RESECH PROPOSAL

8/10/2019 RESECH PROPOSAL

1/17

1.0 Introduction

Staphylococcus aureus ( S.aureus hereafter) is a bacterium that commonly colonizes

human skin and mucosa (e.g. inside the nose). It can also cause disease, particularly if

there is an opportunity for the bacteria to enter the body, for example through injured

skin or a medical procedure.S.aureus infections are increasingly reported around the

world (Grundmann H et al., 2006). In a recent analysis of US inpatients, nearly

400,000 patients were admitted due to the S.aureusinfection as in 2003 (Noskin GA

et al., 2007).Furthermore, the treatment of these infections has become more

difficult,since Infection S. aureuss infectionimposes a high and increasing burden on

health care resources, as well as increasing morbidity and mortality (Wisplinghoff H

et al., 2004). More specifically, S.aureus bacteremia is associated with higher

morbidity and mortality, compared with bacteremia caused by other pathogens.

Additionally, S. aureusis a leading cause of nosocomial bloodstream infection in the

United States. Among 24,000 nosocomial bloodstream infections between 1995 and

2002, S. aureus was the most cause of this infection, accounting for 20 percent of

cases (Chu VH et al., 2005).

Most strains of S. aureus are sensitive to the more commonly used antibiotics, and

infections can be effectively treated. albeit that, some S. aureus bacteria are more

resistant. Such resistant to the antibiotic methicillin are coined as methicillin-resistant

Staphylococcus aureus (MRSA) and often require different types of antibiotics to treat

them on the other hand,those that are sensitive to methicillin are coined as

methicillin-sensitive Staphylococcus aureus (MSSA) (Fowler VG Jr et al., 2005).

S.aureus is increasingly recognized as a cause of hospital associated (HA) and

community associated (CA) infections. Macrolide, lincosamide and streptogramin B

(MLSB) antibiotics are commonly used in treatment of staphylococcal infections.

Widespread use of MLSB antibiotics has led to an increase in resistance to these

antibiotics especially clindamycin, among staphylococcal strains (Noskin GA et al.,

2007). Macrolides (e.g. erythromycin, dirithromycin, clarithromycin, azithromycin),

lincosamides (e.g clindamycin and lincomycin), and streptograminB (e.g


2/17

quinupristin/dalfopristin ) belong to different classes of antimicrobials but act through

the same mechanism that is by inhibition of protein synthesis. Clindamycin has long

been an option for treating both methicillin susceptible S. aureus (MSSA) and

methicillin resistant S. aureus (MRSA) infections(Mukesh Patel1 et al., 2006).

Acquired staphylococcal resistance to three types of MLSB antibiotics are largely

mediated by multiple mechanisms including target site modification, active efflux,

and enzymatic drug inactivation. Modification of the antibiotic target site is mediated

by erythromycin ribosomal genes (erm), it is believed that changes in A2058

nucleotide would lead to the impairment of the antibiotic binding to the target site. A

specific efflux pump is encoded by the msrA gene, this energy dependent pump

effectively expels macrolides and streptograminB from bacterial cell before they bind

to their binding site on the ribosome. Notably, this mechanism of resistance does not

create resistance to clindamycin (MS phenotype), which is active against such isolates.

Inactivation of MLSB antibiotics confers resistance to structurally related antibiotics

only.Esterases, phosphotransferases, acetyltransferases, hydrolases, and

nucleotidyransferases have been identified in strains resistant to macrolides or

lincosamides (Clin Infect Dis. 2002). A previous study from India in 2008 had

reported the prevalence of iMLSB among MSSA as 45% out of 215 isolates (GS

Ajantha et al., 2008). While other study from Western India in 2010 found the iMLSB

among MSSA as 6.93% of 7 isolates. On the other hand a study form Libya found no

iMLSB phenotype from 55 MSSA isolates tested (Zorgani A1 et al., 2008). In contrast

a study from Turkey in 2012 investigated 69 MSSA isolates, and found out that 71%

were erythromycin resistant, 6% showed iMLSB phenotype, while cMLSB was found

as 27% and MS phenotype was 67% (Uzun B et al., 2014). These observations

indicate the incidence of constitutive and inducible MLSB resistance in

staphylococcal isolates which is varied by geographic region.

