Research Article Structural and Population Polymorphism of ...c markers of the avian schistosomes of...

Research ArticleStructural and Population Polymorphism ofRT-Like Sequences in Avian Schistosomes Trichobilharziaszidati (Platyhelminthes Digenea Schistosomatidae)

S K Semyenova G G Chrisanfova A S Guliaev A P Yesakova and A P Ryskov

Institute of Gene Biology Russian Academy of Sciences Vavilov Street 345 Moscow 119334 Russia

Correspondence should be addressed to S K Semyenova seraphimasmailru

Received 31 October 2014 Accepted 7 March 2015

Academic Editor Peter F Stadler

Copyright copy 2015 S K Semyenova et alThis is an open access article distributed under theCreativeCommonsAttribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Recently we developed the genus-specific markers of the avian schistosomes of the genus Trichobilharzia the causative agents ofhuman cercarial dermatitis The 7 novel genome sequences of T franki T regenti and T szidati revealed similarity with genomerepeat region of African schistosome Schistosoma mansoni In the present work we analyzed the 37 new T szidati sequences tostudy intragenome variability and host specificity for the parasite from three localities of East Europe DNAs were isolated fromcercariae or single sporocysts obtained from 6 lymnaeid snails Lymnaea stagnalis and L palustris from Belarus and Russia Allsequences formed three diverged groups one of which consists of the sequences with multiple deletions other groups involved twoparalogous copies with stop codons and frameshift mutations Strong association between geographical distribution and snail hostspecificity cannot be established All studied sequences have homology with the reverse transcriptase domain (RT) of Penelope-likeelements (PLE) of S mansoni and S japonicum and new members of RT family were identified We proposed that three divergedgroups RT sequences of T szidati are results of duplication or transposition of PLE during parasite evolution Implications of theretroelement dynamics in the life history of avian schistosomes are discussed

1 Introduction

Transposable elements (TEs) are an essential part of amoder-ately repetitive fraction of any eukaryotic genome Incorpo-rating into the various regions of genome they play a sig-nificant role in increasing mutational variability and reor-ganization of the genome TEs can also alter expression ofindividual genes and participate in formation of the newones [1] Genomic rearrangements induced by TEs are oftenassociated with a variety of adaptations to the environment[2 3] and thus promote reproductive isolation of organismsthat is they are implicated in speciation events [4 5] TEsdistributions can vary among isolates of single species soTEs have been used as markers to distinguish geneticallydivergent populations and subpopulations [6]

Retrotransposons constitute a significant proportion ofthe TEs their typical characteristic is the use of the reversetranscription mechanisms involving a reverse transcriptase(RT) Retrotransposons are major components of eukaryotic

genomes and have been usually divided into four classescontaining the long terminal repeat (LTR+) without LTR(non-LTR) Penelope-like elements (PLE) and DIRS Non-LTRs are grouped into 11 different clades based on thephylogeny of RT domains [7]

Several retrotransposons have been identified in bloodflukes of the genus Schistosoma Despite the fact that theyare more than half (585) of the repetitive elements [8 9]detailed characteristics are known only for a few LTR retro-transposons (Boudicca Gulliver for S mansoni and Tiao forS japonicum) as well as for some non-LTR retrotransposons(CR1 for S mansoni and S japonicum and SjR2 and Pido forS japonicum) [10] The third class of retrotransposons PLEis widespread among eukaryotes including schistosomes inwhich only two of PLEs were described [11 12]

As compared with these Schistosoma species the genomeof our object belongs to a more ancient group of the bloodflukes infectingwaterfowl namelyTrichobilharzia and is stillvirtually unexplored

Hindawi Publishing CorporationBioMed Research InternationalVolume 2015 Article ID 315312 8 pageshttpdxdoiorg1011552015315312

2 BioMed Research International

Table 1 General data for 6 cercarial isolates from L stagnalis and L palustris and for 40 sequences obtained by the primers TR98F andTR98R Distribution of clones examined between three groups indicated in Figure 1 is shown in square brackets [I II III]

Isolate Host Locality Total number of sequenceslowastlowast

119863-distance () minndashmax (average)Cercariae Sporocysts

Sz31 Ls Belarus 2 [2 0 0]spc 1 [1 3 3] 03ndash211 (106)

Sz43 Lp Belarus 2 [1 0 1] spc 2 [0 1 6] 0ndash13 (05)Σ = 14 [1 4 9] 0ndash209 (65)

Sz11 Lp Karelia 5 [4 0 1] mdash 05ndash196 (86)spc 1 [2 1 1] 0ndash201 (137)

Sz12 Lp Karelia mdash spc 2 [4 1 1] 03ndash199 (81)Σ = 10 [6 2 2] 0ndash205 (91)

Sz1 Ls Moscow 2 [1 1 0] mdash mdashSz3lowast Ls Moscow 5 [0 1 4] mdash 0ndash03 (02)

Σ

Ls 9 [3 2 4] mdash 0ndash183 (105)Lp 7 [5 0 2] 24 [7 6 11] 0ndash212 (113)

Ls + Lp 16 [8 2 6] 24 [7 6 11] 0ndash459 (241)lowast

This group includes three previously deposited sequences GU980751ndashGU980753 lowastlowastThe comparison was carried out only for 390 and 391 bp fragments spcsporocyst

We converted RAPD amplicons into SCAR (SequenceCharacterized Amplified Region) markers for three avianschistosome species T szidati T franki and T regentiand found new genus-specific repetitive sequences whichrevealed 64homologywith the repeat region of Schistosomamansoni [13] For that reason a pair of specific primers TR98Fand TR98R was matched to the sequence of one T frankiRAPD spectrum amplicon Following PCR allowed us todetect 391ndash393 bp fragments in the spectrum of each speciesand additional shorter fragment 274 bp was amplified onlyin T szidati which parasitized one snail Lymnaea stagnalisA few species-specific mutations and indels were found inseven nucleotide sequences from three schistosome genomesstudied and confirm the suitability of these sequences formolecular diagnostics of species of genusTrichobilharzia [13]

