Review Article - jmg.bmj.com

Review ArticleJournal of Medical Genetics (1972). 9, 254.

Gene Duplication, Mutation Load, andMammalian Genetic Regulatory Systems*

SUSUMU OHNO

Department of Biology, City of Hope Medical Center, Duarte, California, USA

In recent years, the complete amino-acid sequen-ces of increasing numbers of polypeptide chains be-came known. We have been afforded opportunitiesto look at the direct products of genes and thisenabled us to deduce the evolutional history ofindividual gene loci. The extremely conservativenature of natural selection became immediatelyapparent. The observation that histone IV (110amino-acid residues) of cattle and garden peas differfrom each other only by two substitutions is mostrevealing (DeLange and Smith, 1971). It appearsthat an entire molecule of histone IV represents afunctionally critical active site, so that almost anymutational amino-acid substitution makes a mutantprotein delinquent in the performance of itsassigned function which is to attach itself side-by-side to a DNA strand. Accordingly, natural selec-tion has eliminated almost all the bearers of muta-tions affecting this gene locus since the creation ofeukaryotes. Table I supports the view that theactive site sequence of any functional polypeptidechain tended to remain invariant, as it appears thatthe smaller the proportion of active sites in a pep-tide chain, the faster the rate of its evolution.Fibrinopeptides A (15 to 19 amino-acid residues)and B (14 to 21 residues) are the fastest evolving ofall the known peptide chains (Blomback, Blomback,and Grondahl, 1965; Dayhoff, 1969). Duringblood clot formation, fibrinopeptides A and B arediscarded from the inert fibrinogen molecule by thetrypsin-like action of thrombin. Their role beingpassive, most amino-acid substitutions would beharmless as only the carboxyl terminal arginine anda few other sites are functionally critical for theirassigned function. There is indeed much evidenceto support the view that most evolutional amino-

Received 24 April 1972.* This work was supported in part by a grant (CA 05138) from the

National Cancer Institute, US Public Health Service.

acid substitutions represent functionally neutral,and therefore, trivial mutations (Kimura and Ohta,1971).So long as a particular function is assigned to a

single gene locus in the genome, natural selectionnever permits character-changing mutations toaffect that locus, for such mutations are deleteriousto individuals which bear them. It follows then thatnatural selection is not a great advocator of changesas the Darwinian concept of evolution had us be-lieve, but rather an extremely conservative forcewhich tends to maintain the status quo at each locus.Conditio sine qua non of evolution had to be theescape from the relentless pressure exerted bynatural selection. Only a redundant copy of anoriginal gene created by the mechanism of geneduplication escapes from the stranglehold bynatural selection, and while being ignored bynatural selection, it is free to accumulate formerlyforbidden mutations which change the active site.As a result, it may emerge as a new gene locus witha previously nonexistent function. There is littledoubt that the creation of many new gene loci viagene duplication through polyploidy as well as un-equal crossing-over contributed greatly to evolutionfrom fish to mammals (Ohno, 1970).

Yet this mechanism too has its limitations.Since 3 of the 64 codons are chain terminating non-sense codons, there is a 1 in 24 chance that the firstmutation sustained by a redundant copy would bechain-terminating. If long ignored by naturalselection, a redundant copy would surely become aworthless degenerate DNA base sequence. In ordernot to degenerate, it has to acquire a new and usefulfunction before long and begin contributing to thewell-being of an organism. Only then, can it againbe placed under surveillance by natural selection.It is natural selection that prevents further accumu-lation of randomly sustained mutations by this new

254

copyright. on January 3, 2022 by guest. P

rotected byhttp://jm

g.bmj.com

/J M

ed Genet: first published as 10.1136/jm

g.9.3.254 on 1 Septem

ber 1972. Dow

nloaded from

http://jmg.bmj.com/

Gene Duplication, Mutation Load, and Mammalian Genetic Regulatory Systems

gene locus which would certainly lead to degeneracy.By doing so, natural selection in this role becomes anactive contributor to evolutional changes. Never-theless, a group of genes which shared a common

ancestral gene, as a rule, show only a limited degreeof functional divergence; ie, myoglobin and haemo-globin genes (Ingram, 1963). It becomes quite clearthat evolution cannot be understood by knowingonly the functional diversification of structuralgenes by gene duplication.

Indeed, we realize that major steps in vertebrateevolution were more often accomplished by changesin regulation of already existing structural genesrather than by the acquisition of new structuralgenes. The first major anatomical improvement thatoccurred to early vertebrates was the developmentof jaws. The earliest known vertebrates of morethan 300 million years ago were jawless fish belong-ing to the class Agnatha. These fish-like creatureshad a mouth which was merely an opening that ledto the digestive tract with as many as 10 pairs ofgills opening into it. Each gill was supported by an

arch formed by a series of bones arranged in thefashion of a V turned on its side. When such a Vof the third gill arch was strengthened and suppliedwith teeth and hinged at the point of the V, it be-came the jaw. Such a change required no newstructural genes, but a change in direction of onto-genic development which is no doubt under the con-trol of genetic regulatory systems. During mam-malian evolution, extensive modification of digitsoccurred. Yet, the same set of structural genes areinvolved in the formation of man's hand, the horse'smiddle toe, and the whale's flipper. Thus, we

come to realize that there is more truth than meetsthe eye to the time honoured statement 'ontogenyrecapitulates phylogeny'. In order to know bothprocesses, some understanding of the nature ofgenetic regulatory systems which operate in eukary-otes, in general, and in higher animals in particularis essential.