It is important for laboratories to distinguish between MS and iMLSB resistance

before reporting an erythromycin-non susceptible Staphylococcus sp. isolate as

clindamycin susceptible. They can be distinguished by the erythromycin-clindamycin
http://jcm.asm.org/search?author1=Mukesh+Patel&sortspec=date&submit=Submithttp://www.ijpmonline.org/searchresult.asp?search=&author=GS+Ajantha&journal=Y&but_search=Search&entries=10&pg=1&s=0http://www.ijpmonline.org/searchresult.asp?search=&author=GS+Ajantha&journal=Y&but_search=Search&entries=10&pg=1&s=0http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://www.ijpmonline.org/searchresult.asp?search=&author=GS+Ajantha&journal=Y&but_search=Search&entries=10&pg=1&s=0http://www.ijpmonline.org/searchresult.asp?search=&author=GS+Ajantha&journal=Y&but_search=Search&entries=10&pg=1&s=0http://jcm.asm.org/search?author1=Mukesh+Patel&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Mukesh+Patel&sortspec=date&submit=Submit


3/17

disk approximation test or D-test. When an organism expressing iMLSB resistance is

tested according to Clinical and Laboratory Standards Institute (CLSI) methods with a

15-g erythromycin disk placed between 15-26mm close to a2g clindamycin disk,

the zone of inhibition around the clindamycin disk is flattened to form aD shape

(positive D-test), whereas in the MS phenotype, the clindamycin zone remains

circular (sensitive). A false-negative D-test will result in reporting an isolate as

clindamycin susceptible when it should be reported as resistant (very major error),

while a false-positive test will result in reporting an isolate as resistant when it should

be reported as susceptible (major error) (Matthew V et al., 2006).

1.1 The aims of this study are:

General objective:

To study phenotypic and genotypic characteristic of clindamycin resistance among

methicillin susceptiblestaphylococcus aureus(MSSA) among clinical isolates.

Specific objective:

1.

To screen the MLSB(iMLSB, cMLSB, MS) phenotypic characteristics of

MSSA isolates by doing D-test in between four distance 12mm, 15mm , 22mm,

26mm.

2. To detect resistant genes erm A, erm B, ermCfor iMLSB, cMLSB phenotype, and

msr A for MS phenotype.

3. To correlate between MLSB phenotypes with its genes erm (ermA, ermB, ermC),

and msr.

1.3 Significance of study:

In accuracy in detecting inducible clindamycin resistance possess a major issue. In

consequence it leads to treatment failure because it recorded as clindamycin sensitive .

We will undertake this study to assess the accuracy of the clindamycin-erythromycin

disk approximation test, identification the best distance where to put antibiotic edge

to edge can help to avoid false- negative result and also therapy failure and the gene


4/17

that responsible for resistance will be detected.

1.4 Problem statement:

Bacterial infections persist as major causes of morbidity and mortality in hospitals

around the world. One recent study analyzed that nosocomial S. aureus infections

alone resulted in 2.7 million days in excess length of stay, 9.5 billion dollars in extra

hospital charges and nearly 12,000 inpatient deaths per year (G.A. Noskin et al.,

2005). The resistance to antimicrobial agents among Staphylococci is an increasing

problem. This has led to renewed interest in the usage of MLSB antibiotics to treat S.

aureus infections. Clinical failure of clindamycin therapy has been reported due to

multiple mechanisms that confer resistance to MLSB antibiotics. In vitro routine tests

for clindamycin susceptibility may fail to detect inducible clindamycin resistance due

to erm genes resulting in treatment failure, thus necessitating the need to detect such

resistance by a simple D test as a routine basis (Yilmaz G et al., 2007).

1.5 Research question:

1. Can we detect MLSB phenotypes in our isolates?

2. What are the prevalent MLSB phenotypes among MSSA isolates?

3. Can different measurement between clindamycin and erythromycin antibiotics

give false negative results?

4. What is the best distance between clindamycin and erythromycin to detect

iMLSB phenotype?

5. What are the prevalent ermgene in our isolates?

2.0 Literature review :

S. aureus is a gram-positive coccal facultative anaerobic bacterium sln wnk sl

"on l hp lsed" . The microscopic appearance of S. aureus is round and resembles

that of a sphere (cocci). Because of the way the bacteria divide and multiply, it

appears in clusters or tetrads. In Greek, staphylococcus means "clusters of grapes."