In another study we assessed the overall representationof different types of repeats in a small RAPD library of Tszidati obtained from clonal offsprings individual cercariaewithin daughter sporocysts 50 polymorphic nonoverlappingDNA fragments sim300ndash1500 bp were revealed from RAPDpatterns of 47 individual genomes of parasites infected 6freshwater snails L stagnalis These sequences containedtandem inverted and dispersed repeats as well as regionshomological to retroelements of two human parasites Smansoni and S japonicum Tandem and inverted repeatsconstituted 89 and 221 respectively while the percentageof dispersed repeats was 210 About 40 of sequencesof approximately 1000 bp included regions which displayedamino acid homology with open reading frame pol productsof S mansoni and S japonicum retroelements nonlong ter-minal repeat retrotransposons (nLTRs 76) long terminalrepeat retrotransposons (LTRs 14) and Penelope-like ele-ments (PLEs 10) Most of these regions (864) containedframeshifts gaps and stop codons [14] In the present studyone of the SCARs is to provide detailed characteristics of Tszidati intragenome variability for the first time Furthermore

we examined the host specificity of the parasites from threegeographic localities obtained from two freshwater snailspecies L stagnalis and L palustris We present the resultsof structural phylogenetic and bioinformatic analyses todetermine the distribution and possible functions of 37 newlyidentified genomic sequences belonging to the RT domainas a part of the PLE in T szidati We also demonstratedforthe first time that T szidati genomes contain threediverged-groups ofRT sequences which are result of duplication ortransposition of TEs during parasite evolution

2 Material and Methods

21 Collection Sites and Sequence Generation A total of 6T szidati isolates (infrapopulations) were collected fromthe freshwater snails Lymnaea stagnalis (Ls 119899 = 3) andLymnaea (Stagnicola) palustris (Lp 119899 = 3) The snails weresampled from the three geographical localities Moscowfreshwater pond Altufyevo (in 2005) Lake Naroch (Belarus2008) and Lake Onega (Karelia Russia 2012) (Table 1)Total genomic DNA was extracted from 5ndash10 ethanols fixedfree-swimming mature cercariae or fragments of individualsporocysts as described previously [14] PCR with a spe-cific primer pair TR98F (CTCCGACTGATGATGACAA-GAAGA) and TR98R (ATGAGTGGCGAACGGTATCCT)and cloning and sequencing of amplified products were car-ried out as described [13] For each PCR fragment 2ndash5 cloneswere sequenced In total 37 newly generated sequences wereanalyzed of which 30 clones contained inserts of 390 or391 bp and 7 contained the shorter inserts of 274 bp in sizeAll sequences were deposited in GenBank under accessionnumbers KP889985-890021

22 Data Analysis Multiple alignments were made withCLUSTAL and MUSCLE algorithms implemented in

BioMed Research International 3

MEGA52 [15] software and were edited manually Searchof stop codons in alignments ATGC ratio mean pairwisegenetic distances (min-max overall 119889-distance) [16] andcodon based 119885-test of neutrality (Nei-Gojobori method withJukes-Cantor correction and 1000 bootstrap replications)were made using MEGA version 52 Phylogenetic analysis(Neighbour Joining and Bayesian Inference) was performedby MEGA version 52 and MrBayes version 322 software[17] The best-fit nucleotide substitution model was selectedusing jModelTest version 216 [18] We used HKY modelfor Bayesian analysis with two simultaneous runs of fourchains for 5 000 000 generations sampling trees every 500generations The first 25 trees sampled were discardedas ldquoburn-inrdquo For comparative analysis we used threesequences of T szidati deposited in GenBank (Acc numbersGU980751ndashGU980753 [13])

Similarity searches of homology between our nucleotidesequences of T szidati and previously known nucleotideand amino-acid sequences of mammalian schistosomes andother trematodes have been performed using BLAST (blastnblastx and tblastx) with the default parameters [19]

3 Results

31 Analysis of Intra- and among Population Variability SixDNA patterns were obtained with the use of two specificprimers TR98F and TR98R andDNA templates isolated frommature cercariae or individual sporocysts from six isolatesinfecting the three snails of L stagnalis (Ls) and three snails ofL palustris (Lp) during the course of PCR amplification Eachof the patterns comprises two amplicons with the identicalintensity of UV luminescence and approximate size of 400and 300 bp The size of the cloned sequences of the longeramplicon (119899 = 30) reached 390ndash391 bp and the sequencesof the shorter fragment (119899 = 7) contained 274 bp Only 17sequences out of 40 were unique and the rest contained fromtwo to four identical copies

Estimates of genetic heterogeneity of each of the sixT szidati infrapopulations (isolates from single snails) arepresented in Table 1 They were obtained by calculation ofgenetic distances for each pair of sequences of the size 390and 391 bp of free-swimming mature cercariae (isolates Sz3and Sz11) and fragments of single sporocysts (isolates Sz12 andSz43) The maximum and minimum estimates of divergencebetween pairs ranged from 0 to 211 and depend mainly onthe size of the sample Sequence divergence was revealed tobe up to 03 in a few samples of the parasite of snails LsThemaximumdiffering copies (up to 21)were found amongthe parasites that infect the snails Lp (isolates Sz11 Sz12 andSz43) Despite this the average levels of divergence betweenthe copies do not differ much for cercariae isolated from thetwo different species of snails (105 and 113) In the totalsample the divergence of copies reaches 241

The reason for such a high intraspecific heterogeneitybecomes apparent in the construction of the dendrogramof genetic differences demonstrating the distribution of 40sequences in six infrapopulations from the three geographicallocalities (Figure 1) 15 sequences of 390 bp in size (Group

I) and 17 sequences of 391 bp (Group III) are combined intwo large clusters with high reliability (IB = 100) Thus thefull-length amplicons form the two groups of significantlydiverged sequences

