RNA Interference Silencing of Chalcone Synthase, the First ... · Chs Gene Expression Analysis...

RNA Interference Silencing of Chalcone Synthase,the First Step in the Flavonoid Biosynthesis Pathway,Leads to Parthenocarpic Tomato Fruits[C]

Elio G.W.M. Schijlen*, C.H. Ric de Vos, Stefan Martens, Harry H. Jonker, Faye M. Rosin,Jos W. Molthoff, Yury M. Tikunov, Gerco C. Angenent, Arjen J. van Tunen, and Arnaud G. Bovy

Plant Research International, Business Unit Bioscience, 6700 AA Wageningen, The Netherlands(E.G.W.M.S., C.H.R.d.V., H.H.J., F.M.R., J.W.M., Y.M.T., G.C.A., A.G.B.); Philipps Universitat Marburg,Institut fur Pharmazeutische Biologie, D–35037 Marburg/Lahn, Germany (S.M.); and Keygene N.V.,6700 AE Wageningen, The Netherlands (A.J.v.T.)

Parthenocarpy, the formation of seedless fruits in the absence of functional fertilization, is a desirable trait for several importantcrop plants, including tomato (Solanum lycopersicum). Seedless fruits can be of great value for consumers, the processingindustry, and breeding companies. In this article, we propose a novel strategy to obtain parthenocarpic tomatoes by down-regulation of the flavonoid biosynthesis pathway using RNA interference (RNAi)-mediated suppression of chalcone synthase(CHS), the first gene in the flavonoid pathway. In CHS RNAi plants, total flavonoid levels, transcript levels of both Chs1 andChs2, as well as CHS enzyme activity were reduced by up to a few percent of the corresponding wild-type values. Surprisingly,all strong Chs-silenced tomato lines developed parthenocarpic fruits. Although a relation between flavonoids and partheno-carpic fruit development has never been described, it is well known that flavonoids are essential for pollen development andpollen tube growth and, hence, play an essential role in plant reproduction. The observed parthenocarpic fruit developmentappeared to be pollination dependent, and Chs RNAi fruits displayed impaired pollen tube growth. Our results lead to novelinsight in the mechanisms underlying parthenocarpic fruit development. The potential of this technology for applications inplant breeding and biotechnology will be discussed.

Flavonoids are plant secondary metabolites that arewidespread throughout the plant kingdom. To date,more than 6,000 flavonoids have been identified. Basedon the structure of their basic skeleton, flavonoids canbe divided into different classes, such as chalcones,flavonols, and anthocyanins (Fig. 1). In nature, flavo-noids are involved in many biological processes. Forexample, they act as UV light scavengers to protectagainst oxidative damage, as antimicrobial compoundsto defend against pathogens, and as pigments in fruits,flowers, and seeds, where they have a function inattracting pollinators and seed dispersers to facilitatereproduction (Koes et al., 1994). Flavonoids are alsopresent in pollen and pistils of many plant species(Wiermann, 1979), and there is increasing evidenceshowing that flavonoids, at least in some plants, play acrucial role in fertility and sexual reproduction. Forexample, inhibition of flavonoid production in Petuniaplants, through antisense suppression of the gene

encoding chalcone synthase (CHS), the first enzymein the flavonoid pathway (Fig. 1), resulted not only inthe inhibition of flower pigmentation but also in malesterility (Van der Meer et al., 1992). Pollination exper-iments revealed that flavonoids in either the anther orpistil are essential for pollen tube growth, fertilization,and subsequent seed set (Ylstra et al., 1992). After crosspollination, the sterile phenotype could be partlyrescued by flavonoids present in the wild-type plant.In addition, in vitro experiments showed that flavo-nols, in particular, kaempferol and quercetin, are es-sential for pollen tube germination and growth inPetunia and maize (Zea mays; Mo et al., 1992; Ylstraet al., 1992, 1996). Further evidence for a role of fla-vonoids in sexual reproduction is provided by themale sterile Petunia white anther (wha) mutant, whichcould be complemented by the introduction of afunctional CHS cDNA (Napoli et al., 1999).

In addition to (male) sterility, parthenocarpy, whichis defined as the formation of seedless fruits in theabsence of functional fertilization (Gustafson, 1942;Gorguet et al., 2005), is a desirable trait for several im-portant crop plants. The production of seedless fruitscan be of great value for consumers when directlyeaten but also for the processing industry. Besides this,parthenocarpy is advantageous when pollination orfertilization is affected due to extreme temperatures.Unfortunately, mutations causing parthenocarpic fruitsas well as plant hormone-based approaches to obtain

* Corresponding author; e-mail [email protected]; fax 31–317–41–80–94.

The author responsible for distribution of materials integral to thefindings presented in this article in accordance with the policydescribed in the Instructions for Authors (www.plantphysiol.org) is:Elio G.W.M. Schijlen ([email protected]).

[C] Some figures in this article are displayed in color online but inblack and white in the print edition.

www.plantphysiol.org/cgi/doi/10.1104/pp.107.100305

1520 Plant Physiology, July 2007, Vol. 144, pp. 1520–1530, www.plantphysiol.org � 2007 American Society of Plant Biologists www.plantphysiol.orgon May 29, 2020 - Published by Downloaded from

Copyright © 2007 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

parthenocarpy often have pleiotropic effects and canresult in undesirable characteristics, such as mis-shapen fruits (Varoquaux et al., 2000; Fos et al., 2001;Wang et al., 2005).

To obtain more insight into the role of flavonoids inreproduction and fruit development, we have blockedflavonoid biosynthesis in tomato (Solanum lycopersi-cum) by RNA interference (RNAi) suppression of thegene encoding CHS. The resulting transgenic fruitsshowed a strong decrease of total flavonoid levels anddisplayed an altered color. Surprisingly, these fruitswere devoid of seeds.

In this article, we show that engineering of theflavonoid pathway may be a novel approach to obtainparthenocarpic tomato fruits. In addition, we presentevidence for a possible mechanism and discuss po-tential applications of this technology.

RESULTS

RNAi Strategy Down-Regulates Chs Gene Expressionin Tomato

To down-regulate the flavonoid biosynthesis in to-mato, we introduced a Chs1 RNAi gene construct (Fig.2) using Agrobacterium-mediated plant transformation.

Figure 1. Schematic overview of theflavonoid biosynthesis pathway inplants. The pathway normally active intomato fruit peel, leading to flavonolproduction, is indicated by solid arrows.Abbreviations: STS, stilbene synthase;CHI, chalcone isomerase; F3H, flava-none hydroxylase; FNS, flavone syn-thase; IFS, isoflavone synthase; FLS,flavonol synthase; F3#H, flavonoid-3#-hydroxylase; F3#5#H, flavonoid-3#,5#-hydroxylase; DFR, dihydroflavonol-4-reductase; ANS, anthocyanidin syn-thase.