It has often been stated that compared with thelac-operon system of E. coli (Jacob and Monod,1961) and other regulatory systems of prokaryotes,genetic regulatory systems in mammals must beenormously complicated, defying meaningful analy-sis at present. Such a modest statement has not

necessarily been conducive to making headway inthis direction, for while confessing ignorance, regu-

latory function of some sort has casually beenassigned to undefined nonhistone proteins of thenucleus as well as to nuclear RNAs which do not

belong to the known categories: messenger, transfer,and ribosomal RNAs. Similarly, a number of struc-

tural mutations in which amino-acid substitutions

could not be demonstrated have been claimed to beregulatory in nature. It appears that we have beenworse off for not having thought out the conceptualframework on the nature of mammalian regulatorysystems. Any regulatory system whether of pro-karyotes or of mammals must abide by certain rulesand function within a framework imposed bycertain restrictions. In the present paper, I shalltry to point out the more obvious of these rules andrestrictions.

Needless to say, the structural gene products suchas enzymes are to a certain extent self-regulatory intheir function because the concentrations of sub-strates and products as well as other conditionsdetermine their efficiency. However, we are con-cerned here only with the genetic regulatory systemswhich direct ontogenic development of a fertilizedegg. Jacob and Monod (1963) defined differen-tiation as '. . . two cells are differentiated with respectfrom one another if, while they harbour the samegenome, the pattern of proteins which they synthe-size is different'. One can think of no better defi-nition.

Mutation Load and Regulatory SystemsIt is generally thought that the mammalian

genome must harbour an enormous number ofstructural gene loci and that, in order to regulatesuch a large number of structural loci, mammalsmust possess infinitely complicated regulatorysystems. The point is that an organism cannotafford to maintain an inordinately large number ofgene loci. As soon as the copying mechanism ofDNA replication based on the inherent comple-mentality between pairs of bases (adenine andthymine, guanine and cytosine) becomes so perfectthat there is no more room for error, the evolutionalprocess will cease to exist. Errors (base substitu-tions, deletions, etc) do occur spontaneously andrandomly and these errors which affect individualgene loci are recognized as mutations. So long as agiven gene locus contributes to the well-being of anorganism, mutations affecting it can be deleteriousas well as neutral or advantageous to individualswhich bear them. Natural selection eliminates thebearers of deleterious mutations as they are unfit.For some gene loci such as the histone IV locus,almost all mutations are deleterious, while forothers, a considerable fraction of the mutationswould be harmless (Table I). Nevertheless, thereis fairly good agreement that for man and othermammals, the mean spontaneous deleterious muta-tion rate per locus per organism generation is of theorder of 10-5. It follows then that the more gene

255



g.bmj.com

/J M



ber 1972. Dow

nloaded from

http://jmg.bmj.com/

Susumu Ohno

TABLE IINFLUENCE OF 'ACTIVE SITE'ON MOLECULAR EVOLUTION

Amino-acid Peptide Chain/YearSite/Year

Histone IV 0-0006 x 10 - 8 0-006 x 10 - 8

Cytochrome C 0 03 x 10 - 8 3-12 x 10 - 8

Haemoglobinsa and 9 0-12 x 10 -8 17 2 x 10-8

Immunoglobulin K-chainVariable region 0 34 x 10 - 8 37-4 x 10 -8Constant region 0 40 x 10 - 8 44-0 x 10 - 8

FibrinopeptidesA and B 0-90 x 10 8 16 2 x 10 -8

The evolutionally permissible mutation rate of each protein isexpressed as the rate of amino-acid substitution, deletion, and inser-tion per year per amino-acid site as well as per peptide chain.Modelled after Dayhoff (1969).

loci an organism possesses in its genome, the higherthe overall deleterious mutation rate. This is whatHaldane (1957) explained as the cost of naturalselection and Muller (1967) called the mutationload. Obviously, the mutation load imposes afinite upper limit to the number of gene loci anorganism can afford to have.The mammalian genome (haploid set of chromo-

somes) contains roughly 3 x 10-9 mg of DNAwhich conveniently corresponds to 3 x 109 basepairs. Taking the average gene size to be 103 basepairs which can specify a 330 amino-acid residuelong polypeptide chain, there is room for 3 x 106gene loci. The overall deleterious mutation rateper organism generation for 3 x 106 gene loci is 30,and recessive deleterious mutations accumulate inthe genome generation after generation. Because ofthis, Kimura (1968) estimated that if the humangenome contains that many gene loci, at this time inevolutional history, in order to ensure that a few ofthem would survive, each mated pair would have toproduce 1078 zygotes. The realistic number offunctionally significant gene loci in the mammaliangenome has been estimated to be between 4 and5 x 104 (Muller, 1967; Crow and Kimura, 1970).These many gene loci account for no more than 2 oof the total genomic DNA. Although ribosomaland transfer RNA genes which exist in multiplecopies have to be added to the above number, it in-deed appears that the bulk of our genomic DNA hasno definable finction in that these segments areeither never transcribed or if transcribed are nottranslated to meaningful amino-acid sequences.Accordingly, these segments are undergoing veryrapid evolutional changes by unrestricted accumula-

tion of randomly sustained mutations (Walker,1968). One of the main reasons that caused theaccumulation of so many nonfunctional basesequences in the mammalian genome is, I believe, aseries of gene duplications that occurred in the past(Ohno, 1970). In order to emerge as a new genelocus with a previously nonexistent function, a re-dundant copy of a functional gene created by geneduplication had to be ignored by natural selection sothat it could accumulate formerly forbidden muta-tions as mentioned in the introduction. The morelikely fate of an ignored copy, however, is degenera-tion rather than a new functional locus. My esti-mate is that for every copy which emerged trium-phant as a new gene locus, 10 or so copies joined theranks of nonfunctional DNA. Thus, in order todouble the number of gene loci, the genome size hadto increase 10 times. This was the price which hadto be paid for acquiring increasingly complex bodyorganization. A considerable portion of non-functional DNA exists as long tandem repeats of ashort sequence known as satellite DNA (Southern,1970) occupying the heterochromatic region ad-jacent to the centromere of each chromosome (Jones,1970). The origin of this repetitious DNA is notclear. In the euchromatic region, long stretches ofnonfunctionalDNA appear to space apart functionalgenes. This is reflected in the calculation that inmammals one genetic cross-over unit correspondsto 106 base pairs. These spacer DNA sequencesprobably represent extinct species of structuralgenes in that they are redundant copies which failedto acquire new functions. Furthermore, it appearsthat parts of nonfunctional DNA base sequenceadjacent to a structural gene are transcribed to-gether with a structural gene to messenger RNA.Thus, messenger RNA of a given peptide chain tendsto be two or three times longer than expected.Messenger RNAs apparently contain a long stretchof monotonous polyadenylic acid sequence, and therecent discovery of longer than usual mutant humanhaemoglobin alpha- as well as beta-chain (Flatz etal, 1971; Milner, Clegg, and Weatherall, 1971)indicates that the 3' end of haemoglobin messengerRNA normally contains a stretch of normally un-translatable sequence which is not poly A.The above considerations on the number and