The intragroup differentiation is somewhat higher forGroup III (119863 = 39) compared with Group I (119863 =06) whereas the intergroup differences account for 241(Table 2) Eight sequences of short copies of 274 bp formits own cluster (IB = 100) It is composed of two distinctcopies of the isolate Sz1 derived from the L stagnalis Ls1(Moscow) Apart from them there are six sequences ofthe two schistosome isolates Sz12 and Sz43 from snails Lpalustris (Karelia and Belarus) (Figure 1 Group II) Theaverage value of 119863 in the group II is 22 In Group Iwe found no clear subclusters neither characterizing geo-graphic population identity nor belonging to either of twospecies of intermediate snail hosts In the third group foursequences of the parasite from one L stagnalis fromMoscow(isolate Sz3) and schistosome sequences from L palustrisfrom Belarus (isolate Sz43) comprised their own subclustersThe sequences of two isolates Sz11 and Sz12 from Karelianmollusks L palustris either fall into one of the two subclustersor stand quite separately (eg variant Sz12 1 11 on Figure 1)Note that another sequence of isolate Sz11 namely Sz11 5holds an isolated position in Group I

Occasionally snails in natural populations can be infectedwith not one but twoormoremiracidia having different geno-types This leads to biased estimates of variability in someinfrapopulations Therefore we compared the variability notonly ofmature cercariae but also of individual sporocysts Forthis purpose two sporocysts (spc1 and spc2) were isolatedfrom each of the two snails L palustris from Belarus (Sz43)and Karelia (Sz12) and for each of them from four to sevensequences were obtained Individual variability of sporocystsconsisted of the presence of two or three differing copies ineach of the three groups of sequences

Sequences of Groups I and II were simultaneously iden-tified in only three of sporocysts where the average levelof divergence was high and reached 81 (Sz12 2) 106(Sz43 1) and 137 (Sz12 1) All sequences of the remainingsporocyst Sz43 2 belong to Group II and were almost identi-cal (119863 = 05) All short copies were also almost the sameboth within individual sporocysts and between sporocystsfrom the same mollusk (Figure 1) while the most divergenttwo copies from Group II (Sz12S 2 16 and Sz12S1 10) andGroup III (Sz12 1 11 and Sz12 2 17) which define the highestlevel of infrapopulation variability in Sz12 are the part ofthe genomes of both sporocysts 1 and 2 of mollusk Sz12Thus comparing the genetic heterogeneity of cercariae fromone sporocyst we demonstrated that the composition ofa bird schistosome T szidati genome could simultaneouslypresent three groups of copies of closely related sequencesMaximum intragenomic divergence is typical for the parasiteinfrapopulation from mollusk L palustris (Karelia) and canreach 20

The distribution of copies in the six infrapopulations ofsnails indicates a lack of host specificity However there is atendency to the formation of specific sets of copies of GroupsII and III in geographically isolated parasite infrapopulations


Table 2 Characteristics of intra- and intergroup polymorphism and results of similarity search of studied T szidati sequences

SimilarityGroups Polymorphism BLASTN BLASTX TBLASTX

(++) (Frame +3) (Frame +3+3)

Group I

119873 = 15

119871 = 390

119881 = 12

Pinfo = 2AT GC = 623 377119885 test dN-dS = minus0021 (119875 = 0983)Dn = 06Da = 11

No

Sm RT CAJ00247score 493ndash524 bits Exp2119890 minus 05ndash2119890 minus 04 cover51 (15ndash215 bp) I =39ndash42Sj RT CAX83715score 481ndash508 bits Exp6119890 minus 05ndash1119890 minus 04 cover54 (3ndash215 bp) I =35ndash38Cs RTGAA47523score 458ndash462 bits Exp0002ndash0003 cover 40(57ndash215 bp) I = 42

Sj Penelope-like elementretrotransposonSj-penelope2 FN356226score 654ndash702 bits Exp3119890 minus 24ndash4119890 minus 17 cover 98(3ndash215 bp) I = 39ndash42Sm Penelope-likeretrotransposon Perere-10BN000801Score 542ndash588 bits Exp3119890 minus 13ndash6119890 minus 06 Cover53-54 (15ndash221 bp) I =39ndash42

Group II

119873 = 8

119871 = 274

119881 = 20


No

Cs RTGAA47523score 350 Exp 45ndash46cover 43ndash48(466ndash521 bp) I =38-39

No

Group III

119873 = 17

119871 = 391

119881 = 24


S j Anhui clone BACC108 113I17FN293021score 554 bits Exp119890 minus 04 cover 17(308ndash375 bp) I = 78Chr1 chr2 chr3 chr4chr7 Wchrscore 482ndash464 bitsExp 119890 minus 026 cover15ndash19 (116ndash220 bp)I = 70ndash77

Sm RT CAJ00247score 647ndash736 bits Exp9119890 minus 13ndash2119890 minus 07 cover91ndash95 (15ndash386 bp) I =30ndash37Sj RT CAX83715score 504ndash608 bits Exp9119890 minus 05ndash2119890 minus 07 cover77ndash95 (3ndash374 bp) I =30ndash32Cs RTGAA47523score 462ndash522 bits Exp5119890 minus 05ndash0002 cover39ndash41 (3ndash374 bp) I =47ndash49

Sj Penelope-like elementretrotransposonSj-penelope2 FN356226score 702ndash1030 bits Exp1119890 minus 26ndash2119890 minus 19 cover 98(3ndash386 bp) I = 34ndash36Sm Penelope-likeretrotransposon Perere-10BN000801score 826ndash831 bits Exp2119890 minus 20ndash3119890 minus 13 cover 95(15ndash386 bp) I = 35Sm Chr1 chr3 chr4 chr7Wchrscore 118ndash482 bits Exp119890 minus 14ndash11989028 cover 98-99(3ndash386 bp) I = 27ndash47S j Anhui clone BACC108 113I17 FN293021score 35ndash492 bits Exp1119890 minus 06ndash4119890 minus 04 cover40ndash93 (81ndash230 bp) I =26ndash40

