Resolvin D2 supports MCF-7 cell proliferation via...

JPET #214403

1

Title Page

Resolvin D2 supports MCF-7 cell proliferation via activation of

estrogen receptor

Nuha Al-Zaubai, Cameron N Johnstone, May May Leong, John Li, Mark

Rizzacasa and Alastair G Stewart

Department of Pharmacology and Therapeutics, University of Melbourne, Vic., Australia: NA

and AGS

Peter MacCallum Cancer Centre, Vic., Australia: CJ

School of Chemistry, the Bio21 Institute, University of Melbourne, Vic., Australia: ML, JL and

MR

Sir Peter MacCallum Department of Oncology, University of Melbourne, Vic., Australia: CJ

Department of Pathology, University of Melbourne, Vic., Australia: CJ

This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on July 30, 2014 as DOI: 10.1124/jpet.114.214403

at ASPE

T Journals on M

ay 26, 2018jpet.aspetjournals.org

Dow

nloaded from

http://jpet.aspetjournals.org/

JPET #214403

2

Running Title Page

RvD2 and estrogen receptor positive breast tumours

Corresponding author

Alastair G. Stewart, Department of Pharmacology and Therapeutics, University of

Melbourne, Grattan St., Parkville, Vic. 3010, Australia.

E-mail: [email protected]

Phone number: 61-431 270 122

Fax number: 613 8344 0241

Number of text pages: 32

Number of tables: 1

Number of figures: 7

Number of references: 44

Number of words in abstract: 250

Number of words in introduction: 470

Number of words in discussion: 1495

Abbreviations

RvD2, resolvin D2; ER, Estrogen receptor; E2, 17β-estradiol; ERE, estrogen

response element


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

3

Abstract

Inflammation has been implicated in tumour initiation, angiogenesis and metastasis

and linked to the development of more aggressive, therapy-resistant estrogen

receptor positive breast cancer. Resolvin D2 (RvD2) is a potent anti-inflammatory

lipid mediator. As RvD2 may be synthesized within breast tumours by both tumour

cells and the surrounding stroma cells and is present in plasma at bioactive

concentrations, we sought to characterize the impact of RvD2 on cell processes

underlying breast tumour growth and spread. Trypan-blue exclusion, transfection

with estrogen response element (ERE) reporter, qRT-PCR, competitive radioligand

binding assays, western blotting and immunofluorescence were the techniques used.

Unexpectedly, whilst RvD2 (10-1000 nM) supported the proliferation of the ER-

positive breast tumour, MCF-7, cells, it did not affect the ER-negative, MDA-MB-231

cell number. The proliferative effect of RvD2 in MCF-7 cells was attenuated by the

estrogen receptor antagonist 7α-[9-[(4,4,5,5,5-pentafluoropentyl)sulfinyl]nonyl]estra-

1,3,5(10)-triene-3,17β-diol (ICI 182,780). Furthermore, RvD2 increased ERE

transcriptional activity in a number of ER positive breast and ovarian tumour cell

lines. This activation was also inhibited by ICI 182,780. RvD2 altered the expression

of a subset of estrogen-responsive genes. Although binding experiments showed

that RvD2 did not directly compete with 3[H]-17 β-estradiol (E2) for ER binding, prior

exposure of MCF-7 cells to RvD2 resulted in a significant reduction in the apparent

cytosolic ER density. Confocal immunocytochemistry and western blotting studies

showed that RvD2 promoted nuclear localization of ERα. These observations

indicate that RvD2 displays significant but indirect estrogenic properties and has the

potential to play a role in estrogen-dependent breast cancer progression.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

4

Introduction

Despite the substantial advances in treatment options and the overall better survival

rate in recent years, breast cancer remains the most common cancer in women

(Jacobs and Finlayson, 2011). In addition to genomic instability and other factors

specific to cancer cells, inflammation is now considered to be a hallmark of cancer

and can play a role in virtually all aspects of tumour biology, including initiation,

promotion, angiogenesis, and metastasis (Hanahan and Weinberg, 2011). Chronic

inflammation that precedes tumour development, tumour-associated inflammation

and therapy-induced inflammation are the main types of inflammation involved in

tumorigenesis and cancer development (Jiang and Shapiro, 2013). Some risk factors

for breast cancer such as menopause, increased age and obesity are associated

with systemic inflammation, as indicated by high levels of circulating inflammatory

cytokines (Bruunsgaard et al., 2001; Pfeilschifter et al., 2002; Ouchi et al., 2011). An

inflammatory tumour microenvironment consists of infiltrating immune cells and

activated fibroblasts, both of which can secrete cytokines, chemokines, and growth

factors, as well as DNA-damaging free radicals and oxidants. Tumours themselves

are able to both generate and respond to inflammatory microenvironments

(Baumgarten and Frasor, 2012).

Resolution of inflammation, previously believed to take place passively, is now

considered an actively programmed process distinct from anti-inflammatory

processes, enabling the host tissue to return to homeostasis (Serhan et al., 2007).

‘Specialised pro-resolving lipid mediators’ (SPM) including lipoxins, resolvins E and

D series, protectins and maresins are new families of endogenously synthesized

chemical autacoids identified by Serhan and collaborators, which have been

characterized for their anti-inflammatory and pro-resolution properties (Serhan,


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

5

2007). In inflamed sites, neutrophils can interact with neighbouring cells, such as

other leukocytes, platelets, endothelial cells, mucosal epithelial cells and fibroblasts,

in their immediate vicinity and acquire the ability to produce SPM (Serhan et al.,

2008). Resolvin D2 (RvD2) is a member of this family, biosynthesized from the poly-

unsaturated fatty acid, docosahexaenoic acid, by the sequential actions of 15- and 5-

lipoxygenases (Serhan and Petasis, 2011). Biologically active concentrations of

RvD2 can be readily measured in human blood following n-3 fatty acid

supplementation (Mas et al., 2012). We have previously demonstrated that a

member of this family, lipoxin A4, stimulates the proliferation of ERα-positive MCF-7

and ERα-negative MDA-MB-231 breast cancer cell lines via FPR2 signalling (Khau

et al., 2011). Therefore, we hypothesized that the persistence of inflammation is

accompanied by persistent production of SPM which may stimulate breast cancer

growth. Given that both lipoxin A4 and RvD2 share a significant structural homology

