wlth

a 90 kilodalton (kDa) heat shock protein (hsp90). When this

receptor preparation was heated or treated wi th salt, i t

sedimented as a 4S molecule thé1t had high DNA-bindlng

activlty (Pratt et al., 1988). The same 4S receptor form

was found upon hormone add i t ion (Hollenberg et al., 1989).

C-terminal and N-terminal deletions created in the HBD of

the hGR revea1ed the presence of transer ipt ion inhibi tory

regions. Gene constructs were made with normal and deleted

HBDs of the hGR to measure transcription of a luciferase

reporter gene (Denis and Gustafsson 1989). Two

transcr 1 pt 10n Inh 1 bi tory repress i on reg l ons were found, one

between amino acids 530 to 582, and another between residues

697 and 777. Two models have bèen proposed for the

mechanism of repression. The first proposes that the

inh1bitory sequences mask the DNA-binding sites, and the

second suggests that the inhibi tory sequences might be

ovary ___ A Fallopian .J7fJ tube . ,

INDIFFERENT STAGE

mesonephros

ullerian duet

If tian duet

epididymis testis

as deferens

seminal vesiele

........... / :" :i .~ prostate ..... ~ " '..,

...... ::,-/ ',t.

MALE

Fig. 5: Formation of the internaI geni tal tract in male and

female embryos (Wilson et al., 1981),

14

occupied by a non-receptor protein (one being the hsp90).

A "dock Ing complex" has been propos ed by Pratt (1992). In

this model the GR is attached to a cytoplasmic "docking"

structure made of two hsp90 molecules, and one each of

hsp56, p50, p23, and p14. It i5 also postulated that the

bind lng of the receptor to hsp90 confers on the receptor a

conformation that promotes steroid-binding and a cytoplasmic

location, but inhibits DNA-binding, and that the function of

the complex 1s mainly trafficklng and folding of the

receptoI. Upon l igand-binding, the GR dissociates from the

hsp90. This was not found for the PR and the ER, as these

receptors b Ind ligand in hsp90 fr ee state (pr att et al.,

1992) .

4. Androgen insensitivity:

4.1 Androgen hormone action:

In humans, androgen hormones are responsible for the

normal development of the male genitalia prenatally, and for

virilization at puberty. Defects of androgen action at any

stage of the deve lopment of the human embryo cause androgen

resistance or androgen insensitivity syndromes (AIS).

Under~tanding the normal process of male sexuai

differentiation explains the di fferent cl inical phenotypes

observed in subjects wlth AI.

A mammalian zygote carrylng a 46, XX karyotype will

develop into a female, whereas a 46, XY zygote develops into

a male. Ir. humans, at 5 to 6 weeks of gestation,

indifferent gonads form. At this stage the internaI

genitalia are made of two duct systems: the Wolfian (male),

IN DI FFERENT STAGE

ovary ___ ~

FalioPian=:tfJ tube ~ ,

uterus--:....L

vagina , , 'oM.'

FE MALE

mesonephros

ullerian duct

pididymis --testis

s deferens

. ..-....... .' .' .;.... prostate .: ~

··:l!:~j MALE

Fig- 5: Formation of the internal genital tract in male and

female embryos (Wilson et al., 1981).

15

and the Mullerian (female) (Fig. 5). A "switch mechanism"

15 necessary to decide whlch pathway wlll be chosen (male or

female). The short arm of the Y chromosome contains a gene,

called SR Y, that ls responslble for the development of

testes in male f""nbryos (Sinclair et al., 1990). When

formed, the testes produce testosterone via the Leydig

cells, and the anti-Mullerian hormone (AMH) via the Sertoli

ce 115. The AMH i s a g lycoprotei n that acts i ps i lateral1y

and causes regresslon of the Mu11erian ducts. These

structures lose responsiveness to this hormone after a

critical period of fetal development (Hughes et al., 1989).

Testosterone causes the differentiation of the Wolffian

ducts into the epididymes, vasa deferentia, and seminal

veslcles. Simultaneously, the prostate gland is formed from

endodermal buds in the pr imi t i ve urethra (Wilson et al.,

1981). In a female fetus, the Mu1lerian ducts differentiate

into the fallopian tubes, uterus, upper vagina, and the

Wolfflag ducts regress.

In target cells, testosterone ls metabolized to 5Œ­

dihydrotestosterone (DHT) by the action of the 5Œ- reductase

enzyme (Fig. 6). In male embryos, DHT is responsible for

the development of the male external geni tal ia. By i ts

action, the urogenital sinus (or genital fold), the genital

tubercule, and the genita1 swe11lngs de~elop, respectively,

Into the penis, the penile urethra, and the scrotum (Hughes

and Plnsky, 1989). In the female embryo, the genital

tubercule becomes the clitoris, the genital swellings become

the 1abla majora, and the genita1 folds become the labla

minora (Wilson et al., 1981) (Fig. 7). Deficient or

OH OH

5a- Reductase

o o

TESTOSTERONE DI HYDROTESTOSTERONE

Fig. 6: Conversion of testosterone to 5tt-dihydrotestosterone

by the enzyme 5tt-reductase (Wilson et al., 1981).

genital~~ : •• 0 ". • ... , .:: fald :: .. :;'O·~' :::.

genital--+' \; ::}:.=I swelling \'. ",-" :'1~:.)'

"l' ",'~ ... . .... .' "-.... ~ ..... . genital INDIFFERENT tubercle /' STAGES

f////,Cff\---Q 1 ans

It-;.:f~-urethral graave

~ /' .. ,!.-:-; .. ; ':':. " l' t . . f:·' ". .... C Ions ;t . .::~." ;",: ::/0:. f. .. :.' ":. -~ urethral orifice ~: •••. ' .1°:; ~:.: 1'. "! .-..: hymen ','.' : '7-1' .• ~f': ":0.. )?::.,,:o ':",~ .'. II" ~::.'

~ rJ!.:·' l·:.!~!

Fig. 7: Formation of the externa1 qenita1 tract in male and

fema1e embryos (Wilson et al., 1981).

16

defect ive 5et-reductase act i vi ty resul ts in an autosomal

recessive disorder in males because of decreased con\eIsion

of t!stostelone to DHT. The gene encoding this enzyme has

been cloned Iecently (Andersson et al., 1991). The affected

ind1viduals have a 46,XY kalyotype, are born wlth

predominant1y female external gen;talia and are often Ieared

as females. At puberty most subjects experience appreciable

virilizat1on.

4.2 Androgen insensltivity syndromes (AIS):

A deficient or defective response to androgens during

embryogenesis and puberty results in AIS. The affected

Individuals have a 46,XY karyotype but their clinical

phenotype varies from a female with complete AIS (CAlS) to

a mildly undervirilized male with mild AIS (HAIS). An array

of intermediate variations (partial AIS or PAIS) occurs

between the two extremes. 1 t 1s an X-l inked d lsorder,

mainly caused by mutations in the androgen receptor. The

gene encod ing the hAR is present in a 5 ingle copy in the

human genome, and has been localized on the long arm of the

X chromosome in the Xqll-l2 reqion (Brown et al., 1989).

Two-thirds of the mutations are passed on from one

generatlon to the next by fema1e carriers, s1nce affected

males are generally i nfert i le. The other one-thi rd of

affected males represent new mutations.

4.2.1 Complete androgen insensltlvlty:

The CAlS 15 the most severe form of AIS. The subjects

are born and reared as females and present in infancy w1th

17

inguinal hernia (testes) or at puberty with primary

amenorrhea. The external genitalia are feminine, but the

blind vagina may be short, the testes are present in the

abdomen or in the inguinal canal, and there are no fernale

internal genitalia or Wolfian duct derivatives. After

puberty, they aiso have I1ttle or n~ pubic and axillary hair

with normal or e1evated male testosterone levels in the

blood (Kovacs et al., 1986).

4.2.2 Partial androgen insensltlvlty:

PAIS is char acter ized by phenotypic heterogene i ty.

Individuals with PAIS a,·e born with more-or-less ambiguous

external genitalia: at one externe, they are masculinized,

but with abnormalitles (micropenis and hypospadias); at the

other extreme, they are those of a female with sorne degree

of virillzation (clitoromegaly and labial fusion) (Hughes

and Pinsky, 1989). Sorne of the eommon features among the

affected subjects are: hlgh-pi tched voiee, ske letal

undermuseulature, gynecomastia, hypospadias, and sparse

facial and pubic halr. Affected individuals may have one or

more of these features, but near ly aIl share absence of

spermatogenesls (Pinsky 1988). Corrective surgery can be

used to restore female or male external genitalia depending

on the severlty of the clinlcal phenotype (more femlnized or

masculinized) .

The milder cases ot PAIS are classified as havlng HAIS.

These are male Indivlduals who are infertile and possibly

show gynecomastia. The "undervir il ized ferti le male

syndrome" encompasses indivlduals who are fertile but

18

possess sorne clinical features of MAIS. This group is the

least freguent.

4.3 Blochemical characterization of the hAR:

~he development and use of androgens in binding assays

fac i 1 i tated the understand ing of androgen-receptor (A-R)

binding properties. Serially subcultured genital skin

f ibroblasts (GSFs) were used pr imar ily because they have

three times more specifie binding activity than nongenital

skin fibroblasts (Pinsky et al., 1992). Androgen-binding

assays in GSFs yielded the first evidence for androgen

receptor defects in AIS, and allowed classification of

mutant receptor~ into three quantitative categories:

receptor-negative (undetectable specifie androgen-binding

activity), receptor-deficient (lower than normal blndlng

activity) and receptor-positive (normal range of binding

activity) •

A-R complexes are also characterized qualitatively in • order ta identify and classify patients with different types

of AIS. For that purpose, various biochemical markers have

been developed: increased thermolabill ty; increased

equilibrium and nonequilibrium rate constants of

dissociation; and defective upregulation upon prolonged

exposure to synthetic, nonmetabolizab1e ligand (Kaufman et

al., 1984).

4.4 structure-function of the hAR:

The hAR was c10ned in severa1 different laboratorles at

approximately the same time (Lubahn et al., 1988; Tilley et

19

al., 1989; Trapman et al., 1988; and Chang et al., 1988)

(Fig. 8). The cDNA clones had different sizes depending on

the laborator ies where they were discovered. The size

differences were due to the polymorphie nature of the the N-

terminal domain, where homopolymeric sequences vary in

length in healthy individuals (Janne et al., 1993). One of

the original hAR cONA clones had an open reading frame of

2.7 kb that corresponded to a protein of 918 1 amine acids

(Chang et al, 1988) (Fig. 9). The calculated molecular

weight was 98.8 kOa and the deduced size of the gene

encoding the hAR spanned a region of approximate1y 90 kb

long (Brinkmann et al., 1989). The hAR runs as a 110 kDa

protein (Brinkmann et al., 1992) on SOS-PAGE (sodium dodecy1

sulfate-polyacrylamide gel electrophoresis).

The promoter of the hAR gene lacks TATA and CCAAT

boxes. The mechanism of transcription of the hAR gene is

not weIl understood. Two transcription initiation sites

have been located, AR-TI S 1 (+1/2/3), and AR-TIS II

(+12/13), in a pyrimidine-rich, 13 base-pair-region. Faber

et al., ( 1993) used mutat i ona1 analyses to ident i fy the

minimal promoter of the hAR. They found two potential

regulatory regions: a Ge box (-59/-32), and a long

homopurine stretch (-117/-60). SpI (transcription factor)

was found to bind a sequence from -46 to -37 (GC box), and

was involved in transcription initiation from AR-TIS 1. The

sequences involved in transcription "initiation from AR-TIS

1. 1 have used the same number ing system as Chang et al, (1988) throughout the thesis. The amine acid numbers vary in the literature due to the variation of the length of the homopolymeric sequences in the N-terminal domain.

20

Fig. 8: The cDNA sequence and deduced amine acid sequences

of the rat AR (rAR) and the hAR. Identical amino

acids are represented by hyphens. Dots replace gaps

that have been created to reach the best alignment.

AlI ATG/methionine residues are boxed. Homopoly­

merle or oligomeric reglons are indlcated by bold­

face brackets. Identical regions between the rAR

and hAR are boxed (amino acids 556-623 and 666-918

in hAR) (Chang et al., 1988).

"MI :.v.--c-:~~ ~ 1\ ~~~-r-..a::--~""--=--~JIC-ro-....::.-a::~""'~A-~-:--"""-/laX~····C···C""",··'t·"X'::.u.a.·~T.\A".uc-~"~~

~u.~o:r~ AXJ.·~"-:--...v.~~"""""-"'-~.to:AC~~NX~~~~~.Jo:.X"""':---'CA

,... .:.u.--::z;T-x..u..x-~.u......x

-.J4 la, ~~Q"'"""'I;-:::-..c~~~~Af;L""'"XNZ:"".JC"".\.C'CX ... - .... '""!.N:~~·x"c",·..-rrc ~....a:-.~" ..•. _4--':-C .. -....:::-­

,l1li 1 -=; " 'A' ;J/' .... :: ., .... :a., ....,. v •• -" ,,.. .... " ,,.. ". 1., .. , ...... , ..." u~ .. , ~ ,"'- :.~ ..... .-, ... :1 .. 1 .. , " •• "'0' : ... ' .. 1.1 \e:: /1 A,,,, ,,,. :1., ,,. -V1 lu ,,.. , ... ,) 1 .~ .JJ: ;-0,: JI'. -" .::a: ::-.; ~ ,IGI;:""'C ".. CLl :0: ""'X 'X'C ""'="= ....".. lICt' .",,, :z:A %.A x:; --= ~ _r :;"""1; -ç ~ -.x ~ ;:xx: ~ xc .'"'e ~ UiC ::0: ::CI: = aa; ~ ::c-JI'" Il' J _ 1-" - -- - - -. -- _ .. - .. _. -1 -- -.; _ .. - -- -- - --c - - _. - _. - - - -- - - - - 1- - - - - - - _. --li ., ..... 1 .. .... .. ..

, .. "1 ................... , 1" ....... r,. ,,, ;a, fI.., -.,. __ ~\n -:" ..,~ ~"'" .:\ .. ·"tu •• , , .... t ..... q .... ., 4.1;1 ~ • ..."t; .. r" ,. :.oMO ôTX Z- .a: ...... x..-. 'X"T x:e Qt;1' :xc -.::'" -.. ::M: ':,Jill: cg; ~ ~ IC"" .-gr: :c::: :::œ :::;c :cc ::;c o:;c ~ ",.. Ill, __ ~ _ œ= _ __ - -< --... _ -..:-c. -:-e C""'I: - - .-.. - :.w: ":M; :.a.: :.tI' :.AC. ~ ::..III::: ~ c...: :.rc: c:N: o:N: =.M ___ -- .\- .a.- .a.- .. A- -a- -.. /III UI .. .... .. .. hr, ..... .-. _'I .. -:1 .... ::, ... :: .. :: .. :: fi :J> :1 .. :: .. :1'1 :1 .. :1" :1 .. : .... :1", .. .. ,:1 .. ~ .. :' .. <:. .. -

.~ ".;JI CI. ,,... ~" • ...,. :1' ..... ,,... -:,,. A.U l'.' ...... ., -:1, ~f ~f:' "'Yt..-. AJ,. -.,.'; ... : .... : .. ':~ .... 1'" ,,.. Ie":u\ :;1 .. :,"'ler AJ. ... , :1 .. Qlt .. ~.,,.. :1 ...... :' c-,. f~ JI', C.IIG -:AC :c- :IiIG :.Ar ~ ~ 'X'T I:M xx: ~ A"'C "'" ~ ACt. /ItL.I. xx: !.IriC :-'1: X1: :-: =--.: :.IIiC :.u. c:...c ':JIG ~ -cA.:AC:..III: c:.w:: ~ 2:%: '"'IX ::.tIC QIX' -:..IrC :::- ~ .ItGI: :xc ~ "lU '1', _ CIl:.- _ - -T _ --<! ___ -t :c't _ - -:: - - - - - .... - _. - - --- --1. - - - -c. - ~ - C""Ç - ... - - --c __ -II. -t -....... " ~ 'u, - - N'1 - .... .1. - """ - - , .... - - t..... - e-r. - - ..... -II4#. 1. ~ .,... ; .. ,,... : , ....... a.J. '!"lU ..... 're :., _" :1, ~ 're : .. -:,. t,.. ,,... ..... 're ,., ut :LI\ .. , ...... , t.l.t &.L. , .... 1., ~r ........... .- ~ =~, ,_ ... , ,,.. p,.. :1, ,NI "', --e x:c :.t.a a:1 3;,A -x- :zx ara; QC'1' a:- :n: J,N: 'XI: C""'C = !:NO '!,IIIC. :x.a. :t:.A 2:'" :r-- :::::..t :;.t.. :...-: ::.At -;.te"-I:A XT 2X o::A owo:: ac:::. ~ --c: ~. ::-OC::IX ax: IC"" 1'-.: :x.a .z:c ... JiII 101 l-- _ ... __ ... __ --c _ ::or_ --c ~ • ________ -____ -- '"Ç - __ A - -= -< .:-- -- -- - - - - -- -- - - --C - -- - - - -< -,,, .. l' , .. 1 - v.l _ "'11 1., _ .. t..oro. - .. :'... -

,A,II \)} -.. k' I.r :-rI t ....... UJI , • _,. -"0 • ..-.. ••• '; .. '-1. : ., .... '~c:1" ....... ~r:i:"".:-,-:-"-:,"".:-:-,-:"-:,:-"::-:-:-:-"-:,:-":-:-:""::-::""~:-:-,.-:"-:,:-~:-::-:""",:-:-.-::,-::'""":::-."'"-::,-:.,-:-:-:-.-:,:-~::-:-:-:-.-:,:-~::-:-:":'. r'" ",, -A loX' ...x -a:: "'f"t: :c..A ;.AC At"" ...... -'< ....... :-0: an:: ,.N:;. xe 2X ..c: ,~ ~ :- .- :A; :JrG ~ ':..oIrr:: :.u. ::..; c:AA ~ <:JW: .:.AoC ~ .:...: :AI; ::.tIC :.aG !!AC; ::.,t,.;. :AI; :AA ::.AI: ::.104 "1 .... Jl,. ___ - -- -- -. -- c:- _ -_ -_______ --- ... - - -,- --C --- - - ... --- - ~

" .... " - t...I - ••• r - L.....:-J - ., - , .... U, -;-::;" :a .. "" l' M' .... : ,~ v&l ...... ., ""' ...... .., :1 .. AJ.. '"IV :1., ........... ~l, ...... '.r -.,., _ =1, :~r Ae" ,., "'"U' 1 •• &et ...." ..... AJ.... _,. :1 ... .- e-r. ,U "1, ~ ;.!roI;l ;;-.... r. -rc ......... ~ JIIm: -.; AIIiII: ~ ..... 'JC.Jt .u:. .....:;; ;,;:;'C ..:-- ~ ~ :-0::: ""C"'" ~ -0:: ......: ~- IICT -/IItC C'T'" QQG:IZ: """1' '"'CI: -.c: ..... A ""'I:'T ~ olCT z:::: .I0oIII: ':oIIG _ ""C:T

~... 1. -fi C ... ~ - - _ - - __ ~ __ ç; __ - - "-e - -- - ,- - - - --<: •• - -- - - -c - - -- - -_ le - - -- - ->lAII If ....... v., -. ~:, _. - _ •• , - - - ~ - - - - ... '" - - -~, _ - . - - A.I ..... - -

.1-' "r. ",.. ou ..... 1 'e, V.1 "'êJ-' Ct, - ':::II, v. ::1 .......... ..- =1 .. "1 ........ ,., .... :: • ., :1 .. ;0.11 .... A.I~ Cl., "'Il e-,.r;;;;"!...,., u.. hl' 1-. ~ Cl., :1.,. ..... 'ro-. .u..a val Ar, .,.. ~

.... '4', u.Jj. 2:A;""'C '""C'T .-.:; -WCC'Al"!O ace 'M'Q X"" ~:.AA ::c.A =-.:: GAA ~ .. c-c: lItCT :z:.a. ::a: :AC ..a.. :-- o::z: ::.::;c ~ -0:1 ~!"JC QtC ""C: C"""I: ~ x.t. Z't IX.A IX'C' ::cc ;""'C :='T ::c: ltC""