spacing of functional genes in the mammalian gen-ome are very pertinent to our discussion on thenature of mammalian genetic regulatory systems aswe shall shortly see.

First of all, the mammalian genome does notappear to contain an exorbitantly large number ofgene loci. Since the difference between E. coli andmammals with regard to the actual number of gene

256



g.bmj.com

/J M



ber 1972. Dow

nloaded from

http://jmg.bmj.com/


loci is likely to be 10-fold rather than a 1000-fold,mammalian regulatory systems need not be socomplicated.

Secondly, not only structural genes, but alsoregulatory components, can sustain deleteriousmutations. Thus, regulatory components con-tribute heavily to the overall mutation load. Aregulatory locus (i) can mutate to either is or ic andgive the noninducible or constitutive mutant pheno-type. In the case of a repressive locus, the former(iS), in simplest terms, represents a mutational de-crease by a repressor of its binding affinity to aninducer. All the structural gene products of asystem which are normally inducible would not bemade even in the presence of an inducer. Thelatter represents either a mutational loss of thebinding affinity to the operator (iC) or the loss bydeletion of i gene (i-). Mutational base changesin the operator region affect its binding affinity tothe wild-type regulator and give either the Os(operator noninducible) or oc (operator constitutive)phenotype. As a single regulatory locus controls anumber of structural genes, individual regulatorymutations should be even more deleterious thanindividual structural mutations.

During evolution from unicellular prokaryotes tomulticellular eukaryotes of increasing complexity,the necessary increase in number of regulatorysystems had to be compensated by simplifying eachregulatory system. If the increase in number ofsystems was accompanied by the increase in com-ponents of each system, the overall mutation loadwould have become unbearable. I contend, there-fore, that the direction of natural selection has beento reduce the number of components in eachregulatory system as multicellular organisms attainedhigher degrees of complexity (Ohno, 1971).

Thirdly, mammals may come to rely moreheavily on translational controls rather than trans-criptional controls.

In transcriptional control of prokaryotes, a regula-tor binds to the operator region on DNA, as theoperator is either a part of or situated immediatelyadjacent to the promotor region (Smith and Sadler,1971), this binding either prevents (repressive con-trol) or enhances (activating control) the transcrip-tion of that regulated structural gene by RNApolymerase. Thus, the regulation is primarilytranscriptional.

In mammals whose genome is so loaded with non-functional DNA base sequences, however, the pre-cise transcriptional control may have become verydifficult or nearly impossible. Indeed, the trans-cription in mammals appears to be rather indiscrimi-nate as already indicated. The original observation

(Harris and Watts, 1962) that up to 90% of thefreshly transcribed RNAs in the mammalian cellnucleus (heterogeneous nuclear RNA) are instantlydegraded either in situ or in the cytoplasma (Aronson,1972) has been repeatedly confirmed (Harris, 1970).To be sure, there would still be a general sort oftranscriptional control. For example, a steroid hor-mone induced hypertrophy of target cells appears tobe caused in part by the selective activation of RNApolymerase I which results in increased productionof ribosomal RNA, therefore, ribosomes (Liao et al,1965; Blatti et al, 1970).

Nevertheless, precise transcriptional control assuch may be the exception rather than the rule.Very recently, it became possible to make a DNAcopy of a particular species of messenger RNA bythe use of viral reverse transcriptase (Kacian et al,1972; Verma et al, 1972). If it is shown in the nearfuture that heterogeneous nuclear RNAs isolatedfrom fibroblasts contain a sequence complementaryto haemoglobin DNA, it will become certain thatthere is not much transcriptional control sensusstricto in mammals. A principle difference inregulatory systems that exists between prokaryotesand mammals might be that mammals principallyexercise translational control on already mademessenger RNAs.

Essential Components of a Self-containedRegulatory System

There is little doubt that the construction of amammalian body requires a rather large number ofregulatory systems and these regulatory systems sortthemselves out to sets of hierarchial arrangements.Furthermore, several independent regulatory sys-tems may simultaneously operate in the samesomatic cell type in an interlocked manner in thatthe same structural locus may be placed under thecontrol of two different regulatory systems. Forexample, tyrosine aminotransferase in the rat livercan be induced either by hydrocortisone or byinsulin (Lee and Kenney, 1971). Yet, in order toanalyse a regulatory system, it has to be recognizedas a self-contained entity distinguishable fromothers which are interlocked with it.A regulatory system is definable as one which is

under the control of a single regulatory locus, and itis likely to include a number of structural geneswhich are regulated. How can one regulatory genecontrol more than one structural gene ? In order tobe regulated, all the structural genes or theirmessenger RNAs included in the system must sharein common a stretch of identical or nearly identicalDNA or RNA base sequence, for it is this base

257



g.bmj.com

/J M



ber 1972. Dow

nloaded from

http://jmg.bmj.com/

sequence to which a regulatory gene product hasspecific binding affinity. Such a base sequencewhich constitutes a part of each regulated structuralgene is defined as the operator region. Theoperator region need not be and should not be long.The longer the region, the higher the possibility ofsustaining deleterious mutations. Furthermore, astretch made of 20 consecutive bases or base pairscan be sufficiently specific to function as the bindingsite for a particular regulatory gene product, for agiven sequence represents one of 420 possiblesequences (Smith and Sadler, 1971).