5/17

using of gram stain, helps to identify S. Aureus, in which the bacteria appears purple

when it observes under the microscope. All staphylococci produce the enzyme

catalase when introduced to hydrogen peroxide. While this enzyme differentiates the

staphylococci from the streptococci. The coagulase enzyme is a key to differentiate S.

aureusfrom other staphylococci (Vasanthakumari,2009).

S. aureus produces various enzymes such as coagulase which works on clotting

plasma and prevent phagocytosis by coating the bacterial cell, hyaluronidase aides

in spreading of S. aureus by breaking down hyaluronic acid, DNAase

(deoxyribonuclease)which damage the DNA, staphylokinase to decompose fibrin and

help in spread of S. aureus, lipasse to digest lipids, and bete-lactamase which

responsible for drug resistance() [17].

S. aureus is able to secret several exotoxins, many of these toxins are related with

specific diseases. Exfoliative toxins, (EF) toxins are implicated in the disease

staphylococcal scalded-skin syndrome (SSSS), which occurs most commonly in

infants and young children.Superantigen activities that inducetoxic shock syndrome

(TSS). This group includes the toxin TSST-1, enterotoxin type B. Other toxins that act

on cell membranes include Panton-Valentine leukocidin (PVL) is associated with

severe necrotizing pneumonia in children, alpha toxin, beta toxin, and delta toxin

[18][19].

In the past, a lot of the serious S. aureus infections were treated with penicillin.

However, over the past fifty years, treatment of these infections has become more

difficult because of the development of resistance in S. aureus to several antibiotics,

involving the generally used penicillin-related antibiotics.

S. aureus is a common microorganism in both compromised and healthy hosts. It

cause chronic and asymptomatic colonization of human tissues or integrate in bio

films on inert surfaces; it also causes a fulminate host invasion with diverse

manifestations. S. aureus can remain alive under extreme circumstances in the human

host, as well as in the animals and environment. Staphylococcal infections take place
http://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:http://en.wikipedia.org/wiki/Phagocytosishttp://en.wikipedia.org/wiki/Deoxyribonucleasehttp://en.wikipedia.org/wiki/Scalded-skin_syndromehttp://en.wikipedia.org/wiki/Superantigenhttp://en.wikipedia.org/wiki/Toxic_shock_syndromehttp://en.wikipedia.org/wiki/Panton-Valentine_leukocidinhttp://en.wikipedia.org/wiki/Panton-Valentine_leukocidinhttp://en.wikipedia.org/wiki/Toxic_shock_syndromehttp://en.wikipedia.org/wiki/Superantigenhttp://en.wikipedia.org/wiki/Scalded-skin_syndromehttp://en.wikipedia.org/wiki/Deoxyribonucleasehttp://en.wikipedia.org/wiki/Phagocytosishttp://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:


6/17

regularly in hospitalized patients and have serious effects. S. aureus known as an

significant pathogen in human disease (Wulf MW et al., 2008).

2.1 S. aur eus infections:

S. aureus is one of the most important human pathogens since the development of

germ theory. It is the second cause of hospital-acquired pneumonia (Wisplinghoff H,

2004). It cause meningitis (swelling of the membranes around brain and spinal cord),

usually as result of infection after surgery. S. aureus causes a painful infection of joint

fluid known as septic or infective arthritis. Most serious of all are the deep-seated

infections such as osteomyelitis usually occurs in children under 12, an infection of

the heart valves called endocarditis, and cause blood stream infection bacteremia. S.

aureusis the most common cause of surgical wound infections. Dramatic increase in

the number of such infections is caused by antibiotic resistant S. aureus.Because of

this, many patients today die from infection that were easily cured (Lisa F et al.,

2009).

2.2 Macrolides and lincosamide and streptogramin B:

Although (MLSB) antibiotics are chemically discriminating, but they have a Similar

manner of action.There are several important in the use of MLSB antibiotic because

of their mechanism of action involves the inhibition of microbial protein synthesis,

they bind to overlapping site on the 50S subunit of the ribosome, especially located on

23S ribosomal RNA, and function by interfering with microbial protein synthesis.

Macrolides are primarily bacteriostatic agent. Although Macrolides achieve excellent

penetration into most tissue and fluid, they do not penetrate will into the central

nervous system. Macrolide resistance is growing problem among certain pathogens,

most notably Streptococcus pneumonia, S. aureus and Enterococcus species.

Clindamycin is active against many aerobic gram positive cocci and variety of

anaerobes (Douglas M, 2009). While the majority ofMRSA are clindamycin

resistance (>50%), clindamycin has activity against most MSSA isolates (>85%).