::: :::: -: -:- - ~ - -:- -:- ~ c-:= -:- - --<: --:= T:- -:- -:- -:- -:- -:- --: -:A -:- -=- -:- --C -:' -:-0- -::;~ -:T T:- -:- ~~ -:-- :- -:T -:- :- -:- -:-,AlI " •• , .. ('., ...... ,,.. 1-. •. 1. QI .. e-r. 1.,. QI, '- •• , _ .... :1 .. Çl., ". Çl, .,.. =1, ...... , :1 .. ; .. """', A"h :1,.. 1"'rr 19' h' , .... J'I ~1,. :1, ?yy ~ L,. 01., ~ :.l .. =1., = ..... , .AII '.'1 cr"" --cT x:::o :rT C"'""1 .z:r; ~ t'IX .u.A 'X'T .:- ""0: ~ ~ :.u. œc co: ::0: ...... ZI: JC"T ~ :.AoC IICT x-- ~ -"T '"'CI: ~ t--c:: A.JiIG QCA :a:T -/ItC .z:z: AN/. ':taC ----= a\ Z"T Q"lC ,..-

"''''IJ'', _ - -< --a T- - - - - - ""C C""'C _ .. __ -< A·_ Q.. ... - -4 .. - - - -- - - - - - c-- - - - - - A- -- - e·1I - -< - -< "'1&.11 J ", _ .. "'r 1...000... _ ....... a., Al. • - le, - - ...... - - .r. .. . ~ .. _ .M UI _ Cl.,.....,. le, ::', ... , Se, Ga .. M. ca, •• , •• , ::1, ""',.- Cl .. 1.'''' •• , ,., "- .. , _....,,, ., .... ~1,.I.l.. V.l ..... ' =1 .. f..l.J.e.l.l.. AJ..i ...,., ca .............. T)'r....,., .... . • AA "1, ~ :0:: ""'IX ~ zr M% lrC'T c.u. :z:.a '2:T .II!X ~ :r..c ..c..A :"'f' ~ ATC =:%: ""C: '"'I:..A ;-:: ~ .:-.: ':AT .ur..: ~ ;r.a QCA ~" ~ c:.tIC XA 2:A XA "UC ~ .u.T ca: ::..c "'ac -Je AN: .... ' •• 6, _ .. ~ __ - _ x~ -< -- -.ç - ~< ___ - _ ... :::...; - -T .-< - - -= --C - --C - -- c:..c: -- - - -T -4 - .- ~ ___ - - -...... JII. - .. ~ - .. - tMw - - ~I - .. t.." • .. L..:.......:.-: - - •• ~ .. , .... 141, , ..... ,... _ AJ.. t.u ,., ;1, ,,.. ,,. .. u J1I,. ,,.. 'r. , .. i~, IIIU ,,... lU ....... """ • _, ...... : • .., ",-", " ........... ..." ;1, .......... ,..'1U.e AJ. • .u. oU ........ 1 :, ... e-,. "" ~ ,J.tl. " --r ::c:: ~ r'"' ::-c ""c: :n:: ::c::x:r: :...t.C ::o:.:c: =cr: -:t:"" ace: c:...T 'XA.:.AC x:: :::x "-0: .a.tw: ::""'::..N;. .u.c: :a: -: .:..c ~ ;IX ag: z:::: ~ Z""' ;z:::;r;c; tXA ZI: :.u. ""'IX c:::x ':A-tI",,'.I!, __ A --c: _ - ;- -.10 - -..e _, __ -<: _ C'-- __ -c - _ .. _ - - _w. - __ t;- - - -- - _ - --4 -T - --<; _ -< - - -.. """ UI, _ - AJ.. -, - .. Pro .. - 'r., _ . 1 • _ , _

....... 'U, :1, .... ..- AJ. ...... __ .1. :.,:; .. h, ," .u =1., ,,.. '.or -", 1: ., I.e" .... ". "-" -U- A.h i ,., , ... ,.,'.". !tu ""'lu ....., ,1Ie;~ .. a.... 1: ... 0; ... :It ;1", _ -n 1:1,. ,,..t;:;

..... ,., ;;.a:;:.-= --:; ~ .IIŒ' -:- ... :AZ :x:.... oo:c ~ -;;-.0\ ';IC"': ::.;.A::C-:: .trQC I>C"" X.A ~ = :A x-:: ..c::: zc "'C""" --co- '"'C1: -= CA,. AC- ~ --C ....... ::é"" :.AA ':.AA:;ar: ~ -...JI, "10.- 2:1; :I:A "Z/I.

"""" 1', -~ - 1:;- -. -- --c - -< oC ;.-... -oC ...: _- -:""T ""- ......:: - ... - ... ..- - ::.-- -T --C -" - -- -< - -- - - .. ...e - - - -<: -01; - -A.....o; --T - .I..1.:,A...J. - Ql,l.r - •• ,.~~. - Cy.

rU ",, :lp ,: ... " :., :_1 ~ ..... '.r .....,. L. ct, 'r.. V.l .1..1.1 .,. ..." :::11 .... r -a.- ..... 2',.. ',..:0.11 I~"'t. 2lC ~ :u:. .zE IIOX tC" aa: :-:..a. aa: :.JI, CX'T:IZ =- ;-" x:: ::::0: ....... "" '"'AC J.I.'!* =c; :a::: =r:.wo 'Uotl"" _T -T -T -Ç :t"" :t"" :r::""" :0: QDC' 2X .xc :cc 2X :IX QIOC .:0: :rc XI; 2X :a: xr: ..: ::.-- ;..< ....... :a: Q- .< ~ _.u. ~ __ - -C "'_ - - - - - -

"AlI "", - ç ., :; ,. ::1, 1;1" C\" ':,,, : , : r :.r -:t" Cil, e " : ., ::.r r: • ::lf :.'" : r ; , .. r ::1, : ,:1.,,:.1. ... = ........ -~~'::J: ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~:::;.:! ~;;! ;..: ;!! ~ :: ~;=.: ~ ~ ~ ~ ~ ~ ~ ~ :!.: ~ ~I~I~ ~ :::~,~ ~ ~::: :::, -:- - ~ ;;; ~:- ~& :~ - -:- ~~ - ... ;;: ;:; ~- ~ -~ -.- -: -:c :...~ -:- ~ -:- ~ -:- -=- -=- -: -:- ~: -:- -:= -: -: -:8-:c -: -:l:j~: :; , .... 'l' ..,... s..:, " • ...,r::, ..... ÇlA.t ............. , h, t"'I .. .." ...... U "., _ '·a ....... ...".." ..... 'n'!"'e:: ... I .. , ..... r::-y. ___ -:Y' ::., ........ 1.", AJ.. 1.' :,:y. -Ill' --,.1 r ..... "'., -II: ""'C:: :r..A ~ ·Ar :ocr: ::.N:l A-9 cr:"" ~::.AC ~- Jo&:: .w:z; CJIC ':.JI(: ':"""T -A = ... n::..c """.N: --= -::::::...::ZX ca.cIMC te: -a:::---.; .. -: -:- ZA:,l-:.a.. r- '--e- 2:"" --=- ~~' ~:a:,:' -:- -=- -:- -:- --:= -:- -:-0 -:- ~ ~ ~, ~: -:- -:- -:T -- -: -:- -:1' - -=- -:- -:T -:- -=- -=-1-:- -:- -:- -:- -:- .:- -:- ":- -:- -:- -:- -:: -=- -:- -:TI ,AlI ,t, 1 :.., ................ 'If =.,. :: , ... :..,. L,. "'.l ,.,. ''14 _, ..... ., 'li AJ.. :1 .. -:" .,. :." _, • ...,., _ ::r' ... 11 1., AI, .......... :y. ~ 1 ... , .,. , .... AIt, AI'I ., ..... " c:"f. ;p,.. ... ,! , ..... , .. " 1 ~ X- ~ loC"" ~ .xx: ...x "U Vtt; :"'"'C" -: -eMA/lI:.AX-.x:::::...AX;C ....... :.aI; ~ .... ~. ~ Z'l:: M% lo:A -...- .... - -X -== ... - ::.r. • .u.A - o::;c aac .......... T ~ ::.a. '"'= ~~:~: -:- --:- - -:11 -: -.0\ -:- --- -:- -:- - - -- -:- ~ -:: -:- -:- - -=- -:- -:- -: ~ ~ -:- _ -:- -: _ :- -:' :- -:- -:- -: -: .. -:- -:- -:- -:- -:- -:·1 , .... "":'y' .u, _ .. "'1 .,. :"y. ,..,r :1. ... Al. ::1.,. "t /-" .- : . .,,, ....... , .. ,. _ .. , •. , ..... : , ............. _ri .- : ... -: ... : ... :. , -: ...... " l.er ... r ........ l, 1 •• 'ro-. '"'!l, :1 ......... ',. ''''''11 , ~ ;;:::- =-= :;g;j; """'" -.;- -Jo,- ....... ZA :.Jt; ... '"'t;!"--- -;-;;; :;x;.A .;rr =- ~ ;-""';0 .-....;; IAA =-- .......... 1' =-= ......... =-A ~ ........ :.tr.A ;o('...t. :.Mo .u.;: --c; .IIC1' ;;r:- a:T .....: = JoC'" ~ ~ XAo

I\MJJ" , -- - _ .. - -- - - - - - - -- -- - < -~ .- - - -- -- -- - --<; - -- - ......c - - --c X- - --C A-< a.c: - - - -- -.; ...... '\"""l .. - - .. -. - - .... - .. - -.. .. - - - - .. - . - - """'""" ... _ .. : .. ~ 1 •• "_"" r' _li -" ~ •• 1er "1. r • :: ... .-.f ...,. : .. ':7' ~ ... 'tG • 'Ile __ " JI -..:......... _:. 'r. ~ ,1. " •. :-y ...... : 1 "'l' ................ =~ ... 're ....... 10er ,~

tIA •• , ........-::.AI: ......... -;j ~ ::Jo. ~ :Je. ... - ;.A,A :00: -", .. :..u. -:"' ':.M ::r-- ..... ""C - =- ...... ~ ::-- ::..u. 'XI:' A.- :.w: ::::... Z.A ~ .:-: ~ x:: %;,A :,t.- :.AC UC /rJJIC ~ =-- :.I.T ~ -

:::::' ~ = ~:~: ~~ ::::. = :: ~::::;. : ~~ .:.:::: ::.:: = : :. :=:: ~:: ~:::. := :~: : :: ~: ::: : ~ ::.:: ~::i ' ~ ~ :: ~~ ~ 1. ~ ~ ~ ~ ~ ~ ~ ~:; ~~ ::: =? ~ ~ -; ~ ~ ~ ::: ~ ~ =:: ~ ~ ~ ; =? ~ ~ ~8~ ::= ~ ~ ~I , .... "li ! •• r -.",~ :1,. ...... , ..... t v.l , ... U., l'til : , .". "'" la, ,~ ~, ..... '" v.~ ...... a.t "'1''''-l _ ...,,, , .... a.... 're ..., .- ~ •• , ....... " : ... ..,r N., .... t Il ... .,. .... ",., "'t '""rY , .... J " , """1:"': ~ .. '"'=' Xoo\ --=, A .... tCO-A - XCI "--::, %"" -.z: c:c "'C:' -oc ac- M" :""C .uc '"":" .I!C: ..... -: C""'C! "AC - XA :::T :AI: ~ ::- --= A,A" ::,a,,: ." .. ::X8~ eJrC .t.M: ---=- :::.t. A..-:l"lC! ,,~-(&,,- _j-J._ .... --<\-\--4 - -'--1--<= --- -. - --- --c- __ - - ~ - - -- - --< --< -- _. - _ - - - --c: - - - - --e...c: --r--" .... ·"11· . ~. -~ - - . U ~ . - - - - - .. - - - '-..:.... - - - . - - - , - . .. - - - ... - . -~ -.. AIl tU, ... , .. JI :y • .".1 Alfj __ t)âf. "u t.u ..... :..11; .. ,he = , .,. .-. •• " 1 • ...., '" ::1.1 :.101 , ....... :-,.~",. aJ.a.' ...... ..- .-'n .... r n •.•• ,.. V.i. ..... .:" ...... _,. .... ", ,. ..... Jl1'11Ci!::.AC -Z:""l:: .IoaC:::::!III:JDCJC:-t ~ ~::.a.: - z:.tt."-a: =--e:=.....: ...... .ac: =ce-:a.:::.u. -.: =-= -ar: .L--:,LU. XA~~""=-"'!:: ~ ~.:- ..... -'ecA.:""!: ~ ZI::-' #IAA.u!1

:~~.: : -:- -:- -:' ~ ; -"L:;:J -:- -:- ~ -=- -:- -:- -:- :- -:- -:- __ A -:: -:- -: .. -:- -:- -:- -:- -:"") -: 1-:- -:., -:- -:- -:-, -:- -:- :- -:- -:- -:- -=- -:- -:- -:- -=-[ , ..... ' 1 : ..... r' ,~ 'PI ......... Il ... :- "'1~"" ...." ..... ,. ':::.4 ...... "'1' -"'1 ,_. _e """. :y. _,., ... , _,. ",-,,-;;::'""1" •• , e,. MI 0\1" ""1 'fi_ ....,or :1.tI .- "" ... , ............. ,... h', ,A-'J"I ,=» ....... -.: - :.u !;AA =-- ':z:.A"""'I:IAM:. wN:; .~ ~ :..t.A. =--:.At:=c "'''''C'''-:cA -..x MA.-.c.A JtN,...t..A! ==.cA "t:C ""X' -c:A Aœ::X .......:: "'IC :AI::""'C IC: A.otC: :--t::-;; ~ '""::"""

~:~ :"7 -=- -:- -~ -=- -:- -:- -=-L! -:- -:- - - -:- -~ -:- "':T -:- -:- :-~ -:- -:- -:- -=- "':- "':-- -:- -:- -:- -:A -:- -:-- -:- -: .. -:- -:- :- -=- -:- .-:= -:c; ...... , ... 1 : .. 'N Il ...... , ". - .u ,~ , ............ '- - .. >, ....... -." ..... , .... , .. ,~ :'.'i!' .... ". ,. , .... -01 "ft ~, ,~ ,JO h' -' ,AAUH .:r"'1:M:r""' Ar!1C4 /ItGA.:.tIC:"'Iô:AT ':M -e 1C" - -;JIC c-.:;:-A ..... ...:; AN; -c:: .:.a'"' ... ""'4 .-: u ::-; :..AC -:0::- ~,1w4OC Il''': XA:.Ie.""'.~ ""C""':;"'!';o::M:""!: = ~ A-C: =-1

~l~!:" -=- -:- -:- -:- ~:- -:- - - -:- -:- :- -:- -:- -- -:- -:- -:- -:A --;:='-:- -=- -:- -:- -:-:- ~ .. :-!-:- ~-:- -:- -:- -:- -:'" -:- -:- -:-- -:- -:- -:- -:-1 tU! "1 , I.r 21p .r' "'.L .,. Ire • ...,. ,.,. Ill. ,""", :.", ,"'1-" ""':"" lOI: ..... :--e -"'::C:",""C --U r--c;:AC fOC.A:..IGI~ ~~""'''A~:.AOI!_ • • x ~-:-::-'t"'"X::--;-....... ~~~-:c"""":""'ac-" '1""J'!' ) _ -- _. - _ .. -- - -- -- - -..: -, _ ........:0\- _____ •• r~_.:-__:._-~~ c::--~~ .. ~e .. _e_-c-_·A.:A .. ~x.ac-~--~--A.A__:::_·-t._·~~ ......... ' _1

, ..... :." _ .........:-c-:-c:.a"""!:.uc.r.-c--~~.u C......... ce C c: C" .... Je;;.. =x::::-:::--....... ~---,;.ufl:":~X'"'CC""'CI:~~A~ ... '\Mla~. ..10&.:"'C ~"'QI:,A-T""'C ..... -"'O-~-T·----c--:--C--""C~-c:-:----c--<- C<""O: -. I!" "";'·_~·_""".;-<:M.-·<~-~-C-c:.a-....co-::--U-----"....IJC.---~·-T-A--·

' ..... 1'1. - .... _ •• xx:c::AC""~ .... ~~c-x::.uc~~~~ ....... -r"' ..... -OZ:u..-N;~A .. II,ItC'-A~·'<··ItI:··""·etC C:'~~~~ '\AAJ,'\ --.... -& ... - .. -- .... ---.:,..."'C"-at--c--.~~ .. -...:c.I.C<A --e: .. _-It&* .... _ .. - ... -X---=-A·Ç""-~aa:"~-A.-:-:c_A·_""C ... ....ç ... ·A<-Cc:::::;---""C

' .... 1 '\ a.c-"" , ... x: ......... NT". '---C

Exon 1 ::r-_ .......... 1_2-->1'--3-1......1 _4_-1--5 --1--6--L-_

7 ---1-

8---.1

• Amino Acid • _ ~""'~ (Gln),7_2t (Pro). (G/Y),f-27 556 623

.... ONA-

~ff#/00WM 666 918 _.1--_ Androgen --~._

Binding Domains

Fig. 9: The exonic and modular structure-function organi­

zation of the hAR using the amine acld coordinates

of Chang et al., (1988). The recent normal range of

glutamines in the homopolymeric region 15 now known

to extend from Il to 31 (Pinsky et al., 1992).

21

II were located between position -5 and +57 (Faber et al.,

1993).

The N-terminal domain of the hAR contains sever al

homopolymeric amino acid segments. The major ones include:

Il to 31 consecutive glutamine residues, 8 prolines, or 16

to 27 glyc i ne res ldues . Glutarnine-rich regions have been

found in many established or suspected transcription factors

: the mammalian transcription factors SpI, OCT-I and OCT-2i

the Drosophila Antennapedia and Ultrabithorax proteinsi and

the yeast HAPI and HAP2, among others (reviewed by Mitchell

and Tjian 1989). In the hAR, expansion of the glutamine

tract to 40 or more glutamines causes an adult-onset motor

neuronodegenerative disorder, callp.d Spinal Bulbar Muscular

Atrophy (SBMA) (La Spada et al., 1991).

In vitro mutagenesh~ in the N-terminal domain of the

rAR has revealed sequences that seem necessary for

transcriptional activation. When coexpressed with wild type

rARs, t;he deletion mutants behaved as dominant-negative

regulators most probably by heterodimer formation (Palvimo

et al., 1993).

The HBD of the hAR contains 250 amine acids, and is

encoded by exons 4 to 8 of the gene. Deletions of amine

acid 651 to 712 in the C-terminal part of the HBD abolished

the hormone-binding capacity (Jenster et al., 1991). A

mutant AR lack ing 12 amine acids from the C-terminus was

unable to bind hormone, whereas deletions in the N-terminal

domain or the DNA-binding domain did not affect hormone-

binding. Complete deletion of the HBD resulted in a

constitutively active receptor (Jenster et al., 1991).

22

Fig. 10: Amino acid sequence homology among various members

of the nuclear receptor superfamily is shown in the

left panel. The right panel shows four conserved

amine acid regions in the putative hormone-blnding

domain of steroid receptors represented by roman

letters. Dashes replace identical amino acids.

Gaps have been created to reach the best allgnment

and are shown in dots (Chang et al., 1988).

