Patterning of mouse embryonic stem cell-derived pan-mesoderm by
Reprogramming Mouse Glioma Stem Cells with Defined · PDF fileReprogramming Mouse Glioma Stem...
Transcript of Reprogramming Mouse Glioma Stem Cells with Defined · PDF fileReprogramming Mouse Glioma Stem...
Reprogramming Mouse Glioma Stem Cells with Defined Factors
by
Julia Alexandra Maria DiLabio
A thesis submitted in conformity with the requirements for the degree of Master of Science
Laboratory Medicine and Pathobiology University of Toronto
© Copyright by Julia A.M. DiLabio 2011
ii
Reprogramming Mouse Glioma Stem Cells with Defined Factors
Julia A.M. DiLabio
Master of Science
Laboratory Medicine and Pathobiology
University of Toronto
2011
Abstract
This thesis shows that p53-deficient mouse glioma brain tumour stem cells (BTSCs), which fail
to express pluripotency factors, can be reprogrammed with specific transcription factors to
generate iPS cell lines (GNS-iPS) expressing endogenous pluripotency factors (Nanog, Oct4, and
Rex1). GNS-iPS cell lines formed embryoid bodies (EBs) in vitro and undifferentiated growths
in vivo that phenotypically did not resemble tumours derived from non-reprogrammed BTSCs.
EBs formed from one GNS-iPS cell line expressed markers of mesoderm, endoderm, and
ectoderm. Tumours produced from GNS-iPS cells had reduced astrocytic marker (GFAP)
expression compared to those generated from control iPS cell lines or non-reprogrammed
BTSCs. Preliminary results suggest that the reprogrammed cells can be re-differentiated into
cells that show neural precursor phenotype. These findings suggest that BTSCs can acquire
aspects of the pluripotent state with a defined set of transcription factors, opening the door for
further exploration of reprogramming strategies to attenuate the cancer phenotype.
iii
Acknowledgements
I owe a great deal of gratitude to all members of the Dirks Lab and colleagues at the Hospital for
Sick Children for advice and support throughout my MSc candidacy. I am particularly grateful
for Dr. Peter Dirks’ mentorship, unwavering support, and contagious enthusiasm for science and
medicine. I am also thankful for the scientific guidance and support from Dr. Ian Clarke, Dr.
Steven Pollard, and advisory committee members Dr. James Ellis and Dr. Derek van der Kooy.
I would like to acknowledge the work of Dr. Ryan Ward, who established and
characterized the mouse glioma stem cell lines, Lilian Lee, who carried out mouse injections and
helped to process tumours, Dr. Akitsu Hotta, who produced and shared the EOS lentivirus, and
Natalie Farra, who provided experimental guidance in generating and characterizing mouse
induced pluripotent stem cell lines.
I am also eternally grateful for the love and support of family and friends. This body of
work is dedicated to my parents, who have always been there for me every step of the way. They
have helped me to learn that happiness and success are not found at the end of the road, but are
experienced along the way.
iv
Table of Contents
Acknowledgements ........................................................................................................................ iii
Table of Contents ........................................................................................................................... iv
List of Abbreviations ................................................................................................................... viii
List of Tables ................................................................................................................................ xii
List of Figures .............................................................................................................................. xiii
List of Appendices ........................................................................................................................ xv
Chapter 1 ......................................................................................................................................... 1
1 Introduction ................................................................................................................................ 1
1.1 Introduction to Stem Cells .................................................................................................. 1
1.1.1 Adult Stem Cells ..................................................................................................... 1
1.1.2 Neural Stem Cells ................................................................................................... 2
1.1.3 Embryonic Stem Cells ............................................................................................ 2
1.2 Pluripotency ........................................................................................................................ 4
1.3 Nuclear Reprogramming ..................................................................................................... 7
1.3.1 Nuclear Transfer ..................................................................................................... 7
1.3.2 Cell Fusion .............................................................................................................. 9
1.3.3 Transcription Factor-Mediated Reprogramming .................................................. 10
1.3.4 Induced Pluripotent Stem Cell Technology .......................................................... 11
1.3.5 Improving iPS Cell Technology ........................................................................... 15
1.3.6 Induced Pluripotent Stem Cells Generated from Neural Stem Cells .................... 16
1.4 Reprogramming and Cancer ............................................................................................. 17
1.4.1 Introduction to Epigenetics ................................................................................... 17
1.4.2 Epigenetic Contribution to Cancer ........................................................................ 19
1.4.3 Chemotherapy Targeting Epigenetic Modifications in Cancer ............................ 21
v
1.4.4 Pluripotency and Cancer ....................................................................................... 22
1.4.5 Nuclear Reprogramming of Cancer Cells ............................................................. 24
1.5 Cancer Stem Cells ............................................................................................................. 25
1.5.1 The Cancer Stem Cell Hypothesis ........................................................................ 26
1.6 Brain Tumours .................................................................................................................. 29
1.6.1 Human Glioma ...................................................................................................... 29
1.6.2 Mouse Glioma ....................................................................................................... 32
1.6.3 Brain Tumour Stem Cells ..................................................................................... 33
1.7 Thesis Rationale, Hypothesis, and Specific Aims ............................................................ 35
1.7.1 Rationale ............................................................................................................... 35
1.7.2 Hypothesis ............................................................................................................. 35
1.7.3 Specific Aims ........................................................................................................ 36
Chapter 2 ....................................................................................................................................... 37
2 Materials and Methods ............................................................................................................. 37
2.1 Characterization of Mouse Glioma Stem Cell Lines ........................................................ 37
2.1.1 Mouse Glioma Stem Cells .................................................................................... 37
2.1.2 Cell Culture and Differentiation ........................................................................... 37
2.1.3 RNA Isolation and Reverse-Transcriptase PCR ................................................... 37
2.1.4 Alkaline Phosphatase Staining .............................................................................. 38
2.1.5 MTT Assay ........................................................................................................... 38
2.2 Mouse iPS Cell Induction ................................................................................................. 39
2.2.1 EOS Lentiviral Infection ....................................................................................... 39
2.2.2 Retrovirus Production and Infection ..................................................................... 39
2.2.3 Isolation and Maintenance of iPS Cell Colonies .................................................. 40
2.3 Molecular Characterization of iPS Cell Lines .................................................................. 41
2.3.1 Immunocytochemistry .......................................................................................... 41
vi
2.3.2 Quantitative RT-PCR ............................................................................................ 41
2.4 In Vitro Differentiation ..................................................................................................... 41
2.4.1 Embryoid Body Assays ......................................................................................... 41
2.4.2 Immunocytochemistry for Germ Layer Markers .................................................. 42
2.5 In Vivo Differentiation ...................................................................................................... 42
2.5.1 Teratoma Assays ................................................................................................... 42
2.5.2 Histology and Immunohistochemistry .................................................................. 43
2.6 Directed Differentiation to Neural Stem Cells .................................................................. 43
Chapter 3 ....................................................................................................................................... 45
3 Results ...................................................................................................................................... 45
3.1 Characterization of Mouse Glioma Stem Cell Lines ........................................................ 45
3.1.1 Mouse Glioma Stem Cells Express Neural Stem Cell Markers, but Not Core
Pluripotency Markers ............................................................................................ 45
3.1.2 Mouse Glioma Stem Cells Express Alkaline Phosphatase ................................... 47
3.1.3 Serum Alters the Growth Rate of Glioma and Normal Neural Stem Cells .......... 47
3.2 Defined Factors Can Reprogram Mouse Glioma Stem Cells ........................................... 49
3.2.1 Induction of Reprogramming with Four Transcription Factors ............................ 49
3.2.2 Induced Pluripotent Stem Cell Lines Express Pluripotency Factors, but Not
Neural Stem Cell or Astrocytic Cell Markers ....................................................... 51
3.2.3 Retroviral Silencing in Reprogrammed Cell Lines ............................................... 55
3.3 Altered Differentiation Potential of p53-Deficient iPS Cells ........................................... 57
3.3.1 Induced Pluripotent Stem Cell Lines Generate Embryoid Bodies with Reduced