(trihydroxytetraenes), which is a feature of all eicosanoids of this class (Serhan et

al., 2008), and that the enzymes involved in RvD2 synthesis are expressed in

normal and tumour mammary tissues (Jiang et al., 2006a; Jiang et al., 2006b), we

sought to gain further insights into the impact of the SPM, RvD2, on breast tumour

cell functions related to growth and dissemination.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

6

Methods

Cell culture and treatment preparations

The MDA-MB-231 cell line was grown in phenol red-free RPMI 1640 (Invitrogen,

Carlsbad, CA, USA) containing 10% (v/v) heat-inactivated FCS (Sigma-Aldrich,

Castle Hill, NSW, Australia), 2 mM l-glutamine (Sigma Chemical, St. Louis, MO,

USA), 1 mM nonessential amino acids (Sigma), 1 mM sodium pyruvate (Sigma),

100U/ml penicillin G, 100 μg/ml streptomycin (CSL Biosciences, Parkville, VIC,

Australia), 15 mM HEPES, and 0.2% (v/v) sodium bicarbonate. MCF-7, T47D,

BT474 and SKOV3 cells were cultured in phenol red-free DMEM (Invitrogen)

supplemented identically to RPMI described above. Cells were passaged every three

to four days at a density of 3 x 106 cells per 75cm2 flask and maintained at 37oC in

5% CO2. For experiments, cells were seeded at 50, 000 cells/well in 24 well plates

and incubated in serum-free DMEM medium containing, in addition to 0.25% (w/v)

BSA, all the above-mentioned supplements for 24 h prior to incubation with different

treatments of interest as specified below.

All compounds were dissolved in 100% dimethyl sulfoxide (DMSO) to a stock

concentration of 10mM and stored at -20oC and diluted in fresh medium just before

use. To ensure stability, RvD2 stock was stored at -80oC and each aliquot was

thawed and discarded immediately after use. Vehicle solutions were used for the

respective control treatment. The concentration of each treatment, including 17β-

estradiol (E2) and RvD2, was chosen based on preliminary studies and previous

publications (Hughes et al., 2002; Miyahara et al., 2013).

Cell enumeration

Viable MCF-7 and MDA-MB-231 cells were identified by trypan blue (BDH/Merck,

Kilsyth, VIC, Australia) exclusion and enumerated (by an operator blinded to


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

7

treatment) with the aid of a hemocytometer 24-72 h after treatment with 5% FCS

(v/v) or different concentrations of RvD2, obtained by total chemical synthesis (Li,

2013). In separate experiments, MCF-7 cells were treated with the estrogen receptor

antagonist, ICI 182,780 (100nM) (Sigma-Aldrich, Castle Hill, NSW, Australia) for 30

min prior to E2 (10nM) or RvD2 (100nM) incubation to evaluate the potential

involvement of estrogen receptor. In order to investigate whether the proliferative

effect of RvD2 involves activation of the signalling pathways that are known to

mediate cell proliferation /or survival, MCF-7 cells were incubated with inhibitors of

ERK1/2 (PD98059 and UO126) (Tocris, Bristol, UK), PI3K (LY294002)

(Calbiochem/Merck, Kilsyth, VIC, Australia), or p38MAPK, (SB202190 and SB203850)

(Calbiochem/Merck, Kilsyth, VIC, Australia) pathways 30 min prior to RvD2

treatment.

ERE-SEAP luciferase reporter construct transfection

MCF-7, T47D, BT474, SKOV3 cells were seeded in a penicillin / streptomycin free

medium for 24 h. The ERE-secreted human placental alkaline phosphatase (SEAP)

reporter construct (BD Biosciences Clontech, Palo Alto, CA) (300ng/well) was

incubated with pGL3 Luciferase control vector (Promega Corp., Madison, WI) (50

ng/well, to account for transfection efficiencies) and 1.0 μl Lipofectamine 2000

reagent (invitrogen) in a volume of 100 μl/well of OptiMEM for 30 min at room

temperature. Cells were then transfected for 6 h, washed once with sterile PBS and

incubated with 1 ml of serum-free DMEM. Next day, the cells were treated with RvD2

(10-1000 nM) or estradiol (1nM) for 48 hours. Supernantants were collected at the

end of each experiment and assessed for SEAP content using a chemiluminescence

kit (Roche Applied Science, NSW, Australia). At the conclusion of each experiment,

cells were lysed in 25mM Tris-phosphate PH 7.8, lysis buffer containing 10%


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

8

glycerol, 1% Triton X-100, 1mg/ml BSA, 2mM EDTA, 2mM DTT. To assess

luciferase activity, 50 μl of each cell lysate was transferred to a black and white 96-

well plate and 25 μl of luciferin substrate (Promega) and reagent buffer (20 mM Tris-

base PH 7.8, 33.3 mM DTT, 8 mM MgCl2, and 0.13 mM EDTA) was added.

Chemiluminescence for both secreted alkaline phosphatase and luciferase assays

was measured by Topcount (Perkin Elmer, Glen Waverley, VIC, Australia).

RT-qPCR

To quantify gene expression, cells were treated for 4-24 h with 0.1 nM E2 or 0.1-1

μM RvD2 in the presence and absence of 100 nM ICI 182,780 or 10 μM LY 294002.

Total RNA was extracted using trizol reagent according to the manufacturer’s

instructions, reverse transcribed into cDNA, using random primers for subsequent

analysis by real-time PCR using the following thermal protocol: 37°C (60 min), 95°C

(5 min) and 4°C (5min). Transcript levels of genes of interest were assayed by real-

time PCR with pre-developed assays (Applied Biosystems) and Platinum SYBR

Green qPCR Supermix-UDG (Invitrogen, Mulgrave, VIC, Australia) using the ABI

Prism 7900 HT sequence detection system (Applied Biosystems). Cycle number to

reach threshold (Ct) values for each reaction were determined using SDS 2.0

software (Applied Biosystems). All Ct values were normalized to the 18S rRNA Ct

value as an internal control. Primer sequences used in this study are included in

table 1. They were obtained either from published references as annotated, or

designed using Primer Express software (Applied Biosystems) with mRNA

sequences from the National Centre for Biotechnology Information

(http://www.ncbi.nlm.nih.gov).