Figure 2. Schematic drawing of the tomato Chs RNAi construct. Trans-gene expression was under control of the CaMV double 35S promoter(Pd35S) and terminated by Tnos. An inverted repeat was generated bycloning a sense Chs1 cDNA fragment (801 bp) followed by the full-lengthcDNA sequence encoding tomato Chs1 in anti-sense orientation.

Inhibition of Flavonoids Leads to Parthenocarpic Tomatoes

Plant Physiol. Vol. 144, 2007 1521 www.plantphysiol.orgon May 29, 2020 - Published by Downloaded from



This Chs RNAi construct was expressed under controlof the constitutively enhanced cauliflower mosaic vi-rus (CaMV) 35S promoter, and, therefore, it was ex-pected that the transgene effect would not be restrictedto the tomato fruit only but would also influence theflavonoid pathway in other parts of the tomato plant.

Biochemical Analysis of Flavonoid Levels

In total, 15 PCR-positive transgenic Chs RNAi T0plants were used for a first biochemical analysis. Basedon HPLC analyses of leaf as well as fruit peel extracts,transgenic plants showing various degrees of reducedtotal flavonoid levels could be identified (Fig. 3A).

From these primary transformants, four single-copytransgenic lines (24, 34, 39, and 44) with strongly de-creased flavonoid levels were selected for further anal-ysis. Of each plant, three cuttings were propagated,and from each individual cutting a sample was col-lected encompassing at least three ripe fruits. Thesesamples from transgenic and wild-type tomato plantswere analyzed for flavonoid content using HPLC. Themain flavonoids accumulating in wild-type tomatofruits are naringenin (NAR)-chalcone and the flavonolrutin (quercetin-3-rutinoside). In fruits, these flavo-noids are predominantly produced in the peel becausethe flavonoid pathway is inactive in flesh tissue (Muiret al., 2001; Bovy et al., 2002). In peel extracts of Chs

Figure 3. Comparison of flavonoid levels betweenwild-type and Chs RNAi tomato. A, Total flavonoidlevels in leaf extracts of different CHS RNAi trans-genic lines. B, HPLC chromatograms obtained fromnonhydrolyzed fruit peel extracts of wild-type (top)and Chs RNAi plants (bottom). In the control plant,the major compounds found are NAR-chalcone (NC)and the flavonol rutin. C, Percentage of flavonoids inthe fruit peel of Chs RNAi plants (lines 34, 39, 44, and24) relative to the fruit peel of control tomatoes. Meancontrol values (milligram per kilogram fresh weight):NAR-chalcone, 212.5, SD 66.5; quercetin derivatives(rutin 1 rutin apioside), 80.7, SD 11.0. [See onlinearticle for color version of this figure.]

Schijlen et al.

1522 Plant Physiol. Vol. 144, 2007 www.plantphysiol.orgon May 29, 2020 - Published by Downloaded from



RNAi fruits, a large decrease was observed in the lev-els of both rutin and NAR-chalcone when comparedwith extracts from control plants (Fig. 3, B and C).According to the percentage of NAR-chalcone andquercetin derivatives relative to control plants, lines24, 39, and 44 were regarded as lines with a ‘‘strong’’phenotype (,5% of total flavonoids left), and line 34 asa ‘‘weak’’ phenotype (approximately 30% left).

Chs Gene Expression Analysis

Tomato contains two established Chs genes, Chs1and 2, although both southern hybridization signals(O’Neill et al., 1990; Yoder et al., 1994) and EST data-base searches suggest the presence of at least oneadditional, more divergent Chs gene family member.Gene-specific oligonucleotides were designed to dis-criminate between both Chs1 and Chs2 mRNA (Table I).The samples used for biochemical analysis were alsoused to measure the expression of the endogenousChs1 and Chs2 genes by real-time quantitative reversetranscription (RT)-PCR. The constitutively expressedtomato gene encoding ribosomal protein L33 was usedas internal standard. Expression of this gene wasfound to be constitutive in DNA microarray experi-ments with Chs RNAi and wild-type fruit peel, as wellas during different stages of fruit ripening (data notshown). Compared to wild type, the strong Chs RNAilines showed a large decrease in expression levels ofboth Chs1 and Chs2 (Fig. 4). In contrast, a relativelysmall decrease in Chs expression was found in fruits ofline 34, the weak phenotype. For all lines, the observeddecreases in gene expression levels correlated wellwith the biochemical data.

A similar decrease was found in CHS enzymeactivity (Fig. 5). The strong Chs RNAi lines appearedto have the lowest CHS activity and product levels(reduced to 2% of wild-type values), whereas most re-maining activity was found in line 34 (approximately8% of wild-type values). In fruits derived from recip-rocal crossing, the presence of CHS activity was re-

lated to the wild-type maternal genotype, giving riseto fruit peel tissue.

Phenotypic Characterization of Chs RNAi Tomatoes

The Chs RNAi tomato plants were phenotypicallysimilar to wild type with respect to the vegetative tis-sues. However, all the strong Chs RNAi plants showeda delayed fruit development and yielded smaller fruits(Fig. 6). In addition, ripe fruits derived from Chs RNAiplants were reddish, and their peel showed a dull ap-pearance (Fig. 7, B and C) in contrast to wild, ripefruits that are more orange-red and shiny (Fig. 7A).The more intense red color of Chs RNAi fruits wasmost probably due to the reduction in the levels of theyellow-pigmented NAR-chalcone normally present athigh levels in epidermal cells of the ripening fruit (Huntand Baker, 1980). Interestingly, chalcone isomerase-overexpressing fruits display reduced NAR-chalconelevels, a more intense red color, and a dull appearanceas well (Muir et al., 2001). This suggests a relationshipbetween flavonoids and fruit dullness. To investigatethe dull appearance of the fruit peel in more detail, redwild-type and Chs RNAi fruits were subjected toelectron microscopy analysis. The epidermal cell layerof the wild-type fruits consisted of intact cells with atypical conical shape (Fig. 8, A and B), which normallyconfers the properties of higher light absorption andvelvet sheen. The absence of this conical cell surface inChs RNAi fruits could be an explanation for thedullness, as was described for the Antirrhinum majus(mixta) and the Petunia (mybPh1) mutants (Noda et al.,1994; Mol et al., 1998; van Houwelingen et al., 1998) inwhich the fainter petal colors also resulted from flat-tening of the epidermal cells. Furthermore, the fruitsurface of the Chs RNAi plants consisted of dead epi-dermal cells that were empty, as shown by the scan-ning electron microscopy freeze-fraction cross view(Fig. 8, C and D). A similar collapsed flat tire appear-ance of epidermal cells was observed in petals of thePetunia shriveled up (shp) mutants and led to a drasticchange of flower color (Mol et al., 1998).