If a binding between a regulatory gene productand the operator region results in preventing eithertranscription of that structural gene or translationof its messenger RNA, that product is functioningas a repressor and the regulation is repressive. If,on the other hand, this binding results in enhancingeither transcription or translation, the activatingcontrol is in operation. A difference between therepressive and activating controls is not as great asit may appear at first glance.

Contrary to various claims made on acidic pro-teins and RNAs of mammalian cell nuclei, the mereindication or even the fact of having bindingaffinity to a particular group of structural genes doesnot suffice as a requirement to be a regulator of aself-contained regulatory system. For example,the presence in cell nuclei of activator RNA hasbeen postulated. This smallish piece of singlestranded RNA is said to complex with a particularDNA base sequence (operator ?), and by so doingremoves histones from its vicinity and permitstranscription of certain structural genes (Bekhor,Bonner, and Dahmus, 1969). Even if activatorRNAs exist, the gene which specifies such RNAdisqualifies itself as a regulator, since whether aregulatory system is to be switched on or off is de-pendent upon the presence or absence of activatorRNA. A true regulatory gene of such a systemmust be the one which controls the gene whichspecifies activator RNA (Britten and Davidson,1969).A chromatid of an average mammalian chromo-

some 5,u or so in length should contain a DNAstrand 4-5 cm long. A gene is but a particular por-tion of such a strand equipped with a short promotorregion on one side and a transcription terminatingsignal on the other. RNA polymerase recognizesthe promotor base sequence and initiates transcrip-tion. Although only two species ofRNA polymer-ases, one for the transcription of ribosomal RNAgenes in the nucleolus and the other for transcrip-tion of presumably all other genes, have so far beenrecognized in mammals (Roeder and Rutter, 1969);

for the sake of argument, let us assume that themammalian genome contains hundreds of gene locifor different species ofRNA polymerases each havingan affinity to a specific promotor base sequence. Itfollows then that each species of RNA polymerasetranscribes only a particular group of structuralgenes. It may appear that each RNA polymeraselocus is a master regulatory locus of a specificregulatory system. In fact, however, these poly-merase loci are merely regulated structural loci aswere the activator RNA loci.From the above considerations, one comes to the

conclusion that to be a self-contained regulatorysystem, it has to contain a regulatory locus which isitself not subjected to regulation in that system. Itfollows that a regulatory gene product by definitionshould be made constitutively (all the time). Toput it another way, until a constitutively producedregulatory gene product is identified, that regulatorysystem has not revealed itself as a whole. Thereason that neither activator RNA nor sequencespecific RNA polymerase can be considered ashaving a primary regulatory function is that theyhave binding affinity only towards a specific basesequence (operator and promotor). Therefore,while they may have the power to switch on certaingroups of structural genes, in order to do so, theythemselves have to be switched on by some othermeans.

In order to be a master of a regulatory system, aregulatory gene product should have the capacity tomodify its binding affinity to the operator region ofstructural genes it controls. Jacob and Monod(1961) reasoned that this modification occurs be-cause a regulatory gene product also has bindingaffinity to a particular small molecule (inducer). Ifbinding with an inducer reduces the regulator'saffinity towards the operator, that regulator functionsas a repressor. If, on the other hand, the inducer-bound regulator shows stronger affinity than un-bound regulator towards the operator, it must func-tion as an activator. Either way, a regulatorysystem becomes a self-contained unit in that it canassume either a switched on (induced) or switchedoff (noninduced) state depending upon the presenceor absence of an inducer. Thus, by having such aregulatory system, the cell acquired the ability toadjust to changes in the outside environment whichare represented as changing inducer concentrations.Even in such complicated eukaryotes as mam-

mals, the essential components of each self-containedregulatory system have to be (1) an inducer, (2) aregulator, and (3) the operator region of regulatedstructural genes or their messenger RNAs. As aregulator has to have binding affinity to both an

Susumu Ohno258



g.bmj.com

/J M



ber 1972. Dow

nloaded from

http://jmg.bmj.com/


NONINDUCED STATE

i+_-

VAv'0 0 0

INDUCED STATE

it

O ~ ~ ~~~O

\YAf\7VVI A/\/yVAJV \/Y*{/VVo 0 0

1

CDFIG. 1. Three essential components of any self-contained regulatory system. The system is expressed in its simplest form. (1) An inducerwhich is a small molecule such as a steroid hormone. (2) A regulator specified by i gene which has binding affinity to an inducer, on one hand,and to the operator base sequence of structural genes or their messenger RNAs it controls, on the other. (3) Operator (o) base sequence containedin the regulated structural genes or their messenger RNAs.

inducer and the operator, and since binding with aninducer should affect the regulator's affinity to theoperator, a regulatory product has to be a proteinrather than nucleic acid. These components areschematically depicted in Fig. 1. It is granted thatthere can be many modifications of the abovescheme. Nevertheless, any regulatory system miss-ing any of the essential components mentionedabove is not self-contained, and only never endingcircular arguments can sustain its purported exist-ence.