Radioligand binding assays using 3[H]E2


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

9

Intact cells were treated with unlabeled E2 or RvD2 for 30 min prior to incubating

them with 0.1 nM [2,4,6,7-3H]E2 (89.2 Ci/mmol; PerkinElmer) for 1 h at 37°C in

humidified air with 5% CO2. To determine nonspecific binding, 100-fold excess of

unlabeled E2 was added. Ethanol was used as a negative control. Cells were then

washed 3 times with ice-cold PBS to eliminate free and bound label; cellular 3[H]E2

was then extracted with 500 μl 80% EtOH for 30 min at room temperature. The

supernatant was mixed with 4 ml Optiphase Hisafe 2 scintillation fluid (PerkinElmer)

and the tritium was counted. Cytosol from MCF-7 cells was prepared and binding

assays were performed as previously described (Hughes et al., 2002). In brief,

MCF-7 cytosol was incubated with 0.2 nmol/L 3[H]E2 in a 10 mmol/L Tris buffer (pH

7.4; 1.5 mmol/L EDTA, 10% w/v glycerol) in the presence and absence of 1 uM ICI

182,780 to define nonspecific binding. Increasing concentrations of either E2 or

RvD2 were added to cytosol containing 0.2 nmol/L 3[H]E2 to determine IC50 values

for displacement of 3[H]E2 .

Immunofluorescence

Cells were seeded at 25,000 cells per chamber in an eight-chamber cell culture slide

(Nunc, Roskilde, The Netherlands), allowed to attach for 24 h, starved in DMEM

containing 0.25% BSA for a further 24 h and then treated with 10nM E2 or 1 μM

RvD2 for 30 min. Cells were fixed in 10% v/v neutral buffered formalin for 10 min,

washed in PBS and incubated with the primary antibody against ERα (ER rabbit

polyclonal #sc-20: Santa Cruz Biotechnology) overnight at 4°C. Slides were washed

twice with PBS and incubated with FITC-conjugated secondary antibody for 1 h at

room temperature, prior to nuclear staining using 4′-6-diamidino-2-phenylindole

(DAPI) (Santa Cruz Biotechnology) and coverslipping using fluorescence anti-fade

mounting medium (DAKO, VIC, Australia). Fluorescence microscopy (Zeiss Meta,


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

10

North Ryde, Australia) was used to confirm co-localization of DAPI and ERα

immunoreactivity.

Subcellular fractionation

Cells were lysed in lysis buffer (250 mM sucrose, 20 mM HEPES, 10 mM KCl, 1.5

mM MgCl2, 1 mM EDTA and 1 mM EGTA) containing protease inhibitor cocktail and

1 mM dithiothreitol (DTT). To obtain the nuclear pellet, the lysates were passed 10

times through a 25 gauge needle and then centrifuged at 720 g for 5 min. The

nuclear pellet was then washed with lysis buffer, passed 10 times through a 25

gauge needle and centrifuged again at 720 g for 10 min. The nuclear pellet was then

suspended in lysis buffer containing 10% (v/v) glycerol and 0.1% (w/v) sodium

dodecyl sulphate and sonicated for 3 s. The supernatants (cytosolic fraction) from

the first centrifugation were re-centrifuged at 10,000 g for 10 min and the resulting

supernatants were transferred into fresh tubes and centrifuged again at 100,000 g

for 1 h to pellet cell membranes.

Western blot analysis

MCF-7 cells were seeded in 6-well plates at 200,000 cells/well for 24 hours and

incubated with serum-free media. After 24 hours of serum deprivation, cells were

treated with 10nM E2 or 1μM RvD2 for 30 min. Cells were then washed twice in ice-

cold PBS and lysed on ice for 20 min in lysis buffer containing NaCl (100 mM), Tris-

HCl (10 mM) pH 7.5, EDTA (2 mM), deoxycholate (0.5% w/v) with phosphatase

inhibitor cocktail (1 % v/v) (#P5726 Sigma-Aldrich, Castle Hill, Australia), protease

inhibitor (1 % v/v) (#P1860 Sigma-Aldrich) and MgCl2 (1 mM) added immediately to

the buffer before use. Cells were removed from the plastic dish by scraping,

transferred to microfuge tubes, and centrifuged at 10,000 rpm for 10 min at 10°C,

after which supernatants were collected and protein content was determined by


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

11

Bradford protein assay (Biorad). Proteins were resolved electrophoretically on 12%

sodium dodecylsulfate (SDS)-polyacrylamide gels, and transferred onto

nitrocellulose membranes (Amersham/GE Health Care, Rydalmere, NSW, Australia)

for Western blotting. Membranes were blocked in 5% (w/v) skim milk for 1 h at room

temperature, and then incubated overnight with anti ERα rabbit polyclonal antibody

(#sc-20: Santa Cruz Biotechnology) at 4°C. β-actin (mouse monoclonal: Abcam,

Cambridge,UK) and Lamin A/C (goat polyclonal #-sc-5216: Santa Cruz

Biotechnology) were used as housekeeping controls for protein loading.

Immunoblotted membranes were incubated with IRDye infrared-conjugated

secondary antibody (LI-COR Biosceince). Proteins of interest were detected by LI-

COR imaging system. Densitometry was performed using Image J software (NIH

1.45s) to quantify the level of these proteins (http://rsbweb.nih.gov/ij/).

Statistical analyses

Data are presented as the mean + SEM for n independent experiments. Each

experiment was repeated on a minimum of three separate occasions. All data were

statistically analysed using GraphPad Prism 5.0 (Graphpad, San Diego, CA, USA).

One or two-way ANOVA with repeated measures were used to analyse the data, in

most cases, followed by Bonferroni’s post hoc tests to compare treatment groups. A

P-value of <0.05 was considered to be statistically significant.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

12

Results

RvD2 promotes MCF-7 but not MDA-MB-231 cell proliferation

RvD2 (1-100nM) increased MCF-7 cell number after 48 h. However, it had no

detectable effect on MDA-MB-231 cell number (Fig. 1A, B, C). Further investigations

indicated that the increased cell number was more likely due to proliferation, as

neither viability nor rates of apoptosis were affected by RvD2 treatment, as

measured by flow cytometry (data not shown). Since MCF-7 cells are responsive to

estrogen and are a well-established in vitro model for ERα-positive breast cancer

and MDA-MB-231 an in vitro model for triple-negative (ERα, PR, HER2-negative)

breast cancer, this unexpected result triggered our investigation into the role of ER

activation in the apparent proliferative effect of RvD2. Therefore, we co-treated

MCF-7 cells with the estrogen receptor antagonist ICI 182,780. ICI 182,780

significantly inhibited E2- and RvD2-induced proliferation (Fig. 1D). This observation

prompted us to further characterize the estrogenicity of RvD2-induced increases in

cell number.