Dinding Oomoin

ONA Hormone

556 623666 918

hAR --------------[Q]}-I8 100 '!II: hl 540 607 650 902

rAR -------------~[Q]}-li!IOO xM' 565 632 601 933

hPR ---------------IŒ2}-ItHi'.?:, S-t ~ !~,11 1 60' 668 732 904

hMR ŒQ}--I·\.~·a SI '!II: F$li'll1"

419 406 525 795 hfiR ŒJ--If~I':"3 sow; f·~;:1

103 250 30? 595

hER ------ffi}--l.'I~ ~"1' 5 ...-; !"ft"!~ 1 1 56 123 164 432

hRAR --@]-t "'a ( 1 5 '!II: E!l 1 100 167 232 456

hc-erbA ~(IS'J;SJ

III 170231 403

TR2 - __ lliJ--I:"fJJ (15 .,; f~,:1

e

rllR 650 hllR 666 hPR 681 hGR 525 hMR 737 hEIl 309

YECOP 1 • FLNVL(,:A 1 EPGVVCAGIIDNNOPDSFIIIILLSSI.NELGEROLVIIVVI<WAKIILPGFrull.IIVDD

10LI-P Li-L-MS---D-IY-----TK--TSSS--T---O------L~----S-S--------1--1.1'01.1 PTI.vSL--V-- -E-LY--Y-S'iV- - -TWRIMTT--H--G--VIIIII- - - - - - 1- - - - - - -1.-­RIII.T-~ .PVM- --N---E 1 -Y--Y -SSK- -TI\EN- - -T--R-I\GK-HIQ- - - - - -V- - - -K- -PI.!:­SI.TIIIIO HVSII-I.IJII--P J LYSEY-PTR- F-E-SMMGI.-TN-I\I) -E- --M 1 N - - -RV- - -VO-TLII-

-1-------1 1---11---1 rllR 716 OMIIVIOYSWHGI.HVFIIMGWRSFTtMISRMLYFIIPOLVnIEYRMIIKSRHYSQCVRMRIII.SOFFGW. 1.0

hllR 1]2 ---------------------------------------------------------------- --hPR 14 7 -ITI.- - - - - -$- -- -GL----YKII-SGO- - - - - - - -1I.--0--KE-SF- -I.-I.T-WOI P- -- VI<.--hGR 592 --TLI.-----F--A--L----YROSSIINL-C-----II--O--TLPC--O--KII-LYV-S-LIIR.-­hMIl 1"8 -ITI.-- - - - -C-SS- -1.5- --YI<IIT- -OF- - - -- - -- - - -EK- -O-II--FI.-QG-llor -I.O-VR. -­hFR )15 -VIII.I.~CI\-I.EILHIGI.v---HEIIPVK 1.-. ---N-I.LDRNQGKCVFGHVEI FO-I.I.IITSSRFRHHN

1 III 1- IV ----i rllR ïR2 ITPOFFI.CMKI\I.LLFSI 1 PVOGLKNOI<FFOELPHNY II<F.LORIIIICK/U(NPT';CSRRFYOLTKLLOS

hllR 799 -------------------------------------------------------------------hPR n 13 VSOF - - - - - -V---LNT--I.E-- RS-TO-E-H-SS --R--I KJ\-GI.RO-GVV- <;-0- - - - - - - - --II hGIl 650 VSYE- y - - - -T-- -L-SV-K- - - -S-EI.- - -1- -T-- -- -Gl<I\-VKRFC;- SSQNWO- - - - - - -- - -­hMR 964 L-fr-YTI--V---L-T--I<----S-I\II-E-H-T------RKHVTKCPN-Sr.O<;WQ----------­hER 440 LOGE- V-LoS Il-LNSGVYTF-SSTLKSL-EKDII IIIRV--K-TOTLIIILHIlKIIGI.TI.O-OIIOR-I\O

rl\R 849 VOl' IIIREI.1I0FTFOLI.1 KSIIHVSVOFpEMHIIE II SVOVPI< 1 LSGIIYl<PIYFIiTO

hllR 965 ------------------------------------------------------hPR B no J,II!JI.VKQ- -I.YCLNTF-O-RIIL- -F- --- -S-V-III1-I.- -- -II-H-- -1.1.- -KK hGII ns Mllrvv~ 1I-I.NYC-OTFI.IlKT-. -1 E- ---1.-- - -TN-I - -YSN-N 1 - KI.I.- -OK hMIl 9 J 1 HlIIlI.v';!J-I.r -C- YTFRE- -lU.K-E- -I\-I.V- - --0-1.- -VF- -111\- -1.- - -RI< hER 507 1.1.1.-1.:;11 1 RIIMSNKGMEIlLYSHKCKNV'!PI,Y!JI.I.I.r::M!.OIIIIRI.1Jl\pTS RGGII';V

e

23

The DNA-binding damain of the hAR cantains 68 amine

acids. They share 76\ homalogy wi th hGR and hMR, and 79\

with hPR (Chang et al., 1988) (section 3.2) (Fig. 10).

Al though andr ogen-r eceptor compl exes ar e capabl e 0 f

binding the GRE consensus sequences and activating reporter

genes in vitro, there has been mueh Interest in finding HREs

specifie to androgens (AREs). Potential AREs were found in

androgen-regulated genes such as: the sex-limited proteln

(Slp), which 15 expressed in adult male mice (Adler et al.,

1991); the C3 gene, which encodes the C3 subunit of

prostatein, a prostatic protein secreted by the ventral

prostate (Tan et al., 1992); the prostate specifie antigen

(PSA) (Roche et al., 1992); and the rat probasin gene (ra)

which codes for a nuc1ear protein seereted by the

dors01ateral prostate (Rennie et a1., 1993). The 5'­

flanking region of the PB gene was isolated by screening the

rat genomic DNA with the complete coding region of the PB

gene. Band shi ft assays were carr i ed out to determl ne l f

the AR binds the isolatt!d sequences. Cotransfection of

androgen independent PC-3 (human prostatic carcinoma) cells,

with the PB 5' -flanking region (-426 to +28), linked to the

bacterial chloramphenicol acety1 transferase (CAT) gene with

AR, GR or PR expression vectors, showed a hlgher CAT

expression by AR than GR or PR (Rennie et al., 1993) (Table

1).

Since androgen-receptor complexes ace capable of

binding the GRE consensus sequences and activating reporter

genes in vitro, how do they accomplish specificity of

express ion? The answer may res ide in the context 0 f the

24

upstream region of tarqet genes. Recently, specificity of

AR action was demonstrated in in vitro mutagenesis using the

120 bp enhancer from the upstream region of the Slp gene (C'

69) (Adler et al., 1993). In this system the GR binds the

HRE in the enhancer but 1s not capable of transactivation in

that context. C'~9 contains several sequences similar to

HREs. On ly one 3' -HRE (HRE-J) is identical to the GRE

consensus. It binds androgen and confers hormonal-response

on a reporter gene. However, this HRE aione does not

account for the specificity of androgen action. This was

confirmed by testing the effect of sequence alterations of

C'~9 on specificity. CV-l cells were cotransfected with the

AR expression vector and different C'A9 mutants (formed by

site-directed mutagenesis). AlI mutants, mostly HRE-3,

affected androqen response on the thymidine kinase-driven

reporter gene (CAT), and did not change glucocorticoid

action. Therefore these mutants did not alter specificity.

However, when HRE-3 was placed 10 bp downstream of i ts

natural site, androgen-response was restored. GR was aiso

capable of transactivating this plasmid. Thus, distancing

the HRE from the enhancer allowed glucocorticoid

responsiveness. This showed the differences between GR and

AR wlth respect to interactions with other factors on the

enhancer. It was also suggested that the N-termlnal portion

of the receptor contributes to the spec1ficity (Adler et

al., 1993).

4.5 Mutations ln the hAR:

Sequencing the genomic ONA from GSFs or per Ipheral

Genes ARBs

PB ARB-l

ARE-2

Cl

PSA

Consensus GRB

Sequence

-241 to -223

atagcATCTTGTTCTTAGT

-140 to -117

GTAAAGTACTCCAAGAACCTATTT

AGTACGtgaTGTTCT

AGMCAgcaAGTGCT

GGTACAnnnTGTTCT or

GGTACAnnnTGTCCT

Table 1: The sequences of the consensus GRE (Roche et al.,

1992), and the putative AREs in the C3 gene, the

PSA gene (Roche et al., 1992), and the PB gene

(Rennie et al., 1993) a~e shawn in capital lette~s.

(n) designate any nucleotide in the spacing reglon.

For the PB gene, the small lette~s Indicate

sequences flanking the AREs, and for the C3 and PSA

they indicate the spaclng between the two half­

sites.

25

lymphocytes of many subjects wi th AI S has revealed several

categor ies of AR mutations. Mutations were found throughout

the cod ing region of the hAR gene, but the maj or i ty was

present in the HBD and seemed to cluster in two regions: 1)

between amino acids 727 and 773; and 2) I..'etween amine ae Ids

827 and 865 (HcPhaul et al., 1992).

Host CAlS patients have 1ess than 5 fmol/mg protein

androgen-binding activity ln the GSFs. This ls due to:

partial or complete deletions of the AR coding region;

single-base substi tutions resul ting in splicing err ors

leading to a shorter prote in; nonsense mutat ions where base

substi tutions resul t in the introduction of a premature

termination codon; or the most common one, base

substi tut ions that cause replacement of an amine acid by

another (Pinskyet al., 1992).

A large deletion was found ln a patient with CAlS and

mental retardation. The deletion was revealed by a Southern

blot us i ng part of the cDNA as a probe. The hAR had minimal

specifie llgand-binding activity in GSF (Trifiro et al.,

1991).

Recently a base substitution at nucleotide 337 was

found by Zoppi et a1., (1993) in an individual with CAlS.

It resulted in a replacement of a glutamine at position 59

to a stop codon, in the N-terminal domain. No protein was

detected in an immunoblot using anti-N-terminal antibodies,

thls suggested an abnormal amino terminus. Androgen-bind ing

assays showed a deereased bind ing affini ty and increased

dissociation rates. This group raised the hypothesls that

translation of the mutant hAR was re-initiated downstream of

26

the mutat 10n, at lower levels than norma l, and wl th

funct ional impai rments •

Different exon deletions of the hAR gene have been

found in members of one fami l y (HacLean etaI., 1993). Two

sibllngs and the ir maternaI aunt, all a f fected wi th CAlS,

had exon 5 deletion, and exons " e and 7 deletlon,

respective1y. Both deletions resulted in an hAR lackinq

androgen-binding activity. Southern blot analysis on DNA

from the mother, grandmother, the two affected siblings and

the aunt, reveal ed: a 5-kb delet i on of exon 5 in the two

5ibl1ng5 and in one allele of the mother and grandmother

(both are obl igate heterozygotes); and the same size

delet ion 0 f exons 6 and 7 in the af f ected aunt. The

deletion of exon 5 extends into intron 4 and has one

breakpoint in lntron 5. The delet i on found in the aunt, has

the same breakpoint (5' of a Sac1. site ln intron 5) but

extends in the opposi te direct ion in intr on 7. The de letion

in the aunt is a de novo mutation sinee it has not been

found in the grandmother. The authors postulated two

possibilities. The first is nonhomologous crossing-over in

intron 5 occuring at different times and resulting in the

two delet ions. And the second supposes the presence of a

transposon-like sequence in intron 5 causing the two

deletions in two cell lineages in the grandmother.

The AR in CAlS familles can have normal binding

activity with qualitative defects, such as thermolabll1ty,

or increased dissociation rate constants. Two mutations at

the same codon: arginine 773 histidine and arginine 773

cysteine occuring in two unrelated families result from base

27

substitutions in the HBD of the hAR causing CAlS. In the

first family (arginine 773 histidine) there was normal

androqen-binding activity in GSF, whereas in the second

family (arginine 773 histidine) the binding activity was

unmeasurab1e (Pr ior et al., 1992).

A small proportion of CAlS patients have deficient

androgen-binding activity. In one case, described by Ris­

Sta1pers et al., (1991), a guanine-to-cytosine substitution

in exon 4 resulted in a replacement of aspartate by

histidine at codon 694 in the HBD. The AR in the GSF had

deflcient androgen-binding. In transiently transfected COS­

l cells, this mutant AR had an 8-fold increase in A-R

dissociation rates and abnormal transactivation of a

reporter gene. When the same codon was replaced by

asparaq i ne in another pat i ent due to a guan i ne-to-adeni ne

substitution, the patient had CAlS with positive androgen­

binding activity.

Hutat ions in the DNA-binding domain were found in

patients with CAlS. Two different in-frame deletions of

three nucleotides, found in two families, resulted in

biochemically different mutant ARs: de1etion of arginine 614

yie1ded a normal ligand-binding AR; and deletion of

phenylalanine 581 yielded GSF wlth unmeasurable or

deficient androgen-binding activity (Trifiro et al., 1991).

Rec:ently, two di f ferent base s ubst i tutlons in ex on 3 0 f

the DNA-binding domain have been found to cause arginine 606

to be replaced by glutamine, and arginlne 607 by lysine.

They were found in three ind i vidua1s wi th PAIS that aiso had

breast cancer (Lobaccaro et al., 1993).

28

A single base substitution in exon 5 that converts

tyrosine to cysteine at position 762 in the hAR, was

assoclated wi th a shortening of the glutamine tract (12

glutamines), in a fami ly wi th PAl S. The mutat ions were

reproduced and used to act ivate a reporter gene. Together,

the two mutations were less active than either one alone,

and the A-R complexes had increased d issoeiation rates. It

was postulated that the two mutations interact to impair

normal AR function (McPhaul et a1., 1991).

A base substitution in exon 6 changes codon 813 from

serine to asparagine in a family with PAIS. The AR in GSF

had l igand-speci f le misbehaviour: i t had normal levels of

binding with all ligands, but the complexes dissociated

norma11y wi th the synthet ic androgen, MT and abnormally wl th

DHT and the synthetic androgen, MB. The AR seemed ta be

sensitive to DHT, for a reason not yet understood. This

unusual behaviour of the AR added a new quall tat ive

classification: ligand-dependent or sensitive AR. Affeeted

i ndi v idua1s resemble those wi th PAl S, wh ile others have

unambiguous male external geni talla. At puberty they have

a def icient ske1etal musculature, gynecomastia, and female

body contour lPlnskyet al., 1985).

29

5. Objectives:

One of the objectives of this study was to prave the

pathogenicity of three widely dispersed point mutations in

the HBD of the AR, in three individuals wlth AIS: a

transverslon in exon 4 that changes an isoleucine to an

asparagine at codon 663, in a patient with PAISi a

transversion in exon 7 that replaces a leucine by a valine

at codon 820, in a patient with PAIS; and a transition in

exon 8 that changes a proline ta a serine at codon 903, in

a patient with CAlS.

We WE're also interested in correlating bioc:he'mical

phenotype wi th mtolecular genotype in the mutant AR.

And finally, we were hoping to delimit the N-terminal

border of the AR's HBD by proving the pathogenicity of this

domain's most N-terminal mutation (Ile663Asn).

------------~ ~ ---- ~

II KATIRIALS AIID HETHODS

1. Mater:1als:

1.1 Fa.111es:

30

The patient coded 16588 was born with ambiguous

genitaIia, and was diagnosed with PAIS. His maternaI uncie

is affected, and his mother and grandmother are obligate

carriers.

Two siblings, coded 1609 and 6003, were born with

unambiguous female externai genitalla, and bilateral

inguinal gonads. Gonadal biopsies on 6003 revealed testes

bilaterally. Their karyotypes from peripheral lymphocytes

was 46,XY, and they were diagnosed with CAlS.

An individual coded 605 was born wlth amblguous

genitalia, was diagnosed with PAIS and had corrective

surgery dur i ng the newborn per lod . No other af fected

individuals were found in the family.

1.2 Pri.er synthesls:

AlI the pr imels wele synthes i zed us i ng the Gene

Assembler (Pharmacia/LKB Biotechnologies, Bale D'Urfé, PO.).

The sequences of the intronic pr imers were klndly donated by

C. Chang (Chicago) and J. Trapman (Rotterdam). The

sequences for exon 1 pr imers were from Rotterdam and our

Iabolatory.

Mutant pr iaers: nucleotlde no.

605-A S* 5'- GACAGTGTCACACAATGAAGGCTATG -3' 2505 to 2530

605-8 AS* 5'- CATAGCCTTCA~TGTGTGACACTGTC -3' 2530 to 2505

16588-A S 5'- ATTCCAGTGGATGGGqTG~TC -3' 2974 to 2998

31

16588-B AS 5'- GATTTTTCAÇ.CCCATCCACTGGAAT -3' 2998 to 2974

1609 -A S 5' - TGCAAGTGtCCAAGATCCTT -3' 3230 to 3249

1609 -B AS 5' - AGAAAGGATCTTGGlCACTTGCAC -3' 3252 to 3239

F lank 1 ne) pr Imers :

P3' AS 5' - CACCAACCTTCTCGATAGGCAGC -3' 62 bp 3' of BamH!

(P3' 15 located in the O-globln po1y-A taU ln pSVhARo in

Fig. 11).

88271 8 -A S 5' - AACCAGCCCAACTCCTTTG - 3 ' 2599 to 2611

DNA-B

Bac-B

AS 5' - GACTTCACCGCACCTGATGT -3' 2512 to 2526

S 5' - GGCTAGCCTCACTGGGTGTGGAAATAGA -3' 3286 to 3279

1. J Pr imary and secondary PCR:

The PCR reactions were carried out in a DNA Thermal

cycler (Perkin Elmer Cetus, Montreal, PQ.). The Vent

polymerase was purchased from New Eng1and Bi\llabs

(Mississauga, Ont.), and the deoxynucleotides from

Pharmacia/LKB Biotechnologies (Baie D'Urfé, pa.).

1. 4 Pur:ification of DRA:

Low me1 t agarose was purchased from IeN Biomed icals

Canada (Miss issauqa, Ont.). The buf fer used was TBE.

Hexadecylpyr idini um chlor ide was suppl1ed by Sigma (st.

Louis, MO.), and 1-Butanol was purchased fram Fisher

Scient1fic (Nepean, Ont.).

* S = sense, and AS = antisense

32

1. 5 Subcloning:

Restr lction endonueleases were purchased from Promega

(Madlsson, W.) exeept for 8stBl that was obtained from New

England Bi olabs (Miss issauga, Ont.). T4 DNA L igase was

purchased from Gibeo/BRL (Bethesda, MA.). XLl Blue E. coli

eells were purchased from Stratagene (San Diego, CA.).

Calcium chloride was purehased from Fisher Seientific

(Nepean, Ont.). Yeast extract and Baeto-Tryptone were

supplled dy Difco (Detroit, MI.). Agar was purchased from

BDH (st. Laurent, PO.), and Ampiclllin was obtained from

Boehringer Mannheim (Laval, PO.).

1.6 Sequencing:

Dideoxynueleotides were purehased from Boehr inger

Mannheim (Laval, PO.). Aerylamide was obtained from ICN

Biomedieals Canada (Hlssissauga, Ont.). Sequenase enzyme

was purehased from United states Bioehemicals (Cleveland,

Ohio). Sequeneing plates and the Base Runner were obtained

from Terochem (Harkham, Ont.). X-Ray film Cronex 7 was

purchased from E. 1. Dupont de Nemour 5 (N . D. G. photo ,

Montreal, PQ.).

1.7 Bxon 1 a.pllflcation and sequenclng=

Taq DNA polymerase was purehased form Blo/Can Se lent 1 f ic

Ine. (Mlssissauga, Ont.). 7-Deaza-2' -Deoxyguanoslne 5'­

Triphosphate was purchased from Pharmacia/LKB

Biotechnologies (Baie D'Urfé, PQ.).

1.8 Tissue culture:

33

GSFs were derived from biopsies of patients and controis

obtained wi th informed consent according to approved

protocols. COS -1 ce Ils were purchased from the Amer ican

Type Culture Collection (ATCC) (Rockville, MD.). AlI the

cells were incubated in a 37°C humidified incubator supplied

with 5\ CO:z and 95\ air. The culture medium used for the

blnding assays was Opti-HEH supplied by Gibco/BRL Life

Technologies (Burlington, Ont.). The culture medium used in

the growth hormone assays was HEH with Hank's salt buffered

with Hepes purchas~d from ICN Biomedicals Canada

(Hississauga, Ont.). AlI the culture media were

supplemented wi th Gentamycin sulfate that was purchased from

Schering Canada (Pointe claire, PO.)i Penicillin that was

obtained from Ayerst (st. Laurent, PO.); streptomycin

Sul fate that was purchased. from ICN 8 iomed icals Canada

(Hississauga, Ont.); and Sodium Bicarbonate that was

obtained from Fisher Sclentific (Nepean, Ont.). Fetal Calf

Serum was purchased from ICN Biomedicals Canada

(Hlssissauga, Ont.).

1.9 Transfection:

COS-l cells were electroporated in a Gene Pulser using

0.4 mm cuvettes suppl ied by Bio Rad Laborator ies Canada

(Hlsslssauga, Ont.).

1.10 Androgen-blndlng assays:

The androgen-binding assays were performed using two

synthetlc androgens, (17«-methyl-»Hlmibolerone (HS; 7«, 17

«-dimethyl-19-nortestosterone) with a specifie actlvity of

J4

80.6 Ci/mmoll, and [l7<x-methy1-:JHJmethyltrieno1one (MT; 17

B-hydroxyl-17Œ-methy1-4,9,11-estriene-3-one, 83 Ci/mmol),

and two natural androgens [l,2,4,5,6,7-:JHJ5Œ­

dihydrotestosterone (DHT; 120 Ci/mmol) and testosterone

[1,2,6,7-:JH (Nli (Ti with a specifie activity of 92.5

Ci/mmo1l. Radiolabe1led synthetie androgens were purchased

from Dupont Canada (Mississauga, Ont.). The radioinert

androgens were purehased from Amersham (Oakville, Ont.).