Clindamycin is most often used to treat infections involving the abdomen, pelvis, skin
http://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:http://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:


7/17

and soft tissues. MLSB antibiotic have been used to replace -lactams antibiotic in

hypersensitive patients.

2 .3 Mechanism of resistance:

Resistance to MLSB antibiotics may be occurring because of insufficient access of

antimicrobial agent to its binding site, or enzymatic inactivation of antibiotic.

Facultative gram positive bacilli, including Enterobacteriaceae and pseudomonas

species are not affected by lincosamide and this could be attributed to poor

penetration through the outer envelope. Other organisms with at least modest intrinsic

resistance to clindamycin include Haemophilus species, Neisseriaceae, and

Staphylococci species.

Bacteria become resistant to lincosamide by acquiring one of the erm genes on a

plasmid or transposons, encoding a ribosomalRNA-methylating enzyme. This enzyme

alters the antibiotic binding site and when expressed constitutively produces cross

resistance to MLSB antibiotics(the cMLSB phenotype).

The ermAand ermCdeterminants are predominant instaphylococci. TheermA genes

are mostly spread in MRSAand are borne by transposons related to Tn554,where as

erm (C) genes are mostly responsible for erythromycin resistance in MSSA and are

borne by plasmids. Although cMLSB is the most clinically relevant form of acquired

lincosamide resistance, some bacteria express the methylase enzyme only after

induction (iMLSB phenotype). In some strains of staphylococci, 14-15 member

macrolides induce resistance to all of the MLSB antibiotic. If induction has not

occurred clindamycin, streptogramins, and 16-member ring macrolides retain in vitro

activity because they are poor inducer of the methylase (Douglas, 2009).

Enzymatic inactivation of lincomycin and Clindamycin occurs in a minority of

staphylococci that bear genes of the linA group encoding nucleotidyltransferase

enzyme. Various studies have shown that the prevalence of cMLSB phenotype to be

ranging from 11-27% and MS phenotype to be from 12-44% .It was noted that the


8/17

percentage of iMLSB resistance was highest among MRSA as compared to MSSA

57.63% and 16.22% respectively (Wulf MW, 2008). However the true incidence

depends on the patient population studied the geographical region, the hospital

characteristics and Methicillin susceptibility.

3.0 Methodology

3.1 sample isolation: A previously well characterized MSSA collection from

Malaysia n (100) will investigate in the Present study

3.2 Sample Identification:

All the samples will be processed as per CLSI guidelines. An established method is

performed for tube coagulase testing on each isolate. All phenotypic and genotypic

testing will also be performed.

3.3 D-test:

Disk approximation testing will be performed four times for each isolate according

to the CLSI method using 2 g clindamycin disks and 15 g erythromycin dis ks

placed on inoculated Mueller-hinton agar. (Clinical and laboratory standards institute.

2007.) for the first test, disks will be placed 12mm apart edge to edge, 15mm apart for

the second, they will be manually. the third,22mm, and the forth in 26mm will be

use a disk dispenser(Bio-Rad, Hercules, California).

Plates will be incubated at 35C in atmospheric conditions for 16-18hours. Plates

containing the 12,15 mm, D-test will be identified by the accession number of the

specimen only, and placed in numerical order prior to reading, while plates containing

the 22,26mm D-test will be identified by an alphanumeric code and placed in

alphabetical order (Matthew V et al., 2006). The D-tests will be read individually by

three observers by a use of reflected light.

Observations in the tests show flattening the zone of Clindamycin adjacent to the


9/17

erythromycin disk will be termed as D-test positive, whereas Observations with a

circular zone will be categorized as D-test negative. When result recorded by two or

more, it will taken as correct.

The results will be interpretation according to CLS guideline:

A. MS Phenotype - S. aureus exhibiting resistance to ER (zone size 13mm) while

sensitive to CL (zone size 21mm) and giving circular zone of inhibition around

clindamycin.

B.

iMLSB phenotype: S. aureus resistance to ER (zone size 13 mm), sensitive

to CL(zone size 21mm ).with D-shape.

C. cMLSB phenotype: showed resistance to both ER(zone size 13mm) and CL

(zone size 14mm) with circular shape of zone of inhibition if any around

clindamycin.