Groups I +III

119873 = 32

119871 = 391

119881 = 203

AT GC = 604 396Pinfo = 182119885 test dN-dS = minus2640 (119875 = 0009)Dn = 241Da = 216

mdash mdash mdash

119873 the sequence numbers 119871 length (bp) 119881 the number of variable sites Pinfo the number of parsimonial sites 119863 distance () Sm S mansoni Sj Sjaponicum Cs Clonorchis sinensis RT reverse transcriptase Dn nucleotide divergence Da amino acid divergence


Sz12_1_5Sz12_2_16Sz12_2_6Sz12_2_15Sz43_1_2Sz43_1Sz31_2Sz1_7Sz31_1

Sz11_4Sz11_3

Sz12_1_13Sz11_2Sz12_2_5

Sz11_5GU980753 Ts3-3

Sz1S_18Sz12S_2_16Sz43S_2_7

Sz43S_1_1Sz43S_1_4Sz43S_1_2

Sz12S_1_10Sz3_1GU980751 Ts3-1

Sz3_2GU980752 Ts3-2

Sz11_1Sz12_1_11

Sz12_2_17Sz43_1_12

Sz43_1_1Sz43_2_5Sz43_2_9

Sz43_2Sz43_1_3Sz43_2_6Sz43_2_8Sz43_2_11

Sz43_2_19

67

9863

8590

100100

73

6850

100100

62

8897

99100

7353

100100

1001006573

6396

43

002

L stagnalisBelarus BelarusMoscow

L palustris

Karelia

Group I

Group II

Group III

mdash100

Figure 1 Phylogenetic tree ofT szidati inferred from 40 RT-like sequences Topology was inferred usingMEGA 52 software (NJ p-distance1000 bootstrap replications) and confirmed by MrBayes 322 Node support values are shown as follows the first value is Bayesian posteriorprobability assessed using MrBayes software and the second value is bootstrap support assessed by NJ method using MEGA 52 softwareSequences belonging to different localities and host snails are shown by differently colored figures (see the legend)


Stop codon

III

I

II

391bp

390bp

274bp

D = 0ndash18(06)

D = 0ndash44(22)

D = 0ndash90(39)

Figure 2 Schematic image of the distribution of polymorphic sitesand deletions and the location of stop codons in each of the threeRT-like sequences groups of T szidati D min-max and average (inparentheses) pairwise genetic distances

L stagnalis from Moscow and in the pooled sample ofparasites of L palustris from Karelia and Belarus Howeverto clarify these results it is necessary to study more represen-tative samples of Trichobilharziandashinfected snails from widergeographical origins

32 Analysis of the Sequence Structure and Search SimilarityFigure 2 gives schematically the distribution of polymorphicsites deletions and the location of stop codons in each ofthe three groups of sequences All sequences of Group Ihave a length of 390 bp due to a single nucleotide deletionat position 211 compared with the sequences of Group III(391 bp) All short sequences of Group II with the size of274 bp have four extended deletions of total length 117 bp(14 nt 38ndash51 bp 36 nt 133ndash168 bp 5 nt 229ndash233 bp 62 nt273ndash334 bp) Groups I and III sequences each contains threestop codons and Group II one stop codon Their position isindicated with triangle in Figure 2 The second stop codon inGroup III is revealed only in a half of the sequences An excessof AT-bases (AT GC = 604 396) known in all trematodesis found in the nucleotide composition of all sequences(Table 2) Average estimates of divergence of nucleotide andamino acid sequences are the same for Groups II and IIIand amino acid divergence is somewhat higher comparing tonucleotide divergence inGroup I (Dn= 06 Da = 11) Codon-based 119911-test of neutrality showed that observedmutations aresignificantly neutral only within concatenated Groups I andIII Within each group separately results of neutrality test areinsignificant as well as results of both purifying and positiveselection tests (Table 2)

Table 2 summarizes also the results of T szidati sequencehomology with nucleotide and amino acid sequences avail-able throughout theNCBIWe found no significant similarityof T szidati nucleotide sequences in Groups I and II withextended sequences of mammalian schistosome genomes(blastn) Only for Group III a high similarity of shortsegments of the sequences (about 40 nt) with the intergenicregions of 1 2 3 4 and 7 and W-chromosomes of Smansoni as well as with more extensive (about 70 nt) unan-notated region of the BAC-clone of S japonicum (C108 113I17FN293021) was revealed

Translated nucleotide sequence similarity search (blastx)revealed a significant homology between the sequences ofGroups I and III and the reverse transcriptase domain of

two mammalian schistosome species S mansoni (AssnSA00247) and S japonicum (Assn SAX83715) The length ofthese GenBank sequences is equal to 394 and 500 amino acidresidues respectively and the regions of similarity are locatedalmost at the 51015840 terminus and comprise about 125 amino acidresidues of the mammalian schistosomersquos RT Moreover asignificant similarity (41ndash51) with the two shorter regions(30ndash80 aa) of the RT sequence of the human fluke Clonorchissinensis (532 amino acid residues GAA47523) was foundTherefore the results of similarity search with known Schis-tosoma amino acid sequences indicate that new sequences ofT szidati belong to the family of reverse transcriptase (RT)genes

Furthermore using another BLAST algorithm (blastx)the highest similarity our sequences (sim36 for Group IIIsim42 for Group I) was found to the 51015840 terminus of the reversetranscriptase domain of two retrotransposons of S man-soni (Perere-10 BN000801) and S japonicum (Sj-penelope2FN356226) belonging to a large class of Penelope-like trans-posable elements In addition the amino acid sequencesof Group III demonstrate 27ndash47 similarity with the shortregions on the chromosomes 1ndash4 7 andW-chromosome of Smansoni included in the introns of hypothetical proteins ornoncoding intergenic regions