Parthenocarpic Fruit Development

A more detailed investigation of the four selectedsingle-copy transgenic lines revealed that they all pro-duced parthenocarpic fruits, containing no seed at all(strong phenotypes; lines 24, 39, and 44) or arrestedseed set at early stages of development (weak pheno-type; line 34, with occasionally one or a few seeds in afruit). Within each line, the fruit phenotype was quiteconstant, but between different transgenic lines thephenotype varied considerably. Like in many par-thenocarpic plants (Falavigna et al., 1978; Abad andMonteiro, 1989), undersized, misshapen, or hollowfruits were also found in Chs RNAi tomato. At the endof the growing season, the Chs RNAi phenotype ap-peared to be more extreme in terms of very small fruitsize for some lines (39 and 44) when compared to

Figure 4. Quantitative real-time PCR analysis. Steady-state mRNAlevels of tomato Chs1 and Chs2 relative to the housekeeping gene L33(encoding tomato ribosomal protein L33) were measured in fruit peelextracts of RNAi (34, 39, 44, and 24) and control lines. Values representthe average of three biological replicates, each with three technicalreplicates. Expression levels in control were set to 100%.





wild-type fruits (Fig. 7E). Fruits of some Chs RNAiplants contained no jelly and were completely filledwith flesh. An overview of all the phenotypes found isshown in Figure 7.

Plant Pollen Tube Growth and Fertility

Because flavonoids were shown to play an essentialrole in pollen germination and pollen tube growth inPetunia and maize (Mo et al., 1992; Ylstra et al., 1992,1996), we investigated whether these processes wereaffected in Chs RNAi plants as well. Fertilized carpelsof wild-type, Chs RNAi (line 24), and reciprocalcrossed plants were histochemically stained specificfor callose present in growing pollen tubes 2 d afterpollination. In wild-type, self-pollinated plants, pollentubes reached the ovules 2 d after pollination (Fig. 9, B,F, and J). Within the same time period, pollen tubes ofChs RNAi self-pollinated plants germinated but didnot grow well. In these plants, callose staining wasclearly visible in the stigma and absent further downthe style, indicating an inhibited pollen tube growth(Fig. 9, D, H, and L). Pollen tube growth could be (par-tially) rescued by crossing wild-type and Chs RNAiplants in both directions. Pollen tube growth in wild-type female plants pollinated with Chs RNAi pollenreached the base of the style 2 d after pollination (Fig.9, B, F, and J). The reciprocal crossing, i.e. Chs RNAipistils pollinated with wild-type pollen, was less effi-cient (Fig. 9, C, G, and K). Here, the pollen tubes grewonly to about nine-tenths of the way down the style,and some of the tube tips were swollen.

Several cross-fertilized flowers were allowed to givefruits to see if the rescued pollen tube growth was ableto yield fruits with normal seed production (Table II).Seed production was fully rescued when wild-typefemale plants were pollinated with Chs RNAi pollen.Wild-type pollen was also able to give rise to seedproduction in Chs RNAi female plants; however, thiswas less efficient. Interestingly, the size of fruit ob-tained after Chs RNAi flowers were pollinated withwild-type pollen increased to normal, and the fruitsgained their velvet sheen, although they were stillmore reddish (Fig. 7D) compared to wild type due to

the absence of NAR-chalcone as a result of Chs RNAiinhibition (Fig. 5A). It is likely that seed set and fruitshininess result from complex interactions betweenmore development factors. Apparently, flavonoidspresent in wild-type pollen are sufficient to give riseto seed set, and, possibly, they also trigger directly orindirectly signals involved in fruit peel formation. Thewild-type flowers that were pollinated with Chs RNAipollen gave rise to fruits that were indistinguishablefrom normal wild-type fruits.

Transgene Stability and Offspring

A few offspring plants (F1) obtained from transgenicline 34 and several obtained from crossings of ChsRNAi with wild-type plants were selected for furtherevaluation of inheritance stability of the transgene.Both the low flavonoid and the parthenocarpic phe-notype were shown to segregate with the Chs RNAitransgene in all plants tested (n 5 8); fruits of trans-genic offspring contained very low flavonoid levels(less than 1% of nontransgenic fruits, data not shown)and were devoid of seeds.

The segregation of the transgene could already beseen in light-stressed seedlings. Nontransgenic seed-lings accumulated anthocyanins in stems and leaf axiswhen grown under high light conditions and became

Figure 5. CHS enzyme activity. A, Autoradiographyscan of extraction of CHS assays developed on cellu-lose plates in chloroform:acetic acid:water. Left, CHSactivity of tomato fruit peel in different Chs RNAi andcontrol lines. Right, CHS activity in fruits obtained after(reciprocal) crossings between wild type and ChsRNAi. B, Densitometric scans of profiles of selectedassays. The peak representing the CHS reaction prod-uct NAR is indicated.

Figure 6. Tomato fruit weight in grams (black bars) and fruit size atequatorial cross section in millimeters (gray bars). Values representmean values 6 SEM. Control (wild type), n 5 10; line 34, n 5 4; line 44,n 5 15; line 24 and 39, each n 5 14.

Schijlen et al.




purple. In contrast, in Chs RNAi transgenic seedlings,the inhibition of flavonoid biosynthesis resulted in theabsence of anthocyanins and likewise remained green.

DISCUSSION

In this study, we have shown that the flavonoidpathway in tomato can be efficiently down-regulatedby RNAi-mediated suppression of CHS gene expres-sion. In fruits, this led to a strong decrease in expres-sion of both Chs1 and Chs2 genes and CHS activity. Asa consequence, an up to 99% reduction in total flavo-

noids was measured. This was mainly due to reducedlevels of NAR-chalcone and rutin, the predominantflavonoids in tomato peel. Chs RNAi fruits showed analtered fruit color and a dull appearance due toaberrations in the epidermal cell layers. Also, pollendevelopment was hampered, resulting in a stronglyreduced seed set. Surprisingly, all strong Chs RNAilines yielded parthenocarpic fruits. We suggest the useof Chs RNAi as a novel approach to obtain this de-sirable trait in plants.