Simplification in MammalianRegulatory Systems

Regulatory systems of prokaryotes utilize sub-strates or derivatives of substrates as inducers. Forexample, an inducer of the lactose-operon system isallolactose, a natural metabolite of lactose, or itsartificial analogue, IPTG (isopropyl thiogalacto-side). Accordingly, organisms pay no cost ofnatural selection for their inducers. Mammalianregulatory systems, on the other hand, utilize pep-tide hormones, steroid hormones, catecholamines,etc, as inducers. Thus, for synthesis of each in-ducer, a number of structural genes had to be setaside, and they constitute a part of the mutationload. This is yet another reason for simplification

of each mammalian regulatory system. In the caseof regulatory systems which utilize multitudes ofpeptide hormones as inducers, the simplicity wasapparently achieved by introducing a commoninternal inducer as an intermediary. It appearsthat target cells of different peptide hormones differfrom each other only by having a specific membrane-bound receptor for a particular peptide hormone.Nonetheless, the binding between a hormone andits receptor results in activating adenyl cyclasewhich cycicizes adenosine monophosphate (AMP)by introducing a 3' linkage, and the resulting cyclicAMP functions as an internal inducer (Robinson,Butcher, and Sutherland, 1968). Although cyclicAMP may or may not be the only internal inducer,the point is that economy was achieved by having aregulatory system which responds to a commoninducer, instead of having separate regulatorysystems for individual peptide hormones.

Steroid hormones, on the other hand, are incor-porated into the cell and even into the nucleus. Itappears that there is a separate regulatory system setup for each steroid hormone. As each system hasto have a regulatory locus, the economy drive canonly affect the operator region. As already men-tioned, each operator region of a structural gene con-tributes to the mutation load. Even in the lac-operon system of E. coli, the fact that one operator

259



g.bmj.com

/J M



ber 1972. Dow

nloaded from

http://jmg.bmj.com/

region is shared by all 3 regulated structural genesrather than each having its own operator suggeststhat, from the very beginning of evolution, naturalselection favoured the reduction in number ofoperator regions to reduce the mutation load of eachregulatory system.

In the case of transcriptionally regulated struc-tural genes, the operator region necessarily occupiesa position adjacent to the promotor region wheretranscription by RNA polymerase is initiated. Inthe case of transcriptional control, positional re-quirement of the operator region disappears.Binding between a repressor and any part ofmessenger RNA may prevent its translation therebyenhancing its rate of degradation. Since a re-pressor molecule is not required to read the RNAbase sequence as a series of triplet codons, messengerRNAs for polypeptide chains of very different func-tion, and, therefore, different amino-acid sequences,may share in common a stretch of base sequencewhich is identical or nearly identical, thus comingunder the control of a single repressor as illustratedin Fig. 2. In this way, the operator region as anindependent entity has effectively been eliminatedfrom the genetic regulatory system. By switchingprimarily to translational regulation, mammals mayindeed have succeeded in reducing the mutationload of each regulatory system.

Testosterone elicits two responses from its targetcells; the induction of specific enzymes and hyper-trophy. While hypertrophic or hyperplastic re-sponse is universal, different sets of enzymes areinduced in different target organs. We studied theregulatory system of the mouse which responds totestosterone in kidney proximal tubule cells where100-fold induction of alcohol dehydrogenase(EC1.1.1.1) and 3-glucuronidase (EC3.2.1.31) iselicited. The actual inducers are intracellularmetabolites of testosterone; 50c-dihydrotestosterone

The same operator base sequence can beshared by functionally divergent messenger

RNA

GUUCGAAUUCCGCAGCCUGC

(1) VAL.ARG*ILE.PRO*GLN*PRO(2) PHE-GLU*PHE.ARG*SER*LEU(3) SER*ASN*SER.ALA.ALA.CYS

FIG. 2. This shows that messenger RNAs which are translated topeptide chains of very different amino-acid sequences can contain ashort stretch (20 bases or so long) of identical base sequence. Sucha stretch can serve as an operator. Thus, messenger RNAs for verydissimilar enzymes such as alcohol dehydrogenase and l-glucuroni-dase can come under the control of a single regulatory protein.

and 5ca-androstane-3ac-17/3-diol. The supernatant(cytosol) fraction of target cells contains a specificreceptor protein to the former, and when the com-plex between a receptor and 5a-dihydrotestosteroneis formed, the complex moves into the nucleus(Bruchovsky and Wilson, 1968; Fang, Anderson,and Liao, 1969). The latter in low concentration,on the other hand, has no binding affinity to areceptor protein in the cytosol fraction (Baulieu et al,1971; Liao et al, 1971). Instead, in the micro-somal fraction where messenger RNAs are, and,therefore, where a translational repressor should be,there exists another class of protein which has equalbinding affinity to both 5a-androstane-diols (3a aswell as 3fl) and 5ca-dihydrotestosterone (Baulieu etal, 1971).We found that, mg for mg, 5ex-androstane-3a-

17,B-diol is a more potent inducer of alcohol de-hydrogenase and ,B-glucuronidase than 5a-dihydro-testosterone (Ohno, Dofuku, and Tettenborn, 1971).This suggests that response of target cells to testo-sterone is mediated by a translational regulator.Indeed, the induction of specific enzymes by steroidhormones in general appears to be due to the re-moval of translational rather than transcriptionalblock (Tomkins et al, 1969).Has the independent operator region really been

eliminated from the alcohol dehydrogenase and/-glucuronidase loci? The mouse genome con-tains only a single structural locus for ,B-glucuroni-dase located on the linkage group XVII chromo-some (Paigen, 1963). This enzyme in other organssuch as liver and spleen is made constitutivelywhile in kidney proximal tubule cells, it is madeinducibly only in the presence of testosterone. Wehave recovered an apparent amino-acid substitutingmutation of this locus which simultaneously gave anOs (operator noninducible) character with regard toits inducibility by testosterone in kidney proximaltubule cells. Constitutive levels of this mutantosGs (operator noninducible slow electrophoreticvariant) enzyme in various nontarget cells remainedthe same as those of the wild-type o+G enzyme(Dofuku, Tettenborn, and Ohno, 1971a and b).Thus, the view that a translatable part of messengerRNA serves as the operator region finds a measureof support.The logical extension of the argument that each

mammalian regulatory system must be simple isthat the developmental fate of an entire organ oreven a series of organs might be placed under thecontrol of a single regulatory locus. Our findingson the X-linked testicular feminization (Tfm) muta-tion of the mouse (Lyon and Hawkes, 1970) indeedindicates that this can be the case (Ohno, Stenius,