4 Discussion

Search for homology with known schistosome amino acidsequences of the Schistosoma genus indicates that newgenome sequences of the avian schistosomes T szidati belongto theRTdomainwhich is common to all retroretroelementsReverse transcriptase is the most highly conserved proteinencoded by retroviruses and retrotransposonsThis peculiar-ity allows the use of RT sequences as recognizing phyloge-netic signature of host taxa in a retrotransposon phylogenybesides that for studying the dynamics of retroposition in thelife cycle to determine its life history [20 21]

Relatively little is known about intraspecies and intrage-nomic variability of RT among invertebrates Usually it doesnot exceed 10 for the members of the same subfamily

Thus mean intraspecific divergence is 288 betweenreverse transcriptase sequences of SURL elements (fromthe gypsy group) in the closely related echinoid speciesStrongylocentrotus purpuratus and S droebachiensis [22]Several families of elements were found in African and Asianschistosomes which were characterized bymore than 80 ofsimilarity in amino acid sequences of RT It has been shownthat a family can combine both copies of the same elementand the closely related elements [23]

Significant variability in the composition of RT-likesequences (0ndash212) of 390-391 bp in size was found whenstudying T szidati infecting three snails of L palustris Theseestimates do not depend on the geographical location of thesnails (Belarus and Karelia) nor on the stage of the parasitelife cycle (free-swimming mature cercariae or fragments ofsingle sporocysts)

The main reason for the high heterogeneity of the RT-like sequences of T szidati is a simultaneous occurrence


of significantly diverged copies of Groups I and III in onegenome (Table 1 Figure 1)

The nucleotide and amino acid divergence between RTcopies of these groups is 20 on average reaching the level of45 for individual copies (Table 2) Given the lack of detailedannotation of the complete genome sequences of African andAsian mammalian schistosomes we are able to conditionallyinclude all detected RT copies to the members of the samefamily for the present The average sequence divergence in agroup is less than 4 thus presumably we are dealing withrepresentatives of several RT lines or subfamilies

All detected RT-like copies probably are inactive copies asthey contain either stop codons (Groups I and III) or a singlenucleotide deletion (Group I) modifying the reading frame(frame shiftmutation) Note that short copies of 274 bp in sizeof Group II pertain to inactive copies

These copies with typical extended deletions are moredegenerated comparing with the previously mentioned RTcopies Due to the fact that any detected changes in thestructure of RT sequences inT szidati are incapable of codingfor a functional reverse transcriptase (breaking the readingframe of RT) we can refer the elements of each of the threegroups to pseudogenes derived from the RT protein-codinggene Since the pseudogene evolved under neutrality (119885-testsTable 2) they may show the higher level of diversity in somecases For instance there is a 45 of sequences divergencebetween the pairs Sz43 2 10 and Sz12 1 5 (Figure 1 Table 1)Thus for the first time we have discovered the three typesof degenerated RT copies in the same genome of avianschistosomes probably belonging to a few closely relatedsubfamilies of transposable elements

To date from all deposited RT-containing retrotrans-posons of mammalian schistosomes (see Introduction) newobtained sequences detected in the T szidati genome showsignificant similaritywith representatives of the Penelope-likeelements (Perere-10 and Sj-penelope2) Therefore we havereason to include currently all identified RT copies in the Tszidati genome to a class of PLE

The absence of intact sequences among the discoveredcopies indicates their ancient origin while the older groupseems to be a group of highly degenerated and reduced insize sequences of Group II Compared with them paralogs ofGroup I are less degenerated having only one reading frameshift mutation and several stop codons Copies of Group IIIwith two or three stop codons degenerated probably muchlater and therefore only for copies of this group small areas ofsimilar genomic sequences on the five chromosomes ofmam-malian schistosome S mansoni were found as well Besidestheir use for phylogenetic reconstruction demonstrates thepresence of intraspecies structure in T szidati (Figure 1)

We cannot yet reconstruct a detailed scenario for theorigin and invading of discovered RT-like sequences inpopulations of T szidati on the limited material It is likelythat the occurrence of paralogous RT copies is associatedwith transposition bursts that took place in the remote pastof avian schistosomes Apparently two acts of transpositionbursts could result in the three types of RT copies in thegenome of modern T szidati The most compelling evidenceof this assumption will be obtained from the analysis of

the whole genome sequencing of different species of avianschistosomes Currently similar analysis was carried out forgenomes of the schistosomes S mansoni and S japonicum[23] Considerable differences in retrotransposon represen-tation have been shown between the two species (22 and13 resp) A large part of this difference can be attributed tohigher representation of two previously described retrotrans-poson families SR2 and Perere-3SR3 of S mansoni It wassuggested that the S mansoni SR2 families were the subject ofrecent bursts of transposition that were not paralleled by theirS japonicum counterparts It was hypothesized that thesebursts could be a consequence of the evolutionary pressureresulting from migration of Schistosoma from Asia to Africaand their establishment in this new environment helpingboth speciation and adaptation [23]

Similar processes could occur during the life historyof avian schistosomes Their definitive hosts ducks of thefamily Anatidae are characterized by long-distance spatialand temporal migrations changing of ecological niches andmultiple range expansions [24] It is necessary to add thatprocesses of snail-parasite interactions occurring duringthe development or change of the intermediate snail hostalso have a significant role in the genetic differentiationof schistosomes [25] During the evolutionary radiation ofmammalian schistosomes Asian and African groups haveadapted to parasitizing on the snails of different groups ofGastropoda African schistosomes infected representatives ofseveral families of pulmonate snails (Pulmonata) and Asianspecies feed on mollusks belonging to the CaenogastropodaThese processes resulted just in mitochondrial genome rear-rangement Thus the ancestral gene order of mtDNA isconserved amongst East Asian Schistosoma spp [26] anddifferent amongst species sampled from Africa or India [2728] In the evolution of amore ancient group of schistosomesnamely avian schistosomes multiple repeated changes of thedefinitive and intermediate hosts could also occur as well asgenerating of new molecular adaptations and increasing thetransposition activity of TEs may serve as markers of suchevents