Samples were added ta liquid scintillation vials containing

biodegradable scintillation fluid: Beta Max ES, purchased

from ICN Blomedicals Canada (Mississauga, Ont.), and counted

in a TriCarb 1500 liquid scintillation counter (Hewlett

Canberra-Packard

cupr ic sul fates

(Nepean, Ont.).

Canada). Ciocalteu's Folin reagent and

were purchased from Fisher Scientifle

1. LI Growth hormone assays:

Growth hormone levels were measured using an Allegro

human growth hormone assay kit, purchased from Nichois

Institute (Los Angeles, CA).

1.12 8-C)alactosidase assay:

2-Nltrophenyl B-D-galactopyranoside (ONPG) was obtalned

from Boehr i nger Hannhe i m (Lava l, PO.}.

1.13 Western blottinC):

1.13.1 Ce11 lysis and protein assay:

The protease inhibi tors were purchased from Boehr Inger

Mannheim (Laval, PO. l. The sodium dodecyl sulfate (SOS) and

the DC pro t e i n assay were purchased

Laboratorles Canada (Mississauga, Ont.).

1.13.2 Gel electrophoresls:

35

from Bio Rad

Coomassie brilliant blue was purchased from Bio Rad

Laboratories Canada (Mississauga, Ont.). The discontinuous

SOS-gel ran on an electrophoresis apparatus purchased from

Glbco/BRL Life Technologies (Burlington, Ont.).

1.13.3 Protein transfer:

Nitrocellulose filters were purchased from Xymotec

B iosystems (Hontrea l, PO.). The monoc l anal ant ibody F39 .4.1

was kindly donated by A.O. Brinkmann (Zegers et al., 1991).

Horseradish peroxidase was obtained from Professional

Diagnostic Inc. (Edmonton, AB.). Tween 20 was purchased

from BOH (Ville St-Laurent, PO.). ECL detection reagents

were purchased from Amersham (Oakville, Ont.). The X-ray

film used was X-OHAT-AR and was obtained from Eastman Kodak

(Rochester, NY).

2. Hethods:

2.1 Identification of mutations:

The ONA was extractp.d previously in the laboratory from

GSFs or periphera1 blood lymphocytes accordlng ta the method

descr i bed by Greenberg et al., (1987). AlI the exons were

amplified tJy using intronic primers, and the PCR products

were gel purified and used for sequenclng. The mutat ions

were identtfleè and confirmed for each family.

36

2.2 Bxon 1 amplification and sequencing:

Deoxyguanosine 5'-Triphosphate (dGTP) was replaced by 7-

Deaza-2'-Deoxyguanosine 5'-Triphosphate to Eacllitate

amplification of the GC-rich areas. It was aiso used in the

sequencing reactions. Exon 1 was amplified from genomic DNA

using Taq DNA polymerase as follows: 98°C denaturation for

1 min., 55°C annealing temperature for 1 min., and 72°C

extens i on for 1 min. and 30 sec. The PCR pr oducts were

tesolved on a 1\ low meit agarose gel. The right size bands

wer e exc ised and sequenced us i ng Sequenase, a mod i f Led T7

DNA polymerase, according to the manufacturer's protocol.

2.3 Family studies:

In the case of the 16588 family, the DNA was extracted

from blood samples obtained from the gr.:andmother,

grandfather, unc1e, aunt, the mother of the subject 16588,

and the proband 16588. Exon 7 was amplified by PCR and the

PCR products were gel purified and digested wlth the

restriction enzyme HphI.

For the 1609/6003 family, exon 8 was amplified from GSFs

of the two siblings and digested with Bsp1286I. In both

cases the fragments were resolved on a 10\ polyacrylamide

gel at 150 volts for 5 h. The gel was then stained wlth

ethidium bromide and photographed.

2.4 Expression vectors:

2.4.1 pSVhARa/BHEX:

The express ion vector used was pSVhARo (Br inkmann et

37

aL, 1989) (E"ig. Il). It was modified in our 1aboratory by

creating or abo1ishing restriction endonuc1ease sites, to

facilitate cloning. The modlfied vector was renamed

pSVhARo/BHEX (Fig. 12). It 1s 7219 base pairs long and

conta i ns the comp lete cod i ng sequence 0 f the hAF (cDNA)

cloned as a SalI-Pst! fragment in pBR328, the SV40 early

promoter, the rabbit O-globin po1yadeny1ation signal, and

the ampicillin resistance gene for selection in bacteria.

2 • 4 • 2 pHMTV-GH:

A growth hormone gene dr i ven by i ts own promoter was

placed next to the mouse mammary tumour virus long terminal

repeat (LTR) (Prior et al., 1992) (Fig. 13). This plasmid

was used in cotransfectlon assays to measure AR-lnduced

t r ansact i vat i or ..

2.5 Site-dlrected mutagenesls:

The mutations were reproduced by the overlap-extension

method of site-directed mutagenesls using the recombinant

polymerase chain reaction method (peR) described by Higuchi

(1990) and pSVhARo/BHEX as template. First, in two primary

peR reactions, two overlapping pieces of DNA containing the

desired base substitutions are formed by using: 1) one

mutant primer (ie. sense) with a 3' flanking primer, and 2)

the antisense mutant primer with the 5' flanking primer.

Second, a secondary peR reaction amplifies the full length

DNA fragment containing the desired mutation by using the

two overlapping primary peR products and the flanking

38

Fig. Il: hAR eDNA expression veetor (pSVhAR o ) (Brinkmann et

al., 1989). It eontains: the complete eOdlnq

sequence of the hAR cDNA (2751 bp) in a 3037 bp

SalI-PstI fragment; the SV40 early promoter; the

rabbit B-globin poly-adenylation signal; and the

ampleillin resistance gene from pBR 328. Hatched

boxes represent the 5' and the 3' noncoding regions

of the eDNA.

Amp'

p8R 328

ORI

?vu Il

pSVAAo

(7219 bpI

BgI" Bam HI Smal Sali EcoAI

Pslf

Sac 1

pSVhARoIBHEX (7219 bp)

n-globin

1-4--Xhol

Fig. 12: pSVhARo/BHEX, a modified hAR cDNA expression vector

(refer to Fig.ll). Some restriction enzyme sites

have been abolished and others created.

MMTV·LTR 1.45 kb

pMMTV-GH (6264 bp)

Fig. 13: Human grùwth hormone reporter construct pMMTV-GH.

The mouse mammary tumour virus long terminal repeat

(MMTV-LTR, HindIII-NheI fragment) was inserted into

the human growth hormone cD~A (hGH) construct (ptGH)

(Prior et al., 19~2).

39

primers.

2.5.1 Primers:

The pr imers were synthes i zed wi th the spec l f le base

change at the site of the mutation. The sense and the anti­

sense primers were used in conjunction with flanking primers

that were chosen to anneal with the template (pSVhARo/BHEX)

5' or 3' of a unique restriction site (section 1.2).

2.5.2 Primary PCR:

The mutant and the flanking primers were used to amplify

the two overlapping pieces of DNA separately using 2 ug of

the pSVhARo/BHEX. The denaturation reaction was carried out

at 95°C for 45 sec, the annealing reaction (45 sec) was at

57°C for Leu820Val and at 63°C for Pro903Ser, and the

extension reaction was at 75°C for 1 min and 45 sec. The

Vent Po1ymerase enzyme was used because of its 3'

exonuclease activity in proofreading the extended fragment

of DNA.

2.5.3 Secondary PCR:

Equimolar aliquots of the two primary PCR products (gel

purified) were mixed in one FeR reaction. AlI the essential

ingredients were added except for the upstream and

downstream pr Imers (the paramaters were the same as in

sect i on 2.2.2). The r eact i on was allowed to proceed for

f ive cycles when the DNA fragments were denatured and

reannealed as heteroduplexes and 3' extension was carried

out by the enzyme. The flanking primera were then added and

40

the PCR reaction proceeded for 20 more cycles (Fig. 14).

2.6 Purification of DNA fragments:

The pr imary and the secondary PCR products were resolved

by 1\ low melt agarose gel electrophoresis with ethidium

bromide staining. 'rhe DNA fragments were excised over cl

short wave ul traviol et lamp, then extracted from agarosE~

according to Landridge et al. (1980). This method is basecl

on separating DNA fragments by treating the melted agarose

wi th a quaternary ammonium compound, Hexadecylpyr idinium

chloride (ON). The ON+ ammonium cation binds to DNA in lo~,

salt concentration but not to agarose. By the addition of

water equilibrated 1-Butanol, the DNA-QN+ complexes transfer

to the alcohol layer. By increasing the salt concentration

the DNA complexes dissociate and transfer to the aqueous

layer. The DNA ls then pur i f i ed and extracted by a

chloroform and ethanol precipitation respectively.

2.7 Subcloninq:

2.7.1 Restriction endonuclease digestion:

pSVhARo/BHEX and the Insert (secondary PCR product) were

digested with a pair of unique restriction endonucleases 5'

and 3' of the mutations to create identical sites for

ligation. The eut vector and inserts were resolved on a 1\

low melt gel and purified by the ON-butanol method (sec~ion

2. 5) •

41

Fig. 14: steps for PCR mutagenesis (Higuchi 1990). The

arrows indicate the location of the prim~rs and th~

direction of amplification exc~pt for 2) where the

arrows indicate the direction on1y. The mutation

is represented by the symbol (0).

1) Primary PCR 5' 5' __________________ ~ _____ 3'

3'-----------------------------5' 5' A e ~ ..

~ Q B 5' 5'------------------------- 3' 3' 5'

5' ..

2) Secondary PCR a. remove primers, denaturation and renaturation

3' 5'-a= S'

+ 5' i=3' ...

-- 3'

b. 3' extension of the 5' overhanging fragments

~:

c. amplification

~: ---.. -------~s~----------------

3'

5'

3' 5'

3' 5'

42

2.7.2 Llgation:

1: 3 mo lar rat i 0 of the cut vector and the i nsert,

respectively, were added to the ligation mixture according

to the method described by Sambrook et al. (1989b). 100 ng

of the cu t vecto r was added to the llga t ion mi xtu re and

treated as a negative control. The reaction was carrled out

at 1GoC for 18 h.

2.7.3 Competent cells:

E. coli XLI Blue cells were made competent accordlng to

the method descr i bed by Davis et al. (1986). 40 ml of

sterile Luria Broth (LB) medium was inoculated with a sample

of XLI Blue cells (original agar stock). The culture was

grown logarithmica11y at 37°C, pelleted at room temperature

and resuspended ip 20 ml of 50 mM CaC12. The cel1s were

kept on ice for 30 min, then were centrifuged at 4°C and the

pellet was resuspended in one-tenth of the original volume

and kept at 4°C for 1G h to increase the competence of the

cells.

2.7.4 Transforaation and screening of colonies:

The competent bacterial cells were transformed using the

method described by Davis et al. (198Gb). 200 ul of

competent cells were added to: the llgated vector/lnsert

mixture; the negative control (section 2.2.2); and to 1 ng

of the intact vector (positive control). The mixture was

incubated on ice for 30 min, and heat shocked at 42°C for 2

mln. 1 ml of LB was then added and the celis were incubated

at 37°C on a rotor for 45 min. 100 ul of each mixture were

43

added to LB/agar-containing petri dishes, supplemented with

50ug/ml ampicillin, that were incubated at 37°C for 18 h.

The ampt·~illin-resistant colonies were picked aseptically

and grown in 5 ml of LB containing ampicillin at 37°C for 18

h. 1 ml was used to extract DNA using an alkaline-Iysis

procedure described by Sambrook et al. (1989a). Positive

colonies were chosen for a large-scale DNA amplification.

2.8 Large-scale DKA amplification:

The DNA extracted from the positive subclones was

amplified in E coli following the protocol described by

Sambrook et al. (1989c). 500 ml of LB were inoculated with

4 ml of the bacterial culture and incubated at 37°C for 18

h on a shaker. The DNA was extracted using the resin

separation columns (Qiagen) following the manufacturer's

protocol.

2.9 Sequencing:

The plasmids containing the mutations were sequenced

using Sequenase enzyme. The sense and the anti-sense

strands were sequenced according to the manufacturer's

protocol. The sequencing reactions were run on a 5\

denaturing polyacrylamide gel dt 64 watts, and the gel was

exposed to an X-ray film.

2.10 Tissue culture:

COS-l cells and GSFs were grown in Opti-MEH culture

medium, supplemented with 5\ fetal calf serum (FCS). The

cells were harvested with 0.1\ trypsin and centrifuged at

44

200xg for 3 min, and the pellet was resuspended in the same

medium.

2.11 Transfection:

COS-1 cells were harvested and resuspended in the

culture medium at a concentration of 20 million cells Iml.

la million cells were aliquoted in the electroporation

cuvettes (0.5 ml). The control and the mutant plasmids were

added ta different cuvettes in triplicates. 4 ug of the

pCHV-O-Gal plasmid carrying the O-Galactosidase gene driven

by the Cytomeqalovirus promoter, were added ta the cells ta

measure transfection efficiency. The cuvettes were placed

on ice for 5 min prior to electroporation. The cells were

shocked at 250 volts and 960 uF and were placed on ice for

10 minutes. Frp.sh medium was added, the cells were pooled

and plated either in 24 weIl plates (500,000 cells per weIl)

or in 35 mm plates (1 million cells per plate), 24 h later,

the medium was replaced by a fresh one.

2.12 Cotransfection:

COS-1 ce11s were cotransfected with la uq pSVhARo/BHEX,

or the mutant plasmid, 10 uq of pMMTV-GH, and 4 ug of the

pCMV-B-Gal as described in section 2.11. The pulsed cells

were pooled and resuspended in Opt i --HEM wi th 10\ FCS,

500,000 cells were added to each weIl of a 24 weIl plate.

48 hours post-transfection, 10 nH ta 0.03 nH 3H-HB was added

in a 300 ul volume in MEM supplemented with Hank's salts,

Hepes buffer and 10\ FCS. This medium was used because it

lacks biotin which can Interfere wi th the growth hormone

45

assays. The cells were assayed for androgen-binding

activity 48 h after transfection, for 2 h and 48 h after

addition of androgen.

2.12.1 Transactivation and growth hormone assay:

The cotransfected COS-l cells (section 2.9) were assayed

for androgen-induced transactivation of the growth hormone

gene by measuring the amount of GH in the medium 48 hours

after the addition of androgens. The transactivation

activity by the A-R complexes was studied using a growth

hormone immunoassay kit (Nichols Institute Diagnostics)

according to the manufacturer's protocol. This kit

incorporates two monoclonal antibodies with high affinity

and specificity for the human growth hormone. Both

antibodies bind specifically to a different epitope and form

a "sandwich" complex with the hGH. One of the antibodies

was radiolabelled for detection while the other was coupled

to biotin. The complexes thus formed bind to avidin-coated

beads (subsequently added to the reaction mixture) via the

high-affinity binding of biotin to avidin. The media from

cotransfected COS·l cells (incubated with androgen for 48 h

or 72 h) were collected and assayed for growth hormone

activity. 50 or 100 J.l.l of the reaction mixture (12!SI_

Antibody solution or the "sandwich" complex) were added to

an equal volume of the media with one avidin-coated bead in

round-bottom tubes. The tubes were placed on a shaker for

1 h and 30 min at room temperature. The beads were washed

twice with a wash solution (provided in the kit), and the

tubes were placed in a gamma counter in order to measure the

46

hGH activity.

2.13 Androgen-b\nding assays:

GSFs and transfected COS-1 ce1ls were incubated with a

tritiated androgen for 2 h or more at 37°C in tripllcate.

The androgen-binding activity was measured according to the

method described by Kaufman and Pinsky (1989). At the end

of the incubation, the cells were placed on tce, and washed

twice with a Tris/saline buffer (0.2 M Tris/Hel pH 7.4 and

l 5 0 mM Na Cl) . The cells were Incubated with 0.1% Trypsin

for 5 min at room temperature, and were scraped with a

rubber policeman and centrifuged at 200xg at 4°C for 3 min.

The pell et was washed twice wi th the same but ter and the

cells were lysed by the addition of 0.5 N sodium hydroxide.

The lysate was mi xed vigor ous ly, al iquots wer e taken for

protein determination using the Lowry assay (Lowry 1951),

and for counting the radioactivity. The nonspecific binding

was measured by incubating the cells (dupl icates plates) 1

with the tritiated hormone and 200-fold excess of the same

radioinert androgen. The specifie actlvity was measured by

subtracting the nonspecific binding from the total binding

actlvlty.

2.13.1 Monequllibrium dissociation rate constants:

COS-l cells were transfected with 0.05 ug ta 2 ug of the

control and mutant plasmid. 48 h later quadruplicate plates

were incubated with 3 nM of the tritiated androgen for 2 h

at 3?OC, and duplicates received the tritlated hormone with

41

200 fold excess radioinert hormone. After the incubation,

one 8P.t 0 f ce Ils was placed on i ce and processed as in

section 2.10. The lest of the plates received fresh medium

containing 200-fold excess of unlabelled hormone, and then

were placed at 37°C for different periods of time (30 min ta

2 h). At intervals, the cells were processed as in section

2.10.

2.13.2 Thermolability of complexes:

Triplicate plates of GSF or transfected COS-l cells were

incubated at 37°C with 3 nM of 3H-MB or 3H-MT for 2 h with

100 uM cycloheximlde, and duplicate plates were incubated

wi th the same medium plus 200-fold excess of unlabelled

hormone. The basa 1 b i nd i ng act i vi ty was meas ur ed and the

rest of the plates were shi fted to a higher temperature

(42°C) and were processed at different time intervals (1 ta

6 h).

2.13.3 Apparent equilibrium dissociation rate constants:

GSF or transfected COS-l cells were labelled with

di f f erent concentrai ons of tr i t i ated androgens (0.03 to 3

nH) for 2 or 3 h in the presence of 100 uH cycloheximide at

37°C, then the cells were processed 35 described above

(section 2.10).

2.14 8-galactosidase assay:

COS-l cells transfected with pCMV-O-gal were washed and

scraped in a 0.2 M Tris/HCI solution pH 7.4 and centrifuged.

The pellet was resuspended in 100 ul of a 0.25 M Tris pH 8.

48

The cells were then lysed according to the method described

by Sambrook et al., (1989d) by three cycles of freezing and

thawing in a dry ice/ethanol bath and 37°C bath,

respectively, for approximately one minute each cycle. The

tubes were centrifuged at 4°C and 30 ul of the supernatant

were assayed for protein determination and for Beta­

galactosidase activity.

The l3-galactos idase assay uses o-n i trophenyl G-D

ga lactopyr anos ide (ONPG) as s ubstrate . Th i 5 compound 1.5

hydrolysed by l3-galactosidase to yield a chromogenlc

compound o-nitrophenyl (ONP). ONPG was added to 30 ul of

the supernatant pl us 0.1 M sod i um phosphate, 0.1 M magnes i um

ch lor ide and 4.5 M IJ-mercaptoethano 1. The ml xture was

incubated at 37°C until the solution turned yellow, the

reaction was stopped by the addition of 1 M calcium

phosphate. The optical density (OD) of the solution was

measured at 420 nm and the units of O-galactasiddse activity

were calculated according to the following equation:

A 4 4Z0/0. 00 45 units/ml=

t ime x volume

(time, is the reaction time in minutes; volume, 1s th.,.

volume of cell extract in ml; and 0.0045 15 a constant).

The linear range was an 00 from 0.2 ta 0.8.

2.15 Western blotting:

2.15.1 Cell lysis and protein determination:

GSFs were grown to confluence in T 175 cm2 flasKs. The

media was aspirated and the cells were incubated with

49

versene (NaCl, 137 mM; potassium phosphate monobasic, 37 mM;

KCl, 67 mM; sodium phosphate dibasic, 107 mM; and EDTA, 13

mM) at 37°C for 10 min. The cells were harvested by

vigourous tapping and washed twice in a Tris/saline solution

pH 7.4. The pellet was resuspended in an SDS-lysis buf.fer,

then lysed by passing the mixture through a 25 gauge needle

5 times in the presence of a variety of protease inhibitors:

APHSF, Aprotonin, Bestatin, E-64, Leupeptin, and Pepstatin.