Although a relation between flavonoids and parthe-nocarpic fruit development has never been described,it is well known that flavonoids present in the

Figure 7. Overview of different phe-notypes found in Chs RNAi tomatoescompared to wild type. A, Typical ripewild-type tomato fruits are shiny andorange red, in contrast to dull, smaller,and more reddish Chs RNAi fruits(B, C, and D; line 24, 34, and 39,respectively). Fruits derived from flow-ers that were pollinated with wild-type pollen (arrow) grew to normalsize and obtained their shininess (D).Transgenic line 44 yielded extremesmall fruits and line 34 ‘‘fruit caves’’when compared to wild type (E). Inparthenocarpic Chs RNAi fruits, seeddevelopment was disturbed (G) or to-tally absent (H and I), whereas wild-type fruits had a normal seed set (F).

Figure 8. Electron microscopy photographof epidermal cells of red ripe tomato fruits. Aand C, Surface view; B and D, cross section.Wild-type (A and B) fruits contain conical-shaped cells on the epidermal surface,whereas in Chs RNAi (C and D) fruits theepidermal cell layer is disturbed (absence ofconical shapes and empty cells).





sculptured cavities of the pollen exine, the so-calledpollen coat (Edlund et al., 2004), are essential for pol-len development, germination, and pollen tube growthand, hence, play an essential role in plant reproduc-tion. For example, mutation of the two Chs genes inmaize as well as the Petunia wha mutant resulted inwhite, flavonoid-lacking pollen that showed to besterile. Furthermore, Petunia plants harboring a com-plete block of flavonoid production due to anti-senseChs or sense Chs cosuppression had white flowers andwere male sterile (Van der Meer et al., 1992; Napoliet al., 1999) In contrast, flavonoids appeared not to beessential for fertility in the tt4 (Chs) mutant of Arabi-dopsis (Arabidopsis thaliana; Burbulis et al., 1996), al-though also in this mutant a small but significantreduction in seed set was observed (Ylstra et al., 1996).Apparently, the role of flavonoids in plant reproduc-tion varies between different plant species.

To our knowledge, natural Chs mutants have notbeen found in tomato so far. However, several othertomato mutants with reduced flavonoid levels in veg-etative tissues have been described (Jorgensen andDooner, 1986). For none of these mutants, however,

has a seedless phenotype been reported. This is notsurprising because: (1) these mutants were screenedfor reduced levels of flavonoids, in particular, antho-cyanins, in vegetative tissues, and it is unclear if gen-erative tissues were affected as well; and (2) only twoof these mutants, al and af, showed a limited decreasein CHS enzyme activity (4- to 7-fold relative to wildtype in hypocotyls), which was much less severe thanwe observed in Chs RNAi plants (up to 50-fold reduc-tion in red fruits) and may not be sufficient to preventfertilization.

Flavonoids belonging to the class of flavonols haveespecially been shown to have strong stimulatory

Figure 9. Histochemical staining of wild-type and Chs RNAi (line 24) pollen tube growth in carpels 2 d after pollination.Fertilized carpels were stained with aniline blue to specifically stain callose present in growing pollen tubes. A, E, and I, Wild-type carpels crossed with wild-type pollen; B, F, and J, wild-type carpels 3 Chs RNAi pollen; C, G, and K, Chs RNAi 3 wild type;D, H, and L, Chs RNAi self-crossings. A to D, Pollen at the stigma. Note in D, callose in the pollen tubes is still visible at the stigma(arrow), indicating inhibited growth. E to H, Proliferation of pollen tube growth in the middle of the style, except for H, which isonly one-quarter of the way down the style from the stigma. No pollen tubes were visible in the middle of the styles from ChsRNAi selfed plants. I to L, Pollen tube growth at the base of the style, except K, which grew only nine-tenths of the way down thestyle. In K, the tips of the pollen tubes are swollen (arrow). Pollen tubes are not visible at the base of the style in K (not shown) or L.All micrographs are the same magnification. [See online article for color version of this figure.]

Table I. Oligonucleotides used for TaqMan analysis

Gene ID Oligo Name Sequence

TC85035 Le L33-259 F 5# cgc act atc gtt gca ttt gg 3#Le L33-315 R 5# caa cgc cac tgt ttc cat gt 3#

X55194 Chs1-505 F 5# atg ccc ggg tgt gac tac c 3#Chs1-556 R 5# ctg atg ggc gaa gcc cta g 3#

X55195 Chs2-1013 F 5# ggc cgg cga ttc tag atc a 3#Chs2-1063 R 5# ttt cgg gct tta ggc tca gtt 3#

Schijlen et al.




effects on pollen development, germination, pollentube growth, and seed set (Mo et al., 1992; Ylstra et al.,1992, 1996). The inability of pollen from the sterile whamutant to germinate normally could be complemen-ted by the introduction of a functional Chs transgene(Napoli et al., 1999) or by flavonol addition. Whenapplied to wild-type stigmas, tube growth of Chs-deficient sterile pollen and seed set could be partlyrescued (Mo et al., 1992; Taylor and Jorgensen, 1992).This has led to the assumption that Chs-deficientpollen lacks factors that are required for pollen tubegrowth and that wild-type stigmas can functionallycomplement with these factors (Mo et al., 1992).

In accordance to this, we observed that pollen tubegrowth was also strongly inhibited in self-pollinatedChs RNAi tomato plants, leading to parthenocarpicfruit development. Because both male and female ChsRNAi parents were hemizygous, and, hence, pro-duced gametes segregating for the transgene, theobserved effects on pollen tube growth, seed set, andparthenocarpic development are probably determinedby parental tissues. The tapetum and, consequently,pollen wall assembly, as well as the maternal tissuessuch as stigma and the style, can play crucial roles infunctional pollen rehydration, polarization, and pollentube migration into the stigma. Control of these pro-cesses likely requires constant interaction between pol-len tube and stigma (Mascarenhas 1993; Edlund et al.,2004).

Pollen tube growth and seed set was fully rescuedwhen CHS-deficient pollen was applied on wild-typestigmas. The reciprocal crossing (wild-type pollen onChs RNAi stigmas) resulted in only a partial rescue ofpollen tube growth and seed set, indicating that in ChsRNAi tomatoes fertilization is mainly diminished dueto the lack of flavonoids in the female reproductiveorgan.

Pollination appeared to be required for partheno-carpic fruit development in Chs RNAi lines because inthe absence of pollination no fruits were obtained. Thissuggests that pollination is required and sufficient totrigger fruit setting and that fertilization and subse-quent seed set are key determinants for normal fruitdevelopment and expansion.

Hormones play an important role in regulating fruitdevelopment. It is well known that pollen producesgibberellins and that application of gibberellins can

induce an increase in the content of auxin in theovaries of unpollinated flowers of the tomato plant,thereby triggering fruit set in the absence of fertiliza-tion (Sastry and Muir, 1963; Gorguet et al., 2005). Acrucial role for auxin in seedless tomato fruit forma-tion was directly demonstrated by ovule-specific over-expression of bacterial auxin biosynthetic genes,leading to seedless fruit production independent ofpollination (Rotino et al., 1997). Furthermore, down-regulation of the tomato Aux/IAA transcription factorIAA9 resulted in auxin-hypersensitive tomato plantsin which fruit development was triggered before fer-tilization and independent of pollination, leading toparthenocarpic fruits (Wang et al., 2005).