5 Conclusions

In the present work 37 new sequences obtained from genomeof avian schistosome Trichobilharzia szidati parasitized 6lymnaeid snails L stagnalis and L palustris from Belarusand Russia were revealed Phylogenetic reconstructions andBLAST search results indicate that all studied sequencesdemonstrate homologywith the reverse transcriptase domain(RT) of Penelope-like elements of African and Asian mam-malian schistosomes S mansoni and S japonicum Futurewhole genome sequencing and population-wide analysis ofavian schistosomes will help to understand the features of theretrotransposon expansion during host-parasite coevolution

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper


Authorsrsquo Contribution

S K Semyenova and G G Chrisanfova equally contributedto the study

Acknowledgments

The authors thank E P Ieshko S A Bersquoer and M V Voroninfor help in collecting infected snails and A A Lopatkin forhelp with PCR amplificationThis work was supported by theRussian Science Foundation no 14-14-00832

References

[1] M G Kidwell and D Lisch ldquoTransposable elements as sourcesof variation in animals and plantsrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 94 no15 pp 7704ndash7711 1997

[2] A L Schmidt and L M Anderson ldquoRepetitive DNA elementsas mediators of genomic change in response to environmentalcuesrdquo Biological Reviews of the Cambridge Philosophical Societyvol 81 no 4 pp 531ndash543 2006

[3] E Casacuberta and J Gonzalez ldquoThe impact of transposableelements in environmental adaptationrdquoMolecular Ecology vol22 no 6 pp 1503ndash1517 2013

[4] H H Kazazian Jr ldquoMobile elements drivers of genomeevolutionrdquo Science vol 303 no 5664 pp 1626ndash1632 2004

[5] K R Oliver andW K Greene ldquoTransposable elements power-ful facilitators of evolutionrdquoBioEssays vol 31 no 7 pp 703ndash7142009

[6] J Jurka W Bao and K K Kojima ldquoFamilies of transposableelements population structure and the origin of speciesrdquoBiology Direct vol 6 article 44 16 pages 2011

[7] H S Malik W D Burke and T H Eickbush ldquoThe age andevolution of non-LTR retrotransposable elementsrdquo MolecularBiology and Evolution vol 16 no 6 pp 793ndash805 1999

[8] M Berriman B J Haas P T LoVerde et al ldquoThe genome of theblood fluke SchistosomamansonirdquoNature vol 460 no 7253 pp352ndash358 2009

[9] F Liu Y Zhou Z-Q Wang et al ldquoThe Schistosoma japonicumgenome reveals features of hostndashparasite interplayrdquo Nature vol460 no 7253 pp 345ndash351 2009

[10] P J Brindley C S Copeland and B H Kalinna ldquoSchistosomeretrotransposonrdquo in Schistosomiasis W E Secor and D GColley Eds pp 13ndash26 2005

[11] I R Arkhipova ldquoDistribution and phylogeny of Penelope-likeelements in eukaryotesrdquo Systematic Biology vol 55 no 6 pp875ndash885 2006

[12] R DeMarco A T Kowaltowski A A Machado et al ldquoSaci-1 -2 and -3 and perere four novel retrotransposons with hightranscriptional activities from the human parasite Schistosomamansonirdquo Journal of Virology vol 78 no 6 pp 2967ndash29782004

[13] A V Korsunenko G G Chrisanfova A P Ryskov S OMovsessian V A Vasilyev and S K Semyenova ldquoDetectionof European Trichobilharzia schistosomes (T franki T szidatiand T regenti) based on novel genome sequencesrdquo Journal ofParasitology vol 96 no 4 pp 802ndash806 2010

[14] A Korsunenko G Chrisanfova A Arifov A Ryskov and SSemyenova ldquoCharacterization of randomly amplified polymor-phic DNA (RAPD) fragments revealing clonal variability in cer-cariae of avian schistosome Trichobilharzia szidati (TrematodaSchistosomatidae)rdquo Open Journal of Genetics vol 3 no 3 pp141ndash158 2013

[15] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[16] F Tajima and M Nei ldquoEstimation of evolutionary distancebetween nucleotide sequencesrdquo Molecular Biology and Evolu-tion vol 1 no 3 pp 269ndash285 1984

[17] F Ronquist and J P Huelsenbeck ldquoMrBayes 3 bayesian phylo-genetic inference under mixed modelsrdquo Bioinformatics vol 19no 12 pp 1572ndash1574 2003

[18] D Darriba G L Taboada R Doallo and D Posada ldquoJMod-elTest 2 more models new heuristics and parallel computingrdquoNature Methods vol 9 no 8 p 772 2012

[19] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990

[20] Y Xiong and T H Eickbush ldquoOrigin and evolution of retroele-ments based upon their reverse transcriptase sequencesrdquo TheEMBO Journal vol 9 no 10 pp 3353ndash3362 1990

[21] T H Eickbush ldquoOrigin and evolutionary relationship ofretroelementsrdquo in Evolutionary Biology of Viruses S S MorseEd pp 121ndash157 Raven Press 1994

[22] M S Springer N A Tusneem E H Davidson and R J BrittenldquoPhylogeny rates of evolution and patterns of codon usageamong sea urchin retroviral-like elements with implications forthe recognition of horizontal transferrdquo Molecular Biology andEvolution vol 12 no 2 pp 219ndash230 1995

[23] T M Venancio R A Wilson S Verjovski-Almeida and RDeMarco ldquoBursts of transposition from non-long terminalrepeat retrotransposon families of the RTE clade in Schistosomamansonirdquo International Journal for Parasitology vol 40 no 6pp 743ndash749 2010

[24] Y Liu I Keller and G Heckel ldquoBreeding site fidelity and winteradmixture in a long-distance migrant the tufted duck (Aythyafuligula)rdquo Heredity vol 109 no 2 pp 108ndash116 2012