RvD2 proliferative effect is prevented by the PI3K/Akt inhibitor,

LY294002

RvD2 induced mitogenesis was inhibited by the PI3K/Akt inhibitor, LY294002, but

not by the ERK1/2 inhibitors, (PD98059, UO126) or p38MAPK inhibitors, (SB202190,

SB203850) (Fig. 2).

RvD2 enhances ERE transcriptional activity in a panel of ERα

positive cancer cell lines

Hormone-activated ER mediates the transcriptional activation of target genes by

binding to the specific DNA sequence, estrogen response element (ERE), within


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

13

their promoters (Hall et al., 2001). RvD2 increased ERE transcriptional activity in a

concentration-dependent manner in a number of ERα positive breast tumour cell

lines (MCF-7, T47D, BT474) and an ERα positive ovarian tumour cell line (SKOV3).

Prior exposure to ICI 182,780 prevented this stimulation (Fig 3).

RvD2 modulates expression of estrogen responsive genes

Having demonstrated that RvD2 increases ERE-SEAP activity, we then ascertained

whether it modulates the transcription of estrogen-responsive genes. Growth

regulated by estrogen in breast cancer 1 (GREB1) and progesterone receptor (PGR)

are considered markers of estrogen responsiveness (Rae et al., 2005; Bonéy-

Montoya et al., 2010). RvD2 significantly increased GREB1 and PGR mRNA levels

in MCF-7 cells (Fig.4A, B). Furthermore, RvD2 upregulated cyclin D1 (CCND1)

mRNA expression, one of the genes that estrogen induces in breast tumour cells to

mediate its mitogenic effect (Fig.4C) (Peurala et al., 2013). The PI3K/Akt inhibitor,

LY294002, attenuated both E2 and RvD2 induced CCND1 upregulation (Fig.4D). On

the other hand, RvD2 significantly reduced the expression of TGFβRII and TGFβ3

genes which are associated with the suppression of breast cancer cell proliferation

and known to be downregulated by estrogen (Fig.4E, F) (Arrick et al., 1990; Frasor

et al., 2003). These effects were all blocked by the administration of ICI 182,780.

RvD2 does not compete with E2 for ER binding

Based on these observations, we performed competitive radioligand binding assays

to assess the capacity of RvD2 to directly bind to the E2 binding site on ER. In both

intact MCF-7 cells and cytosol, RvD2 did not displace the binding of 3[H]E2 (Fig.4

A,B). However, treating MCF-7 cells with RvD2 for 30 min prior to cytosolic

extraction resulted in a significant reduction in 3[H]E2 binding sites(Fig. 5 C,D).


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

14

RvD2 induces ERα nuclear localization

We showed that prior exposure of MCF-7 cells to RvD2 resulted in marked reduction

in 3[H]E2 binding sites in the cytosol. One explanation of this observation is that

cytosolic ER has translocated to the nucleus. Moreover, steroid hormone receptors,

including ERα form stable complexes with the chromatin matrix in the nucleus upon

hormone stimulation (Leclercq et al., 2006). Therefore, we next investigated the

mechanism of ERE activation in MCF-7 cells by establishing the levels and

subcellular location of ERα in cells treated with RvD2 or E2 for 30 min. Total ERα

protein level was not affected by RvD2 or E2 incubation in these cells (Fig. 6 B).

However, examination of ERα by immunofluorescence revealed that both E2 and

RvD2 increased the nuclear levels of ERα (Fig. 6 A). To further describe the impact

of RvD2 on ERα nuclear localization, an immunoblot of nuclear and cytosolic

extracts of cells incubated with E2 or RvD2 was undertaken. Immunoreactive-ERα

levels increased in the nucleus following treatment with either E2 or RvD2 (Fig. 6 C,

D, E).


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

15

Discussion

We sought to characterize the impact of RvD2 on breast tumour cell growth. Our

findings suggest that RvD2 is estrogenic and supports ERα positive cancer cell

growth via ER signalling at concentrations that overlap with the physiological

concentrations of RvD2 in human circulation (Mas et al., 2012). RvD2-induced

increases in MCF-7 cell number were shown to be more likely due to proliferation, as

neither viability nor rates of apoptosis were affected by RvD2 treatment. We have

also shown that the proliferative action of RvD2 was prevented by the estrogen

receptor antagonist, ICI 182,780. Furthermore, RvD2 concentration-dependently

increased ERE-SEAP transcriptional activity in ER positive breast tumour cell lines

(MCF-7, T47D, BT474) and in an ovarian tumour cell line (SKOV3). The

enhancement of ERE transactivation was shown to have pathophysiological

relevance, as it was paralleled by upregulation of GREB1 and PGR mRNA levels,

well-characterized ERE containing estrogen-inducible genes (Deschênes et al.,

2007; Gohno et al., 2012). The specificity of this phenomenon was confirmed by the

observation that the RvD2 precursor docosahexaenoic acid (DHA) did not have any

impact on MDA-MB-231 and MCF-7 cell proliferation or ERE transactivation (data

not shown).

RvD2 increased cyclin D1 gene expression, a key player in initiation of cell cycle

progression, and a gene known to be induced by estrogens. In addition, cyclin D1

has recently been shown to be required for estrogen-dependent expression of a

subset of genes involved in growth factor and cytokine signalling in vivo by

facilitating the formation of ERα-coactivator complexes (Casimiro et al., 2013). Of

note, cyclin D1 is overexpressed in approximately 30-50% of cancers and is


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

16

considered the most frequently overexpressed gene in breast cancer. Its

amplification is associated with poor prognosis (Casimiro et al., 2014).