During normal fruit set, auxins are produced by thepollen tube as it grows through the style and later onby the embryo and endosperm in the developingseeds. The latter two sources of auxin are clearlydiminished or even absent in Chs-deficient partheno-carpic tomato plants, suggesting that these auxinsources are not required to induce fruit setting butmay be important in later stages of fruit development,such as fruit expansion.

A possible direct role for flavonoids in auxin distri-bution and GA synthesis has been proposed by severalresearch groups, and there is accumulating evidencesupporting this view. For example, loss of CHS activityin Arabidopsis caused an increase in polar auxin tran-sport (Brown et al., 2001). Recently, additional evidencethat flavonoids act as auxin transport inhibitors wasobtained from experiments with Chs RNAi-silencedMedicago truncatula plants; the flavonoid-deficient rootsof these plants showed increased auxin transport rel-ative to wild type and were unable to initiate rootnodulation (Wasson et al., 2006). So, it may well be thatthe reduction in flavonoid levels in Chs RNAi tomatoesaffects the synthesis, stability, or distribution of hor-mones such as auxins or gibberellins, leading to par-thenocarpic fruit development. Such an interaction,however, remains to be demonstrated.

Several tomato mutant genotypes resulting in par-thenocarpic fruit growth have been described, ofwhich pat (Mazzucato et al., 2003), pat2 (Philouze andMaisonneuve, 1978), pat3, and pat4 (Nuez et al., 1986)are the best characterized. In contrast to the Chs RNAitomato, parthenocarpic fruit development of all thesepat mutants is independent of pollination. At leastsome of these mutants (pat2, pat3, and pat4) containincreased GA levels in their parthenocarpic fruits,suggesting that the ability of these mutants to developparthenocarpic fruits is due to alterations in GA me-tabolism (Fos et al., 2000, 2001). Clearly, fruit develop-ment is controlled by complex processes, includingmultiple plant growth hormones and cross talk be-tween regulatory plant hormones.

In this article, we described the effect of decreasingflavonoid levels in Chs RNAi transgenic tomato plantson pollination, fertility, and fruit development. Thisapproach may provide a new method to obtain par-thenocarpic fruits.

Table II. Tomato fruit seed set

Fruit seed set (mean 6 SD) resulting from crossings between wild typeand CHS RNAi tomato line 39 and 44 (fruits of both lines were totallyseedless after self-pollination).

Female 3

Male

Wild Type 3

Wild Type

39 3

Wild Type

44 3

Wild Type

Wild

Type 3 39

Wild

Type 3 44

Seeds perfruit

121 6 47 35 6 8 57 6 22 121 6 41 129 6 22

Fruits (n) 4 6 7 8 5





Efficient RNAi silencing using flavonoid genes hasbeen reported recently in Medicago and soybean (Gly-cine max; Subramanian et al., 2005; Wasson et al., 2006).In these studies, as well as the Chs RNAi tomatodescribed here, relatively large RNAi constructs wereused. Therefore, unintended effects due to aspecificsilencing by small interfering RNAs derived from thelarger RNAi construct (Jackson and Linsley, 2004;Schwab et al., 2006) cannot be completely ruled out.However, no putative unintended target genes of thetomato Chs RNAi were identified by in silico compar-ison of small (20 nucleotides) perfect matching stretches,derived from the Chs RNAi gene construct, to theDana-Farber Cancer Institute tomato gene index (release11.0; June 21, 2006) using Vmatch (Kurtz et al., 2001).Although the RNAi machinery in plants appeared to bemuch more specific than in animals (Schwab et al.,2006), silencing of unintended target genes, due to smallinterfering RNAs derived from Chs RNAi, is highlyunlikely but cannot be excluded. Future experimentsusing smaller Chs RNAi constructs could provide moreinsight in the specificity of the Chs RNAi approachdescribed here.

For a successful commercial application of this tech-nology, it is an essential prerequisite that these par-thenocarpic fruits have a good taste. To address whetheror not the parthenocarpic phenotype dramaticallyaffects fruit taste, we measured the levels of the mostimportant taste- and flavor-related tomato metabolites(sugars, organic acids, and 16 volatiles; Yilmaz, 2001;Ruiz et al., 2005) in Chs RNAi and wild-type tomatoes.For both wild-type and Chs RNAi fruits, the levels offlavor-related volatile compounds fell well within thevariation observed in a collection of 94 commerciallyavailable tomato cultivars (Tikunov et al., 2005). Sim-ilar results were obtained for sugars (Suc, Fru, and Glc)and organic acids (citric acid and malic acid; resultsnot shown), suggesting that these parthenocarpic to-matoes potentially have a normal tomato-like taste.

Controllable parthenocarpic fruit developmentwith minimal side effects would also be of great valuefor future commercial applications. This could beachieved by using flower- or early fruit-specific pro-moters to drive Chs RNAi gene expression. The latterstrategy could also be important to avoid potentialadverse effects of flavonoid down-regulation on, forexample, disease resistance, as was reported for theRNAi-mediated inhibition of isoflavonoid synthase insoybean (Subramanian et al., 2005). There were, how-ever, no indications for increased susceptibility topathogens of the Chs RNAi tomato plants under thegrowth conditions used in this study.

Inducible parthenocarpy could also be achieved byusing inducible promoters, such as the ethanol-induciblealc gene expression system (Deveaux et al., 2003). Asan alternative to the Chs RNAi approach, partheno-carpic fruit development can also be achieved by over-expression of the grape stilbene synthase gene. Thestilbene synthase enzyme competes with CHS for thesame substrates, and overexpression resulted in de-

creased flavonoid levels and male sterile pollen intobacco (Fischer et al., 1997). Using this strategy, asignificantly decreased seed set in tomato fruits wasobserved (Giovinazzo et al., 2005; Schijlen et al., 2006).

Even more desirable for the breeding industry maybe the development of parthenocarpic tomato lineswith inducible seed set rather than inducible parthe-nocarpy. For example, seed set in parthenocarpic ChsRNAi plants could be rescued by stimulating theflavonoid pathway through inducible overexpressionof the transcription factors Lc/C1 (Bovy et al., 2002) inChs RNAi lines.