Endodermal Differentiation in vitro ...................................................................... 57
3.4 p53-Deficient iPS Cell Lines Generate Highly Undifferentiated Tumours ..................... 61
3.5 Reprogrammed Glioma-Derived iPS Cell Lines Have Reduced Astrocytic
Differentiation in vivo ....................................................................................................... 65
3.6 Re-Differentiation of Glioma-Derived iPS Cell Lines to a Neural Stem Cell Fate .......... 67
vii
Chapter 4 ....................................................................................................................................... 69
4 Discussion and Future Directions ............................................................................................ 69
4.1 Summary of Principle Findings ........................................................................................ 69
4.2 Why Reprogram Brain Tumour Stem Cells? .................................................................... 69
4.3 Mouse Glioma Stem Cells are Amenable to Reprogramming .......................................... 71
4.4 Reprogrammed Cell Lines Show Varying Degrees of Retroviral Silencing .................... 72
4.5 Analysis of the Differentiation Capacity of iPS Cell Lines .............................................. 73
4.6 Interplay between Retroviral Silencing, p53 Status, and In Vivo Differentiation
Potential ............................................................................................................................ 76
4.7 Reprogramming Mouse Versus Human Cells .................................................................. 77
4.8 Defining the Reprogrammed State .................................................................................... 78
4.9 Core Pluripotency Network Versus c-Myc Network in Cancer ....................................... 80
4.10 Expression of Pluripotency Factors in Human Glioma.................................................... 82
4.11 Future Directions .............................................................................................................. 84
Appendices .................................................................................................................................... 86
5 Appendix 1. Supplemental Methods ....................................................................................... 86
5.1 Primer Sequences .............................................................................................................. 86
6 Appendix 2. Supplemental Figures ......................................................................................... 88
6.1 Quantitative RT-PCR Results of Pluripotency Factor Expression ................................... 88
6.2 Alkaline Phosphatase Expression in Mouse Glioma Stem Cell Lines ............................. 89
6.3 Nanog Expression in MEF-Derived iPS Cell Lines ......................................................... 91
References ..................................................................................................................................... 92
viii
List of Abbreviations
2i Dual inhibition
ABL v-abl Abelson murine leukemia viral oncogene homolog 1
Akt v-akt murine thymoma viral oncogene homolog/Protein kinase B
AP Alkaline phosphatase
APC Adenomatous polyposis coli
Ascl1 Achaete-scute homolog 1/Mash1
ATM Ataxia telangiectasia mutated
AZA 5-azacytidine
BCR Breakpoint cluster region
bFGF Basic fibroblast growth factor
Bmi1 Bmi1 polycomb ring finger oncogene
BMP Bone morphogenetic protein
Brn2 Pou3f2
BTSC Brain tumour stem cell
CD Cluster of differentiation
CD133 AC133/CD133/Prominin1
CD15 LewisX/CD15/Stage Specific Embryonic Antigen1
CDK Cyclin-dependent kinase
CDKN Cyclin-dependent kinase inhibitor
CML Chronic myeloid leukemia
CNPase 2',3'-Cyclic Nucleotide 3'-Phosphodiesterase
CNS Central nervous system
CpG Poly cytosine-guanine
Cre Cre-recombinase
CSC Cancer stem cell
DMR Differentially methylated regions
DNMT DNA methyltransferase
e Embryonic day
EB Embryoid body
EC Embryonal carcinoma
ix
EG Embryonic germ
EGF Epidermal growth factor
EGFR Epidermal growth factor receptor
ENU N-ethyl-N-nitrosourea
EOS Early transposon promoter and Oct4 and Sox2 enhancers
ER Estrogen receptor
ES Embryonic stem
Exo Exogenous
EZH2 Enhancer of zeste homologue 2
FBS Fetal bovine serum
Fbx15 F-box-containing protein/Fbxo15
FDA Food and Drug Administration
Flk1 Fetal liver kinase 1
FZD9 Frizzled-9
GBM Glioblastoma multiforme
GFAP Glial fibrillary acidic protein
GI Gastrointestinal
Glis1 Gli-similar protein 1
GSK3 Glycogen synthase kinase 3
GSTP3 Glutathione S-transferase pi 1
H&E Hematoxylin and eosin
HDAC Histone deacetylase
HOXA11 Homeobox A11
IDH1 Isocitrate dehydrogenase 1
Ink4/Arf Encodes p15INK4b
, ARF and p16INK4a
iPS Induced pluripotent stem
Jak Janus kinase
Klf4 Krüppel-like factor 4
LIF Leukemia inhibitory factor
LOH Loss of heterozygosity
Map2 Microtubule-associated protein 2
MAPK Mitogen-activated protein kinase
x
MB Medulloblastoma
MDM2 Mdm2 p53 binding protein homolog
MeCP2 Methyl CpG binding protein 2
MEF Mouse embryonic fibroblast
miRNA Micro RNA
MEST Mesoderm-specific transcript homolog
MGMT O6-methylguanine DNA methyltransferase
MLH1 MutL homolog 1
MLL1 Mixed-lineage leukemia 1
MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
Myc Myelocytomatosis viral oncogene homolog
MyoD Myoblast determination protein
Mytl1 Myelin transcription factor 1-like
NF1 Neurofibromin 1
NOD Non-obese diabetic
NSC Neural stem cell
Oct4 Octamer-binding transcription factor 4/Pou5f1
p16INK4A
Cyclin-dependent kinase inhibitor 2A
p21 Cyclin-dependent kinase inhibitor 1/Waf1/Cip1
p53 Tumour protein 53
Pax6 Paired box gene 6
PcG Polycomb group
PDGFRA Alpha-type platelet-derived growth factor receptor
PGC Primordial germ cell
PI3K Phosphoinositide-3-kinase
PLO Poly-L-ornithine
PNET Primitive neuroectodermal tumour
PRC Polycomb repressive complex
Ptc1 Patched1
PTEN Phosphatase and tensin homolog
Ras Rat sarcoma
RASSF1A Ras association domain family 1 isoform A
xi
RB1 Retinoblastoma 1
Rex1 Zinc finger protein 42/Zfp42
RT-PCR Reverse transcriptase polymerase chain reaction
S100β S100 calcium binding protein β
SCID Severe combined immune-deficient
SCNT Somatic cell nuclear transfer
SGZ Subgranular zone
SKP Skin-derived precursor
Sox2 SRY-box containing gene 2
SSEA-1 Stage-specific embryonic antigen 1
Stat Signal transducer and activator of transcription
Tbx3 T-box transcription factor 3
TES Testis derived transcript
TIMP3 Metalloproteinase inhibitor 3
TNFRSF10A Tumor necrosis factor receptor superfamily member 10A
SVZ Subventricular zone
Tgfβ Transforming growth factor β
TP53 Tumour protein 53 (human gene)
VPA Valproic acid
VHL Von Hippel-Lindau
WHO World Health Organization
Wnt Wingless
xii
List of Tables
Table 1. Summary of the isolation of iPS cell colonies derived from four-factor inductions
and the number of clones derived ………………………………………………..... 50
Table 2. Summary of the latency of subcutaneous and intracranial tumour formation …... 62
Supplemental Table 1. Primer sequences used in this study …………………………….... 86
xiii
List of Figures
Figure 1. The core signaling pathways and transcription factors regulating mouse ES cell
pluripotency. ............................................................................................................................... 6
Figure 2. Nuclear reprogramming to pluripotency by nuclear transfer, cell fusion, and
transcription factor transduction. ............................................................................................. 13
Figure 3. A comparison of the stochastic and cancer stem cell models of cancer. ...................... 28
Figure 4. Mouse glioma stem cell lines express neural stem cell-associated factors, but do
not express RNA encoding core pluripotency-associated factors. ........................................... 46
Figure 5. Serum alters the growth rate of glioma stem cell and neural stem cell lines. .............. 48
Figure 6. Molecular characterization of iPS cell lines reveals the expression of core
pluripotency-associated factors. ............................................................................................... 52
Figure 7. Reprogrammed neural stem cells and glioma stem cells fail to express neural stem
cell or astrocytic cell markers. ................................................................................................. 54
Figure 8. Analysis of retroviral vector expression in iPS cell lines. ............................................. 56
Figure 9. Glioma stem cell-derived iPS cell lines form EBs and generate cells of mesodermal
and ectodermal lineages in vitro, as detected by immunostaining. .......................................... 59
Figure 10. Differentiated cell markers are detectable at the transcript level in undifferentiated
iPS and ES cell populations, but are enhanced during EB differentiation. .............................. 60
Figure 11. Reprogrammed NSCs and glioma stem cells generate subcutaneous tumours with
similar macroscopic appearance. ............................................................................................. 63
Figure 12. Glioma stem cell-derived iPS cell lines generate highly undifferentiated tumours
in vivo. ...................................................................................................................................... 64
Figure 13. Glioma stem cell-derived iPS cell lines generate tumours expressing mesodermal
and ectodermal cell markers, but have significantly reduced astrocytic differentiation. ......... 66
Figure 14. Preliminary directed re-differentiation experiments generated Nestin+ cells with
neural stem cell-like morphology. ............................................................................................ 68
Figure S1. Glioma stem cell lines express L-Myc and neural stem cell-associated factors, but
do not express Nanog or Oct4. ................................................................................................. 88
Figure S2. Glioma stem cells, but not normal neural stem cells, express alkaline phosphatase
in stem cell conditions. ............................................................................................................. 89
xiv
Figure S3. Glioma stem cells and normal neural stem cells fail to express alkaline
phosphatase in differentiation conditions................................................................................. 90
Figure S4. MEF-derived iPS cell lines express Nanog and 2i treatment enhances Nanog
expression. ................................................................................................................................ 91
xv
List of Appendices
Appendix 1. Supplemental Methods …………………………………………………….... 86
Appendix 2. Supplemental Figures ……………………………………………………...... 88
1
Chapter 1
1 Introduction
1.1 Introduction to Stem Cells
Stem cells are involved in embryonic and fetal development as well as tissue repair and
maintenance in adult organisms. These cells have the intrinsic ability to self-renew to regenerate
more stem cells and differentiate to produce mature, lineage-restricted cell types. In
development, pluripotent stem cells give rise to the cells of the three germ layers (endoderm,
mesoderm, and ectoderm) of a fetal organism. Multipotent stem cells are lineage-restricted and
generate specialized cell types residing within a tissue. The neural stem cell is an example of a
multipotent stem cell that differentiates to produce the cell types comprising the nervous system:
neurons, astrocytes, and oligodendrocytes. Multipotent stem cells persist throughout an
organism’s lifetime and are responsible for cellular regeneration and tissue replenishment.