Isolate number (MLSB)phenotype (MS) phenotype

ATCC BAA-197 Positive -

ATCC BAA-976 - Positive


10/17

3.4Genetic testing:

3.4.1 DNA extraction:

Single colonies from the susceptibility purity plate will be used for extraction of

bacterial DNA. Colonies will be placed in 100l of digestion buffer, heated to 100c

for 10 minutes, frozen at 20c, then thawed and Centrifuged. The supernatant

containing DNA will then be stored at20c until required for PCR (Matthew V et al.,

2006).

Primer Designing:

Primers are designed for specific gene by sequences obtained from gene bank.

Table 1. The oligonucleotide primers will be used in this study.

Gene Primers

(53)

Size of amplified

product (bp)

ermA,F TATCTTATCGTTGAGAAGGGATT 139

ermA,R CTACACTTGGCTGATGAAA

ermB,F CTATCTGATTGTTGAAGAAGCATT 141

ermB,R GTTTACTCTTGGTTTAGGATCAAA

ermC,F AATCGTCAATTCCTGCATGT 299

ermC,R TAATCGTGGAATACGGGTTTG

msrA,F GGCACAATAAGAGTGTTTAAAGG 940

msrA,R AAGTTATATCATGAATAGATTGTCCTGTT


11/17

3.4.2PCR:

Genes encoding iMLSB resistance (ermA, ermB, and ermC) and MS resistance (msrA)

will be amplified in multiplex pcr reactions using the primers indicated in Table 1,

for Isolates that will be phenotypically erythromycin-resistant (illustrating either

inducible or constituent resistance to clindamycin). PCR amplification will be

carried out in a DNA thermo cycler using the amplification parameters with initial

denaturation at 95oC for 15 minutes, followed by 35 cycles of denaturation at 95oC

for 30 S, annealing at60oC for 30 S, and extension at 72oC for 1 minute, with a final

extension at 72oC for10 minutes. PCR amplified products will be analyzed by 1%

agarose gel electrophoresis (Matthew V et al., 2006).

3.4.3 Data analysis and statistics:

Data will be analyzed using Microsoft Access 2000and statistical calculations

performed using Microsoft Excel 2000, Statistical Program for the Social Sciences

(SPSS) for Windows, Confidence Interval Analysis for Windows (available at

http://www.medschool.soton.ac.uk/cia), and Program for Reliability Assessment with

Multiple Coders (PRAM).

3.5 EXPECTED RESULT:

The macrolides resistant isolates will be seen based on zone of inhibition and the

presence or absence a D-shaped zone around the clindamycin disc will define the

phenotype. Resistance to erythromycin, with susceptibility to clindamycin will define

the MLSB phenotype. The macrolides resistant genes (ermA, erm B and ermC) of

S.aureus will be determined.


12/17

The result may be represented as in the tables below:

isolates cMLSB iMLSB MS

MSSA (n)

isolates ermA% ermB% ermC% Msr%

MSSA (n)

Isolate identification

D-test

E-R/C-S (D+) E-R/C-R(D-)

PCR PCR

ermA ermB ermC msr


13/17

References

1.

Grundmann H,Aires-de-Sousa M,Boyce J,Tiemersma E. Emergence and

resurgence of meticillin-resistant Staphylococcus aureus as a public-health threat.

Lancet 2006;368:874-85.

2.Laupland KB,Church DL,Mucenski M,Sutherland LR,Davies HD.

Population-based study of the epidemiology of and the risk factors for invasive

Staphylococcus aureus infections. J Infect Dis 2003;187:1452-9.

3. Noskin GA,Rubin RJ,Schentag JJ,et al. National trends in Staphylococcus aureus

infection rates: impact on economic burden and mortality over a 6-year period

(19982003). Clin Infect Dis 2007;45:1132-40.

4.Fowler VG Jr,Miro JM,Hoen B,et al. Staphylococcus aureus endocarditis: a

consequence of medical progress. JAMA 2005;293:3012-21.

5.Wisplinghoff H,Bischoff T,Tallent SM,Seifert H,Wenzel RP,Edmond MB.

Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a

prospective nationwide surveillance study. Clin Infect Dis 2004;39:309-17

6.Chu VH,Crosslin DR,Friedman JY,et al. Staphylococcus aureus bacteremia in

patients with prosthetic devices: costs and outcomes. Am J Med 2005;118:1416.

7.GS Ajantha,Raghavendra D Kulkarni,Jeevan Shetty,C Shubhada,Pavithra Jain.