Data obtained from the proliferation experiments suggest that RvD2 produces its

proliferative effect through PI3K/Akt signalling, since its effects were abrogated by

the PI3K/Akt inhibitor (LY294002). Moreover, we have demonstrated that both E2-

and RvD2-induced upregulation of cyclin D1 were also inhibited by LY294002. It is

well established that cell survival and cell proliferation are mediated predominantly

through the phosphatidylinositol-3-kinase (PI3K)/Akt and the Erk1/2 MAPK

pathways. These kinases are often found to be highly deregulated in cancer and

their activation will ultimately result in upregulation of cyclin D1 expression

(Castaneda et al., 2010; Vadlakonda et al., 2013). Moreover, they are also important

for ER activity in some tumours, because they phosphorylate and thereby activate

both E2-free and E2-bound ER (Renoir et al., 2013). This ER phosphorylation

augments the transcriptional activation potential of ER and enhances its effects on

cell proliferation and survival.

Exposure of MCF-7 cells to RvD2 prior to the cytosolic extraction resulted in

significant reduction in 3[H]E2 binding sites in the cytosol as evident from the

radioligand binding experiment (Fig.5C, D). Regardless of the extent to which the

displacing concentration of E2 was back-titrated, the data clearly show that the

displacement curve was not left shifted. There was an apparent loss of binding sites.

That is to say, prior exposure to RvD2 decreased the apparent ER density in the

cytosol. RvD2 enhancement of proteasomal degradation of ERα (a known

characteristic of ERα ligand(Lee and Lee, 2012) can be excluded as an explanation

of the loss of cytosol ERα, as ERα protein level (membrane+ cytosol+ nucleus) was

not affected by RvD2 or E2 treatment (Fig.6 B). These observations lead us to the


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

17

conclusion that RvD2 has caused translocation of ER from the cytosol to the

nucleus. This possibility was confirmed by both immunofluorescence and

immunoblotting studies, which indicated that RvD2 increased the nuclear localization

of ER and this may explain the subsequent gene transcription. It is evident that the

fraction of liganded ER involved in gene transactivation must be present in the

nucleus. Moreover, it is established that activation of ER (e.g. by ligand binding)

causes stabilization of ER interactions with the chromatin (Leclercq et al., 2006).

Thus, increased ER nuclear localisation is consistent with RvD2 estroegenic actions.

However, our results do not exclude additional influences of RvD2 on the recruitment

or de-recruitment of ER co-activators or co-repressors, respectively or an influence

on regulatory phosphorylations sites on ERα as underlying the estrogenic actions of

RvD2.

Our observations parallel, to some extent, those in a recent report by Russell and

colleagues in which they demonstrate an estrogenic profile for lipoxin A4 in human

endometrial adenocarcinoma (Ishikawa) and endometrial epithelial (hTert EEC) cell

lines (Russell et al., 2011). They suggest that LXA4 bioactivity involves direct binding

to ER. However, competitive radioligand binding assays that we performed show

clearly that RvD2 did not compete with 3[H]E2 for ER binding, which excludes the

possibility that RvD2 actions are mediated via binding to the orthosteric 17β-estradiol

binding site. In addition, we observed that cotreatment with E2 and RvD2 did not

inhibit the E2 induced-increases in cell number or the expression of estrogen

responsive-genes (data not shown), in contrast to the antiestrogenic actions of LXA4

observed in endometrial epithelial cells. However, several important differences in

the two studies could account for these distinct basis for estrogenic actions, including

differences in estrogen receptor population in endometrial versus breast epithelial


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

18

and carcinoma cells, and the interaction of ligand-receptor complexes with different

co-activator/co-repressor proteins. In addition to estrogen receptor itself and the

genomic response element to which it binds, a number of other cellular adaptor

proteins are involved in determining the response of individual cell to estrogenic

stimuli. One important example of these coregulatory proteins is the steroid receptor

coactivator-1 (SRC-1). It has been shown that its overexpression can potentiate the

transcriptional activity of tamoxifen-activated estrogen receptor. On the other hand,

overexpression of the corepressor silencing mediator of retinoic acid and thyroid

hormone (SMRT) in target cells permitted tamoxifen-activated estrogen receptor to

manifest partial agonist activity and overexpression of SRC-1 was unable to reverse

this process (Smith et al., 1997). Collectively, this indicates that the relative

expression of coactivators and corepressors can modulate ligand regulation of

estrogen receptor transcriptional activity and suggest that they contribute to the

tissue-specific ability of certain compounds to activate or inhibit ER mediated gene

expression. Most importantly whilst LXA4 is thought to act through FPR2, the

receptor for RvD2 remains unknown. Thus, there is no reason to expect these

trihydroxy polyunsaturated fatty acids will behave concordantly.

Our results also exclude the possibility that RvD2 functions as an allosteric

modulator of ER, since it did not alter 3[H]E2 affinity for ER binding. However, ER

transcriptional activity does not necessarily entail direct ligand binding. Small

hydrophilic signalling molecules (e.g. dopamine (Power et al., 1991; Riby et al.,

2000), growth factors (e.g. EGF, IGF-1 (Ignar-Trowbridge et al., 1996; Marquez et

al., 2001)), as well as components downstream of membrane receptors, such as

second messengers (Zhang et al., 2013) have been shown to influence ER-mediated

gene expression. These various molecules influence the phosphorylation status of


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

19

the receptor through signal transduction pathways (for instance phosphorylation of

Ser 118 by p44/42 MAPK when EGFR is activated by EGF) (Bunone et al., 1996).

Transcriptional co-regulators are also targets for these signal transduction pathways

(Driggers and Segars, 2002). Evidence has been reported to support the idea that

growth factor signalling acts in synergy with estradiol for optimal transcriptional

effects (Marquez et al., 2001). Thus, RvD2 may activate signalling cascades that

leads to post-translational modifications of ERα or its co-activators or co-repressors.