1.1.1 Adult Stem Cells
The most restricted type of stem cell is the multipotent stem cell, which produces differentiated
cells of the tissue type in which it resides. Stem cell activity occurs not only during fetal
development, but also in adult tissues, when multipotent stem cells are required for the
maintenance of the tissues under normal conditions and repair after injury. Normal tissue
turnover occurs at significantly different rates, depending on the tissue type; brain and skeletal
muscle have relatively little turnover, whereas the highest turnover rates occurs in the intestines
and skin, which are replenished approximately every 5 days and 4 weeks, respectively [1]. In
tissues with little turnover, such as the brain, it was initially thought that stem cells were not
present and the generation of new neurons (neurogenesis) ceased just after birth, but the
identification of proliferating cells based on labeling experiments with tritiated thymidine in the
adult rat brain suggested otherwise [2]. Self-renewing, lineage-restricted neural stem cells
(NSCs) were later identified in the adult mammalian brain, and neurogenesis was shown to occur
not only during development, but also in the adult brain [3,4,5].
2
1.1.2 Neural Stem Cells
The sites of adult neurogenesis, where adult NSCs are found, are the subventricular zone (SVZ)
lining the lateral ventricles and the subgranular zone (SGZ) of the dentate gyrus in the
hippocampus [6,7]. The regulation of proliferation and differentiation is mediated by the stem
cell niche – factors such as the microenvironment that provides extrinsic signals to the stem cell
and includes soluble growth factors, hormones, and contact with other cells and the extracellular
matrix [8]. Soluble factors such as epidermal growth factor (EGF) and basic fibroblast growth
factor (bFGF) were identified as potent mitogens regulating NSC proliferation and
differentiation in vivo; both growth factors enhanced neural stem cell self-renewal, but EGF
promoted the generation of glial cells and prevented neurogenesis, whereas bFGF promoted
neurogenesis [9,10]. These important mitogens are included in standard neural stem cell culture
conditions in vitro, allowing self-renewing, multipotent NSCs to be expanded in defined, serum-
free medium as spherical aggregates (neurospheres) or as an adherent monolayer on a substrate
such as laminin [3,11].
NSCs are among the best-characterized multipotent stem cells in terms of cell-surface
and intracellular marker expression; human NSCs can be identified by the cell-surface marker
CD133 (Prominin-1) and the intracellular expression of the neuroepithelial stem cell marker
Nestin and the stem cell-associated transcription factor Sox2 [3,12]. Mouse NSCs can also be
identified by these markers, but express the cell-surface carbohydrate moiety CD15 instead of
CD133 [13]. Multipotent NSCs are restricted in their differentiation capacity and generate
neurons, astrocytes, and oligodendrocytes, the differentiated cells of the mammalian CNS in
vitro and in vivo.
1.1.3 Embryonic Stem Cells
Embryonic stem (ES) cells are cultured cells that are derived from the inner cell mass of the
blastocyst after fertilization. These cells are defined as pluripotent stem cells and have the ability
to differentiate into cells of the three germ layers (endoderm, mesoderm, and ectoderm). When
aggregated with blastocysts, ES cells cannot generate extraembryonic tissue, such as trophoblast
cells that form the placenta, but give rise to cells and tissues of the endoderm (gastrointestinal
tract, lungs, stomach lining), mesoderm (muscle, bone, blood), and ectoderm (skin and the
nervous system).
3
Human and mouse ES cells are isolated from the developing mammalian blastocyst at
embryonic day (e) 4-5 and can be grown in vitro in conditions promoting the maintenance of
pluripotency [14,15]. Standard mouse ES cell culture conditions include medium containing
serum (providing bone morphogenetic protein, or BMP) and the cytokine leukemia inhibitory
factor (LIF) [16,17]. Mouse ES cells are often grown on a mitotically-inactivated “feeder” layer
of cells, typically consisting of mouse embryonic fibroblasts (MEFs), which help to support the
growth of pluripotent ES cell colonies and secrete growth factors and cytokines [17,18].
Undifferentiated mouse ES cells can also be propagated in feeder-free conditions on a substrate
such as gelatin in the presence of LIF or MEF-conditioned culture medium [17,18]. Extrinsic
cytokine signaling, particularly mediated by LIF, counteracts the intrinsic tendency of ES cells to
differentiate [19]. LIF activates the Jak-Stat3 pathway in mouse ES cells, which directly
increases the expression of Klf4 and indirectly upregulates the expression of Sox2, as well as the
PI3K-Akt pathway, which indirectly enhances Nanog expression via the transcription factor
Tbx3 (Figure 1A) [19,20]. Kfl4 is a direct target of LIF signaling and binds to the promoter of
the Nanog gene, thereby regulating its expression [21]. The self-renewal of ES cells in an
undifferentiated state can be maintained in the absence of LIF by suppressing differentiation-
inducing signaling from mitogen-activated protein kinase (MAPK) and glycogen synthase kinase
3 (GSK3) using a cocktail of dual inhibition (2i) chemical inhibitors [22].
ES cells can self-renew indefinitely and exhibit tri-lineage differentiation in vitro, thus
recapitulating the characteristics of the cells of the inner cell mass in vivo. However, mouse ES
cells can be induced to differentiate in vitro into cells of extraembryonic origin, such as
extraembryonic endoderm (yolk sac) or trophectoderm (placenta) by knockdown of Nanog or
Oct4, respectively [23,24]. Mouse ES cells express cell-surface markers, such as stage-specific
embryonic antigen-1 (SSEA-1, or SSEA-4 in the case of human ES cells) and express the
transcription factors Nanog, Oct4, and Rex1 that cooperatively maintain pluripotency.
Functional pluripotency of mammalian ES cells is defined by in vitro embryoid body (EB)
formation and in vivo teratoma formation. EBs are spherical aggregates which form when
differentiated ES cells are grown in the absence of LIF. The EBs contain cells that express
markers of endodermal, mesodermal, and ectodermal lineages. Teratoma assays involve the
injection of ES cells into immune-compromised mice, typically in the kidney capsule, testes, or
4
dorsal flank, and the subsequent identification of three germ layers by the detection of
characteristic histological structures that also express appropriate linage markers.
1.2 Pluripotency
A core transcription factor network involved in the maintenance of pluripotency has been
identified in human and mouse ES cells, which consists of the transcription factors Nanog, Oct4,
and Sox2 [25,26]. These factors form a cooperative regulatory loop that maintains the
pluripotent phenotype by binding to promoter regions of target genes, including each other
(Figure 1B). These transcription factors activate the expression of genes required for the
maintenance of pluripotency and self-renewal, including members of the Tgfβ and Wnt signaling
pathways [25]. Sox2 cooperates with Nanog, which binds to the promoter region and activates
the expression of Rex1, a transcription factor used as a marker of pluripotency in mouse ES cells
[27]. Nanog, Oct4, and Sox2 also inactivate the transcription of genes involved in differentiation
into extra-embryonic, endodermal, mesodermal, and ectodermal lineages. It has recently been
suggested that the regulation of germ layer differentiation is controlled in part by Oct4 and Sox2,
and that these factors not only repress differentiation-inducing transcription factors, but promote
different fate decisions [28]. Neural ectodermal differentiation is repressed by Oct4 and
enhanced by Sox2, whereas mesendodermal differentiation is promoted by Oct4 and inhibited by
Sox2 (Figure 1C) [28]. This finding was supported by the initial identification of Oct4 as a key
regulator of pluripotency in mouse ES cells [24]. This study showed that the levels of Oct4
expression in mouse ES cells are critical in maintaining pluripotent self-renewal and preventing
differentiation, since a two-fold increase in expression promotes lineage commitment to
primitive endoderm and mesoderm [24]. Therefore, a balance of the expression of these
dominant lineage specifiers must be maintained to sustain the undifferentiated self-renewal of ES
cells and to prevent differentiation and lineage commitment.
Nanog has been identified as the master regulator of the entry into the ground state of
pluripotency during embryonic development and late during the process of nuclear
reprogramming to the pluripotent state [29,30]. It is thought that Nanog controls the transition to
pluripotency by promoting the binding of Oct4 and Sox2 to target promoters of pluripotency-
associated genes [29]. Although Nanog deletion results in early embryonic lethality, Nanog-null
ES cells are viable and contribute to all three of the germ layers in chimeric mice, but cannot
5
form mature germ cells [23,31]. This shows that Nanog is dispensable for established
pluripotent cells but plays a critical role in the formation of germ cells. Nanog-null blastocysts
fail to generate pluripotent ES cells and are unable to mature into epiblast [23]. Taken together,
these studies show that the function of Nanog is a key component that establishes a core
transcriptional regulatory network in mouse ES cells and is essential for the induction of full
pluripotency.