The lysate was boiled for 10 min. and a sample was used for

protein determlnation. This was done using a colorimetrie

assay for protein concentration following detergent

solubilization. It is similar ta the Lowry assay (Lowry et

al., 1951).

2.15.2 Discontinuons SDS-PAGE:

The gels were prepared according ta Sarnbrook et al.,

(198ge) . After boiling the lysate and determining the

concentration of the protein, 200-400 Jlg were loaded on the

gel. The gels ran overnight at 100-110 volts in duplicates.

One set was stai"ed with Coomassie brilliant blue, and the

other was transferred anto a nitrocellulose fnter.

2.15.3 Protein transfer:

Protein transfer was done by electroblotting, fallowing

the methad of Sambrook et al., (1989f). The current used

was 325 mAmp. for 3 h and 30 min. Following the transfer,

the blot was incubated for 1 heur at room temperature (or

overnight at 4°C) in a blocking solution containing Tris-

50

buffered saline (TBS) pH 7.4 and 0.5\ Tween 20 (detergent).

It was then incubated with the monoclonal antlbody

(F39.4.1), 1:10000 dilution, for 1 hour at room temperature.

This antibody recognizes a peptide sequence corresponding to

amino acids 301-320 in the N-terminal domain of the hAR

(Zegers et al., 1991). The blot was t hen washed s everal

times wi th TBS and 0.5% Tween 20 at room temperatur e and

incubated with the secondary antibody. The latter was a

horseradish peroxidase (HRP) goat anti-mouse immunoglobin G

(1: 10000 di lut ion) . The blot was washed and s ubjected to

the chemi 1 uminescence detect ion method accord lng to the

suppl ier' s protocol (ECL protocol from Amersham). It was

immersed in a mixture of detection reagents for 1 minute,

and exposed to an X-ray film for maximum 1 hour.

51

1 Il RESULTS:

1. Identlf ication of mutations:

By sequenc i ng exons 2 to 8 of the hAR from genomic DNA

of GSF the mutat i on in the pat ient C oded 605 was found to be

a thymidine-to-adenlne transversion at nucleotide 2519 in

exon 4. It changes an isoleucine ta an asparagine at codon

663 (Fig. 15), a nonconserved amino acid in the GR

subf amily.

A cytosine to guanine transversion was found in the

genomic DNA of patient 16588 at nucleot ide 2989 in exon 7.

It changes codon 820 in the HBD from a leucine to a valine

(Fig. 16), a conserved residue in the GR subfamily.

The mutat i on found in 1609 and 6003 was a cytos i ne-to­

thym i d in e t r ans i t ion a t nue le 0 t ide 3 2 3 8 i n e x 0 n 8. l t

rep1 aces a prol i ne by a ser i ne near the c-terminal end 0 f

the HBD at codon 903 (F ig. 17) which is conserved in the GR

subf amitly.

wi th the

Table 2 displays base

clinical phenotype of

and codon substitutions

the patients and the

biochemical phenotype of the mutant hAR. The structure of

the amine acids invo1ved in each mutation 1s shawn in figure

18.

2. Family studies:

2.1 16588 (Leu820Val):

Normally exon 7 (262 bp) of the hAR cantains one HphI

restriction endonuclease site. The mutation Leu820Val

creates an extra site for this enzyme (Fig. 19). Exon 7 was

ampli f ied f rom DNA extr acted from per ipheral lymphocytes of

52

Fig. 15: T ta A substi tut ion in codon 663 found by sequen­

cing exon 4 of 605. The mutant nucleotide and

amina acid sequences are compared ta control.

Aste r lsks and bo Id let ters i ndica te the base

susbsti tut ion.

Normal

C-terminus

Î

665 Gly

Glu

Ile Asn

HIS

Ser 661

J, N·terminus

53

Fig. 16: C to G substitution in codon 820 found by sequen­

cing exon 7 of 16588. The mutant nucleotide and

amino acid sequences are compared ta control.

Asterisks and bold letters indicate the mutatlon.

C-terminus

Î

n 822 [1\ Asn

[1 ~ GATC. GATC

~J Lys

~~ ~J Leu 820 va{ ~

*C G*

n Gly D Normal

n Asp [~ 818

t N-terminus

54

Fig. 17: C ta T substitution at codon 903 found by sequen­

cinq exon 8 of 1609 and 6003. The mutant nucleo­

tide and amino acid sequences are compared ta

contra 1 . Aster isks and bo ld let ters i nd icate the

mutation.

C-terminus

Î

n 905 U Ile

GATe n Lys [; GATe

•• -. a-~}ro 903 s{~ -. 41ft

• • . ~- *C T* ,: • . -'- n u " ~ --Normal Val 1609/6003

n Gin [~ 901

J, N-terminus

Phenotype Code Exon Codon Base Residue Receptor Cllnical

605 4 663 T to A Ile ta Asn deflcient PAIS

16588 7 820 C to G Leu ta Val pos iti ve PAIS

1609/ 8 903 C to T Pro to SeT. positive CAlS 6003

Table 2: Base and codon substitutions in the three families,

their exonic locations, the andragen-binding pheno-

type of the corresponding mutant AR and the clini-

cal phenotype observed.

55

Fig. 18: Chemical structure of the amino acids involved in

the three mutations: (a) praline and serine in the

Pro903Ser mutation; (h) leucine and valine in the

Leu8 2 OVal mu tat i on; and (c) iso l euc i ne and aspara­

gine in the Ile663Asn mutation. The arrows point

to the amino acid created by the mutation in each

case.

proline (Pro, or P)

+ H2N

,00-C-H

1 1 BzC CB2 ""/ Clh

leucine (Leu, or L)

COO + 1

H3N -C--H

1 Clh

1 CH

/, }bC 013

isoleucine (Ile, or 1)

COO + 1 HJN-C-H

1 H-C-C}13

1 C:-12

1 Cr13

... +

serine (Ser, or S)

COO

1 HJN-C- H

1 }1-C- (C)!FJ

1 lB

valine (Val, or V)

coo + 1

---... ~ HJN - C - H

1 œ

/" }hC CH)

asparagine (Asn, or N)

(a)

(b)

(C)

Fig. 19: Leu820Val nueleotlde and amino acid sequence alte­

ration in exon 7 and HphI sites. 7Aand 78 are the

sense and ant i -sens e nue 1 eot ide sequences us ed as

intronie primers for exon 7 amplification. Arrows

point to the substitutions and the digestIon sites.

Intronie sequences are shawn in smaller Slze

letters.

G

~ GCTCCTICGTGGGCATGCTICCCCTCCCCATICTGTCTICATCCCACATCAG TI CCA GTG GAT GGG .eTG

7 A le Pro Val Asp G1y ~u ~ ,

Hph 1 Val

AAA AAT CAAfAAA TIC ITT GAT GAA CIT CGA ATG AAC TAC ATC AAG GAA Lys Asn Gin Lys Phe Phe Asp Glu Leu Arg Mel Asn Tyr Ile Lys Glu

crc GAT CGT ATC AIT GCA TGC AAA AGA AAA AAT CCC ACA Tec TGC TCA Leu Asp Arg Ile Ile Ala Cys Lys Arg Lys Asn Pro Thr SeT Cys SeT

Hph 1 , AGA CGC TTC TAC CAG CTC ACC AAG crc crG GAC TCC GTG CAG CCTGTAAG Arg Arg Phe Tyr Gin Leu Thr Lys Leu Leu Asp SeT Val Gin Pro

CAAACGATGGAGGGTGCTTTATCAGGGAGA~CAGCçrGATAGAGCCAATG

..2!! --

e -

51

16588 and his grandmother, grandfather, mother, 2 maternal

aunts and an af fected unele. The PCR pr oducts were di gested

wi th Hp.'7.I, and the fragments were r esolved on a 10'\

polyacryl amide gel. Figure 2 a shows the r estr i ct i on patter n

of the family. The unele and the proband (lanes 4 and 6,

respectively) had identieal 3-band pattern of 96, 88, and 18

bp. The mother and the grand mothe r (lanes 3 and S,

respecti ve ly) had identieal 4-band heterozygote patter ns

( l 7 4, 9 6 , 8 8 , and 7 8 b p) e 0 m p ris i n g the no r ma l a II e 1 e (1 1 4

and 88 bp fragments), and the mutant allele (96, 88, and 78

bp fragments).

2.2 1609/6003 (Pro903Ser):

Exon 8 was ampl if ied and digested with Bsp1286I. The

fragments were resol ved or, a 10'\ polyacrylamide ge 1 . The

mutation Pro903Ser abolishes the site for asp1286I in exon

8 (F i g . 2 1 ) . Fig ure 2 2 s h 0 ws the 16 0 9 / b 003 f ami lys t u d y .

A digested control sample (lane 5) yie1ded 2 Lt"agments: 152

and 143 bp. The PCR products frui',1 the 1609 and 6003 were

resistant to digestion (lanes 6 and 7, respectively).

2.3 605 (Ile663Asn):

There was no fami ly study conducted on the 1 l e663Asn

mutation for three reasons: 1) 605 was the only fam! ly

member affer::ted; 2) the mother's DNA was not available; and

3) the mutation dld not ereate or abo1ish a known

res t r let i on enzyme.

58

Fig. 20: Family study of 16588 (Leu820Val mutation). Exon

7 PCR produets were digested Wit:1 HphI. The frag­

ments were resolved on a 10% polyacrylamide gel.

Lanes 1 and 9 eontain PhiX174 cut with HaeIII (DNA

moleeular we ight marker). Lane 2 carr ies an uncut

control PCR produet of exon 7 (262 bp). The mother

and the grandmother (lanes 3 and 5 respect i vely)

show the heterozygote pattern of digest. The

mutant allele, having an additional site for diges­

tion, was eut in three fragments (96, 88 and 78

bp), and the normal allele in two (174 and 88 bp).

The uncle and the proband (lanes 4 and 6 respec­

tively) show the homozygote mutant pattern of

digestion. Lanes 7 and 8 show the normal pattern

of HphI digestion of exon 7 of an unaffected aunt

and gr andfather re.=; pect i vely.

262 234 194

118

72

123456789

174

~3 78

59

Fig. 21: Pro903Ser nucleotide and amino acid sequence alte­

rdtlon and Bsp12861 site. 8A and 8B are the sense

and anti-sense nucleotlde sequences used as

intronic primers for ~xon 8 amplification. Arrows

point to the substitutions and the Bsp12861 site in

control. 'Lntronic sequences are shown in smaJ 1er

size lettets.

e

ACCKCTIQICACCçrGTITITCTCCCTCTIATIGTICCCTACAG AIT GCG AGA GAG CTG CAl' CAG 8A Ile AJa Arg Glu Leu His GIn

TIC ACf TIT GAC erG CfA ATC AAG TCA CAC ATG GTG AGC GTG GAC nT Phe 111r Phe A"p Leu Leu Ile Lys Ser His Met Val Ser Val Asp Phe

Bsp 12861

1 \ X

CCG GAA ATG ATG GCA GAG ATC ATC TCT GTG CAA G";G tct AAG ATC CIT Pro Glu Met Mel Ala Glu Ile He Ser Val GIn Val Pro Lys Ile Leu

-rCT GGG AAA OTC A 7

")ct Gly Lys V"i

::CCCA<iCTCATt .J\..

r t

1er :rc TAY TIC CAC ACC CAG TGAAGCATIGGAAACCCTA

{, ,e Tyr Phe His Thr GIn

T-Lr ,-, rCTTCIGCCIGTTAIAACTCIGCACTAÇTÇCJÇJGÇAGIGCCTnGGGG

88

e

60

1"'lg. 22: Family stuc1y of 1609/6003 (Pro903Ser mutation).

Amplified exon 8 was digested with Bsp1286I. Lanes

1, 2 and 3 show amplified exon 8 of a control, 1609

and 6003 respect ively (295 bp). Lane 4 shows the

molecular weight ffi~~ker PhiX174 cut with HaeIII.

Lane 5 shows amplifled exon 8 of a control, cut

with Bsp1286I. Two fragments were generated: 152

and 143 bp. Lanes 6 and 7 (exon 8 from 1609 and

6003 respectively) show resistance to digest.

MW 1 2 3 4 5 6 ., MW bp bp

310

234

194 52

118

61

1. Si te-d i rected mutagenes 15 :

AIl three rnutatlons were reproduced by a recombinant

PCR technique (Higuchi 1990). For the Ile663Asn 1 mutation,

the two primary PCR reactions were perfGrmed by I.Ising: the

f lank ing sense pr imer DNA-B wi th the mutan tant isense pr imer

605-B [section II (1.2») to give a 504 bp fragment; and the

Elanking antlsense primer Bac-B with the mutant sense primer

605-A to give a 768 bp fragment. The secondary PCR produced

the full-length DNA fragment. It was double-digested with

HindIII and XhoI. Thus, a 330 bp DNA fragment, harboring

the mutation, was released. It replaced the normal seqüé:nce

in pSVhARo/BHEX.

For 16588, the two prlmary PCR reactions were performed

by using: the flanking sense primer 605-A with the mutant

antisense primer 16588-B [section II (1.2)] to produce a 492

bp fragment; and the f1anking antisense primer P3' [section

II (1.2)] with the mutant sense primer 16588-A (section II

( 1 .2) 1 to produce a 472 bp fragment. The secondary PCR

synthesized the full-length fragm2nt that was digested with

EcaRI and BamHI and re1eased a 462 bp-DNA fragment

containing the mutation.

For 1609/6003, the two primary PCR reactions produced

a 651 bp fragment and a 222 bp fragment by using: the

flanking sense primer 882718-A [;ection II (1.2)] with the

mutant antisense primer 1609-8; and the flanking antisense

1 The site-directed mutagenesis and the subcloning of Ile663Asn were done by Sylvie Bordet, a former graduate 5 tudent.

62

primer P3' with the mutant 1609-A [sectlon II (1.2)} sen:.,'t'

prImer respectively. The full-length DNA fraqment was

synthesized in the secondary PCR reaction. It was dlqested

with EstEr and BamHI and yielded a 394 bp long fragment.

The three mutant hAR cDNA sequences g~nerated by PCR ln

the hAR expreSSlon vector, were verlfied by DNA sequencing

prior to functional studies. This was done ta exclude

unwanted mutatio~s.

4. Androgt'n-binding assays:

4.1 Genital skin fibroblasts:

Androgen-binding assays on GSF from 1609 and 6003 were

published by Gottlieb et al., (1987). The A-R complexes

formed in GSF from 6003 had an incr~ased apparent

equilibrium dissociatlon rate constant (K4=0.5 to 0.7 nMi,

but a normal maximal bindlng capacity (Bu.) with MB and MT.

The complexes fa i 1 ed to augment (0 r upr egu la1:e) the i r 1

androgen-binding activity upon prolonged incubation with

synthet i c nonmetabo 1 i zable andr ogen. The unliganded A.Rs

were thermostable. In th i sassay, the GSFs wer e i ncubated

at 42°C, in the presence of 100 ~M cycloheximlde, for

different lengths of time, then the tritiated MB was ddded

and the cells were incubated at 37°C. The complexes formed

at various tirnes after the addition of :JH-MB 37"C were cl

measure of the rernaini'1g receptors capable of hormone-

binding. However, when the complexes (already labelled at

37°C) were placed at 42°C, they were thermolablle. The A-R

complexes had increased nonequilibrium dissoci.'ition rate

constants at 37°C (t 11Z =40 min, normal t 1l2 =230 mln. with MB).

63

A-R complexes in GSF from 16588 had normal androgen­

bInding activity (>20 fmol/mg protein with MB) and were able

to augment with prolonged incubation wlth dndrogen. The

nonequllibrium dissOcIatIon rates were increased with MB,

MT, and DHT. The complexes were thermolabIle at 42°C. The

apparent equilibnumdlssociation rates observed (K.=0.l6 nM)

f e Il l n t he n 0 r ma 1 r ange (O. 0 1 - 0 . 3 n M) .

Initlally, A-R complexes formed in GSFs from 605 had

deficient levels of androgen-binding activity (between 10

and 20 fmol/mg protein). Due to the low level ot activity,

the qualitative assays were not possible. The GSF cultures

grew poorly. Once we were successfùl in g::owinq a new

culture of 605, the number of A-R complexes with MB was

~loser to the normal range. The dissociatiùn rates 0f the

complexes were normal. The complexes were able to augment

with prolonged incubation with androgens. The specifie

androgen-binding activity increased from 25 to 58 fmol/mg

protein in 24 hours.

4.2 Transfected COS-l cells:

In order to prove the pathogenicity of the mutations,

we transfected COS-l cells with the hAR expression vector

pSVhARo/BHEX harbor ing each of the appropr iate base

substitutions. Base substitutions were introduced by site­

directed mutagenesis. Transiently transfected COS-l cells

were then subjected to a serles ot" kinetic assays. They

were: thermolabilitYi nonequilibrium dissociation rates;

apparent equilibrium dissociation rates; and transactivation

assays.

64

4.2.1 Thermolability:

COS-l cells transfected with 2 )1g of the Prû903Ser

mutant plasmid had very thermolablle A-R complexes at 42°C

as seen in GSF. The cells were labelled wlth ~H-MB or 3H-MT

at 37°C for two hours in the presence of 100 pM

cycloheximide (the latter was used to prevent protein

synthesis during the IncubatIon). The cells were then

shifted ta a higher temperature (42°C) and were incubated

for different lengths of rime (0 to 6 h). They were then

assayed for the remaining androgen-binding actlvIty. This

was pl8tted semi-logarirhmlcally, as percent activlty,

against time. 50% of the mutant complexes were lost in 60

minutes exposure to 42°C with MB (Fig. 23c). In COS-1 cells

transfected with the control plasmid, the same amount of

complexes was lost in 900 mInutes. Therefore, the Pro903Ser

mutant plasmids were 15 times more thermolabile or unstable

than control with MB. These mutant A-R complexes were ~lso

thermolabile with MT and the complexes were lost at a faster

rate than MB. Thus, thlS mutatIon causes thermo1abi1ity of

the complexes in GSF and COS-l cells.

When COS-l cells were transfected wlth the Leu820Val

mutant plasmid, the complexes formed were thermolabi le at

42°C, as seen also ln the GSFs of the patIent 16588. The

mutant complexes lost 50% of their activity in 150 minutes,

whereas the control complexes lost 50% of the activity ln

900 minutes (Fig. 23b). Therefore, the Leu820Val mutant

complexes were 6 times more thermolabIle than control. The

loss of activlty was slower than that seen in the Pr0903Ser

mu ta t ion under the same cond i t ions. The abnorma 1 therma 1

65

behavlour of the complexes seen in GSF was repeated ln the

transfected COS-l cells. This proved the pathogenicity of

this mutation.

When COS-l cells were transfected with the Ile663Asn

mutant AR, the complexes were as thermostable as the control

AR at 42°C with 3H-MB (Fig. 23a).

When the unliganded receptors were exposed to 42°C for

30 min or l h then labe1led with 3H-MB at 37°C in the

presence of 100 ~M cycloheximide, the complexes formed were

as thermostable as control (Fig. 24). Therefore, the

unligdnded receptors were not thermolabile but the liganded

ones were. This phenomenon has been reported by Gottlieb et

al., (1987) in GSFs from 1609 as mentioned above. Thus the

receptors appeared to be in two different states depending

on presence or absence of hormone.

4.2.2 Nonequilibrium dissociation rates:

The nonequilibrium dissociation rate constant (k,

min- 1 ) is a measure of how fast A-R complexes dissociate

inside the cells. Table 3 displays the mean k values

obtained in GSFs and COS-l cel1s transfected with the three

mutant hARs. For 1609/6003 (Pro903Ser) it was clear that

the A-R complexes had higher (2-to-4 fo1d) dissociation

rates than control, with aIl ligands. The k values in COS-l

ce1ls were not identical ta the ones from GSF (control or

mutant) probably because the internal milieu of the two cell

types is different. However, as in GSF, the COS-l system

revealed mutant rates of dissociation higher than control.

Figure 25 is a representative dissociation assay in

66

Fig. 23: Thermolability of complexes in transfected COS-l

cells. 1 ~g of control, Ile663Asn (a), Leu820Val,

(b), and Pro903Ser (c) plasmids were used. 48 h

after transfection, the cells were labelled at 37°C

with 3 nM 3H MB for 2 h in the presence of 100 ~M

cycloheximide. Then, they were shifted ta 42°C for

a to 6 h. The ce11s were assayed for the remaining

MB-binding activity at 0, l, 2, 4, ana 6h. The

remaining binding activity was plotted semi-loga­

rithmlcal1y agalnst time (min.).