Another possibility which could explain RvD2 estrogenicity and we have not explored

in this study is the involvement of the plasma membrane associated estrogen

binding protein, GPER1, previously named GPR30. GPER1 is a membrane-

spanning protein, and a member of the G protein-coupled receptor family. GPER1

has been proposed to mediate both genomic and nongenomic actions of E2. It has

been demonstrated that GPER1 can promote the progress of ER positive tumours

through MAPK signalling pathway (Wang et al., 2010). However, it has also been

shown that GPER1 is pro-apoptotic in ER positive breast cancer cells and its

expression correlates with increased distant disease-free survival of estrogen

receptor positive breast cancer patients (Broselid et al., 2013). We have previously

made extensive efforts to establish the contribution of this receptor in ER positive

breast cancer cell lines using the commercially available synthetic GPER1 agonist,

G1, and failed to observe any of the known biological effects of estrogen mediated

through this receptor (unpublished observations, Tan, Stewart and Ziogas). Taken

together with the clear inhibitory effect of ICI182, 780, we conclude that it is unlikely

that signalling through the GPER1 could explain the observed RvD2 effects.

This study defines a potential role for RvD2 as a modulator of ERα signalling in ER

positive breast cancer cells with effects on proliferation and ER dependent


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

20

transcription. RvD2 effects did not involve direct binding to ER, nor did it alter binding

of E2 to the ER. RvD2 effects appear to be as a result of activation of the PI3K/Akt

signalling pathway with subsequent upregulation of cyclin D1 expression (Fig.7).

Further investigations are necessary to fully characterize RvD2-elicited effects in

physiological and pathological conditions of the mammary glands.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

21

Acknowledgements

We thank Trudi Harris and Michael Schuliga for expert technical assistance.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

22

Authors Contributions

Participated in research design: Stewart, Al-Zaubai, Johnstone, Rizzacasa

Conducted experiments: Al-Zaubai, Stewart.

Contributed new reagents or analytic tools: Rizzacasa, Li, Leong.

Performed data analysis: Al-Zaubai, Stewart.

Wrote or contributed to the writing of the manuscript: Al-Zaubai, Stewart, Johnstone,

Rizzacasa.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

23

References

Arrick BA, Korc M and Derynck R (1990) Differential Regulation of Expression of Three

Transforming Growth Factor β Species in Human Breast Cancer Cell Lines by Estradiol.

Cancer Research 50:299-303.

Baumgarten SC and Frasor J (2012) Minireview: Inflammation: An Instigator of More

Aggressive Estrogen Receptor (ER) Positive Breast Cancers. Molecular Endocrinology

26:360-371.

Bonéy-Montoya J, Ziegler YS, Curtis CD, Montoya JA and Nardulli AM (2010) Long-Range

Transcriptional Control of Progesterone Receptor Gene Expression. Molecular

Endocrinology 24:346-358.

Broselid S, Cheng B, Sjöström M, Lövgren K, Klug-De Santiago HLP, Belting M, Jirström K,

Malmström P, Olde B, Bendahl P-O, Hartman L, Fernö M and Leeb-Lundberg LMF (2013) G

Protein–Coupled Estrogen Receptor Is Apoptotic and Correlates with Increased Distant

Disease-Free Survival of Estrogen Receptor–Positive Breast Cancer Patients. Clinical

Cancer Research 19:1681-1692.

Bruunsgaard H, Pedersen M and Pedersen BK (2001) Aging and proinflammatory cytokines.

Curr Opin Hematol 8:131-136.

Bunone G, Briand PA, Miksicek RJ and Picard D (1996) Activation of the unliganded

estrogen receptor by EGF involves the MAP kinase pathway and direct phosphorylation.

EMBO J 15:2174-2183.

Casimiro MC, Velasco-Velázquez M, Aguirre-Alvarado C and Pestell RG (2014) Overview of

cyclins D1 function in cancer and the CDK inhibitor landscape: past and present. Expert

Opinion on Investigational Drugs 23:295-304.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

24

Casimiro MC, Wang C, Li Z, Di Sante G, Willmart NE, Addya S, Chen L, Liu Y, Lisanti MP

and Pestell RG (2013) Cyclin D1 Determines Estrogen Signaling in the Mammary Gland In

Vivo. Molecular Endocrinology 27:1415-1428.

Castaneda C, Cortes-Funes H, Gomez H and Ciruelos E (2010) The phosphatidyl inositol 3-

kinase/AKT signaling pathway in breast cancer. Cancer Metastasis Rev 29:751-759.

Deschênes J, Bourdeau V, White JH and Mader S (2007) Regulation of GREB1

Transcription by Estrogen Receptor α through a Multipartite Enhancer Spread Over 20 kb of

Upstream Flanking Sequences. JOURNAL OF BIOLOGICAL CHEMISTRY 282:17335-

17339.

Driggers PH and Segars JH (2002) Estrogen action and cytoplasmic signaling pathways.

Part II: the role of growth factors and phosphorylation in estrogen signaling. Trends

Endocrinol Metab 13:422-427.

Frasor J, Danes JM, Komm B, Chang KCN, Lyttle CR and Katzenellenbogen BS (2003)

Profiling of Estrogen Up- and Down-Regulated Gene Expression in Human Breast Cancer

Cells: Insights into Gene Networks and Pathways Underlying Estrogenic Control of

Proliferation and Cell Phenotype. Endocrinology 144:4562-4574.

Gohno T, Seino Y, Hanamura T, Niwa T, Matsumoto M, Yaegashi N, Oba H, Kurosumi M,

Takei H, Yamaguchi Y and Hayashi S (2012) Individual transcriptional activity of estrogen

receptors in primary breast cancer and its clinical significance. Cancer Med 1:328-337.

Hall JM, Couse JF and Korach KS (2001) The Multifaceted Mechanisms of Estradiol and

Estrogen Receptor Signaling. JOURNAL OF BIOLOGICAL CHEMISTRY 276:36869-36872.

Hanahan D and Weinberg Robert A (2011) Hallmarks of Cancer: The Next Generation. Cell

144:646-674.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

25

Hughes RA, Harris T, Altmann E, McAllister D, Vlahos R, Robertson A, Cushman M, Wang Z

and Stewart AG (2002) 2-Methoxyestradiol and Analogs as Novel Antiproliferative Agents:

Analysis of Three-Dimensional Quantitative Structure-Activity Relationships for DNA

Synthesis Inhibition and Estrogen Receptor Binding. Molecular Pharmacology 61:1053-

1069.

Ignar-Trowbridge DM, Pimentel M, Parker MG, McLachlan JA and Korach KS (1996)

Peptide growth factor cross-talk with the estrogen receptor requires the A/B domain and

occurs independently of protein kinase C or estradiol. Endocrinology 137:1735-1744.