6
A
B C
Figure 1. The core signaling pathways and transcription factors regulating mouse ES cell
pluripotency.
(A) LIF activates the Jak-Stat3 and PI3K-Akt pathways, which directly upregulate the
expression of Klf4 and Tbx3, respectively. Klf4 positively regulates the expression of Sox2
and Nanog, the latter of which is also regulated by Tbx3, to promote pluripotency.
Inhibition of MAPK and GSK3 signaling (MAPKi + GSK3i) maintains pluripotency in a
LIF-independent manner. (B) The core transcription factor network (yellow box) involved
in maintaining pluripotency in mouse ES cells, consisting of Nanog, Oct4, and Sox2. These
transcription factors form a cooperative regulatory loop and maintain pluripotency by
suppressing lineage commitment and positively regulating themselves. Nanog also binds to
the promoter region and activates the expression of Rex1. (C) Oct4 promotes mesoderm
and endoderm differentiation, but suppresses neural ectoderm differentiation, whereas
Sox2 has the opposite role in regulating lineage commitment.
7
1.3 Nuclear Reprogramming
During development, cells that are committed to a specific lineage generally do not change fates
and produce cells of another germ layer; for example, neuroectodermal cells do not generate
endodermal cells or tissues. It was previously thought that cells constitutively inactivated genes
as they committed to a specific tissue lineage [32]. However, several classic experiments have
shown this to be untrue. Although it is now known that neural crest cells have differentiation
potential outside of the ectodermal lineage, the ability of these cells to generate mesodermal
tissue was explored in a series of experiments that raised questions about the degree of lineage
restriction in a given tissue. Transplantation experiments of quail neural crest cells into chick
embryos and subsequent tracking of the quail cells showed that ectodermal neural crest could
give rise to mesenchymal tissues [33]. It was concluded that the environment in which a cell
resides has the ability to dictate fate determination [33]. This was one of the first examples of
“transdifferentiation”, whereby a cell belonging to one tissue type could produce cells of another
type. Classical experiments have shown that differentiated cells exhibit some degree of cellular
plasticity. Through methods such as nuclear transfer, cell fusion, and transcription factor-
mediated induction of pluripotency (Figure 2), it has been shown that mature, differentiated
somatic cells can be reverted to a primitive, pluripotent state [32].
1.3.1 Nuclear Transfer
Somatic cell nuclear transfer (SCNT) is the process in which a nucleus from a differentiated
somatic cell is transplanted into an unfertilized enucleated oocyte, typically at the stage of
second meiotic metaphase [34]. Also known as cloning, SCNT generates an organism that is
genetically identical (i.e. a “clone”) of the original somatic cell. This process shows that somatic
cells retain all of the genetic information required to produce a fully developed organism, and
that pluripotent cells can be generated from differentiated cells. These studies also suggested
that the oocyte contains non-DNA molecules, RNA, or protein that are capable of directing
reprogramming of somatic cell DNA.
The first SCNT experiments were carried out by Briggs and King in the 1950s and
showed that tadpoles could be generated from frog blastula nuclei that were transplanted into
enucleated oocytes [35]. However, developmental arrest and death occurred using nuclei from a
8
different donor species or from more specialized tissues [35]. Gurdon carried out similar SCNT
experiments involving nuclei from highly specialized intestinal epithelial cells and a different
species of frog, which generated viable tadpoles, albeit with relatively low efficiency [36,37].
The efficiency of generating viable adult frogs was roughly ten times greater if the donor nucleus
was derived from a more primitive cell (such as a blastula, which is formed after zygotic
cleavage during early embryonic development) than from highly specialized, differentiated cells
(such as intestinal epithelium) [36]. This provoked the debate that only a rare intestinal stem
cell, which may be more amenable to nuclear reprogramming, produced viable clones. The
argument that a rare, contaminating somatic stem cell being reprogrammed was put to rest
decades later when highly specialized mature lymphocytes were reprogrammed by nuclear
transfer [38]. Mice derived from tetraploid complementation with donor B-cell or T-cell nuclei
had rearranged immunoglobulin alleles or T-cell receptor genes in all tissues, thereby confirming
that terminally differentiated cells can be reprogrammed by nuclear transfer [38]. Therefore,
through the process of SCNT, endogenous reprogramming factors in oocytes reactivate a full
developmental program, overriding restricted lineage commitment to direct the development of a
viable organism from highly specialized nuclei.
Although the precise molecular mechanisms involved in nuclear reprogramming remain
unclear, it is generally thought that maternal factors present in unfertilized enucleated oocytes
initiate the derepression of previously silenced genes in somatic cells, primarily by chromatin
decompaction and demethylation of gene promoters [34]. In fact, one of the earliest events in
nuclear reprogramming is the demethylation of the promoter region and expression of Oct4 [34].
Since early mouse development relies on precise levels of Oct4 expression, incomplete
demethylation of the promoter of Oct4 and low expression levels may account for the relatively
low efficiency (approximately 2%) of generating an adult mouse from a differentiated cell by
SCNT [24,34]. Other developmental abnormalities commonly seen in cloned animals, such as
elongated telomeres, obesity, weakened immune systems, and cancer predisposition suggest that
nuclear reprogramming may not be a completely efficient process [32].
9
1.3.2 Cell Fusion
The impact of one genome on another can be studied through cell fusion, a technique that may
aid in uncovering the precise molecular mechanisms required for nuclear reprogramming. The
process of cell fusion can result in proliferating hybrid cells containing a single fused nucleus, or
non-dividing heterokaryons with multiple nuclei [32]. Early cell fusion experiments revealed
that the neoplastic phenotype could be suppressed by fusing a malignant cell with a non-
malignant cell, suggesting the presence of trans-acting tumour suppressor proteins [39]. These
results suggested that the non-neoplastic state was dominant over the malignant state. In normal
tissues, the linage plasticity of differentiated cells was demonstrated when stable heterokaryons
generated by the fusion of human amniotic cells and mouse myotubes resulted in the activation
of expression of previously silent muscle-specific genes in the human non-muscle cells [40].
Subsequent experiments showed that the relative ratio of the nuclei present in the heterokaryon
determined the differentiated fate of the heterokaryon, and previously silent genes were activated
in cells from all three of the germ layers [41]. DNA synthesis was not required for
transdifferentiation in heterokaryons, but DNA demethylation was found to be essential, which
was one of the first instances that epigenetics were implicated in nuclear reprogramming [42].
These studies suggested that some degree of plasticity exists in the differentiated state of
mammalian cells, which is not a permanent state.
Pluripotency was first induced in hybrid mouse cells by fusing female embryonic germ
(EG) cells with thymocytes; the resulting hybrids showed demethylation of imprinted and non-
imprinted genes and contributed to all three of the germ layers in chimeric embryos [43]. In
contrast, pluripotent hybrids formed from the fusion of thymocytes with ES cells had remaining
allele-specific methylation, suggesting that ES cells were unable to fully erase parental imprints
[44]. Demethylation of promoters and Oct4 expression have been shown to be essential for
nuclear reprogramming to the pluripotent state; in fact, in the fusion of human B cells or
fibroblasts with mouse ES cells, it has been shown that the promoter regions of Nanog and Oct4
are demethylated and gene expression is activated in the mixed-species heterokaryons within 24
hours of fusion [45,46]. Taken together, these experiments have shown that factors present in
the pluripotent state can supersede the differentiated nuclear state during cell fusion, and have
10
helped to suggest that transcription factors or other molecules can allow for the induction of
pluripotency in differentiated cells.
1.3.3 Transcription Factor-Mediated Reprogramming
Ectopic overexpression of transcription factors, or as few as a single master regulatory
transcription factor, can convert the fate of a cell to that of another cell type. This was first
shown in the late 1980s, when an extra set of legs was formed instead of antennae in Drosophila
melanogaster as a result of ectopic overexpression of Antennapedia, a homeotic gene [47].
Similarly, the ectopic expression of a single transcription factor, eyeless (known as Pax6 in the
mouse), generated functional eyes on the legs, wings, and antennae of D. melanogaster,
identifying this transcription factor as a master regulator of eye morphogenesis [48]. MyoD was
identified as a key regulator of tissue specification in mice, since overexpression of MyoD in a
fibroblast cell line induced myotube formation [49]. These studies suggest that the ectopic
overexpression of a single transcription factor can induce the activation of previously silenced
signaling pathways, resulting in transdetermination or transdifferentiation from one cell fate to
another closely related cell type derived from the same germ layer.
Recently, using strategies similar to induced pluripotent stem cells (see below), mouse
and human fibroblasts have been converted to functional neurons, bypassing the pluripotent
state, as a result of the introduction of the transcription factors Ascl1 (also known as Mash1),
Brn2, and Myt1l [50,51]. However, fibroblasts are derived from primitive mesenchyme, which
has primarily a mesodermal origin, but may also originate from neural crest cells, which may be
more amenable to reprogramming to a neural fate [33]. In addition, multipotent skin-derived
precursor (SKP) cells have been identified, which differentiate in culture to generate cells
expressing neuron-specific proteins, such as βIII tubulin [52]. This suggests that rare specialized
subtypes of cells capable of transdifferentiation may be responsible for the reprogramming seen
in these studies.