[25] A E Lockyer C S Jones L R Noble and D RollinsonldquoTrematodes and snails an intimate associationrdquo CanadianJournal of Zoology vol 82 no 2 pp 251ndash269 2004

[26] T H Le D Blair T Agatsuma et al ldquoPhylogenies inferred frommitochondrial gene ordersmdasha cautionary tale from the parasiticflatwormsrdquo Molecular Biology and Evolution vol 17 no 7 pp1123ndash1125 2000

[27] A E Lockyer PDOlson POslashstergaard et al ldquoThephylogeny ofthe Schistosomatidae based on three geneswith emphasis on theinterrelationships of SchistosomaWeinland 1858rdquo Parasitologyvol 126 no 3 pp 203ndash224 2003

[28] B LWebster andD T J Littlewood ldquoMitochondrial gene orderchange in Schistosoma (Platyhelminthes Digenea Schistoso-matidae)rdquo International Journal for Parasitology vol 42 no 3pp 313ndash321 2012

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


Table 1 General data for 6 cercarial isolates from L stagnalis and L palustris and for 40 sequences obtained by the primers TR98F andTR98R Distribution of clones examined between three groups indicated in Figure 1 is shown in square brackets [I II III]

Isolate Host Locality Total number of sequenceslowastlowast

119863-distance () minndashmax (average)Cercariae Sporocysts

Sz31 Ls Belarus 2 [2 0 0]spc 1 [1 3 3] 03ndash211 (106)

Sz43 Lp Belarus 2 [1 0 1] spc 2 [0 1 6] 0ndash13 (05)Σ = 14 [1 4 9] 0ndash209 (65)

Sz11 Lp Karelia 5 [4 0 1] mdash 05ndash196 (86)spc 1 [2 1 1] 0ndash201 (137)

Sz12 Lp Karelia mdash spc 2 [4 1 1] 03ndash199 (81)Σ = 10 [6 2 2] 0ndash205 (91)

Sz1 Ls Moscow 2 [1 1 0] mdash mdashSz3lowast Ls Moscow 5 [0 1 4] mdash 0ndash03 (02)

Σ

Ls 9 [3 2 4] mdash 0ndash183 (105)Lp 7 [5 0 2] 24 [7 6 11] 0ndash212 (113)

Ls + Lp 16 [8 2 6] 24 [7 6 11] 0ndash459 (241)lowast

This group includes three previously deposited sequences GU980751ndashGU980753 lowastlowastThe comparison was carried out only for 390 and 391 bp fragments spcsporocyst

We converted RAPD amplicons into SCAR (SequenceCharacterized Amplified Region) markers for three avianschistosome species T szidati T franki and T regentiand found new genus-specific repetitive sequences whichrevealed 64homologywith the repeat region of Schistosomamansoni [13] For that reason a pair of specific primers TR98Fand TR98R was matched to the sequence of one T frankiRAPD spectrum amplicon Following PCR allowed us todetect 391ndash393 bp fragments in the spectrum of each speciesand additional shorter fragment 274 bp was amplified onlyin T szidati which parasitized one snail Lymnaea stagnalisA few species-specific mutations and indels were found inseven nucleotide sequences from three schistosome genomesstudied and confirm the suitability of these sequences formolecular diagnostics of species of genusTrichobilharzia [13]

In another study we assessed the overall representationof different types of repeats in a small RAPD library of Tszidati obtained from clonal offsprings individual cercariaewithin daughter sporocysts 50 polymorphic nonoverlappingDNA fragments sim300ndash1500 bp were revealed from RAPDpatterns of 47 individual genomes of parasites infected 6freshwater snails L stagnalis These sequences containedtandem inverted and dispersed repeats as well as regionshomological to retroelements of two human parasites Smansoni and S japonicum Tandem and inverted repeatsconstituted 89 and 221 respectively while the percentageof dispersed repeats was 210 About 40 of sequencesof approximately 1000 bp included regions which displayedamino acid homology with open reading frame pol productsof S mansoni and S japonicum retroelements nonlong ter-minal repeat retrotransposons (nLTRs 76) long terminalrepeat retrotransposons (LTRs 14) and Penelope-like ele-ments (PLEs 10) Most of these regions (864) containedframeshifts gaps and stop codons [14] In the present studyone of the SCARs is to provide detailed characteristics of Tszidati intragenome variability for the first time Furthermore

we examined the host specificity of the parasites from threegeographic localities obtained from two freshwater snailspecies L stagnalis and L palustris We present the resultsof structural phylogenetic and bioinformatic analyses todetermine the distribution and possible functions of 37 newlyidentified genomic sequences belonging to the RT domainas a part of the PLE in T szidati We also demonstratedforthe first time that T szidati genomes contain threediverged-groups ofRT sequences which are result of duplication ortransposition of TEs during parasite evolution

2 Material and Methods

21 Collection Sites and Sequence Generation A total of 6T szidati isolates (infrapopulations) were collected fromthe freshwater snails Lymnaea stagnalis (Ls 119899 = 3) andLymnaea (Stagnicola) palustris (Lp 119899 = 3) The snails weresampled from the three geographical localities Moscowfreshwater pond Altufyevo (in 2005) Lake Naroch (Belarus2008) and Lake Onega (Karelia Russia 2012) (Table 1)Total genomic DNA was extracted from 5ndash10 ethanols fixedfree-swimming mature cercariae or fragments of individualsporocysts as described previously [14] PCR with a spe-cific primer pair TR98F (CTCCGACTGATGATGACAA-GAAGA) and TR98R (ATGAGTGGCGAACGGTATCCT)and cloning and sequencing of amplified products were car-ried out as described [13] For each PCR fragment 2ndash5 cloneswere sequenced In total 37 newly generated sequences wereanalyzed of which 30 clones contained inserts of 390 or391 bp and 7 contained the shorter inserts of 274 bp in sizeAll sequences were deposited in GenBank under accessionnumbers KP889985-890021