This report demonstrates the use of a flavonoid geneto induce parthenocarpic fruit development in tomato.The strict requirement for pollination to obtain par-thenocarpic fruit development suggests a close mech-anistic link to the essential role flavonoids play inpollen development. Further research is needed, how-ever, to better understand the role of flavonoids inhormone-related processes such as parthenocarpicfruit development.

MATERIALS AND METHODS

Plasmid Construction

A full-length cDNA-encoding tomato (Solanum lycopersicum) NAR-CHS-1

(Chs1; X55194) was obtained from a cDNA library of tomato fruits.

Two oligonucleotides, CHS-3#BamHI (GGATCCACTAAGCAGCAACAC)

and CHS-5#SalI (GTCTCGTCGACATGGTCACCGTGGAGGA) were used to

introduce a BamHI restriction site at the 3# end and a SalI site at the 5# end of

the Chs1 sequence. The PCR product was digested and ligated as a BamHI/

SalI fragment into pFLAP50, a pUC-derived vector containing a fusion of the

double CaMV 35S promoter (Pd35S) and the Agrobacterium tumefaciens nos

terminator (Tnos). The resulting plasmid was designated as pHEAP-02.

To create an inverted repeat construct, a sense cDNA fragment was cloned

between the promoter sequence and the anti-sense Chs1. Therefore, an 801-bp

fragment was obtained by PCR amplification using two primers with restric-

tion sites for BglII (forward primer CCCAGATCTATGGTCACCGTGGAG-

GAGTA; reverse primer CCCAGATCTTCACGTAAGGTGTCCGTCAA) The

BglII-digested PCR fragment was cloned in the BamHI-digested plasmid

HEAP-02, resulting in the plasmid pHEAP-17. The Pd35S-Chs1 inverted

repeat-Tnos construct was transferred as a PacI/AscI fragment into pBBC90, a

derivative of the plasmid pGPTV-KAN(11), and the final binary plasmid was

designated pHEAP-20.

Plant Transformation

The plasmid pHEAP-20 was transferred to A. tumefaciens strain COR308 by

the freeze-thaw method (Gynheung et al., 1988). The Agrobacterium-mediated

tomato (hypocotyls) transformation (‘Moneymaker’) was performed accord-

ing to the standard protocol (Fillatti et al., 1987). Kanamycin-resistant shoots

were grown under controlled greenhouse conditions in Wageningen, The

Netherlands. Plants were grown on rock-wool plugs connected to an auto-

matic irrigation system comparable to standard commercial cultivation con-

ditions with a minimum temperature set point of 19�C during daytime and

17�C at night. To compensate for the lack of sunlight, between autumn and

spring, supplementary high pressure sodium light was provided with a

minimum light intensity of, on average, 17 W m22 at a photoperiod of 16 h

light:8 h dark. All plants were self-pollinated to produce fruits and offspring.

The transgenic status of tomato plants was confirmed by PCR analysis on

young leaf material according to manufacturers protocol (X-amp PCR; Sigma-

Aldrich).

High molecular weight genomic DNA was isolated from young leaves of

tomato, as described by Dellaporta et al. (1983). Insert copy number of

transgenic plants was determined by Southern-blot hybridization according

to manufacturer’s protocol (DIG labeling; Roche) using 10 mg BglII-digested

genomic DNA and npt-II as probe.

Schijlen et al.




For further analysis (HPLC, DNA, and RNA), fruits were harvested when

visually ripe. From each selected primary transformant, three cuttings were

made and grown to maturity. From each plant, at least three fruits were pooled

for extraction to minimize sample variation. The fruit peel (approximately

2 mm consisting of cuticula, epidermis, and subepidermis) was separated

from the flesh tissue (i.e. columella; jelly parenchyma and seeds excluded) and

immediately frozen in liquid nitrogen. In addition to fruit material, young

leaves were also collected and frozen in liquid nitrogen to store at 280�C for

later use.

HPLC Analysis

Flavonoid content was determined both as glycosides and aglycones by

preparing nonhydrolyzed and acidic-hydrolyzed extracts, respectively. Non-

hydrolyzed extracts were prepared in 75% (w/v) aqueous methanol using

15 min of sonication. Subsequent HPLC of the extracted flavonoids was

performed with a gradient of 5% to 50% acetonitrile in 0.1% formic acid.

Absorbance spectra and retention times of eluting peaks were compared

with those of commercially available flavonoid standards (Apin Chemicals).

Analysis of flavonoids in the extracts was performed by reverse phase HPLC

(Phenomenex Luna 3 mm C18, 150 3 4, 50-mm column, at 40�C) with photo-

diode array detection (Waters 996).

RNA Isolation

Total RNA was isolated from tomato fruits as described previously (Bovy

et al., 1995). After DNAse-I treatment and RNeasy column purification (Qiagen),

the total RNA yield was measured by absorption at 260 nm. To determine the

RNA quality, a small amount (1 mg) of each sample was evaluated on a 1%

Tris-acetate EDTA agarose gel.

RT-PCR Gene Expression Analysis

Real-time quantitative RT-PCR analysis was performed to test the effect of

the RNAi construct on the endogenous Chs gene expression levels. Sequence

detection primers were designed based on the published tomato Chs se-

quences from tomato (Chs1; X55194 and Chs2; X55195) using the SDS 1.9

software (Applied Biosystems). All primers (Table I) were synthesized by

Applied Biosystems. Then 2 mg total RNA was used for cDNA synthesis using

Superscript II reverse transcriptase (Invitrogen) in a 100-mL final volume

according to the standard protocol. For each of the three biological replicates

of each transgenic line, Chs1 and Chs2 expression was measured in triplicate

using SYBR-green RT-PCR on the ABI 7700 sequence detection system. Chs

gene expression was expressed relative to the constitutively expressed ribo-

somal protein gene L33 (TC85035). Calculations of the expression in each

sample were carried out according to the standard curve method (PE Applied

Biosystems).

Enzyme Assay

NAR was from Roth. [2-14C]Malonyl-CoA (spec. act. 53 mCi/mmol) was

from Hartmann Analytic. 4-Coumaryol-CoA was a gift from W. Heller

(Neuherberg, Germany). [4a,6,8-14C]NAR was prepared as described by

S. Martens (unpublished data) using recombinant CHS and chalcone isom-

erase. Radioactivity incorporated in labeled substrate was quantified by scan-

ning sample aliquots after migration on cellulose plates (Merck) using a

bio-Imaging Analyzer Fuji BAS FLA 2000 (Raytest) and by direct scintillation

counting (LKB Wallac 1214 Rackbeta; PerkinElmer Wallac).