Susumu Ohno260



g.bmj.com

/J M



ber 1972. Dow

nloaded from

http://jmg.bmj.com/


and Christian, 1970). In a series of embryologicalexperiments on rabbits and rats, Alfred Jost (1961)has shown that the expression of the male or femalephenotype strictly depends on the presence orabsence of testosterone. This is because the per-sistence and differentiation of embryonic Mullerianducts to Fallopian tubule and uterus of the femaleare a constitutive process which does not require aninducer, while the mesonephric (Wolffian) duct canpersist and differentiate to epididymis and seminalvesicals of the male only in the presence of an in-ducer (testosterone). In the absence of testoster-one, the urogenital sinus too would differentiate to-wards the female direction and form vagina andvulva instead of penis and prostates. Thus, it canbe said that maleness and femaleness represent theinduced state and noninduced state of one and thesame regulatory system. If that were so, an is(regulator noninducible) mutation of this regulatorylocus should give the female phenotype to a mutanteven in the presence of testosterone. Indeed, theX-linked Tfm mutation of the mouse which genetic-ally behaves as a point mutation of a single locussatisfies all the requirements to be an is mutation.Affected XTfmY chromosomal males are equippedwith testes which produce a normal amount oftestosterone at least until the neonatal stage. Yet,derivatives of the mesonephric ducts are com-pletely absent, and their external phenotype isfemale. Neither induction of alcohol dehydrogen-ase and f-glucuronidase nor hypertrophy occurs inXTfmY kidney proximal tubule cells even after theadministration of as much as 20 mg of testosterone,5a-dihydrotestosterone and 5a-androstane-3a-17,7-diol (Ohno and Lyon, 1970; Dofuku et al, 1971a).

Analogous mutations of other regulatory lociwhich control the developmental fate of other organshave not been found in the mouse and other mam-malian species. There is a very simple explanationfor this apparent absence. Such mutations of otherregulatory loci would almost surely cause embryonicdeath, thus they would be classified as embryoniclethals and escape detection as regulatory mutations.A sexual phenotype is a luxury without which anindividual can survive, and this enabled us to studythe Tfm mutation.

Certain Conditions to be Met bya Regulatory Protein

We have already discussed certain characteristicswhich a regulatory gene product has to have. Itshould have binding affinity to an inducer, on onehand, and to the operator base sequence on theother, and binding with an inducer should change

its binding affinity to the operator. Thus, a regula-tor is almost certainly a protein rather than RNA.

In target cells of each steroid hormone a class ofproteins having a high binding affinity to thatsteroid exists. In a strict sense, only one of themhas to be a regulatory protein. Fortunately, thereare a few rigid qualifications which a regulatory geneproduct has to fulfil and defining them will help usto single out a regulatory protein of a given systemfrom a number of candidates. Since what appliesto a repressive regulatory gene product appliesequally well to an activating regulator, we will dis-cuss these qualifications only for the repressor.

First of all, a regulatory gene product by definitionshould be made constitutively in the cell in whichthat regulatory system is operating. A proteinwhich is inducible cannot be the product. Second-ly, a regulatory protein should exist in an exceed-ingly low concentration. Although the operatorregion should show the highest binding affinity toits repressor, DNA and RNA in the cell are boundto contain other base sequences that also show vary-ing degrees of binding affinity towards that repressor.Purified lac-repressor protein of E. coli, for example,shows a considerable binding affinity to poly dATsequence (Lin and Riggs, 1970). Conversely,binding between an inducer and a repressor doesnot completely abolish the affinity between a re-pressor and the operator, it merely reduces theaffinity by a few orders of magnitude (Riggs,Newby, and Bourgeois, 1970). Furthermore, therate of inducible enzyme synthesis varies inverselywith the first power of the repressor concentration(Sadler and Novick, 1965). Thus, the higher theconcentration of a repressor, the more difficult itbecomes to bring about the induced state.

It appears that in order to function as a specificregulator of certain structural genes, a regulatorygene product must exist in the cell in a very lowconcentration. Indeed, it has been estimated thatthe wild-type E. coli contains only 10 molecules oflac-repressor per cell (Muller-Hill, 1971). Oneconcludes that any protein either in the nucleus orthe cytoplasma that exists in rather large quantity(eg, several thousand molecules per cell), is notlikely to be a regulatory protein.

Thirdly, the above relationship between the rateof inducible enzyme synthesis and the repressorconcentration enables us to predict the degree ofbinding affinity (Km) a particular regulatory proteinhas to have towards its inducer. The wild-typelac-repressor protein of E. coli has a Km of1-36 x 10-6 M towards an inducer (IPTG) andat this inducer concentration no induction occursin permeaseless mutant E. coli. Half-maximal

261



g.bmj.com

/J M



ber 1972. Dow

nloaded from

http://jmg.bmj.com/

Susumu Ohno

induction of three enzymes in the lac-operon occursat 2 x 10 - 4M IPTG, and the maximal induction re-quires an inducer concentration greater than 10 -3 M(Gilbert and Muller-Hill, 1966).