(a)

c conU'OI

• I1c663Asn

10 0 100 200 300 400

0.() C .-C

100 .-C': e QJ ... >. -.-~ .-- (b) ~ C': 0.() C ~ C

iii control .-.J:J. • • Leu820Val

== ~ 10

0 100 200 300 400

~

100

(c)

• control • Pro903Scr

o 100 200 300 400

Time (min)

67

Fig. 24: Thermolability of unliganded receptors in trans­

fected COS-1 cells. 1 ~g of control, Leu820Val,

Pro903Ser, and Ile663Asn plasmids were used. 48 h

later, the cells were incubated at 42°C for 0 to 2

h in the presence of 100 ~M cycloheximide. Every

30 min., a group of cells was labelled at 37°C with

3H-MB for 30 min. The MB-binding activity was

plotted semi-logarithmlcally against time (min.).

100

el) c .-c .-œ S ~ s.. >. -.-.. . --tj œ el)

I!& control .5 "C • Leu820Val c :E • Pro903Ser 1

== :; • Ile663Asn ~

10 0 50 100 150

Time (min)

68

Fig. 25: Dissociation assays in COS-l cells transfected with

2 ~g of the Pro903Ser plasmid with MB and MT at

37°C. The binding activity was calculated as per­

cent activity remaining and was plotted semiloga­

rithmically against time (min.). The k values

(min"l) were: MB, 0.002 for control and 0.005 for

the mutant; and MT, 0.007 for control and 0.030 for

the mutant.

.... -

o 30

• control MB

• Pro903Scr MB

• control MT A Pro903Scr MT

60 90 120 150

Time (min.)

6<)

transfected COS-l cells. The cells were transfected with 2

~g of the Pr0903Ser mutant hAR, then labelled with MB or MT

at 37°C for 2 h. The medium was then replaced wlth

unlabelled androgen for different lengths of time. The

percent androgen-binding activity remaining WdS plotted

semi-Iogarithmically agalnst ~ime (min.). The specifie

basal activity after two hours of labelling was considered

100 percent. The log percent binding activity remaining at

different time intervals were used in a linear regression

analysis. The dissociation rate constants (k) were

determined directly from the slopes generated. In GSF the

control mean k values at 37°C for DHT and MT are: 0.006 ±

0.0012 ~n=15) for DHT, and 0.012 ± 0.03 for MT (n=26)

(Pinsky et al., 1985). The normal k value for testosterone

has been defined using 5<x-reductase deficlent cell-lines

( k = 0 . 0 2 4 min - 1) ( Ka u f ma n and Pin s k y 1 9 8 3 ) .

When the Leu820Val mutation was expressed in COS-l

cells, • the A-R complexes had 1.5-to-2 fold increase of

nonequ il i bd um d issoc i at i on rates over contr 0 1 (Table 3).

Figure 26 shows the dissociation profile of Leu820Val and

Ile663Asn complexes expressed in COS-1 cells with (a) MB at

42°C and (b) MT at 37°C. The abnor~al biochemical phenotype

of Leu820Val mutant hAR has been reproduced ln transfected

COS-l cells. This proved that the sequence alteration is

responsible for the abnormal behaviour of the complexes and

the clinical phenotype of the patient. The Ile663Asn

mutation showed normal dissociation rates with MB and MT as

seen in GSFs. The dissociation rates of Ile663Asn with DHT

were slightly higher than normal in COS-l cells and GSF

70

Table J: Mean nonequilibrium dissociation rate constants (k

in xlO- 3 min-1 ) were calculated along with the

standard deviations in dissociation assays. GSF

(from 605, 16588 and 1609/6003) and COS-l cells

(transfected with each of the 3 mutant hARs) were

labelled with MB, MT, DHT or T at 37°C and "chased"

either at 37°C or 42°C. n represents the number of

experiments. Dashes were used where the experiment

was not performed.

GSF

Mutant (n)

DUT 605 37°C 9 i3 ( 3 )

16588 11t4 ( 4 )

1609/6003 24±6 ( 2 )

MD 605 37°C 3±0.7 (2)

MT 37°C

T 37°C

1609/6003 1 4 ( 1 )

16588 12±0 (2)

1609/6003 30tO (2)

605 I2tO ( 2 )

16588 19 t7 ( 3 )

1609/6003 48t4 ( 2 )

16588 21±4 ( 2 )

(xlO- 3

Control (n)

6:t1.2 ( 15)

3±0.1 (15)

6±0.1 (15)

I2±2 (26)

23

COS-l min-l. )

Mutant (n) control (n)

Ile663Asn 6±1 ( 3 ) 5t! ( 3 )

Leu820Val 9±0.6 ( 3 ) 5t! ( 3 )

Pro903Ser 23±8 ( 3 ) 6 i3 ( 3 )

Ile663Asn 3 (1) 3 ( l )

Pro903Ser 7±2 (3) 3tO.6 (3)

11e663Asn 6 ±O . 8 ( 3 )

Leu820Val

7±0.7 (2)

11±0.2 (4) 7tO.5 (4)

Pro903Ser

11e663Asn 8.2 ( 1 ) 8.5 ( 1 )

Leu820Val 12.5±2 ( 2 ) 9 ±1 ( 2 )

Pro903Ser 31±4 ( 3 ) 7tO.6 (3)

Leu820Val 37 ( 1 ) 18 ( l )

71

Fig. 26: Dissociation assays in COS-l cells transfected with

2 ~g of the Leu820Val or Ile663Asn plasmids. The

cells were assayed at 42°C with MB and 37°C with

MT. k values (min-l.) were: (a) MB, 0.007 for

control, 0.007 for Ile663Asn, and 0.010 for

Leu820Vali (b) MT, 0.009 for control, 0.009 for

Ile663Asn, and 0.011 for Leu820Val.

100

>. ... .• , .• ... ~~ ~ C

o.c 'c (a) C'-.• ~

"0 e .S Q,I &J 1..

1

== a control ~ • Ilc663A~n ~ • Leu820Val

10 0 30 60 90 120 150

Time (min.)

100 >. -.;:; .--~~ '" C ~'c c·· .• ~ (h) ~S .:: Q,I .cl.. • li control E-~ • lIe663Asn ~ • Leu820VaI

10 0 30 60 90 120 150

Time (min.)

72

(Table 3).

4.2.3 Apparent equilibrium dissociation rate constants:

The apparent equilibrium dissOciation rate constants

(K.) (from Scatchard anal' .s) were used in order to

determine che affinity of the rèceptors ta androgens. GSF

or trans f ected COS-I ce Ils wer e labe lIed wi th di f ferent

concentrations of ligand at 37°C for 2 h in the presence of

100 ~M cyc l ohex imide. The ce Ils wer e then ass ayed for

binding activity. Table 4 displays the different mean K.

values with MB or MT in GSF and COS-l cells. GSF from 1609

and 6003 show increased K. values, a proof for lower affinity

or instabi li ty of complexes. These results have been

reproduced in COS-l cells transfected with 1 J.lg of the

Pro903Ser plasmide Figure 27a shows the Scatchard plots of

Pro903Ser with MB, and figure 28a with MT in COS-l cells.

The binding activities h~ve been corrected for transfection

eff icumcy. The K •• were computed from the slope of the

Scatchard plots, and the Bm.x (maximum binding capacity in

fmol/mg protein) was extrapolated from the intercept of the

line on the abscissa. The Brrax vdlues in COS-I cells

transfected with 1 J.lg of the Pro903Ser plasmid were normal

with MB, but apparently abnormal with MT. The normal K.

values in GSF (exposed ta hormone for 2 h) have been defined

by Pinsky et al., (1985): DHT, 0.22 ± 0.09 nM (26

experiments); and MT, 0.16 ± 0.08 nM (8 experiments). The

8m _ Je •• values were for DHT, 28 ± 8 fmol/mg protein (26

experiments); and for MT, 31 ± 12 fmol/mg protein (8

exper i ments ) .

13

Table 4: Mean apparent equilibrium dissociation rate

constants in GSF and transfected COS-l cells (K,)

expressed in nM. With COS-l cells, 1 ~g of

plasmids were used except where it is speclfled

(0.05 ~g). The experiments were conducted at 37°C

for 2h.

GSF COS-l nH

Mutant (n) Control (n) Mutant (n) Control (n)

MB 605 Jle663asn .01 to .30 (0.05~g) .49t6 ( 2 ) .19:t0.007 ( 2 )

16588 Leu820Val .16:t:4 ( 3 ) (0.05~g) .48t3 ( 2 ) .19±0.007 ( 2 )

(l~9 ) .60±l ( 3 ) .sO±.lO ( 3 )

1609 Pro903Ser .50 (1) .05 ( 1 ) (l~g) l.O±.30 (3) .30±.20 ( 3 )

6003 .70 (1) .10 ( 1 )

MT 605 Ile663Asn (O.Os~g) .50 ( 1 ) .30 (1)

16588 Leu820Val (O.OS~9) .60 ( 1 ) .30 ( 1 )

(l~g) .78±.l2 (3) .SO±.20 ( 3 )

1609 Pro903Ser (1~g) 1. S±. 50 ( 4 ) .70±.30 ( 4 )

74

Fig. 27: Scat chard analysis with 3H-MB (0.03-3 nM) at 37°C

in the presence of 100 J,lM cycloheximide for 2 h and

30 min. (a) l /lg of control (K.= 0.59 nM) and Pro

903Ser (K.=1.59 nH) plasmids were used. (b) 0.05

J.l.g of control (K.=.l9 nH), and Leu820Val (K.=0.51

nM) were used. In (c) 0.05 J.l.g of control (K.=0.18

nM), and Ile663Asn (K.=0.46 nM) were used. The

range of control K. values changed wi th the amount

of p lasmid used. The range 0 f contr a l K. va lues in

transfected COS-l cells was 0.4-0.7 nM with 1 J,lg

plasmid, and 0.18-0.34 nH with 0.05 j.lg.

MB 500

El control

400 • Pro903Ser

300

(3)

100

0 0 50 100 150 200 250 300

300 III control -.

\CI • Leu820Val '= .... il< 200 --~ ~ (b) '-'-- 100 ~ c: = Q

== 0

0 10 20 30 40 50 60

300 ....... --------------III control

• Ile663Asn

200

(c)

100

o+-~~~-~-,-~~~~~~ o 20 40 60 80

Bound (fmol/mg protein)

75

Fig. 28: Scatchard analysis us ing 3H MT (0.03-3 nH) at 37°C

for 2 h and 30 min. in the presence of 100 ~H

cyclohex imide. In (a) 1 )J.g of control (K.=O. 7 nH)

and Pro903Ser (K.=1. 6 nH) were used. In (b) 0.05

~g of control (K.=0.34 nH), Leu820Val (Kd:0.59 nM),

and Ile663Asn (K.=O. 52 nH) were used.

MT 500

iii control

400 • Pro903Ser

300

(a) 200 --"b 100 ....c

~ --~ 0 ~ 0 SO 100 ISO 200 250 300 L.

'-~ = = Q

100 = m m control

80 • Leu820Vai

, Ile663Asn

60 (b)

40

20

0 0 10 20 30 40 50 60

Round (fmol/mg protein)

----------------------

76

When GSF from 16588 were assayed in a Scatchard

analys is, the mean K. value was in the normal range w i th ME

(K.=0.16 nM) (Table 4). When COS-1 cells were transfected

with 0.05 J.lg or l).1g of the Leu820Val plasmid, the Kd values

were higher than normal. Figure 27b shows a Scatchard plot

with MS and figure 28b with MT. There was a difEerence in

the K. values when di ff er ent amounts of p lasmids wer e

transfected. With 0.05 ).Ig, the d ifference between control

and mutant K .. was larger than the difference seen with 1 ).lg

( in each exper i ment) .

Figure 27 c shows a Scatchard plot using 0.05 J.lg of the

Ile663Asn hAR with MB. The K. values were higher than

normal. The values wer e cor rected for tran.:; fect i on

efficiency and the Bm .... was h1.gher than control. The K.

values were aiso higher with MT (Table 4) (Fig. 28b).

5. Transacti vat ion assays:

COS-I celis were cotransfected with 5 to 10 ).Ig of

mutant or control plasmids, 5 to 10 J.lg of the reporter

pl asmid pMMTV-GH, and 3 to 4 ).Ig 0 f the pCHV- Ogal. plasmi d .

48 hours later, different concentrations of HB (0.03 to 10

nM) were added. GH activity was measured 48 hours after

addition of ligand. Figure 29 shows the profile of

transcriptional activation of GH by the three mutant A-R

complexes. GH acti vi ty (cpm//lg pr ote in) was pl otted aga i ns t

MB concentration (0.12 to 3.34 nM). They were both

cor rected for trans fect ion ef f i ciency. The P r 090 39 er

mutation shows a decreased leve 1 of GH express ion. The

complexes were unstable upon prolonged exposure to ligand.

77

Fig. 29: Cotransfection assay measuring the transactivation

profile of the three mutants compared to control.

COS-l cells were cotransfected with 7 ~g of con­

trol, an~ mutant (Leu820Val, Pro903Ser, and Ile663

Asn) hAR expression p1asmids, and 7 ~g of the

pHHTV-GH reporter plas mid . 48 h later the ce 115

were labelled with 0.12 to 3.34 nH 3H HB for 2 h

and 48 h. Another group of cells was labelled for

2 h (between the 94th and 96th hour after transfec­

tion) (see diagram, page 78). The media from

the 48 h group was assayed for GH activity. This

was corrected for transfection efficiency and

plotted as cprn/~g prote in against concentrations of

MB (nM).

78

The samples for GH activlty were taken 48 hours after

addition of ligand; by that time, the complexes lost 75~ of

the activity seen at 2 h incubatlon wlth Ho (48-50 h group)

(Fig. 30b). Figure 30 shows the androg~n-binding activity

in three different intervals: 2 h (48-50 h), 48 h, and 2 h

(94-96 h). The following diagram shows the dlfferent groups

of cells assayed in figure 30 considering cotransfection as

o t ime.

Cotransfection 48h

2h 2h

o 48-S0h 94·96h

The binding activity in Pro903Ser was restored to the

initial 2-h binding activity levels when the cells were

incubated for 96 h (post transfection) without hormone,

followed by 2 h incubation with MB. This group was used ta

show that the drop in activity at 48 h was not due to 1055

of plasmid but rather to the instabi lit y of the complexes

when exposed to hormone for 48 h or more. 1 n f igur e 31, the

Pro903Ser mutation shows normal transactivation per unit

complexes.

In figure 29 the GH activity with Pr0903Ser increased

wi th the HB concentrat ions at a s lower rate than normal, and

d id not reach satur at ion. In higher concentrations of MB

the instability problem was alleviated ta a certain point

probably because of the avallibil1ty of a large

concentration of hormone.

In figure 29, the Leu820Val mutation had lower GH

activity than control at all concentrations of MB and the

100

>. - 80 Il ,-;. ._-tic ('Q'Qj - 60 :c= ca Il control "C~ ~::l 40 • Leu820Val ~Ê ('QQ.

• Pro903Ser S~ ... 20 0 Z • Ile663Asn

0 a 1 2 3 4

[MB] nM

79

Fig. 30: Androgen-binding activity in cotransfected COS-l

cells (F:g. 29) during three intervals: 2-h

interval (48-50 h post transfection); 48-h interval

(48 h post transfection); and a 2-h interval (94-96

h post transfection) (refer to diagram, page 78).

(a) Ile663Asn, (b) Pro903Ser, and (c) leu820Val.

The MB-binding activity (fmol/mg protein) was

plotted against different concentrations of MB (nH)

and corrected for transfection efficiency.

2000 • control 2h (48·50h)

• control48h

• control 2h (94-96h)

1500

1000 (a)

500 ~ Ile663Asn 2h (48-50) ~

0 IIe663Asn 48h .... . -> m IIe663Asn 2h (94-96h) .- 0 ..... C.J ~ 3.34 1.72 0.85 0.45 0.22 0.12

01) C ._- 2000 ':Oc C·-.- ~ ~ ....

1 ~ 1500 ~ '-Cc. ~OI)

~ e 1000 (b) ---~-~~ .- e S~

500 -- f:?l Pro903Ser 2h (48-50h) "'C ~ 0 Pro903Ser 48h N .-- C3 Pro903Ser 2h (94-96h) ~ 0 e 3.34 172 0.85 0.45 0.22 0.12 '-~ Z

2000

1500

1000 (c)

500 ~ Leu820Val 2h (48-50h)

0 Leu820Val 48h

0 ~ Leu820Vai 2h (94-96h)

3.34 1 72 085 0.45 0.22 012

[MB] nM

curve was slightly shifted to the right.

was seen in 5 exper iments out of 8.

performed, the tLansactivation seen

80

Thls type of curve

In aIl the assays

by the Leu820Vai

complexes was always higher than the one seen with

Pro903Ser. In figure 30c thE:: complexes weLe stable wlth

prolonged incubation with hormone (48 hl. The proof for

this was by comparing the binding actlvity between the 48-h

group and the 94 to 96-h group. At one concentration (3

nH), the binding activity at 48 h was higher than the one dt

94-96 h thus showing sorne instability at this concentration.

When the OH activity was plotted against HB-bindlng dctivity

(Fig. 31), the transactivation per unit complex was

intermed iate between that of control and Pro903Ser (3 out of

8 experiments). In one assay, the cells were incubated with

HS for 96 h (fresh media added after 48 h) then medlum

samples were assayed for GH. The GH activity measured was

lower than control and the OH versus MB-binding activity

curve was shifted to the right. The complexes, however,

showed normal transactlvation when GH activity was plotted

against MB-binding activity (Fig. 31).

In figure 29, the Ile663Asn

transactivation in 5 out of 7

stability of the complexes (Fig.

muta t ion showed norma l

exper imen ts and norma l

30 a) • l n t wo cas es, the

transactivation was abnormal. This happened when the cells

were subjected to longer incubation with MB (as mentioned

ab ove for Leu820Val). The transactivation of GH was normal

per unit HB-binding ativity in aIl the experiments (FIg.

31) .

61

Fig. 31: GH activity plotted against MB-binding activity in

cotransfect ion assays from the 48 h group (see Fig.

29). This figure shows the transactivation profile

of control and mutant hARs (Ile663Asn, Leu820Val,

and Pr0903Ser) per unit complex.

~ .... .-~ .-.... (,J -~c: .-:C~ Co -'QQ.,

~~ .- :::l --~5 CQ., -eJ o-

;Z

- -----------------

, 00

80

60

40

m control 20 • Lcu820Vai • Pro903Scr ... IIc663Asn

0 a 500 1000 1500 2000 2500 3000

Normalized specifie MB-binding activity (fmol/mg protein)

82

6. Western blottinq:

Fresh lysates were prepared from GSF of 605, 16588, and

6003. The protein concentrations were measured. 325 ~g of

605, and 400 ~g of 16588 and 6003 were loaded on a

discontinuous SDS-po1yacrylamide gel. The amount of protein

in the 605 lane was less than 400 ~g because the sample was

more dilute than the other two. The gel was electroblotted

onto a nitrocellulose filter. The blot was blocked with TBS

and Tween 20 (0.5\) and incubated with the monoclonal

antibody F39.4.1 directed against a portion of the N­

terminal domain of the hAR. After a series of washes, the

blot was incubated with the HRP goat anti-mouse immunoglobin

G. The blot was washed and incubated in the

chemiluminescence detection reagents and exposed to an X-ray

film for 1 h. Figure 32 shows one prominent band of

approximately 110 kDa in aIl the mutants: 605, 6003, and

16588 in lanes 2, 3, and 4 respectively. The protein marker

was also visible and the bands were 116 and 68 kD. The

background was high probably because: firstly, overexposure

(1 hl; secondly, there was sorne degradation of the hAR; and

thirdly, nonspecific binding to the antibody.

5. Bxon 1 amplification and sequencinq:

Parts of exon 1 from 605 and 1609 were amplified using

exonic primers. The PCR products were resolved on a 1\ low

me 1 t agarose. The fragments were exc ised and used for

sequencing. Polyg1utamine and polyglycine tracts in exon 1

were sequenced. In 605, the number of glutamines and

glycine5 fell in the normal range (22 for both). In 1609,

83

Fig. 32: Western blot using a monoclonal antibody directed

agalnst a portion of the N-terminus of the hAR.