Proteins were extracted from grounded fruit tissue as follows: 200 mg

tissue was homogenized with 100 mg sea sand, 200 mg Dowex 200-400 mesh

(aquil. 0.1 M Tris-HCl, pH 7.5) in 1 mL of 0.1 M Tris-HCl, pH 7.5, containing

20 mM sodium ascorbate. After two centrifugation steps at 10,000g (Sorvall

RMC 14; Du Pont Nemours) for 5 min at 4�C, the resulting supernatant was

directly used for CHS assays. Protein concentration was determined accord-

ing to Bradford (1976) using bovine serum albumin as a standard. For each

sample, two independent preparations were performed.

Standard assays for CHS was performed in a final volume of 200 mL and

contained: 140 mL of 0.1 M Tris-HCl, pH 7.5, 50 mL of crude extract (8–22 mg

protein), 5 mL of [2-14C]malonyl-CoA (1.5 nmol; approximately 1,800 Bq), and

5 mL of 4-coumaroyl-CoA (1 nmol). After incubation, reactions were stopped

and extracted twice with 100 mL ethyl acetate. The pooled ethyl acetate phase

from each assay was directly subjected to scintillation counter for quantifica-

tion or chromatographed on cellulose plates with either chloroform:acetic

acid:water; 50:45:5) or 15% acetic acid. For each enzyme preparation, CHS

assays were performed in triplicate. Labeled products were localized and

quantified by scanning the plates as above described. Product identification

was done by cochromatography with authentic samples.

In Vivo Pollen Tube Growth

Mature closed flowers were emasculated and pollinated. Two days after

pollination, pistils were harvested and incubated overnight at 60�C in 1 M

KOH. After rinsing with water, pistils were transferred to a microscope slide

and stained with 0.005% aniline in 50% Gly. A coverslip was placed on top and

pressed gently. Callose in the pollen tubes was visualized by UV light on a

Zeiss Axioskop microscope and photographed using 400 ASA film. Slides

were scanned with an AGFA duoscan scanner.

Cryo-Scanning Electron Microscopy

Small samples of material were dissected from fresh fruits, mounted on a

stub, and subsequently frozen in liquid nitrogen. The samples were further

prepared in an Oxford Alto 2500 cryo-system (Catan) and then analyzed in a

JEOL JSM-6330F field emission electron scanning microscope. The frozen

samples were fractionated inside the cryo system for cross views.

Sequence data from this article can be found in the GenBank/EMBL data

libraries under accession numbers X55194 and X55195.

Received March 27, 2007; accepted April 27, 2007; published May 3, 2007.

LITERATURE CITED

Abad M, Monteiro AA (1989) The use of auxins for the production of

greenhouse tomatoes in mild winter conditions: a review. Sci Hortic

(Amsterdam) 38: 167–192

Brown DE, Rashotte AM, Murphy AS, Normanly J, Tague BW, Peer WA,

Taiz L, Muday GK (2001) Flavonoids act as negative regulators of auxin

transport in vivo in Arabidopsis. Plant Physiol 126: 524–535

Bovy A, de Vos R, Kemper M, Schijlen E, Almenar Pertejo M, Muir S,

Collins G, Robinson S, Verhoeyen M, Hughes S, et al (2002) High-

flavonol tomatoes resulting from heterologous expression of the maize

transcription factor gene Lc and C1. Plant Cell 14: 2509–2526

Bovy A, van den Berg C, de Vrieze G, Thompson WF, Weisbeek P,

Smeekens S (1995) Light-regulated expression of the Arabidopsis

thaliana ferredoxin gene requires sequences upstream and downstream

of the transcription initiation site. Plant Mol Biol 27: 27–39

Bradford MM (1976) A rapid and sensitive method for the quantitation of

microgram quantities of protein utilizing the principle of protein-dye bind-

ing. Anal Biochem 72: 248–254

Burbulis IE, Iacobucci M, Shirley BW (1996) A null mutation in the first

enzyme of flavonoid biosynthesis does not affect male fertility in

Arabidopsis. Plant Cell 8: 1013–1025

Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation:

version II. Plant Mol Biol Rep 1: 19–21

Deveaux Y, Peaucelle A, Roberts GR, Coen E, Simon R, Mizukami Y,

Traas J, Murray JA, Doonan JH, Laufs P (2003) The ethanol switch: a

tool for tissue-specific gene induction during plant development. Plant J

36: 918–930

Edlund AF, Swanson R, Preuss D (2004) Pollen and stigma structure and

function: the role of diversity in pollination. Plant Cell (Suppl) 16:

S84–S97

Falavigna A, Baldino M, Soressi GP (1978) Potential of the mono Mende-

lian factor pat in tomato breeding for industry. Genet Agrar 32: 159–160

Fillatti JJ, Kiser J, Rose R, Comai L (1987) Efficient transfer of a glyphosate

tolerance gene into tomato using a binary Agrobacterium tumefaciens

vector. Bio/Technol 5: 726–730

Fischer R, Budde I, Hain R (1997) Stilbene synthase gene expression causes

changes in flower colour and male sterility in tobacco. Plant J 11: 489–498

Fos M, Nuez F, Garcıa-Martınez JL (2000) The pat-2 gene, which induces

natural parthenocarpy, alters gibberellin content in unpollinated tomato

ovaries. J Plant Physiol 122: 471–479





Fos M, Proano K, Nuez F, Garcıa-Martınez JL (2001) Role of gibberellins in

parthenocarpic fruit development induced by the genetic system pat-3/

pat-4 in tomato. Physiol Plant 111: 545–550

Giovinazzo G, D’Amico L, Paradiso A, Bollino R, Sparvoli F, DeGara L

(2005) Antioxidant metabolite profiles in tomato fruit constitutively

expressing the grapevine stilbene synthase gene. Plant Biotechnol J 3:

57–69

Gorguet B, van Heusden AW, Lindhout P (2005) Parthenocarpic fruit

development in tomato. Plant Biol 7: 131–139

Gustafson FG (1942) Parthenocarpy: natural and artificial. Bot Rev 8:

599–654

Gynheung AN, Ebert PR, Mitra A, Ha SB (1988) Binary vectors. In S

Gelvin, R Schilperoort, D Verma, eds, Plant Molecular Biology Manual.

Kluwer Academic Publishers, Dordrecht, The Netherlands, pp A3/1–19

Hunt JM, Baker EA (1980) Phenolic constituents of tomato fruit cuticles.