Phenotypic detection of inducible clindamycin resistance among staphylococcus

aureus isolates by using the lower limit of recommended inter-disk distance.2008

8.Zorgani A1,2, Shawerf O1, Tawil K1, El-Turki E1 and Ghenghesh KS1. Inducible

Clindamycin Resistance among Staphylococci Isolated from Burn Patients .2007

Tripoli Burns Center, Tripoli-Liby
http://www.ijpmonline.org/searchresult.asp?search=&author=GS+Ajantha&journal=Y&but_search=Search&entries=10&pg=1&s=0http://www.ijpmonline.org/searchresult.asp?search=&author=Raghavendra+D+Kulkarni&journal=Y&but_search=Search&entries=10&pg=1&s=0http://www.ijpmonline.org/searchresult.asp?search=&author=Jeevan+Shetty&journal=Y&but_search=Search&entries=10&pg=1&s=0http://www.ijpmonline.org/searchresult.asp?search=&author=C+Shubhada&journal=Y&but_search=Search&entries=10&pg=1&s=0http://www.ijpmonline.org/searchresult.asp?search=&author=Pavithra+Jain&journal=Y&but_search=Search&entries=10&pg=1&s=0http://www.ijpmonline.org/searchresult.asp?search=&author=Pavithra+Jain&journal=Y&but_search=Search&entries=10&pg=1&s=0http://www.ijpmonline.org/searchresult.asp?search=&author=C+Shubhada&journal=Y&but_search=Search&entries=10&pg=1&s=0http://www.ijpmonline.org/searchresult.asp?search=&author=Jeevan+Shetty&journal=Y&but_search=Search&entries=10&pg=1&s=0http://www.ijpmonline.org/searchresult.asp?search=&author=Raghavendra+D+Kulkarni&journal=Y&but_search=Search&entries=10&pg=1&s=0http://www.ijpmonline.org/searchresult.asp?search=&author=GS+Ajantha&journal=Y&but_search=Search&entries=10&pg=1&s=0


14/17

9.Mukesh Patel1,Ken B. Waites2,Stephen A. Moser2,Gretchen A. Cloud3andCraig J.

Hoesley1.Prevalence of Inducible Clindamycin Resistance among Community- and

Hospital-Associated Staphylococcus aureus Isolates.doi: 10.1128/JCM.02582-05 J.

Clin. Microbiol. July 2006 vol. 44 no. 7 2481-2484

10.Uzun B, Gngr S,Pekta B,Aksoy Gkmen A, Yula E,Koal F,Kaya S.

[Macrolide-lincosamide-streptogramin B (MLSB) resistance phenotypes in clinical

staphylococcus isolates and investigation of telithromycin activity].[2014,

48(3):469-476].

11. Crisostomo, M. I., H. Westh, A. Tomasz, M. Chung, D. C. Oliveira, and H. de

Lencastre. 2001. The evolution of methicillin resistance in Staphylococcus aureus:

similarity of genetic backgrounds in historically early methicillin- susceptible and

-resistant isolates and contemporary epidemic clones. Proc. Natl. Acad. Sci. USA

98:98659870.

12. G.A. Noskin, R.J. Rubin, J.J. Schentag, J. Kluytmans, E.C. Hedblom, M.

Smulders, et al.The burden of Staphylococcus aureus infections on hospitals in the

United States: an analysis of the 2000 and 2001 nationwide inpatient sample. database

Arch Intern Med, 165 (15) (2005), pp. 17561761

13. Yilmaz G, Aydin K, Iskender S, Caylan R, Koksal I. Detection and prevalence of

inducible clindamycin resistance in staphylococci. J Med Microbiol

2007;56(Pt3):342-5.

14.Mechanisms of resistance to macrolides and lincosamides: nature of the resistance

elements and their clinical implications.Clin Infect Dis. (2002) 34 (4):

482-492.doi: 10.1086/324626.