Proteins were detected using a HRP goat anti-mouse

irnrnunoglobin G with a chemiluminescence detection

kit. GSFs from 605 (2), 6003 (3), and 16588 (3)

were lysed. Lane 2 contains 325 ~q protein, and

lanes 3 and 4 contain 400 ~g each. Lane 1 shows

the high molecular weight protein marker. A

prominent band was present at approximately 100 kO

in ail mutant lysates.

kD 1 2 3 4 kD

116-- - 1: a:--=U 68- ..... .:::.

84

the number of glutamines in the glutamlne tract was also in

the normal r~nge (27 glutamines).

85

IV DISCUSSION

Thr ee po i nt mutat i ons have been d iscovered in our

laboratory in three families affected with AIS. Sequencing

exons 2 to 8 of the hAR gene revealed: a T to A transversion

in exon 4 changing isoleucine to asparagine at position 663

in a patient coded 605; a C to G transversion in exon 7

replacing leucine by valine at position 820 in a patient

coàed ]6588; and a C to T transition in exon 8 replacing

proline by serine at position 903 in two siblings coded 1609

and 6U03.

1 was interested in proving the pathogenicity of the

mutations. To accomplish this goal, the mutations have been

reproduced by site-directed mutagenesis in an hAR expression

vector, which was then transfected into COS-l cells. The

resulting androgen-binding activities were measured in

k inet ic assays and compared to control. The COS-l cells

were used in these assays because they have negl igible

amounts of specifie endogenous androgen-binding activity (5

to 6 fmol/mg protein). Transfecting marnrnalian cells with

the mutant AR express ion vectors has been considered the

main approach to prove the causative Iole of mutations in

the development of AIS (French et al., 1990).

ln order to understand the impact of amino acid

substitutions on proteins we need to know the function of

each residue involved in the suL~titution. The following is

a short description of the different existing side chains in

the twenty amine acids. They vary in size, shape, charge,

hydrogen-bonding capacity, and chemical reactivity. They

86

can be grouped as follows: a) nonpolar (alanine, valine,

leucine, isoleucine, proline, phenylalanine, methionine and

tryptophan); b) uncharged polar (glycine, asparagine,

glutamine, cysteine, serine, threonine, and tyrosine) i c)

acidic (aspartic acid and glutamic acid)i and d) basic

(lysine, arginine, and histidine) (Alberts et al., 1983).

The three-dimensional structure of a protein is specified by

its amine acid sequence and the steric relationship among

non-ad j acent ami no ac ids in the sequence. In order f or a

protein to function properly, its conformation must be

intact (Stryer 1988b). In the Pr0103Ser mutation, proline

is replaced by a serine at position 903 in the hAR. This 1s

a major change since proline has a nonpolar, cyclic side

chain and sel' ine has an uncharged polar, hydroxyl one.

Thus, the two amino acids have different chemical

propert i es. The unexpected pl' esence of a ser i ne in that

position might have created a site for phosphorylation. It

has been observed that GR was phosphorylated in human breast

epithelial cells (Rao and Fox 1987). Thf~ phosphorylated

amine acids were phosphoserine (89%) and phosphotyrosine

(11\). However, 90\ of phosphorylation sites of the AR

were located in its N-terminal domain (Kuiper et al., 1993).

This has been also observed for the GR (Hoeck and Groner

1990) and PR (Chauchereau et al., 1991).

The Pro903Ser mutation in COS-l cells produced A-P

complexes with a high degree of instabilitYi an increased

nonequilibrium rate of dissociation; an increased apparent

equilibrium dissociation rate constant (lower affinitY)i

increased thermolability; and defective transactivation

87

mainly because of the instability of complexes. Reproduclng

an abnormal behaviour of complexes in COS-1 ce11s proved the

pathogenicity of the Pr0903Ser mutation. Moreover, the the

kinetics of this mutant A-R in COS-l cells were comparable

to those seen in GSF. The fact that the unI iganded mutant

receptor was thermostable, whi1e a mutant A-R comp1ex was

unstable shows that the receptor might be in two different

physicai states: liganded or un1iganded. SRs are known to

behave di f ferent 1 y in the pr esence and absence of the i r

ligands (Woos1ey and Muldon 1979).

The Pro903Ser mutation site is at the most C-terminal

position found so far in the HBD of the hAR. Recently,

another mutation at the same codon (903) has been described

by McPhau1 et al., (1992).

in a patient with CArS

androgen-binding activity.

It changes proline ta histidine

and the hAR has unmeasurable

Histidine has a basic side

chain. This replacement seems to be more detrimental to the

receptor since it loses androqen-binding activity. The

praline-serine alteration affects the receptor qualitatively

whereas the proline-histidine change affects it

quantitatively and qualitativeIy.

The Pro903Ser mutation is 15 amine acids away from the

C-terminal end of the recepror. It is important for ligand­

binding. Deletion of 12 amino acids from the C-terminal end

of the hAR abolished hormone-binding [(as mentioned earlier

Jenster at al., (1991)]. It probably affects the three­

dimensional structure of the receptor making it highly

unstable when bound to hormone.

A study on the PR by Baniahmad and Tsai (1993) proved

88

the importance of the C-terminal tail of the receptor. They

were interested in studying the effect of the PR and GR

antagonist RU486 on the conformation of the PR. The PR was

translated in vi tro and bound to hormone or RU486. The

complexes were then subjected to limited proteolytic

digestion. A 30 kD protease resistant band was produced

from the hormone-bound PRs, whereas a 27 kD band was

produced from the RU486-bound PRs (Allan at al., 1992). It

has been shawn that SR-antihormone complexes bind HREs

(Bagchi et al., 1988; Guichon-Mantel et al., 1988) but are

unable to transact i vate reporter genes. Therefore the

antagonist induces a different conformation on the receptor

than the one imposed by the hormone. They

immunoprecipitated the receptors after limited protease

digestions. The antibody used was raised against the last

14 C-terminal amine acids of the receptor. It recognized

the 30 kD band but not the 27 kD band. Hormone additlon to

the full length receptor prevented the recognition of the

complexes by the antibody, whereas the RU486 induced

recognition. Therefore, it was concluded that the

antagonist confers on the receptor such a conformation that

the C-terminus is accessible to the antibody and the

proteases. When 42 amine acids were deleted from the C­

terminus, hormone-binding was abolished, whereas RU486-

binding was possible. From these data, Baniahmad and Tsal

(1993) proposed the following model for SRs. In the absence

of hormone the C-termi na l ta il i nh 1 bi ts i ntr 1 ns lc

transactivation and DNA-binding activities [(also seen ln AR

deletion studies by Jem:;ter et al., (1991»). Hormone-

89

binding induces DNA-binding and transactivation by relieving

the repressian. RU486 allows DNA-binding but blocks

transactivation, because of the conforrnational changes

induced (Fig. 33).

Leucine at position 820 is present in a highly

conserved region among the rnembers of the GR subfamily (Fig.

10, re~ion III). Although leucine and valine belong ta the

same group of nonpolar amino acids, the presence of valine

at position 820 is not tolerated in the hAR. In the highly

conserved regions, a position occupied by leucine in one

member of the GR subfamily can be occupied by valine in

another member. Two examples of this are seen at position

589 in the hGR and the corresponding position (729) in the

hAR, and position 595 in the hGR and 735 in the hAR (Fig.

10) .

The GSFs from 16588 (Leu820Val) had: a normal androgen­

binding activitYi normal apparent ~qui1ibrium dissociation

rates; increased nonequilibrium dissociation ratesi and

increased thermolability. AlI the above mentioned

properties of the Leu820Vai receptor are less severe than

those of the Pro903Ser mutant receptor. This correlates

with the degree of severity of their clinical phenotype.

The Pro903Ser mutation was found in two siblings with CArS,

and the Leu820Vai mutation in a family with PAIS. Saunders

et al., (1992) reported a G-to-T substitution causing a

valine-to-leucine alteration in the HBD of the hAR at

position 865. This mutation was found in two unre1ated

individuals with PAIS. It was also reported by Kazemi­

Esfarjani et al., (1993). This position is found in a

N _t.l..----..,~NA: t c

1-

H.".o •• (Hl !

Fig. 33: Model for interactions of PR with hormone and anti-

hormone. In the unliganded form, the receptor 1s

repressed from DNA-binding and transactivation due

to the C-terminal taïl. The binding of the hormone

to the HBD changes the conformation of the receptor

thus relieving the repression. Anti-hormone binds

the HBD and induces a different structural change.

In this case DNA-binding is allowed but not the

intr ins ic transact i vat ion ipdicated as "TAF". Black

arrows indicate the putative protease cleavage

sites. Open arrows indlcate addltional putative

protease digestion sites in the unliganded receptor.

---~--~-

90

1

region lmportant for dlmerization, and va11ne is believed to

play a key role. Our mutation is a change of leucine to

valine and aiso occurs in a famiIy with PAIS. The authors

(Saunders et al., 1992) linked the change in charge and size

of amino acids to the c1inical phenotype and noted that a

conservative substitution often occurs in PAIS patients,

whereas a change in charge and size occurs in CAlS patients.

The abnormal biochemical phenotype of the Leu820Vai hAR

was reproduced ln transfected COS-1 cells. In this system,

the mutant hAR had: normal androgen-binding activitYi

increased nonequilibrium dissociation rates; and increased

thermolability. The apparent equilibrium dissociation rate

constants were increased in COS-'. cells, whereas in GSF

(16588) they were normal. This finding was not conclusive

s ince Scatchard analyses are based on saturat ion curves.

The level of hAR in normal GSF i5 lower than the one in

transfected COS-l cells, since these are known to

overex~ress proteins in transfections. Because of the

overexpression, the ratio receptor:hormone is lower in COS-l

cells. This can affect the Scatchard plot and the affinity

of the receptor 1s modified. Saturation of hARs with

hormone in GSFs is weIl documented and the normal K. values

are known.

Transactivation assays with Leu820Val showed lower GH

activityat aIl MB-concentrations (Fig. 29). GH activity

levels reached saturation at a slightly higher MB-

concentration than normal, showing a slight abnormality in

transactivation. However, the intrinsic transactivation per

unit A-R complex was near normal (Fig. 31) (3 out of 8

91

experiments) as lt was for aIL the mutants dlscusseJ ln thlS

study. The fact that the GH activity was slightly abnarmal

in 3 out 0 f 8 exper i ments when plot ted aga l nst andr agen­

binding activity, strongly suggests that the intrinsic (pet

unit complex) transactivational activity competence WdS

normal or near norma 1. When i nstab il i ty 0 f camp l e xes was

seen at 48 h in tne binding assays, the CH transactivation

curves (GH versus MB-binding) were abnorma1. Thus,

instability of A-R complexes caused an abnormal

transactivation.

times.

This was triggered by longer incubation

Isoleucine at position 663 in the hAR is not conserved

among the members of the GR subfamily (Fig. 34). Isoleucine

i5 a nonpolar amino

polar one (Fig. 18).

ac id and aspar ag i ne i 5 an uncharged

The Ile663Asn mutant AR did not show

major biochemical abnormalities in COS-l cells. The

nonequilibrium dissociation rates were normal with MB and MT

and they were not significantly high with DHT. The apparent

equilibrium dissociation rate constants were abnormally

h igh. The complexes wer e as thermolab i le as cont r 0 1 and

transactivated CH normally. When the conditions for

indue lng i nstabi 1 i ty were presented, the complexes had a

slightly abnormal transactivatlon (1 experiment). Thus the

only abnormallty seen by Ile663Asn in COS-l cells WdS the K.

values. This alone, was not enough to convince me of its

pat h 0 9 e n ici t Y . As dis eus s e d for Le Ù 8 2 0 Val the K. val u e sin

CSF and COS-1 cells were not the same, probably, because of

the differences between the two cell lines in the nature or

quantity of receptor-associated factors.

92

Fig. 34: Amino acid sequence in the hinge region of hAR,

hGR, hPR, and hMR. hGR and hMR have been aligned

according to Arriza et al., (1987). hAR and hPR

(Misrahi et al., 1987) have been aligned with hMR.

Isoleucine at position 663 in the hAR is represen­

ted in boldo Dots flll gaps for best alignment of

the oinge region, and colons for the putative N­

terminal end of HBDs (Chang et al., 1988). Dashes

represent the HBD. Arrows point to the DBD and the

HBD. Amino acids were shown in sing1e-letter­

format, they were: A (alanine); D (aspartic acid)i

E (glutamic acid); F (phenylalanine); G (glycine);

H (histidine); l (isoleucine); K (lysine); L (leu­

cine); N (asparagine); P (proline); Q (glutamine);

R (arginine); S (serine); T (threonine)i V

(valine); y (tyrosine).

DDD ... 1 hAR.24T L G A R K L K K L G N L K L Q E E G ENS S •

hGR4nN L E A R K T K K K 1 K G 1 Q QAT TGV S Q •

hPR .3:JV L G G R K F K K F N K V R V V R A L 0 A V A L PoP

hHR ••• N L G A R K S K K L G K L K G 1 H E E a p a Q Q Q P P

hAR.47. . . . . . . . . . . . . · . T T S P T E E T

hGR510. . . . . · . E T S E N P G N

hPR •• o. . . . . . . · V G V P N E S Q

hHR.,aP P P P P Q S P E E G T T Y 1 A P A K E P S V N T A L

HBD

1 • hAR.55T Q K L T V S H 1 E G Y E C Q p 1 - - - -

hGR 51.K T 1 V P A T L P a L T P - - - -hPR ••• A L S Q R F T F S P G Q D 1 a L 1 P P - - - -

hHR724V P a L S T 1 S R A L T P S - - - -

93

Parts of exon 1 of 605 were sequenced to rule out

additiona1 mutatlons in this region. No mutations were

found and the length of the homopolymeric tracts was in the

normal range.

The po1yg1utamine tract in exon 1 from 1609 was

sequenced to rule out mutations in this region.

Exon 1 from 16588 was not sequenced due to technical

difficulties. Since the pathogenlcity of the two mutations

Leu820Val and Pr0903Ser was proven, 1 did not fee1 the

necess i ty to pursue the sequenc ing of exon 1 in these two

families.

The western blot in figure 32 shows that 605 has as

much hAR as the other two mutants (16588 and 6003) in GSFs.

Therefore, the deficiency in hormone-binding seen in the GSF

was probably due to the quality of the cells during the

assay and not due to the mutation.

Towards the end of this study, a mod i f ied

transactivation assay was developed in the laboratory hoping

to show small differences between control and mutant hARs.

The assay was modified to reduce the number of mutant or

control hAR formed in the transiently transfected COS-l

ce 115, on the assumpt ion that an excess number of mutant

Ile663Asn might conceal an intrinsic transactivational

defect. In these assays, the Ile663Asn mutant A-R complexes

showed normal transactivation (using the same reporter

construct) . These findings proved my results in the

original assays.

One way ta test the transact i vat i anal capac i ty of

l le66 3Asn hAR is to use RNA probes on na tur a Il y OCCU! ing

94

genes that are induced by androgen in GSF. Unfortunately,

these probes do not yet exist.

The three mutations have been reproctucp.d in a

baculovirus expression plasmid. This system offers high

expression of proteins in eukaryotic cells and allows

further characterization of the hAR. For example,

crystallography of the hAR can be achieved which will help

in identifying the amine acids involved in: hormone-binding;

hsp-90-binding; dimerization, and many other important

functions. By studying naturally occuring mutations in the

hAR from AIS individuals, we can have a detailed structure­

function map of the of the hAR.

95

V CONCLUSION

The objectives of this study were to prove the

pathogenicity of the three mutations, to correlate phenotype

with genotype, and to delimit the N-terminal end of the HBD

l n h AR • The r e i s s t r 0 n 9 e v ide n cet 0 b e li e ve th a t a t le as t

two of the mutations are pathogenic (Pro903Ser and

Leu820Val). We based our observation on: 1) the fact that

both mutations occur in conserved regions among the members

of the GR subfamilYi and 2) the mutation cosegregates wi th

the AIS in both familles. There is also a correlation

between the more severe biochemical data of the hAR with the

severe cl inical phenotype of the Pro903Ser mutation in the

two CAlS siblings. The Leu820Val mutation present in a

family with a less severe clinical phenotype (PAIS) had an

hAR tha t bound hormone and t ransact i vated in a less severe ly

defective manner than the Pro903Ser hAR. The patient 605

wi th the Ile663Asn mutation was the only affected member of

the fami ly and we have no information about the mother' s

carr 1er state. The codon affected 1s not conserved among

the membp.rs of the GR subfamily. However, assuming that aIl

the cod i ng sequences of the hAR were sequenced, th is

mutation has not been found in any other individual tested,

whether control or patient. Over a hundred mutations in the

hAR associated with AIS have been discovered to date (Sultan

et al., 1993)]. Polyg1utamine and polyglyc ine tracts in

exon 1 were sequenced from 605 ta exclude any mutat ions in

those regions. The nun,ber of glutamines and glycines fell

in the normal range.

l was not successful in delimitting the N-terminal end

96

of the HBD since the pathogenicity of Ile663Asn was not

proven. There is a possibility that this mutation is a

subtle one and the tools that were used were not adequate to

show its abnormality. More specifie AREs, combined with a

different host for transfection would probably be helpful in

showing the abnorrnality of this mutation and prove its

pathogenic i ty.

97

VI REFERENCES

Adler, A.J., Scheller, A., Hoffman, Y. and RObins, D.M. (1991). Multiple components of a complex androgen-dependent enhancer. Mol. Endo. 5,1587-1596.

Adler, A.J., Scheller, A. and Robins, D.M. (1993). The str i ngency and magn i tude of androgen-spec i fic gene activation are combinatorial functions of receptor and nonreceptoI binding site sequences. Hol. Cell. Biol. 13,6326-6335.

Alberts, B., Bray, D., Lewis, J., Raff, M., Rober .... s, K. and Watson, J.O. (1983). Small molecules, eneL'JY, and biosynthesis. In: Holecular biologyof t:he cell. pp. 58-59. Gar land Pub 1 ish i ng l nc. New York and London.

Allan, G.F., Tsai, S.Y., Tsai, M.-J. and O'Malley, B.W. (1992). Ligand-dependent conformational changes in the progesterone receptor are necessary for events that follow DNA binding. PNAS 89,11750-11754.

Amero, S.A., Kretsinger, R.H., Moncrief, N.D., Yamamoto, K.R. and Pearson, W.R. (1992). The origin of nuclear Ieceptor prote i ns: a single precur SOI dis t inct from other transcription factors. Hol. Endo. 6,3-7.

Arriza, J.L., Weinberger, C., Cerelli, G., Glaser, T.M., Handelin, B.L., Housman, D.E. and Evans, R.H. (1987). Cloning of human mineralocort icoid receptoI complementary DNA: structural and functional kinship with the glucocorticoid receptor. Science 237,268-275.

Bagchi, M.K., Elliston, J.F., Tsai, S.Y., Edwards, D.P., Tsai, M.-J. and O'Mal1ey, B.W. (1988). Steroid hormone dependen tinter action 0 f human pr ogester one receptor wi th its target enhancer e1ement. Hol. Endo. 2,1221-1229.

Baniahmad, A. and Tsai, M.J. (1993). Mechanisms of transcriptional activation by steroid hormone receptors. J. Cel1- Biochem. 51,151-156.

Beato, M. (1991). Transcriptiona1 control by nuclear receptors. FASEB J. 5,2044-2951.

Behr, H. and Loos, U. (1992). Thr) in the hinge region hormone receptor gene in thyroid hormone resistance.

A point mutation (J...la 229 to of the c-erbA beta thyroid

a farnily wi th general i zed Hol. Endo. 6,1119-1126.

Brink, M., Humble, B.M., De K1oet, E.R. and van Driel, R. (1992) . The unl iganded glucocort ico id receptor i5 localized in the nucleus, not in the cytoplasm. Endocrinology. 130,3575-3581.

98

Br i n k ma n n , A . 0 ., Fa ber, P. W ., van R 0 0 i j, H. C . J ., K u i p e r , G.G.J.H., Ris, C., Klaassen, P., van der Korput, J.A.G.H., van Laar, J.H., Mulder, E. and Trapman, J. ( 1989) . The human androgen reee pt or : doma in, s tr uc t ur e, genomic organisation and regulation of expression. J. Steroid Biochem. 34,307-310.