Jacobs L and Finlayson CA (2011) Breast cancer / edited by Lisa Jacobs, Christina A.

Finlayson. Philadelphia : Saunders Elsevier, c2011. 1st ed.

Jiang WG, Douglas-Jones AG and Mansel RE (2006a) Aberrant expression of 5-

lipoxygenase-activating protein (5-LOXAP) has prognostic and survival significance in

patients with breast cancer. Prostaglandins, Leukotrienes and Essential Fatty Acids 74:125-

134.

Jiang WG, Watkins G, Douglas-Jones A and Mansel RE (2006b) Reduction of isoforms of

15-lipoxygenase (15-LOX)-1 and 15-LOX-2 in human breast cancer. Prostaglandins,

Leukotrienes and Essential Fatty Acids 74:235-245.

Jiang X and Shapiro DJ (2013) The immune system and inflammation in breast cancer.

Molecular And Cellular Endocrinology.

Khau T, Langenbach SY, Schuliga M, Harris T, Johnstone CN, Anderson RL and Stewart

AG (2011) Annexin-1 signals mitogen-stimulated breast tumor cell proliferation by activation

of the formyl peptide receptors (FPRs) 1 and 2. FASEB J 25:483-496.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

26

Leclercq G, Lacroix M, Laios I and Laurent G (2006) Estrogen receptor alpha: impact of

ligands on intracellular shuttling and turnover rate in breast cancer cells. Curr Cancer Drug

Targets 6:39-64.

Lee J and Lee M (2012) Emerging roles of the ubiquitin-proteasome system in the steroid

receptor signaling. Archives of Pharmacal Research 35:397-407.

Li J, Leong, M., Stewart, A., and Rizzacasa, M. A. (2013) Total synthesis of the endogenous

inflammation resolving lipid resolvin D2 using a common lynchpin. Beil J Org Chem 9: p.

2762-2766.

Marquez DC, Lee J, Lin T and Pietras RJ (2001) Epidermal growth factor receptor and

tyrosine phosphorylation of estrogen receptor. Endocrine 16:73-81.

Mas E, Croft KD, Zahra P, Barden A and Mori TA (2012) Resolvins D1, D2, and Other

Mediators of Self-Limited Resolution of Inflammation in Human Blood following n-3 Fatty

Acid Supplementation. Clinical Chemistry 58:1476-1484.

Miyahara T, Runge S, Chatterjee A, Chen M, Mottola G, Fitzgerald JM, Serhan CN and

Conte MS (2013) D-series resolvin attenuates vascular smooth muscle cell activation and

neointimal hyperplasia following vascular injury. The FASEB Journal 27:2220-2232.

Ouchi N, Parker JL, Lugus JJ and Walsh K (2011) Adipokines in inflammation and metabolic

disease. Nat Rev Immunol 11:85-97.

Peurala E, Koivunen P, Haapasaari KM, Bloigu R and Jukkola-Vuorinen A (2013) The

prognostic significance and value of cyclin D1, CDK4 and p16 in human breast cancer.

Breast Cancer Res 15:R5.

Pfeilschifter J, Köditz R, Pfohl M and Schatz H (2002) Changes in Proinflammatory Cytokine

Activity after Menopause. Endocrine Reviews 23:90-119.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

27

Power RF, Mani SK, Codina J, Conneely OM and O'Malley BW (1991) Dopaminergic and

ligand-independent activation of steroid hormone receptors. Science 254:1636-1639.

Rae J, Johnson M, Scheys J, Cordero K, Larios J and Lippman M (2005) GREB1 is a critical

regulator of hormone dependent breast cancer growth. Breast Cancer Research And

Treatment 92:141-149.

Renoir J-M, Marsaud V and Lazennec G (2013) Estrogen receptor signaling as a target for

novel breast cancer therapeutics. Biochemical Pharmacology 85:449-465.

Riby JE, Chang GHF, Firestone GL and Bjeldanes LF (2000) Ligand-independent activation

of estrogen receptor function by 3,3′-diindolylmethane in human breast cancer cells.

Biochemical Pharmacology 60:167-177.

Russell R, Gori I, Pellegrini C, Kumar R, Achtari C and Canny GO (2011) Lipoxin A4 is a

novel estrogen receptor modulator. FASEB J 25:4326-4337.

Serhan C, Chiang N and Van Dyke T (2008) Resolving inflammation: dual anti-inflammatory

and pro-resolution lipid mediators. Nature reviews Immunology 8:349-361.

Serhan CN (2007) Resolution phase of inflammation: novel endogenous anti-inflammatory

and proresolving lipid mediators and pathways. Annu Rev Immunol 25:101-137.

Serhan CN, Brain SD, Buckley CD, Gilroy DW, Haslett C, O�Neill LAJ, Perretti M, Rossi AG

and Wallace JL (2007) Resolution of inflammation: state of the art, definitions and terms.

The FASEB Journal 21:325-332.

Serhan CN and Petasis NA (2011) Resolvins and Protectins in Inflammation Resolution.

Chemical Reviews 111:5922-5943.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

28

Smith CL, Nawaz Z and O'Malley BW (1997) Coactivator and corepressor regulation of the

agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol Endocrinol

11:657-666.

Vadlakonda L, Pasupuleti M and Pallu R (2013) Role of PI3K-AKT-mTOR and Wnt Signaling

Pathways in Transition of G1-S Phase of Cell Cycle in Cancer Cells. Front Oncol 3:85.

Wang D, Hu L, Zhang G, Zhang L and Chen C (2010) G protein-coupled receptor 30 in

tumor development. Endocrine 38:29-37.

Zhang X, Tanaka K, Yan J, Li J, Peng D, Jiang Y, Yang Z, Barton MC, Wen H and Shi X

(2013) Regulation of estrogen receptor alpha by histone methyltransferase SMYD2-

mediated protein methylation. Proc Natl Acad Sci U S A 110:17284-17289.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

29

Footnotes

Financial support: This work was supported by the National Health and Medical

Research Council (grant 1023185)

Person to receive reprint requests: Nuha Al-Zaubai, Department of Pharmacology

and Therapeutics, University of Melbourne, Grattan St., Parkville, Vic. 3010,

Australia.