15.Matthew V. N. O'Sullivan, Yongwei Cai, Fanrong Kong,Xianyu Zeng and

Gwendolyn L. Gilbert J. Clin., Influence of Disk Separation Distance on Accuracy of

the Disk Approximation Test for Detection of Inducible Clindamycin Resistance in
http://jcm.asm.org/search?author1=Mukesh+Patel&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Ken+B.+Waites&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Stephen+A.+Moser&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Gretchen+A.+Cloud&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Craig+J.+Hoesley&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Craig+J.+Hoesley&sortspec=date&submit=Submithttp://jcm.asm.org/content/44/7/2481.full#aff-1http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://europepmc.org/search?page=1&query=AUTH:http://jcm.asm.org/content/44/7/2481.full#aff-1http://jcm.asm.org/search?author1=Craig+J.+Hoesley&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Craig+J.+Hoesley&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Gretchen+A.+Cloud&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Gretchen+A.+Cloud&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Stephen+A.+Moser&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Stephen+A.+Moser&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Ken+B.+Waites&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Ken+B.+Waites&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Mukesh+Patel&sortspec=date&submit=Submithttp://jcm.asm.org/search?author1=Mukesh+Patel&sortspec=date&submit=Submit


15/17

Staphylococcus spp. Microbiol. 2006, 44(11):4072. DOI:10.1128/JCM.01632-06.

16.Vasanthakumari: Practical Microbiology. BI Publications Pvt Ltd, 2009.

8172253184, 9788172253189.

17.Medical Laboratory Manual For Tropical Countries vol two.

18.http://textbookofbacteriology.net/staph_2.html

19.http://cmgm.stanford.edu/micro/MI209/Staphylococcus%20aureus.pdf.

20.Lisa Freeman-Cook, Kevin D. Freeman, I. Edward Alcamo.,Staphylococcus

Aureus Infections. Infobase Publishing, 2009, 1438101686, 9781438101682.

21.Douglas Mayers,Antimicrobial Drug Resistance: Mechanisms of Drug Resistance,

Volume 1. Springer Science & Business Media, 2009, 1597451800, 9781597451802

22.Wulf MW,Tiemersma E,Kluytmans J,Bogaers D,Leenders AC,Jansen

MW,Berkhout J,Ruijters E Haverkate D,Isken M,Voss A: MRSA carriage in

healthcare personnel in contact with farm animals. J Hosp Infect 70: 186190, 2008.

21.

Matthew V. N. O'Sullivan, Yongwei Cai, Fanrong Kong,Xianyu Zeng and

Gwendolyn L. Gilbert J. Clin., Influence of Disk Separation Distance on Accuracy of

the Disk Approximation Test for Detection of Inducible Clindamycin Resistance in

Staphylococcus spp. Microbiol. 2006, 44(11):4072. DOI:10.1128/JCM.01632-06.

22. Clinical and laboratory standards institute. Performance standards for

antimicrobial susceptibility testing; Seventeenth informational supplement. Vol. 27.

No.1 Clinical Laboratory Standards Institute; 2007.
http://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:http://textbookofbacteriology.net/staph_2.htmlhttp://cmgm.stanford.edu/micro/MI209/Staphylococcus%20aureus.pdfhttp://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:http://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:http://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:http://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:http://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:http://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:http://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:http://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:http://cmgm.stanford.edu/micro/MI209/Staphylococcus%20aureus.pdfhttp://textbookofbacteriology.net/staph_2.htmlhttp://www.google.com.my/search?hl=ar&tbo=p&tbm=bks&q=inauthor:


16/17

23. Wisplinghoff H, Bischoff T, Tallent SM, et al. Nosocomial bloodstream infections

in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance

study. Clin Infect Dis 2004; 39:309.
http://www.uptodate.com/contents/epidemiology-of-staphylococcus-aureus-bacteremia-in-adults/abstract/4http://www.uptodate.com/contents/epidemiology-of-staphylococcus-aureus-bacteremia-in-adults/abstract/4http://www.uptodate.com/contents/epidemiology-of-staphylococcus-aureus-bacteremia-in-adults/abstract/4http://www.uptodate.com/contents/epidemiology-of-staphylococcus-aureus-bacteremia-in-adults/abstract/4http://www.uptodate.com/contents/epidemiology-of-staphylococcus-aureus-bacteremia-in-adults/abstract/4http://www.uptodate.com/contents/epidemiology-of-staphylococcus-aureus-bacteremia-in-adults/abstract/4http://www.uptodate.com/contents/epidemiology-of-staphylococcus-aureus-bacteremia-in-adults/abstract/4http://www.uptodate.com/contents/epidemiology-of-staphylococcus-aureus-bacteremia-in-adults/abstract/4


17/17

RESECH PROPOSAL

Documents

Transcript of RESECH PROPOSAL