In mammals, 93 to 96% of the circulating testo-sterone in blood plasma is protein-bound, and,therefore, may not contribute to the inducer con-centration. The free testosterone concentration ofnormal man is about 3 6 x 10 10 M and that ofnormal woman about 1-7 x 10- 1 M (Hudson et al,1970). The same relationship holds true for themouse, although the respective concentrations areslightly above one third of those of man. Bothmarker enzymes in normal female kidney proximaltubule cells are in a noninduced state, while they arein 30% induced state in the normal male and themaximal induction requires a single injection to anadult mouse of either 1 mg of 5a-androstanediol or3 mg of 5a-dihydrotestosterone which would boostthe inducer concentration above 10-8 M (Ohno etal, 1971; Dofuku et al, 1971a). There is a remark-able parallel between the lac-operon system of per-measeless E. coli and a regulatory system controlledby the X-linked Tfm locus of the mouse in thisrespect. This comparison is fair because kidneyproximal tubule cells do not appear to be equippedwith a specific permease for testosterone (Bullock,Bardin, and Ohno, 1971). It follows that a regula-tory protein specified by the Tfm locus should havea Km towards an inducer in the range of 10-11 M.The point which I wish to make is that once a

pertinent mutation or mutations are recovered, theidentification of a regulatory gene product need notbe a difficult task. A mutational reduction by afew orders of magnitude of the binding affinity to-wards an inducer, for example, a change from thewild-type Km of 10-11 M to a mutant Km of10-9 M, suffices as the molecular basis of the is(regulator noninducible) mutation.

Regulatory Systems and Evolutionby Gene Duplication

There is little doubt that evolutional increase inthe number of regulatory systems was also accom-plished by a successive series of gene duplications.There is at least one regulatory gene for each of themultitudes of steroid hormones the body produces.These regulatory genes must have shared a commonancestry sometime in the past, since the amino-acidsequence required for the specific binding withtestosterone is bound to be more similar thandifferent from that required for high affinity bindingwith, say, progesterone.

In the case of structural genes, too, a true func-

tional diversification between a newly created geneand its immediately ancestral gene is accomplishedwhen the two are placed under the control of differ-ent regulatory genes. This requires a new struc-tural gene which is created by gene duplication toacquire an operator base sequence different fromthat possessed by its predecessor.The observation that the fate of a series of organs

derived from mesonephric (Wolffian) ducts is placedunder the control of a single X-linked Tfm locussuggests to us that drastic evolutional changes ofdigits and other body parts may have been accom-plished by a few changes in regulatory components.As we learn more about genetic regulatory systemsof mammals and other higher organisms, we willbegin to understand the true molecular basis ofevolution as well as ontogeny.

REFERENCESAronson, A. I. (1972). Degradation products and a unique endo-

nuclease in heterogeneous nuclear RNA in sea urchin embryos.Nature New Biology, 235, 40-44.

Baulieu, E. E., Jung, I., Blondeau, J. P., and Robel, P. (1971).Androgen receptors in rat ventral prostate. In Advances in theBiosciences, ed. by G. Raspe, vol. 6. Pergamon Press, Oxford.

Bekhor, I., Bonner, J., and Dahmus, G. K. (1969). Hybridizationof chromosomal RNA to native DNA. Proceedings of the NationalAcademy of Sciences of the United States of America, 62, 271-277.

Blatti, S. P., Ingles, C. J., Lindell, T. J., Morris, P. W., Weaver,R. F., Weinberg, F., and Rutter, W. J. (1970). Structure andregulatory properties of eucaryotic RNA polymerase. ColdSpring Harbor Symposium on Quantitative Biology, 35, 649-657.

Blomback, B., Blomback, M., and Grondahl, N. J. (1965). Studieson fibrinopeptides from animals. Acta Chemica Scandinavica, 19,1789-1791.

Britten, R. J. and Davidson, E. H. (1969). Gene regulation forhigher cells: A theory. Science, 165, 349-357.

Bruchovsky, N. and Wilson, J. D. (1968). The intranuclear bindingof testosterone and 5a-androstan-17$-ol-3-one by rat prostate.journal of Biological Chemistry, 243, 5953-5960.

Bullock, L. P., Bardin, C. W., and Ohno, S. (1971). The androgeninsensitive mouse: Absence of intranuclear androgen retention inthe kidney. Biochemical and Biophysical Research Communica-tions, 44, 1537-1543.

Crow, F. and Kimura, M. (1970). An Introduction to PopulationGenetics Theory. Harper and Row, New York.

Dayhoff, M. 0. (ed.) (1969). Atlas of Protein Sequence and Struc-ture, vol. 4. National Biomedical Research Foundation, SilverSprings, Maryland.

DeLange, R. J. and Smith, E. L. (1971). Histones: Structure andfunction. Annual Review of Biochemistry, 40, 279-314.

Dofuku, R., Tettenborm, U., and Ohno, S. (1971a). Testosterone-regulon in the mouse kidney. Nature New Biology, 232, 5-7.

Dofuku, R., Tettenborn, U., and Ohno, S. (1971b). Furthercharacterization of the os (operator noninducible) mutation of themouse 1-glucuronidase locus. Nature New Biology, 234,259-261.

Fang, S., Anderson, K. M., and Liao, S. (1969). Receptor proteinsfor androgens. On the role of specific proteins in selective reten-tion of 176-hydroxy-5a-androstan-3-one by rat ventral prostatein vivo and in vitro. Journal of Biological Chemistry, 244, 6584-6596.

Flatz, G., Kinderlerer, J. L., Kilmartin, J. V., and Helmann, H.(1971). Haemoglobin Tak: A variant with additional residues atthe end of the $-chains. Lancet, 1, 732-733.

Gilbert, W. and Muller-Hill, B. (1966). Isolation of the lac re-pressor. Proceedings of the National Academy of Sciences of theUnited States of America, 56, 1891-1898.

Haldane, J. B. S. (1957). The cost of natural selection. J3ournal ofGenetics, 55, 511-524.

262



g.bmj.com

/J M



ber 1972. Dow

nloaded from

http://jmg.bmj.com/


Harris, H. (1970). Nucleus and Cytoplasm, 2nd ed. ClarendonPress, Oxford.

Harris, H. and Watts, J. W. (1962). The relationship betweennuclear and cytoplasmic ribonucleic acid. Proceedings of the RoyalSociety. Series B, 156, 109-121.

Hudson, B., Burger, H. G., de Kretser, D. M., Coghlan, J. P., andTaft, H. P. (1970). Testosterone plasma levels in normal andpathological conditions. In The Human Testis, pp. 423-437, ed.by E. Rosemberg and C. A. Paulsen. Plenum Press, New York.