The most notable example of transcription factor-mediated reprogramming, however,
was the discovery of induced pluripotent (iPS) cells [53]. The finding that mature, differentiated
somatic cells can be converted to a pluripotent ES cell-like state using a defined set of
transcription factors has provided a novel method of studying the epigenetic state and plasticity
of differentiated cells and will be discussed in detail in the following sections.
11
1.3.4 Induced Pluripotent Stem Cell Technology
The technology of generating induced pluripotent stem (iPS) cells has provided a technically
more feasible method of reprogramming somatic cells using a defined set of transcription factors
[32]. Pluripotency can be induced in fully differentiated somatic cells by retroviral transduction
of vectors encoding combinations of the transcription factors Oct4, Klf4, Sox2, and c-Myc.
Pluripotency was first achieved in mouse embryonic and tail-tip fibroblasts by these methods,
although selection of reprogrammed cell lines by Fbx15 expression, a transcription factor found
specifically in mouse ES cells and early embryos, generated iPS cell lines that were unable to
form chimeras [53]. Similar reprogramming experiments involving selection for Nanog or Oct4
expression yielded germline-competent iPS cell lines from mouse embryonic fibroblasts [54,55].
Reprogramming with selection for Nanog was achieved with a maximum efficiency of
approximately 0.05% and selection for Oct4 yielded iPS colonies with a maximum estimated
efficiency of 0.08%, roughly one tenth the efficiency of iPS cell generation through Fbx15
selection [53,55]. Nanog and Fbx15 are both binding targets of Oct4 and Sox2, but Fbx15 is not
required for the maintenance of ES cell pluripotency and is dispensable for mouse development
[56]. Pluripotency was induced in adult human fibroblasts and other cell types from humans and
mice using the same four transcription factors [57,58]. It has been shown that secondary iPS
cells (generated from mouse fibroblasts harbouring doxycycline-inducible vectors and obtained
from chimeric mice produced from primary iPS cells) can be generated with an efficiency
roughly 50 times greater than primary iPS cells [59]. Regardless of the method or type of cell
employed for reprogramming experiments, the efficiency at which a cell can be converted to a
pluripotent state remains relatively low, suggesting that transcription factor-mediated nuclear
reprogramming is context dependent and may involve a series of stochastic events [60,61].
Induced pluripotent stem cells are similar to ES cells in many ways, in that they share
similar gene expression profiles, including comparable gene expression levels of key
pluripotency factors such as Nanog, Oct4, and Rex1, and similar hypomethylation patterns at the
promoters of Nanog and Oct4 [54]. Both types of cells generate cells of the endodermal,
mesodermal, and ectodermal lineages in vitro and form teratomas containing cells derived from
all three of the germ layers in vivo. However, it has recently been shown that iPS and ES cells
have many differences in DNA methylation patterns, and that reprogramming is associated with
differentially methylated regions (DMRs), some of which reflect the epigenetic memory of the
12
cell of origin [62]. Epigenetic memory refers to the similarities observed in the gene expression
patterns of reprogrammed cells and cells of the somatic tissue of origin, which does not result
from changes in DNA sequence, but from epigenetic modifications such as DNA methylation.
Epigenetic memory affects the differentiation potential of iPS cells, since iPS cells harbouring
residual epigenetic marks reflecting the somatic cell type of origin differentiate more readily
along lineages related to the tissue of origin, but have restricted differentiation potential to other
lineages [63,64]. Furthermore, some of the DMRs observed in iPS cells represent iPS cell-
specific methylation patters and are produced as a result of reprogramming, suggesting that iPS
cells harbor an epigenome that is not equivalent to that of ES cells.
13
A Somatic Cell Nuclear Transfer
B Cell Fusion
C Transcription Factor-Mediated Reprogramming
Figure 2. Nuclear reprogramming to pluripotency by nuclear transfer, cell fusion, and
transcription factor transduction.
(A) In somatic cell nuclear transfer (SCNT), a nucleus from a somatic cell is transplanted
into an unfertilized enucleated oocyte. This results in the nuclear reprogramming of the
somatic cell nucleus to generate a blastocyst containing pluripotent cells. ES cells can be
14
derived from the inner cell mass of the blastocyst or a cloned organism can be produced if
development proceeds to completion. (B) During cell fusion, two types of cells are fused to
form proliferative hybrids or non-proliferative multinucleated heterokaryons. The ratio of
the types of nuclei present prior to fusion determines the phenotype of the heterokaryon.
(C) In transcription factor-mediated reprogramming, pluripotency can be induced in
differentiated somatic cells by the ectopic expression of a combination of the transcription
factors Oct4, Klf4, Sox2, and c-Myc. The resulting iPS cells are phenotypically similar to
ES cells.
15
1.3.5 Improving iPS Cell Technology
Several alterations to Yamanaka’s initial retroviral-mediated reprogramming procedure have
been reported with the overall goal of improving reprogramming efficiency, reducing the number
of exogenous transcription factors required for the induction of pluripotency, or reducing the
possibility of oncogenic transformation.
Altering the cellular environment or disrupting key signaling pathways has been shown to
increase reprogramming efficiency. Ascorbic acid or hypoxic exposure (5% O2) enhanced the
generation of mouse and human iPS cells by promoting the transition of the somatic gene
expression profile to that of ES cell [65,66]. Ascorbic acid, or vitamin C, prevented cell
senescence and promoted the transition of pre-iPS cells to the fully reprogrammed state, whereas
hypoxia enhanced proliferation and increased the levels of expression of Nanog and Oct4
[65,66]. The role of epigenetics in reprogramming to the pluripotent state was further
emphasized by the finding that DNA methyltransferase and histone deacetylase (HDAC)
inhibitors enhance the generation of mouse and human iPS cells [67,68]. The DNA
methyltransferase inhibitor, 5-azacytidine (AZA) enhanced mouse iPS cell generation by
promoting the transition to the fully reprogrammed state [67]. Similarly, the reprogramming
efficiency of generating mouse iPS cells was increased by approximately 100-fold using the
HDAC inhibitor valproic acid (VPA), and human fibroblasts were successfully reprogrammed
with only Oct4 and Sox2 in the presence of VPA [67,68]. Cellular senescence and the DNA
damage response mediated by the p53-p21 pathway and other cell cycle regulatory pathways
controlled by the Ink4/Arf locus have been shown to prevent reprogramming to the pluripotent
state [69,70,71,72,73]. The aforementioned studies have aided in improving the efficiency of
generating iPS cells and have helped elucidate the molecular events and signaling pathways
implicated in the reprogramming of somatic cells to a pluripotent state.
The retroviruses commonly used in reprogramming experiments can cause insertional
mutagenesis, which may complicate the study of cancer with iPS cells and prevent their use in
clinical applications. Methods of generating iPS cells without viruses were therefore developed,
such as piggyBac transposition [74], recombinant protein delivery [75], transfection of plasmid
vectors or non-integrating episomal vectors [76,77], synthetic mRNA delivery [78], and ectopic
miRNA expression [79]. However, it has been shown that human iPS cells generated from five
16
different methods acquired not only epigenetic modifications, but also genetic alterations during
the reprogramming process; these reprogramming-associated mutations included genes
implicated in cancer [80]. Furthermore, the reprogramming process results in de novo copy
number variations and deletions of genomic regions containing tumour suppressor genes in
human iPS cells [81,82].
The exclusion of the potent oncogene c-Myc from the reprogramming process was
investigated due to the fact that this potent oncogene was reactivated in iPS cells injected in vivo
to produce tumours in chimeric mice and their offspring [54]. This transcription factor was
found to be dispensable for the induction of pluripotency in mouse and human cells, although
reprogramming efficiency was substantially reduced if c-Myc was excluded during the
reprogramming procedure [83]. An alternative to the omission of c-Myc is its replacement with
L-Myc, which has been shown to promote iPS cell generation and germline transmission with
less potent oncogenic effects [84]. Recently, it has been shown that the efficiency of
reprogramming is further enhanced by the addition of Glis1, a transcription factor found in
oocytes but not ES cells [85]. This finding represents the first transcription factor involved in
nuclear reprogramming of somatic cells to a pluripotent state, but not expressed in pluripotent ES
cells.
1.3.6 Induced Pluripotent Stem Cells Generated from Neural Stem Cells
Adult mouse and human NSCs have been successfully reprogrammed with two factors (Oct4 and
Klf4) [86,87] or one factor alone (Oct4) [88,89] to generate iPS cells, albeit with remarkably
lower efficiencies than with all four Yamanaka factors (Oct4, Klf4, c-Myc, and Sox2) [53].
Although Klf4 is an oncogene and could potentially be reactivated in vivo to produce tumours, its
inclusion as a reprogramming factor enhances the efficiency of generating iPS cells from mouse
NSCs by approximately 10-fold compared to one-factor reprogramming with Oct4 alone [89].