Phytochemistry 19: 1415–1419

Jackson AL, Linsley PS (2004) Noise amidst the silence: off-target effects of

siRNAs? Trends Genet 20: 521–524

Jorgensen RA, Dooner HK (1986) Activity of anthocyanin biosynthetic

enzymes and CHS in anthocyanin deficient mutants in tomato. Tomato

Genet Coop Rep 36: 6–7

Koes RE, Quattrocchio F, Mol JNM (1994) The flavonoid biosynthetic

pathway in plants: function and evolution. Bioessays 16: 123–132

Kurtz S, Choudhuri JV, Ohlebusch E, Schleiermacher C, Stoye J, Giegerich R

(2001) REPuter: the manifold applications of repeat analysis on a geno-

mic scale. Nucleic Acids Res 29: 4633–4642

Mascarenhas JP (1993) Molecular mechanisms of pollen tube growth and

differentiation. Plant Cell 5: 1303–1314

Mazzucato A, Olimpieri I, Ciampolini F, Cresti M, Soressi GP (2003) A

defective pollen-pistil interaction contributes to hamper seed set in the

parthenocarpic fruit tomato mutant. Sex Plant Reprod 16: 157–164

Mo Y, Nagel C, Taylor LP (1992) Biochemical complementation of chalcone

synthase mutants defines a role for flavonols in functional pollen. Proc

Natl Acad Sci USA 89: 7213–7217

Mol J, Grotewold E, Koes R (1998) How genes paint flowers ands seeds.

Trends Plant Sci 3: 212–217

Muir SR, Collins GJ, Robinson S, Hughes S, Bovy S, De Vos CH, van

Tunen AJ, Verhoeyen ME (2001) Overexpression of petunia chalcone

isomerase in tomato results in fruit containing increased levels of

flavonols. Nat Biotechnol 19: 470–474

Napoli CA, Fahy D, Wang HY, Taylor LP (1999) White anther: a Petunia

mutant that abolishes pollen flavonol accumulation, induces male

sterility, and is complemented by a chalcone synthase transgene. Plant

Physiol 120: 615–622

Noda K, Glover BJ, Linstead P, Martin C (1994) Flower colour intensity

depends on specialized cell shape controlled by a Myb-related tran-

scription factor. Nature 369: 661–664

Nuez F, Costa J, Cuartero J (1986) Genetics of the parthenocarpy for tomato

varieties ‘Sub-Arctic Plenty’, ‘75/59’ and ‘Severianin’. Z Pflanzenzuch-

tung 96: 200–206

O’Neill SD, Tong Y, Sporlein B, Forkmann G, Yoder YI (1990) Molecular

genetic analysis of chalcone synthase in Lycopersicon esculentum and

an anthocyanin-deficient mutant. Mol Gen Genet 224: 279–288

Philouze J, Maisonneuve B (1978) Heredity of the natural ability to set

parthenocarpic fruits in the Soviet variety Severianin. Tomato Genet

Coop Rep 28: 12–13

Rotino GL, Perri E, Zottini M, Sommer H (1997) Genetic engineering of

parthenocarpic plants. Nat Biotechnol 15: 1398–1401

Ruiz JJ, Alonso A, Garcia-Martinez S, Valer M, Blasco P, Ruiz-Bevia F

(2005) Quantitative analysis of flavour volatiles detects differences

among closely related traditional cultivars of tomato. J Sci Food Agric

85: 54–60

Sastry K, Muir R (1963) Gibberellin: effect on diffusible auxin in fruit

development. Science 140: 494–495

Schijlen E, de Vos CHR, Jonker H, van den Broeck H, Molthoff J, van

Tunen A, Martens S, Bovy A (2006) Pathway engineering for healthy

phytochemicals leading to the production of novel flavonoids in tomato

fruit. Plant Biotechnol J 4: 433–444

Schwab R, Ossowski S, Riester M, Warthmann N, Weigel D (2006) Highly

specific gene silencing by artificial microRNAs in Arabidopsis. Plant

Cell 18: 1121–1133

Subramanian S, Graham MY, Yu O, Graham TL (2005) RNA interference

of soybean isoflavone synthase genes leads to silencing in tissue distal to

the transformation site and to enhanced susceptibility to Phytophthora

sojae. Plant Physiol 137: 1345–1353

Taylor LP, Jorgensen R (1992) Conditional male fertility in chalcone

synthase-deficient Petunia. J Hered 83: 11–17

Tikunov Y, Lommen A, de Vos CHR, Verhoeven HA, Bino RJ, Hall RD,

Bovy AG (2005) A novel approach for nontargeted data analysis for

metabolomics. Large-scale profiling of tomato fruit volatiles. Plant

Physiol 139: 1125–1137

Van der Meer IM, Stam ME, Van Tunen AJ, Mol JN, Stuitje AR (1992)

Antisense inhibition of flavonoid biosynthesis in Petunia anthers results

in male sterility. Plant Cell 4: 253–262

van Houwelingen A, Souer E, Spelt K, Kloos D, Mol J, Koes R (1998)

Analysis of flower pigmentation mutants generated by random trans-

poson mutagenesis in Petunia hybrida. Plant J 13: 39–50

Varoquaux F, Blanvillain R, Delseny M, Gallois P (2000) Less is better;

new approaches for seedless fruit production. Trends Biotechnol 18:

233–242

Wang H, Jones B, Li Z, Frasse P, Delalande C, Regad F, Chaabouni S,

Latche A, Pech J-C, Bouzayen M (2005) The tomato Aux/IAA tran-

scription factor IAAg is involved in fruit development and leaf mor-

phogenesis. Plant Cell 17: 2676–2692

Wasson AP, Pellerone FI, Mathesius U (2006) Silencing the flavonoid

pathway in Medicago truncatula inhibits root nodule formation and

prevents auxin transport regulation by Rhizobia. Plant Cell 18:

1617–1629

Wiermann R (1979) Stage specific phenylpropanoid metabolism during

pollen development. In M Luckner, L Schreiber, eds, Regulation of

Secondary Product and Plant Hormone Metabolism. Pergamon Press,

Oxford, pp 231–239

Yilmaz E (2001) The chemistry of fresh tomato flavor. Turk J Agric For 25:

149–155

Ylstra B, Muskens M, van Tunen AJ (1996) Flavonols are not essential for

fertilization in Arabidopsis thaliana. Plant Mol Biol 32: 1155–1158

Ylstra B, Touraev A, Benito Moreno RM, Stoger E, van Tunen AJ, Vicente

O, Mol JNM, Heberle-Bors E (1992) Flavonols stimulate development,

germination and tube growth of tobacco pollen. Plant Physiol 100: 902–907

Yoder JI, Belzile F, Tong Y, Goldsbrough A (1994) Visual markers for

tomato derived from the anthocyanin biosynthetic pathway. Euphytica

79: 163–167

Schijlen et al.




RNA Interference Silencing of Chalcone Synthase, the First ... · Chs Gene Expression Analysis...

Documents

Transcript of RNA Interference Silencing of Chalcone Synthase, the First ... · Chs Gene Expression Analysis...