Ingram, V. M. (1963). The Hemoglobin in Genetics and Evolution.Columbia University Press, New York.

Jacob, F. and Monod, J. (1961). Genetic regulatory mechanism inthe synthesis of proteins. Journal of Molecular Biology, 3, 318-356.

Jacob, F. and Monod, J. (1963). Genetic repression, allostericinhibition, and cellular differentiation. In Cytodifferentiation andMacromolecular Synthesis, ed. by M. Locke. Academic Press,London.

Jones, K. W. (1970). Chromosomal and nuclear location of mousesatellite DNA in individual cells. Nature, 225, 912-919.

Jost, A. (1961). The role of fetal hormones in prenatal development.The Harvey Lectures, Series 55. Academic Press, New York.

Kacian, D. L., Spiegelman, S., Bank, A., Terada, M., Metafora, S.,Dow, L., and Marks, P. A. (1972). In vitro synthesis of DNAcomponents of human genes for globins. Nature New Biology,235, 167-169.

Kimura, M. (1968). Evolutionary rate at the molecular level.Nature, 217, 624-626.

Kimura, M. and Ohta, T. (1971). Protein polymorphism as a phaseof molecular evolution. Nature, 229, 467-469.

Lee, K.-L. and Kenney, F. T. (1971). Assessment of hormoneaction in cultured cells. In Karolinska Symposium on ResearchMethods in Reproductive Endocrinology, 3rd Symposium, ed. by E.Diczfalusy. Bogtrykkeriet Forum, Copenhagen.

Liao, S., Leininger, K. R., Sagher, D., and Barton, R. W. (1965).Rapid effect of testosterone on ribonucleic acid polymerase activityof rat ventral prostate. Endocrinology, 77, 763-765.

Liao, S., Tymoczko, J. L., Liang, T., Anderson, K. M., and Fang, S.(1971). Androgen receptors: 170-hydroxy-5a-androstan-3-oneand the translocation of a cytoplasmic protein to cell nuclei inprostate. In Advances in the Biosciences, ed. by G. Raspe, vol. 6.Pergamon Press, Oxford.

Lin, S. and Riggs, A. D. (1970). Lac repressor binding to DNA notcontaining the lac operator and to synthetic poly dAT. Nature,228, 1184-1186.

Lyon, M. F. and Hawkes, S. G. (1970). An X-linked gene fortesticular feminization in the mouse. Nature, 227, 1217-1219.

Milner, P. F., Clegg, J. B., and Weatherall, D. J. (1971). Haemo-globin-H disease due to a unique haemoglobin variant with an

elongated a-chain. Lancet, 1, 729-732.

Muller, H. J. (1967). The gene material as the initiator and theorganizing basis of life. In Heritage from Mendel, ed. by R. A.Brink. University of Wisconsin Press, Madison.

Muller-Hill, B. (1971). Lac repressor. Angewandte Chemie (inter-national edition), 10, 160-172.

Ohno, S. (1970). Evolution by Gene Duplication. Springer-Verlag, Heidelberg.

Ohno, S. (1971). An argument for the simplicity of mammalianregulatory systems: Single gene determination of male and femalephenotypes. Nature, 234, 134-137.

Ohno, S., Dofuku, R., and Tettenborn, U. (1971). More about X-linked testicular feminization of the mouse as a noninducible (iS)mutation of a regulatory locus: 5a-androstan-3a-179-diol as thetrue inducer of kidney alcohol dehydrogenase and /1-glucuronidase.Clinical Genetics, 2, 1-13.

Ohno, S. and Lyon, M. F. (1970). X-linked testicular feminizationin the mouse as a noninducible regulatory mutation of the Jacob-Monod type. Clinical Genetics, 1, 121-127.

Ohno, S., Stenius, C., and Christian, L. (1970). Sex difference inalcohol metabolism: Androgenic steroid as an inducer of kidneyalcohol dehydrogenase. Clinical Genetics, 1, 35-44.

Paigen, K. (1964). The genetic control of enzyme realization duringdifferentiation. In Congenital Malformations, Second Inter-national Conference, 1963. The Intermational Medical Congress,Ltd, New York.

Riggs, A. D., Newby, R. F., and Bourgeois, S. (1970). Lac repres-sor-operator interaction. II. Effect of galactosides and otherligands. Journal of Molecular Biology, 51, 303-314.

Robinson, G. A., Butcher, R. W., and Sutherland. E. W. (1968).Cyclic AMP. Annual Review of Biochemistry, 37, 149-174.

Roeder, R. G. and Rutter, W. J. (1969). Multiple forms of DNA-dependent RNA polymerase in eukaryotic organisms. Nature224, 234-237.

Sadler, J. R. and Novick, A. (1965). The properties of repressorand the kinetics of its action. Journal of Molecular Biology, 12,305-327.

Smith, T. F. and Sadler, J. R. (1971). The nature of lactoseoperator constitutive mutations. J7ournal of Molecular Biology, 59,273-305.

Southern, E. M. (1970). Base sequence and evolution of guinea-pig a-satellite DNA. Nature, 227, 794-798.

Tomkins, G. M., Gelehrter, T. D., Granner, D., Martin, D.,Samuels, H. H., and Thompson, E. B. (1969). Control ofspecific gene expression in higher organisms. Science, 166, 1474-1480.

Verma, I. M., Temple, G. F., Fan, G., and Baltimore, D. (1972).In vitro synthesis of DNA complementary to rabbit reticulocyte10S RNA. Nature New Biology, 235, 163-167.

Walker, P. M. B. (1968). How different are the DNA's from relatedanimals? Nature, 219, 228-232.

263



g.bmj.com

/J M



ber 1972. Dow

nloaded from

http://jmg.bmj.com/

Review Article - jmg.bmj.com

Documents

Transcript of Review Article - jmg.bmj.com