The generation of iPS cells from mouse NSCs by the ectopic expression of Oct4 and Klf4 is
generally associated with a reprogramming efficiency of approximately 0.11% [86], which is
similar to the efficiency of producing four-factor iPS cells from MEFs [54]. A small-molecule
histone methyltransferase inhibitor, BIX-01294, was found to increase the efficiency of
reprogramming mouse NSCs with ectopic Oct4 and Klf4 to the efficiency achieved for four-
17
factor reprogramming, again implicating epigenetic modifications in the process of nuclear
reprogramming [90].
The expression of the stem cell maintenance gene Sox2 by NSCs is partly responsible for
the enhanced efficiency of generating iPS cells from NSCs. In fact, human and mouse NSCs
endogenously express Sox2 and c-Myc at greater levels than ES cells, and also express markers
associated with the iPS cell phenotype, such as alkaline phosphatase (AP) and
CD15/LewisX/SSEA-1 [89]. It is also interesting that a pluripotency marker used to identify iPS
cells, such as SSEA-1 is also a marker of adult neural progenitor cells [13]. It has been shown
that AP and SSEA-1 are activated sequentially and relatively early during the reprogramming of
mouse somatic cells, and are followed by the expression of Nanog and Oct4 [30]. The
expression of stem cell maintenance genes, particularly Sox2, makes NSCs good candidates for
reprogramming to a pluripotent state using few exogenous factors.
1.4 Reprogramming and Cancer
Cancer could be considered to be a disease of pathological “reprogramming”, since normal cells
can be transformed into cancer cells as a result of combinations of genetic and epigenetic
aberrations. Initially proposed in a 1971 study on retinoblastoma, Knudson’s “Two Hit”
Hypothesis of cancer suggested that at least two mutational events are required for the initiation
of cancer [91]. In other words, for a genetically unstable cell to be transformed into a cancer
cell, the process requires a second perturbing event, or “hit” [92]. Genetic predisposition and
environmental factors increase an individual’s risk of developing cancer [92]. Therefore, cancer
results from the accumulation of genetic and epigenetic (non-genetic) changes over time. We
now understand that both inherited and sporadic cancers can be caused by the inactivation of
tumour suppressor genes and/or the activation of oncogenes as a result of two independent hits,
which involves a combination of genetic and epigenetic aberrations [93]. Studies assessing the
role of epigenetics in cancer, and the plasticity and potential pluripotency of cancer cells, have
provided valuable insights into the non-genetic factors influencing cancer.
1.4.1 Introduction to Epigenetics
Epigenetics is the term describing the inheritable changes in gene expression levels by
mechanisms other than changes in DNA sequence, which are mediated by processes such as
18
DNA methylation, histone modification, and chromatin remodeling [94]. Stable gene expression
alterations are caused by epigenetic processes, which are retained through mitosis; for instance,
DNA methylation patterns are transmitted during cell division [95]. Interplay exists between
epigenetic processes, since DNA methylation recruits histone-modifying enzymes and vice-
versa.
The most common targets for methylation are cytosine-guanine (CpG) sites, which
cluster in 0.5-2 kb regions of the genome termed “CpG islands” [96]. Predominantly situated in
promoter and coding regions of genes, CpG islands remain, for the most part, unmethylated in
autosomal genes. Methylation of CpG islands in promoter regions alters protein-DNA
interaction, since methylcytosine protrudes into the major groove of DNA, and reduces the
binding affinity of some transcription factors, thereby inhibiting transcription initiation [95].
Furthermore, methyl CpG binding protein 2 (MeCP2) and similar proteins bind to methylated
regions of DNA and recruit HDAC enzymes [97,98]. Nucleosomes consist of DNA wrapped
around an octamer of histone proteins, which are subject to reversible post-translational
modifications, including acetylation and methylation, among others. Generally, genes silenced
by DNA methylation are associated with histones that are hypermethylated and hypoacetylated at
specific lysine residues [99]. Nucleosome remodeling complexes bind to modified histone
proteins and reposition nucleosomes, thus exposing or concealing genes to be transcribed or
repressed.
The importance of DNA methylation during mammalian development was initially
exemplified by gene targeting in mouse ES cells to mutate a putative DNA methyltransferase
(DNMT) gene, resulting in a recessive lethal phenotype in embryos [100]. Dnmt1 homozygous
mutant ES cells and embryos showed approximately 3-fold reduction in genomic methylcytosine
levels compared to controls; the ES cells were viable in culture, whereas the embryos died mid-
gestation [100]. The subsequent identification and inactivation of Dnmt3a and Dnmt3b genes,
which are highly expressed in undifferentiated ES cells but downregulated in differentiated cells
of adult mammals, revealed that these DNMTs are essential for de novo methylation and
mammalian development [101,102]. Inactivation of both Dnmt3a and Dnmt3b in mice resulted
in embryonic lethality before e11.5, due to growth arrest and impaired development shortly after
gastrulation [102]. Dnmt1 is involved in the maintenance of DNA methylation marks during cell
division, whereas Dnmt3a and Dnmt3b are responsible for de novo methylation during
19
development [102]. Somatic cells harbour predominantly methylated CpG sites, with the
promoter or coding regions of genes containing regions with a high proportion of unmethylated
CpG islands [96]. Inactivation of the X chromosome, genomic imprinting, and silencing of
autosomal Alu insertional elements (a type of short interspersed element) and L1
retrotransposons are processes that rely on methylation of CpG islands in the promoter regions of
genes [96]. Gene expression is silenced by methylation of CpG islands and methylation patterns
are heritable, which provides a method of altering levels of gene expression without affecting the
underlying DNA sequence.
1.4.2 Epigenetic Contribution to Cancer
Cancer is a disease of aberrant genetics and epigenetics, but the relative contribution of each to
tumour progression remains largely unclear. DNA methylation is the most thoroughly
characterized epigenetic process involved in cancer [96]. In broad terms, cancer is associated
with genomic hypomethylation and CpG island hypermethylation. The first epigenetic
aberration to be associated with cancer was, in fact, global hypomethylation, which may promote
malignant transformation by causing chromosomal instability, promoting the loss of imprinting,
or reactivating transposable elements [93,103]. The aberrant methylation in cancer may involve
decreases in the overall amount of methylcytosine, demethylation of specific loci, de novo
methylation of CpG islands, or overexpression of DNMT enzymes [96]. It was first shown that
sites of cytosine methylation often correlated with mutated regions of DNA; the spontaneous
deamination of 5-methylcytosine resulted in transition mutations of cytosine to thymine and
subsequent failure to correctly repair the mismatch [104]. This study established a link between
methylated DNA regions and genomic mutations.
Similar to genes in normal cells, tumour suppressor genes in transformed human cells are
susceptible to methylation, including TP53, RB1, VHL, CDKN2A, CDKN2B, MLH1, and APC
[95]. The promoter regions of these genes harbour CpG islands, which are targeted for
methylation and subsequent gene silencing. For instance, approximately one quarter of the point
mutations in the tumour suppressor p53 gene are associated with CpG islands; in colon cancer,
this fraction is increased to nearly one half [96]. In addition to promoter hypermethylation, point
mutation and loss of chromosomal material through homozygous deletion or loss of
heterozygosity (LOH) may contribute to gene inactivation in cancer [95]. Aberrant methylation
20
in cancer may be mediated by increased expression or deregulated activity of de novo
methyltransferases, although the precise molecular mechanisms by which global methylation
levels are altered in cancer remain unclear [94].
It was long disputed whether de novo methylation in cancer was causative and directly
involved in initiating oncogenic transformation, or secondary and merely accompanying tumour
incidence [95]. The causal role of DNA methylation in cancer was investigated by gene
targeting of Dnmt1, which is a classical DNMT involved in the maintenance of methylation; not
only was genomic imprinting impaired, but the incidence of intestinal cancer was significantly
reduced [105,106]. Interestingly, cancer cells show a loss of genomic imprinting that arises as a
result of aberrant DNA methylation [107]. Furthermore, Dnmt3a and Dnmt3b, which are
involved in de novo methylation, are frequently overexpressed in cancer; depletion of Dnmt3b
reactivated genes that were silenced by hypermethylation and induced apoptosis in human cancer
cells in vitro [102,108]. Finally, promoter hypermethylation of important oncogenes in their
wildtype form, such as VHL and RB1, directly suppresses gene expression and has been
confirmed in familial cases of VHL syndrome and retinoblastoma, respectively [95]. Taken
together, these studies suggest that DNMTs involved in the maintenance and initiation of new
methylation patterns play an important causative role in cancer.
In addition, methylation of CpG islands within the promoter region of genes encoding
DNA repair enzymes silences the expression of these genes and promotes mutagenesis [96]. A
notable example is O6-methylguanine DNA methyltransferase (MGMT), which removes
mutagenic alkyl groups from O6-methylguanine [109]. This alkylated nucleotide binds
preferentially to thymine, causing transition mutations, or cross-links with cytosine residues,
impeding DNA replication [109]. Aberrant methylation of the MGMT promoter occurs in 40%
of glioma brain tumours and colorectal carcinomas, and in 25% of non-small cell lung cancers,
lymphomas, and head and neck carcinomas, but rarely in other types of tumours [109]. Silenced
MGMT expression as a result of promoter hypermethylation is an important factor in the
pathogenesis of these types of cancer by promoting DNA mutagenesis.