[email protected]


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

30

Legends for Figures

Figure 1. Effect of RvD2 on MDA-MB-231 and MCF-7 cell number. After incubation with serum free

media for 24 h, MDA-MB-231 cells (A) and MCF-7 cells (B,C) were exposed to increasing

concentrations of RvD2 (10-1000nM) or FCS (5% v/v) for 24-72 h. In separate experiments, MCF-7

cells were incubated with RvD2 (100nM) or E2 (10nM) for 48h in the presence or absence of the

estrogen receptor antagonist ICI 182,780 (100nM) (D). Numbers of viable cells were then counted.

Data represent means + SEM (n=6-10 for A, B, D and n=1 for C, each determined in triplicates). **P <

0.001, ***P < 0.0001 vs. vehicle control (B) or ICI treatment (D); ###P < 0.0001 vs. RvD2 treatment,

respectively.

Figure 2. Effect of inhibitors of PI3K/Akt (LY294002), ERK1/2 (PD98059, UO126) and p38MAPK

signalling pathways (SB202190, SB203850) on the RvD2 (100nM) induced increases in MCF-7 cell

number when given 30 min prior to RvD2. Results are expressed as percentage of basal cell numbers

(vehicle-treated cells) and presented as means + SEM ###P < 0.0001 vs RvD2; n=5.

Figure 3. Effect of RvD2 on ERE activity. MCF-7 (A), BT474 (C), T47D (D) and SKOV3 (E) cells

transiently transfected with ER-SEAP reporter construct and pGL3 luciferase control vector and

incubated with E2 or RvD2 for 48 h. MCF-7 cells (B) incubated with RvD2 (100nM) 24 h prior to

incubation with increasing concentrations of E2 for another 24 h. At the conclusion of each

experiment the level of SEAP in the supernatant was measured and normalized to the luciferase

counts and expressed as a percentage of the basal level. Values represent means + SEM for n=4-7

independent experiments. *P < 0.05, **P < 0.001, ***P < 0.0001 compared with control. #P < 0.05, ##P

< 0.001, ###P < 0.0001 compared with RvD2 (100nM) or E2. ^P < 0.05, ^^P < 0.001 compared with E2

0.1 and 1nM respectively.

Figure 4. Effect of RvD2 on PGR (A), GREB1 (B), CCND1 (C, D), TGFβR2 (E), and TGFβ3 (F)

mRNA levels normalised to concurrently measured 18S rRNA and referenced to vehicle treated cells.

MCF-7 cells were pretreated with ICI 182, 780 (A, B, C, E, F) or LY 294002 (D) for 30 min prior to

incubation with E2 or RvD2 for another 4-24 h. RNA was extracted and mRNA expression was

measured by RT-PCR. Data represent means and the SEM of n=3-7. *P < 0.05, **P < 0.001, ***P <

0.0001 vs control. #P < 0.05, ##P < 0.001, ###P < 0.0001 vs E2 or RvD2 (1μM).


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

31

Figure 5. Effect of RvD2 on ER binding. MCF-7 cells (A) and MCF-7 cytosol (B) were incubated

with increasing concentrations of RvD2 in the presence of 3[H]E2. MCF-7 cells (C and D) were treated

with 0.1 and 1 μM RvD2, respectively, for 30 min prior to cytosolic extraction and then incubated with

different concentrations of E2 in the presence of a fixed concentration of 3[H]E2 (n=3-5).

Figure 6. (A) Immunofluorescence of ERα in MCF-7 cells treated with E2 (10nM) or RvD2 (1μM) for

30 min before fixation. Nuclei are stained blue with DAPI. ERα was detected with FITC-labelled

secondary antibody at a magnification of 400x (representative of 3 independent experiments). (B)

Immunoblot of ERα in whole MCF-7cell lysates incubated using an identical protocol to that in figure

(6A) and normalised to β actin as a house keeping protein (n=4). ERα/β actin ratio is expressed as a

percentage of the ratio in basal cells. (C) MCF-7 cells, after being treated with E2 or RvD2 (30min),

were separated into (N) nuclear and (C) cytosolic fractions, subjected to SDS page and

immunoblotted with anti ERα. Equal proportions of nuclear and cytosolic extracts were loaded and

normalised to Lamin A/C (nuclear protein) and β actin respectively. (D) and (E) are densitometric

quantifications of nuclear and cytosolic ERα levels respectively, expressed as a percentage of the

control for the respective fraction (n=7). *P < 0.05 and **P < 0.001 vs control.

Figure 7. Proposed mechanism for RvD2-induced proliferation of estrogen receptor positive breast

tumour epithelial cells. RvD2 activates ER which in turn signals through the PI3K/Akt pathway to

promote mitogenesis in breast tumour epithelial cells by upregulation of cyclin D1.


at ASPE

T Journals on M


Dow

nloaded from


JPET #214403

32

Tables

Table 1. Primer sequences for RT-PCR

Gene Forward primer Reverse primer

18s CGCCGCTAGAGGTGAAAT TCTTGGCAAATGCTTTCGCTC

GREB1 GAGGATGTGGAGTGGAGACC GGTAGAGCCTTCTGTCCCC

PGR GTCAGTGGGCAGATGCTGTA AGCCCTTCCAAAGGAATT

CCND1 CTACCGCGTCACACGGTTC AGTCTGGGTCACACTTGATCAC

TGFβR2 GGGCAGGTGGGAACTGCAC TCCTGGATTCTAGGACTTCTGGAG

TGFβ3 CTGTGCGTGAGTGGCTGTTG GTGCTGTGGGTTGTGTCTGC


at ASPE

T Journals on M


Dow

nloaded from



at ASPE

T Journals on M


Dow

nloaded from


Figure 6

ERα

β actin

N C N C N CE2 - - + + - -

RvD2 - - - - + +

ERα

Lamin A/C

β actin

A

C

B

ED

Rabbit IgG

E2 10nM RvD2 1μM

Vehicle


at ASPE

T Journals on M


Dow

nloaded from


RvD2

ER

S-phase Entry & Cell

division

PI3K/Akt

Cyclin D1

ICI 182,780

LY 294002

Figure 7


at ASPE

T Journals on M


Dow

nloaded from



at ASPE

T Journals on M


Dow

nloaded from


Resolvin D2 supports MCF-7 cell proliferation via...

Documents

Transcript of Resolvin D2 supports MCF-7 cell proliferation via...