Br i n k ma n n , A • 0 ., Je n 5 ter, G., Ku l p e r, G. G • J . M ., Ris, C., van Laar, J.H., van der Korput, J.A.G.M., Degenhart, H.J., Trifiro, H.A., Pinsky, L., Romalo, G., Schweikert, H.U., Veldseholte, J., Mu1der, E. and Trapman, J. (1992). The human androge n reeeptor: st ruct ur e- funet ion r e lati onsh i p in normal and pathological situations. J. Steroid Biochem. Mol. Biol. 41,361-368.

Br 0 wn, C. J ., Go S s, S. J ., Lu bah n,O. B ., J 0 sep h, D. R ., W ils 0 n , E.M., French, F.S. and Wi1lard, H.F. (1989). Androgen reeeptor locus nn the human X chromosome: regional loealization to Xql1-12 and description of a DNA polymorphisme Am. J. Hum. Genet. 44,264-269.

Carson-Jur:ica, M.A., Schrader, W.T. and O'Malley, B.W. ( 1990). Ster 0 id receptor f amily: str ueture and funct ion. Endo. Rev. 11,201-220.

Chang, C., Kokontis, J. and Liao, S. (1988). structural ana1ys i s of complementary ONA and ami no ae id sequences 0 f hurnan and rat androgen receptors. PNAS. 85,7211-7215.

Chauchereau, A., Loosfelt, H. and Hi 19rom, E. (1991). Phosphory1at ion of transfected wild type and mutated progesterone receptor. J. Biol. Chem. 266,18280-18286.

Denis, M. and Gustafsson, J.A. (1989). The Mr = 90000 heat shock protein: an important modulator of ligand and DNA­binding properties of the glucocorticoid reeeptor. Cancer Res. (SuppL): 49,22755-22815.

Diamond, M.L, Miner, J.N., Yoshinaga, S.K. and Yamamoto, K.R. (1990). Transcription factor interactions: selectors of positive or negatie regulatlon from a single DHA element. Science 249,1266-1272.

Evans, R.M. (1988). The steroid and thyroid hormone reeeptor superfarnily. Science 240,889-895.

Fa ber 1 P. W ., van R 0 0 i j, H. C • J ., Sc h i pp e r, H. J ., 8 r i n k ma n n , A.O. a.nd Trapman, J. (1993). Two different, overlapping pathways of transcription initiation are active on the TATA-less hUffian androgen r:eceptor promoter:. The role of Spl. J. Biol.Chem. 268,9296-9301.

Fawell, S.E., Lees, J.A., White, R. and Parker, M.G. (1990). Characterization and coloea1ization of steroid binding and dimerization actlvities in the rnouse estrogen

99

receptor. Cell 60,953-962.

French, F.S, Lubahn, D.B., Brown, T.R., Simenta1, J.A., Quigley, C.A., Yarborough, W.G., Tan, J.A., Sar, M., Joseph, D.R., Evans, B.A., et al. (1990). Molecular basis of androgen insensitivity. Rec. Prog. Horm. Res. 46,1-38.

Giguère, V., Hol1enberg, S.M., Rosenfe1d, M.G., and Evans, R.M. (1986). Functional domains of the human glucocorticoid receptor. Cell 46,645-652.

Gortler, L., and Sturchio, J.L. (1992). Introduction to the International Symposium on the History of Steroid Chemistry, New York, August 27 and 28, 1991. Steroids 57,355-356.

Gottlieb, B., Kaufman, M., Pinsky, L., Leboeuf, G. and Sotos, J.F. (1987). Extracellu1ar correction of the androgen-receptor transformation defect in two families with complete androgen resistance. J. Steroid Biochem. 28,279-284.

Green, S. and Chambon, P. (1987). Oestradiol induction of agI ucocort ico id - respons ive gene by a chimaer ic receptor. Nature 325,75-78.

Greenberg, D., Hamerton, J., Nig1i, M. and Wrogemann, K. (1987). DNA studies in a fami1y with Duchenne muscu1ar dystrophy and a deletion at Xp21. Am. J. Hum. Genet. 41,128-137.

GuiochQn-Mantel, A., Loosfelt, H., Ragot, T., Bailly, A., Atger, M., Misrahi, M., Perricaudet, M. and Milgrom, E. (1988). Receptors bound to antiprogestin form abortive complexes with hormone responsive elements. Nature 336,695-698.

Hard, T., Kellenbach, E., Roelens, R., Ma1p~, B.A., Dahlman, K., Freedman, L.P., Carlstedt-Duck, J., Yamamoto, K.R., Gustaffson, J.A. and Kaptein, R. (1990). Solution structure of the glucocorticoid receptor DNA-binding domaine Science 249,157-159.

Higuchi, R. (1990). Recombinant PCR in: Innis, M.A., Gelfand, D.H., Sninsky, J.J, White, T.J. PCR protoco1s: a guide to methods and applications. Academie press, San Diego, 177-183.

Hoeck, W. and Gr oner, B. ( 1990) . Hormon~-dependent

phosphorylation of the glucocorticoid receptor occurs mainly in the amino -terminal transactivation domaine J. Biol. Chem. 265,5403-5408.

Ho11enberg, S.M., Giguère, V., Segui, P. and Evans, R.M.

100

(1987). Colocallzation of DNA-binding and tr anser i pt i onal act i vat i on funct i on5 in the human g1ucocorticoid receptor. Cell 49,39-46.

Hollenberg, S.M., Giguère, V. and Evans, R.M. (1989). Identification of two regions of the human glucocorticoid :r ecepto:r hormone b i nd i ng domai n that block act i vat ion. Cancer Res. (Suppl): 49,22925-22945.

Hughes, I.A. and Pinsky, L. (1989). Sexual Differentlation. In: Pediatrie Endoeclnology. (eds. R. Co1lu, J.R. Ducharme, and H.J. Guyda). pp. 251-293. Raven press, N.Y.

Jan ne, O. A., Pal v i mo, J. J . , Ka lli 0 , P . and Me h t 0, M. (1 9 9 3 ) . Androgen receptor and mechanism of androgen actIon. Ann. Med. 25,83-89.

Jenster, G., van der Korput, H.A.G.H., van Vroonhoven, Cor, van der Kwast, T.H., Trapman, J. and Brinkmann, A.O. (1991). Domains of the human and:rogen receptor involved in steroid binding, transcriptional activat1on, and subce11ular 1ocalization. Hol. Endo. 5,1396-1404.

Kalderon, D., Richardson, W.D., Markham, A.F. and Smith, A.E. (1984). Sequence requirements for nuclear location of simian virus 40 large-T antigen. Nature 311,33-38.

Kasumi, H., Komori, S., Yamasaki, N., 1 s 0 ji ma , S. (l 9 9 3 ) • Sin 9 1 e nu c 1 e 0 t ide the androgen recepto:r gene in a case positive androgen insensitivity syndrome Acta Endo. 128,355-360.

Shima, H. and substitution of wi th r eceptor­

(complete form).

Kaufman, M., Pinsky, L., Bowin, A. and Au, M.W.S. (1984). Familial externa1 genital ambiguity due to a transformation defect of androgen receptor complexes that is expressed with 5a1pha-dihyd:rotestosterone and the synthetic androgen methy1trieno1one. Am. J. Med. Genet. 18,493-507.

Kaufman, M. and Pinsky, L. (1983). The dissociation of testosterone- and 5a-dihydrotestosterone-receptor complexes formed wi thin cul tur ed human geni tal sk in fibrob1asts. J. Stecoid Bioehem. 18,121-125.

Kaufman, M. and Pinsky, L. (1989). A single-site allosteric model of intracellu1ar androgen-receptor interaction. J. Steroid Biochem. 32,113-119. -

Kazemi-Esfarjani, P., Beitel, L.K., Trifiro, M., Kaufman, M., Pinsky, L., Rennie, P., Sheppard, P. and Matusik, R. (1993). Substitution of valine 865 by methlonlne or leucine in the human androgen receptor causes complete or partial androgen insensitlvlty, respectively wlth distinct androgen receptor phenotypes. Mol. Endo. 7,37-

101

46.

Kovacs, W.J, Griffin, J.E. and Wilson, J.O. (1986). Androgen Resistance in Man. In: Steroid Hormone Resistance: Hechanism and Clinica1 Aspects. Adv. Exp. Med. Biol. v.196, leds. G.P. Chrousos, D.L. Loriaux, and M.B. LipsE'tt). p. 258. Plenum press, New York and London.

Krozowski, Z.S., Rund1e, S.E., Wallace, C., CasteIl, M.J., Shen, J.H., Funder, J.W. and Smith, A.!. (1989). Immunolocalization of renal mineralocorticoid receptors wi th an ant i serum aga i nst a pept ide deduced from the complementary deoxyribonucleic acid sequence. Endocrinology. 125,192-198.

Landridge, J., Lanùridge, Extraction of nucleic 8iochem. 103,264-271.

P. and Berguist, P.L. (1979). acids from agarose gels. Anal.

La Spada, A., wilson, E., Lubahn, D., Harding, A. and F ischbeck, K. (1991). Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature 352,77-79.

Laudet, V., Hanni, C., Coll, J., Catzaflis, F. and Stehelin, D. (1992). E:volution of the nuclear receptor gene superfamily. EMBO. J. Il,1003-1013.

Lobaccaro, J.M., Lumbroso, S., Belon, C., Galtier-Dereure, F., Bringer, J., Lesimp1e, T., Heron, J.F., Pujol, H. and Sultan, C. (1993). Male breast cancer and the androgen receptor gene. Nature 5,109-110.

Lowry, O.H., Rosebrough, N., Farr, A., Randall, R. (1951). prote in determination with the fol in phenol reagent. J. 8i~J. Chem. 193,265-275.

Luisi, B.F., Xu, W.X., Otwinowski, Z., Freedman, L.P., Yamamoto, K.R. and Sigler, P.S. (1991). Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature 352,497-505.

MacLean, H.E., Chu, S., Warne, G.L. and Zajac, J.O. (1993). Related 1 nd i v idua 15 wi th di f ferent androgen receptor gene deletions. J. Clin. Invest. 91,1123-1128.

McPhaul, M.J., Marcelli, M., Tilley, W.D., Griffin, J.E., Isidro-Gutierrez, R.F. and Wilson, J.O. (1991). Molecular basis of androgen resistance in a family with a qualitative abnormality of the androgen receptor and responsive to high-dose androgen therapy. J. Clin. Invest. 87,1413-1421.

McPhaul, M.J., Marcelli, M., Zoppi, S. Wilson, C.M., Griffin, J.E. and Wilson, J.O. (1992). Mutations in the

l1gand-bind ing cluster in two 90,2097-2101.

doma in of the andr ogen regions of the gene. J.

102

receptor gene Clin. Invest.

McPhaul, M.J., Marcelli, M., Zoppi, S., Griffin, J.E. and Wilson, J.O. (1993). Genetie basis of endocrine disease 4 the spectrum of mutations in the androgen receptor gene that causes androgen resistance. J. Clin. Endo. Hetabol. 76,17-23.

Misrahi, M., atger, M., d'Auriol, L., Loosfelt, H., Meriel, C., Frid1ansky, F., Guiochon-Mantel, A., Galibert, F. and Mi1<Jrom, E. (1987). Complete amine acid sequence of the human progesterone receptor deduced from cloned cDNA. Biochem. Biophys. Res. Commun. 143,740-748.

Mitchell, P.J. and THan, R. (1989). Transcriptional regulation in mammalian cells by sequence-speci fic DNA binding proteins. Science 245,371-378.

Notides, A.C. and Nielsen, S. (1974). The molecular mechanism of the in vitro 4S to 6S transformÇltion of the uterine estrogen receptor. J. Biol. Chem. 249,1866-1973.

Palvimo, J.J., Kallio, P.J., Ikonen, T., Mehto, M. and Janne, D.A. (1993). Dominant negative regulation of trans -acti vation by the rat androgen receptor: role of the N-terminal domain and heterodimer formation. Hol. End 0 • 7, 13 9 9 -1 407 .

Pearce, D. and Yamamoto, K.R. (1993). Mineralocorticoid and glucocorticoid receptor activities distinguished by nonreceptor factors at a compos i te response element. Science 259,1161-1165.

Picard, D. and Yamamoto, K.R. (1987). Two signa1s mediate hormone-dependent nuclear local izat ion of the glucocorticoid receptor. EMBO J. 6,3333-3340.

Pinsky, L" Kaufman, M. and Chudley, A.E. (1985). Reduced affinity of the androgen receptor for 5<1-dlhydrotestosterone but not methy1tr ienolone ln a form of partial androgen resistance. J. Clin. Invest. 75,1291-1296.

Pinsky, L., Triflro, M., Kaufman, M., Beitel, A., Kazemi-Esfarjani, P., Sabbaghian, N., Alvarado, C., Vasiliou, M., Gottlieb, Androgen resistance due ta mutation of receptor, Clin. Invest. Med. 15,456-472.

L.K., Mhatre, Lurnbcoso, R.,

B., (1992). the androgen

Pratt, w.e" Jolly, D.J., Pratt, D.V., Hollenbecg, S.M., Giguere, V., Cadepond, F.M., Schweizer-Groyer, G., Catelli, M.G., Evans, R.M. and Baulieu, €.E. (1988). A region in the steroid binding domain determines formation

103

of the non DNA-binding 9S glucocorticoid receptor complexa J. B101. Chem. 263,267-273.

Pratt, W.B., Scherrer, L.C., Hutchison, K.A. and Dalman, F.C. (1992). A mode1 of glucocorticoid receptor unfolding and stabillzation by a heat shock protein complexa J. Steroid Biochem. Hol. Biol. 41,223-229.

Prior, L., Bordet, S., Trifiro, M.A., Mhatre, A., Kaufman, M., Pinsky, L., Wrogemann, K., Be1sham, 0.0, Pereira, F., Greenberg, C., Trapman, J., 8rinkmann, A.O., Chang, C. and Liao, S. (1992). Replacement of arginine 773 by cysteine or histidine in the human androgen receptar causes comp lete androgen i nsens i t i vi ty wi th di Uer ent receptor phenotypes. Am. J. Hum. Genet. 51,143-155.

Ptashne, M. and Gann, A.A.lo'. (1990). targets. Nature 346,329-331.

Activators and

Rao, K. V . S. and Fox, C. F . (1 9 8 7 ). Epi der ma l gr a wt h fa c t 0 r stimulates tyrosine phosphorylation of human glucocorticoid receptor in cultured cells. Biochem. Biophys. Res. Commun. 144,512-519.

Rennie, P.S., Bruchovsky, N., Leco, K.J., Sheppard, P.C., McQueen, S.A., Cheng, H., Snock, R., Hamel, A., Bock, M.E., MacDonald, 8.S., Nickel, B.E., Chang, C., Lia, S., Cattini, P.A. and Hatusik, R.J. (1993). Characterization of twa cis-acting DNA elements involved in the androgen regulation of the prabasin gene. Hol. Endo. 7,23-36.

Rhodes, D. and Klug, A. (1993). Zinc Fingers they play a key part in regulating the activity of genes in many spec i es, fr om yeast ta humans. Fewer than 10 years ago na 0 n e k n e w the y ex i ste d • Sc. Am. 5 6 - 6 5 •

Roche, P.J., Hoare, S.A. and Parker, consensus DNA-b i nd i ng 5 i te for the Hal. Endo. 6,2229-2235.

M.G. (1992). A androgen receptor.

Sambrook, J., Fritsch, E.F., Maniatis, T. (1989a). In: Holeculac Cl oning: a Laboratory Manual. 2nd edi tion (ed. C. No1en) pp. 1.25-1.28, Cold Spring Harbor 1aboratory press. Cold Spr i ng Harbor, USA.

Sambrook, J., Fritsch, E.F., Haniatis, T. (1989b) Ibid. p. 1. 68.

Sambrook, J., Fritsch, E.F., Maniatis, T. (1989c). Ibid. p. 1.82.

Sambraok, J., Fritsch, E.F., Maniatis, T. (1989d). Ibid. p. 16.66.

Sambrook, J., Fritsch, E.F., Maniatis, T. (198ge). Ibid.

104

pp.18.47-18.54.

Sambrook, J., Fritsch, E.F., Maniatis, T. (1989f). rbid. pp.18.60-18.66.

Saunders, P.T.K., Padayachi, T., Tincello, D.g., Shalet, S.H. and Wu, C.W. (1992). Point mutations detected in the androgen receptor gene of thrce men w1th partial androgen insensitivity syndrome. Clin. Endo. 37,214-220.

Sinclair, A., Berta, P., Palmer, M., Hawl<ins, J., Grlffiths, B., Smith, M., Foster, J., Frischauf, A., Lovell-Badge, R. and Goodfello\'1, P. (1990). A gene from the human sex­determi n ing reg ion encodes a prote i n w i th homo logy to a conserved DNA-binding motif. Nature 346,240-244.

Strah1e, U., Klock, G. and SChutz, G. (1987). A sequence of 15 base pairs 1s sufflcient to mediate glucocorticoid and progesterone lnductlon of expression. Biochem. 84,7871-7875.

DNA both gene

strahle, U., Schmid, W. and Schutz, G. (1988). Synerg1stic act ion 0 f the g lucocort i co id receptor w i th tr anscr 1 pt ion factors. EMBO. J. 7,3389-3395.

Stryer, L. (198 8a). Biosynthes 1s of membrane 1 i pids and steroid hormones. In: Biochemistry 3nd ed1t1on pp. 464-477. W.H. Freeman and company, San Fransisco.

stryer, L. (1988b). Introduction to protein structure and function. ibid pp32-27.

Tan, JI., Marschke, K.B., Ho, K.C., Perry, S.T. (1992). Response elements of the androgen-regulated C3 gene. J. Biol. Chem. 267,4456-4466.

Tilley, W., Marcelli, M., Wilson, J. and McPhaul, M. (1989). Characterization and expression of a cDNA encoding the human androgen receptor. PNAS 86,327-331.

T r a pma n, J., KI a a s sen, P., Ku i p e r, G. G . J . M ., van der K 0 r put, J.A.G.M., Faber, P.W., van Ro01j, H.C.J, van Kessel, A., Voorhorst, M., Mulder, E. and Brinkmann, A.O. (1988). Cloning, structur e and expr ess i on 0 f a cDNA encod i ng the human androgen receptor. Biochem. Biophys. Res. Commun. 153,241.

Trifiro, M., Kaufman, M., Bordet, S., Beitel, L., Kazemi­Esfarjani, P., Mhatre, A., Sabbaghian, N., Lumbloso, R., Alvarado, C., Gottlieb, B. and Pinsky, L. (1991). Androgen receptor mutat ions that cause male sexual maldevelopment in man. Am. J. Hum. Genet. 49 (Suppl. 4): Abst. N°267, p53.

Tsai, S.Y., Carlstedt-Duke, J., Weigl, N.L., Dahlman, K.,

105

Gustafsson, J.A., TSdl, M.-J. and O'Ma1ley, B.W. (1988). Mo1ecular interactions of steroid hormone receptor with i ts enhancer element: ev idence for receptor d imer formation. Cell 55,361-369.

Wahli, W. and Martinez (1991). Superfamily of steroid nuc1ear receptorsi positive and negative regulators of gene expreSSlon. FASEB J. 5,2243-2249.

Wilson, J.O., Griffin, J.E., George, F.W. and Leshin, M. (1981). The role of gonadal steroids in sexual differentiation. Rec. prug. Horm. Res. 37,1-33.

Woosley, J.t. and Muldon, T.G. (1979). The thermolability of rat uterine cytoso1 estrogen receptors: basis for a novel cytosol exchange-denaturation assay. J. Steroid Biochem. 11,1065-1071.

Zegers, N.D., Claassen, E., Nee1en, C., Mu1der, E., van Laar, J.H., Voorhorst, M.M., Berrevoets, C.A., Brinkmann, A.O., van der Kwast, T.H., Ruizeveld de Winter, J .A. et al. (1991). Epitope prediction and confirmat:on for the human androgen receptor: generation of monoclonal antibodies for multi-assay performance following the s ynthet i c pept ide st rategy. Bi och im. Bi oph. Acta 1073, 23-32.

Zoppi, S., Wilson, C.M., Harbison, M.D., Griffin, J.E., Wilson, J.O., McPhaul, M.j. and Marcelli, M. (1993). Complete testicular feminization caused by an amino­terminal truncation of the androgen receptor with downstream initiation. J. Clin. Invest. 91,1105-1112.