Aberrant methylation patterns also play a role in deregulating the activity of histone-
modifying enzymes. Histone methyltransferases, such as mixed-lineage leukemia 1 (MLL1)
create transforming fusion proteins involved in leukemogenesis, and the polycomb group (PcG)
21
complex protein Bmi1 silences the tumour suppressor genes p16INK4a
and p14ARF
in lymphoma,
brain, and other types of cancer [110,111,112]. Bmi1 is also essential for the regulation of
proliferation of normal and leukemic stem cells, resulting in cell cycle arrest, differentiation, and
apoptosis in Bmi1-deficient stem cells [113]. PcG proteins have a role in maintaining the long-
term silencing of differentiation-inducing genes in stem cells through the alteration of histone
modifications, particularly through trimethylation of lysine 27 of histone 3 [114]. PcG proteins
also have target genes that are often hypermethylated in their promoter regions and silenced in
cancer [115]. This was thought to create an “epigenetic stem cell signature” in cancer, which
could promote the abnormal expansion of cells in the early stages of malignant transformation
[115]. Evidently, a great deal of interplay exists between aberrant methylation patterns and
altered activity of histone-modifying enzymes in cancer.
1.4.3 Chemotherapy Targeting Epigenetic Modifications in Cancer
The epigenetic modifications involved in cancer pathogenesis and progression are theoretically
fully reversible; therefore, processes such as the aberrant methylation in cancer are ideal targets
for chemotherapeutic agents. A caveat could be if a genetic mutation exists in an epigenetic
regulator, such as a DNMT or histone methyltransferase. By restoring normal methylation levels
to CpG islands within the promoter regions of tumour suppressor genes, expression of these
genes could be reactivated to reestablish normal growth control [96]. In fact, AZA was the first
drug approved by the FDA as a methyltransferase inhibitor and is the common treatment for
myelodysplastic syndromes, which are hematopoietic stem cell disorders associated with
hypermethylation of the cell cycle regulator, p15INK4B
[116]. Methylated DNA recruits HDACs
through the assistance of MeCP2 and other methyl CpG binding proteins, which further
emphasizes the interplay between aberrant methylation and histone-modifying enzymes in cancer
[97,98]. AZA and HDAC inhibitors are currently being evaluated in clinical trials for other
types of tumours [117,118].
22
1.4.4 Pluripotency and Cancer
Cancer cells are characterized by many features, including uncontrolled self-renewal and failure
to senesce, which are similar characteristics of pluripotent ES cells, since these cells self-renew
indefinitely in vitro. The aforementioned epigenetic stem cell signature in cancer involves the
preferential silencing of differentiation-inducing PcG target genes by promoter
hypermethylation, thereby promoting the self-renewal of neoplastic cells [115]. In fact, cancer-
specific DNA hypermethylation was 12-fold more likely to be associated with PcG target genes
than with non-PcG targets [115]. These findings are corroborated by a study that implicated a
pluripotent ES cell-like identity, including silencing of PcG-regulated genes, in poorly
differentiated human tumours [119]. Aggressive tumours often consist of poorly differentiated
cells, and cancers such as high-grade estrogen receptor (ER)-negative breast cancer, high-grade
glioma, and bladder carcinomas showed preferential overexpression of activation targets of
Nanog, Oct4, Sox2, and c-Myc [119]. The ES cell-like gene expression profile in ER-negative
breast cancer was a negative prognostic indicator, predicting significantly higher mortality rates
[119]. The ES cell-like expression signature in aggressive tumours did not involve the
expression of Nanog, Oct4, or Sox2, but simply the overexpression of gene sets representing the
core expression signature of ES cells.
However, it is likely that a gene expression network governed by c-Myc accounts for a
significant portion of the similarities between the transcriptional profiles of ES and cancer cells
[120]. The interpretation that cancer represents a regression to an ES cell-like state due to
dedifferentiation of cells is suspect, since the pluripotency signature overlaps significantly with
the c-Myc regulatory network. This network is involved in regulating cellular metabolism, cell
cycle, and protein synthesis pathways during oncogenic transformation [120]. Myc is also
implicated in somatic cell reprogramming to the pluripotent state. A similarity between
pluripotent and cancer cells can be found in the p53-p21 tumour suppressor pathway, which
prevents the transition to the pluripotent state during transcription factor-mediated nuclear
reprogramming in a manner that parallels its role in suppressing oncogenic transformation
[69,70,71,72]. Overlap between the c-Myc network and the core pluripotency network regulated
by Nanog, Oct4, and Sox2 makes it difficult to conclude whether a true ES cell-like signature
exists in cancer cells.
23
Nevertheless, similar to normal cells, precancerous and cancerous cells display some
degree of cellular plasticity. It was recently shown that phenotypic plasticity occurs in healthy
human epithelial breast tissue, with a rare subpopulation of epithelial cells expressing Nanog and
Oct4 and harbouring the capacity to generate teratomas containing derivatives of the three germ
layers in vivo [121]. These cells, termed “endogenous provisionally pluripotent stem cells”, are
distinct from human ES cells and mesenchymal stem cells, expressing markers of endoderm,
mesoderm, and ectoderm upon differentiation, and may act as breast cancer precursors [121].
Furthermore, phenotypic plasticity may occur in cancer, as some neoplastic cells have an
intrinsic capacity for endothelial differentiation, which may play a role in the adaptation to a
hypoxic tumour microenvironment through the process of vasculogenic mimicry [122]. This
process has been associated with aggressive forms of skin, brain, breast, prostate, ovarian, lung,
and rhabdomyosarcoma cancers, among others [122,123,124]. Vasculogenic mimicry is similar
to embryonic vasculogenesis, with cancer cells activating the expression of previously silenced
signaling molecules and endothelium-associated genes to form extracellular matrix-rich fluid-
conducting vessels [122]. This example of phenotypic plasticity may reflect the unstable
epigenetics of cancer cells and should not be interpreted as true pluripotency.
Historically, a link was initially made between pluripotency and cancer by seminal
studies in the mid-1960s showing that single embryonal carcinoma (EC) cells are pluripotent
stem cells of a teratocarcinoma and can produce tissues derived from all three of the germ layers
when injected in vivo [125]. This study also demonstrated the heterogeneity of EC cells derived
from a teratocarcinoma. Upon blastocyst injection, mouse teratocarcinoma cells gave rise to the
generation of viable chimeric mice devoid of tumours and contributed to germline transmission
[126,127]. By directing postimplantation development, the teratocarcinoma cells activated the
expression of many somatic and germline genes that had been silenced in the original tumour
[126]. These studies suggested that embryo-derived teratocarcinomas, which are tumours of
embryonic or germ cell origin, have not only pluripotent potential, but can direct the
development of a viable organism. It was later shown that EC cells express Oct4, which may
confer a pluripotent phenotype in these cells [128]. Oct4 is also expressed in embryonic germ
(EG) cells, primordial germ cells (PGCs), and identifies pluripotent cells in germ cell tumours,
which is suggestive of a PGC cell-of-origin theory for germ cell tumours [129,130]. In germ cell
tumours, Oct4 may be a dose-dependent oncogenic determinant; overexpression of Oct4
24
increases tumour malignancy, whereas suppression of Oct4 prevents tumour growth [129].
Although Oct4 and Nanog expression have been detected in some somatic tumours, including
aggressive breast and brain cancers, the functional role of these transcription factors in the
context of cancer remains unclear [131,132,133,134]. It is highly unlikely that Oct4 and Nanog
have the same pluripotency-associated function in cancer cells as they do in normal cells [134].
1.4.5 Nuclear Reprogramming of Cancer Cells
Taking into account the extensive involvement of epigenetic processes in cancer, a question that
arises is whether resetting the epigenetic program of cancer cells through the process of nuclear
reprogramming could attenuate the neoplastic phenotype. A classical experiment in the late
1960s showed that renal carcinoma nuclei from frogs could be transplanted into enucleated
oocytes to give rise to viable tadpoles [135]. Initially attributed to the pluripotent nature of the
renal carcinoma cells, the wide variety of cell types employed in the classical nuclear
reprogramming studies previously discussed suggests that pluripotency is induced during
reprogramming and is not necessarily a characteristic of the donor cell.