22 Data Analysis Multiple alignments were made withCLUSTAL and MUSCLE algorithms implemented in




3 Results












(++) (Frame +3) (Frame +3+3)

Group I

119873 = 15

119871 = 390

119881 = 12


No



Group II

119873 = 8

119871 = 274

119881 = 20


No


No

Group III

119873 = 17

119871 = 391

119881 = 24





Groups I +III

119873 = 32

119871 = 391

119881 = 203


mdash mdash mdash




Sz11_4Sz11_3

Sz12_1_13Sz11_2Sz12_2_5

Sz11_5GU980753 Ts3-3

Sz1S_18Sz12S_2_16Sz43S_2_7

Sz43S_1_1Sz43S_1_4Sz43S_1_2

Sz12S_1_10Sz3_1GU980751 Ts3-1

Sz3_2GU980752 Ts3-2

Sz11_1Sz12_1_11

Sz12_2_17Sz43_1_12

Sz43_1_1Sz43_2_5Sz43_2_9

Sz43_2Sz43_1_3Sz43_2_6Sz43_2_8Sz43_2_11

Sz43_2_19

67

9863

8590

100100

73

6850

100100

62

8897

99100

7353

100100

1001006573

6396

43

002


L palustris

Karelia

Group I

Group II

Group III

mdash100



Stop codon

III

I

II

391bp

390bp

274bp

D = 0ndash18(06)

D = 0ndash44(22)

D = 0ndash90(39)








4 Discussion
















5 Conclusions







Acknowledgments


References




































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




3 Results












(++) (Frame +3) (Frame +3+3)

Group I

119873 = 15

119871 = 390

119881 = 12


No



Group II

119873 = 8

119871 = 274

119881 = 20


No


No

Group III

119873 = 17

119871 = 391

119881 = 24





Groups I +III

119873 = 32

119871 = 391

119881 = 203


mdash mdash mdash




Sz11_4Sz11_3

Sz12_1_13Sz11_2Sz12_2_5

Sz11_5GU980753 Ts3-3

Sz1S_18Sz12S_2_16Sz43S_2_7

Sz43S_1_1Sz43S_1_4Sz43S_1_2

Sz12S_1_10Sz3_1GU980751 Ts3-1

Sz3_2GU980752 Ts3-2

Sz11_1Sz12_1_11

Sz12_2_17Sz43_1_12

Sz43_1_1Sz43_2_5Sz43_2_9

Sz43_2Sz43_1_3Sz43_2_6Sz43_2_8Sz43_2_11

Sz43_2_19

67

9863

8590

100100

73

6850

100100

62

8897

99100

7353

100100

1001006573

6396

43

002


L palustris

Karelia

Group I

Group II

Group III

mdash100



Stop codon

III

I

II

391bp

390bp

274bp

D = 0ndash18(06)

D = 0ndash44(22)

D = 0ndash90(39)








4 Discussion
















5 Conclusions







Acknowledgments


References




































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




(++) (Frame +3) (Frame +3+3)

Group I

119873 = 15

119871 = 390

119881 = 12


No



Group II

119873 = 8

119871 = 274

119881 = 20


No


No

Group III

119873 = 17

119871 = 391

119881 = 24





Groups I +III

119873 = 32

119871 = 391

119881 = 203


mdash mdash mdash




Sz11_4Sz11_3

Sz12_1_13Sz11_2Sz12_2_5

Sz11_5GU980753 Ts3-3

Sz1S_18Sz12S_2_16Sz43S_2_7

Sz43S_1_1Sz43S_1_4Sz43S_1_2

Sz12S_1_10Sz3_1GU980751 Ts3-1

Sz3_2GU980752 Ts3-2

Sz11_1Sz12_1_11

Sz12_2_17Sz43_1_12

Sz43_1_1Sz43_2_5Sz43_2_9

Sz43_2Sz43_1_3Sz43_2_6Sz43_2_8Sz43_2_11

Sz43_2_19

67

9863

8590

100100

73

6850

100100

62

8897

99100

7353

100100

1001006573

6396

43

002


L palustris

Karelia

Group I

Group II

Group III

mdash100



Stop codon

III

I

II

391bp

390bp

274bp

D = 0ndash18(06)

D = 0ndash44(22)

D = 0ndash90(39)








4 Discussion
















5 Conclusions







Acknowledgments


References




































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



Sz11_4Sz11_3

Sz12_1_13Sz11_2Sz12_2_5

Sz11_5GU980753 Ts3-3

Sz1S_18Sz12S_2_16Sz43S_2_7

Sz43S_1_1Sz43S_1_4Sz43S_1_2

Sz12S_1_10Sz3_1GU980751 Ts3-1

Sz3_2GU980752 Ts3-2

Sz11_1Sz12_1_11

Sz12_2_17Sz43_1_12

Sz43_1_1Sz43_2_5Sz43_2_9

Sz43_2Sz43_1_3Sz43_2_6Sz43_2_8Sz43_2_11

Sz43_2_19

67

9863

8590

100100

73

6850

100100

62

8897

99100

7353

100100

1001006573

6396

43

002


L palustris

Karelia

Group I

Group II

Group III

mdash100



Stop codon

III

I

II

391bp

390bp

274bp

D = 0ndash18(06)

D = 0ndash44(22)

D = 0ndash90(39)








4 Discussion
















5 Conclusions







Acknowledgments


References




































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


Stop codon

III

I

II

391bp

390bp

274bp

D = 0ndash18(06)

D = 0ndash44(22)

D = 0ndash90(39)








4 Discussion
















5 Conclusions







Acknowledgments


References




































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology











5 Conclusions







Acknowledgments


References




































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




Acknowledgments


References




































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology








Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Research Article Structural and Population Polymorphism of ...c markers of the avian schistosomes of...

Documents

Transcript of Research Article Structural and Population Polymorphism of ...c markers of the avian schistosomes of...