Nuclear transfer has been employed to reprogram several mouse models of cancer. Cells
from the classical Patched1 heterozygous (Ptc1+/-
) mouse model of medulloblastoma were
reprogrammed by nuclear transfer, a process that attenuated tumourigenicity and suppressed
proliferation [136]. The epigenetically reprogrammed Ptc1+/-
medulloblastoma nuclei were able
to direct preimplantation development and formed postimplantation embryos devoid of
malignancies, suggesting that tumourigenicity was suppressed, at least at an early developmental
stage. Similarly, nuclei from experimentally induced leukemia, lymphoma, and breast cancer
cells were reprogrammed by nuclear transplantation and formed blastocysts, but failed to
generate viable ES cells [137]. By contrast, Ras-inducible melanoma nuclei were reprogrammed
by nuclear transplantation to generate viable chimeras, although a variety of tumours arose
rapidly in the chimeric mice, due to the reactivation of Ras in vivo [137]. Furthermore, in
tetraploid complementation experiments (when implanted ES cells produce the embryo and
tetraploid host cells generate extra-embryonic tissues), the ES cells derived from Ras-inducible
melanoma nuclei could only support development until e9.5 [137]. Similarly, mouse EC cell
lines were reprogrammed by nuclear transfer, and the resulting ES cells had the same
tumourigenic and developmental potential as the donor EC cells [138]. The failure to alter the
25
tumour-initiating ability of EC cells by SCNT was attributed to permanent genetic lesions, rather
than epigenetic aberrations [138]. Taken together, these finding suggests that the autonomous
developmental potential of cancer cells may be limited by permanent genetic lesions and that
reprogramming by SCNT is insufficient to block tumour-initiating ability.
Recently, gastrointestinal (GI) cancer cells and chronic myeloid leukemia (CML) cells
have been reprogrammed using Yamanaka factors to generate iPS cells [139,140]. It is
interesting to note that the GI cancer-derived iPS cells were associated with an increased
sensitivity to differentiation-inducing treatment and to the chemotherapeutic agent 5-
fluorodeoxyuridine, whereas the CML-derived iPS cells lost the dependency on continuous
signaling of the BCR-ABL oncogene fusion protein and became resistant to the BCR-ABL
inhibitor imatinib [139,140]. Furthermore, re-differentiation of CML-derived iPS cells to a
hematopoietic cell fate restored BCR-ABL dependency; cells expressing hematopoietic markers
(CD34, CD43, and CD45) were killed as a result of imatinib treatment, whereas the viability of
non-hematopoietic cells was not affected [140]. These studies implicated the epigenetic state of
cancer cells in their sensitivity to differentiation-inducing chemicals and chemotherapeutic
agents.
1.5 Cancer Stem Cells
Cancer stem cells (CSCs) comprise the subset of cells in a cancer with the ability to initiate
tumour growth. CSCs share several properties with normal stem cells, such as self-renewal and
differentiation, but are the cells responsible for cancer progression and recurrence. CSCs were
initially identified in human acute myeloid leukemia based on the isolation of cells with the
hematopoietic stem cell surface phenotype (CD34+CD38
-) that could engraft and serially
transplant the disease in sub-lethally irradiated non-obese diabetic/severe combined immune-
deficient (NOD/SCID) mice [141]. This study established a standard in vivo model of serially
transplanting cells into NOD/SCID recipients to verify the cancer-initiating capacity of putative
CSCs, which must also produce a xenograft that recapitulates or phenocopies the original cancer.
Through similar methods, CSCs were first identified in solid tumours by isolating cells
from primary human breast cancers based on the cell surface marker expression profile
CD44+CD24
-/Lineage
-; these CSCs engrafted and initiated tumour growth that phenotypically
mimicked the primary human tumour when as few as 1,000 cells were injected into the
26
mammary fat pad of NOD/SCID mice [142]. CSCs were later identified in solid primary
tumours including cancer of the brain [143], bone [144], prostate [145], skin [146], colon [147],
lung [148], head and neck [149], pancreas [150], and mesenchymal tissue [151]. Early
controversial studies involving the transplantation of cancer cells subcutaneously in human
subjects were conducted in the mid-20th
century were the first to demonstrate the functional
heterogeneity of human tumours [152,153,154]. One study showed that the incidence of tumour
formation was only 50% when one million cancer cells were implanted in human subjects [154].
Initially attributed to the “host resistance to cancer”, these results can be described by the Cancer
Stem Cell Hypothesis, which relates to the functional heterogeneity occurring within a tumour.
1.5.1 The Cancer Stem Cell Hypothesis
The hierarchical model of tumour progression involving cancer stem cells suggests that not every
cell within a tumour has an equivalent potential for self-renewal, differentiation, or tumour
initiation. The Cancer Stem Cell Hypothesis proposes that only CSCs are able to regenerate
tumours when cancer cells are injected into immune-compromised animals. The CSC therefore
lies at the apex of the hierarchy of cells within a tumour, initiates tumour growth, and can self-
renew to generate CSCs or differentiate to generate non-cancer stem cells of the tumour bulk
(Figure 3). This model is in contrast to the stochastic model of cancer, which suggests that every
cell within a tumour has the potential to proliferate and initiate tumour growth, although the
probability of tumour initiation remains low for any given cell [155]. The stochastic model of
cancer implies functional homogeneity within a tumour, whereas the Cancer Stem Cell
Hypothesis suggests functional heterogeneity of cells in a tumour. The isolation of CSCs from a
primary tumour based on markers or phenotype, therefore, enriches for clonogenic cells in vitro
and tumour-initiating cells when injected into immune-deficient recipients in vivo. Importantly,
the Cancer Stem Cell model does not predict the cell of origin of a cancer. Although CSCs share
several characteristics with normal stem cells, such as self-renewal and differentiation, this does
not imply that CSCs occur as a result of oncogenic transformation of normal stem cells.
The Cancer Stem Cell Hypothesis has important clinical implications in cancer,
particularly in treatment and tumour recurrence, since treatment regimens targeting non-CSCs,
which constitute the majority of cells within the tumour (i.e. tumour bulk), fail to cure the
disease and lead to recurrence if CSCs remain after treatment. The Cancer Stem Cell Hypothesis
27
is supported by experimental results suggesting that CSCs are more resistant to chemotherapy
and radiation treatment compared to non-CSCs, due to expression of drug transporters and
increased DNA repair capacity [156,157,158]. Furthermore, recent evidence from acute
lymphoblastic leukemia suggests that genetic diversity exists in leukemia-initiating cells and that
multi-clonal evolution occurs during leukemic progression [159]. Therefore, due to the
functional heterogeneity of cells within a cancer of the blood or solid tissues, treatments
specifically targeting CSCs are essential in curing cancer and preventing recurrence.
28
A
B
Figure 3. A comparison of the stochastic and cancer stem cell models of cancer.
(A) The stochastic model of cancer (left) posits that every cell within a tumour is
functionally equivalent and has similar, albeit low, tumour-initiating potential. The cancer
stem cell model of cancer (right) implies functional heterogeneity within a tumour, with the
tumour-initiating CSC located at the apex of the hierarchy. This model suggests that only
rare CSCs have the ability to initiate and maintain tumour growth, through self-renewal
and differentiation to produce non-CSCs of the tumour bulk. (B) Treatments failing to
target CSCs lead to tumour recurrence by sparing CSCs, whereas targeted treatments
eliminate the CSCs and cause tumour regression.
29
1.6 Brain Tumours
Brain tumours comprise a diverse group of cancers occurring in the central nervous system
(CNS). In the developing brain of children (aged 0-14) and young adults (aged 15-29), tumours
are thought to arise as a result of spontaneous oncogenic transformation of proliferating cells,
whereas the gradual accumulation of genetic lesions has been attributed to the cause of brain
tumours in adults (>30 years) [160]. In fact, the most common types of brain tumours occurring
in younger individuals vary significantly from those occurring most commonly in the aged
population. The most common types of brain tumours occurring in children and young adults are
embryonal tumours such as primitive neuroectodermal tumours (PNETs) and medulloblastoma
(MB), low-grade astrocytomas, and ependymomas [160]. These tumours are considerably rarer
in adults, who are most frequently affected by astrocytic glioma brain tumours. The World
Health Organization (WHO) has applied a histological grading scale of I-IV to CNS tumours,
with grade I tumours consisting of benign growths with low proliferative potential and grade IV
glioblastoma multiforme (GBM) consisting of anaplastic growths displaying high proliferative
indices, angiogenesis, cellular invasion, and necrosis [161]. High-grade GBM is the most
common type of brain tumour occurring in adults and is associated with a median survival of
only 12.1 months with radiotherapy alone or 14.6 months with the addition of temozolomide
chemotherapy [162]. Therefore, while non-metastatic embryonal tumours arising in children,
such as MB, are associated with relatively high survival rates with aggressive therapy, high-
grade gliomas affecting adults are one of the most devastating types of cancer.
1.6.1 Human Glioma
Gliomas are characterized pathologically as primary parenchymal tumours that exhibit glial
differentiation and are classified as astrocytomas, oligodendrogliomas, ependymomas, or mixed
gliomas, based on the predominant cell type present [161]. Grade IV malignant gliomas can be
identified as a primary GBM upon initial diagnosis, or can develop from a low-grade
astrocytoma over the course of approximately 5 years to produce a secondary GBM. The
majority of GBMs (>90%) arise de novo in patients aged 62 years (average) and progress rapidly
over the course of only a few months, whereas secondary GBMs occur in a younger population
(aged 45 years, average) and are associated with longer survival [161]. It has been proposed that
although primary and secondary GBM share several genetic, pathological, and biological
30
features, they consist of two distinct clinical entities, due to striking differences in the genetic
pathways affected. For instance, both types are characterized by LOH 10q (approximately 70%
of cases), but primary GBMs are most often associated with EGFR amplification (36%), p16INK4a
deletion (31%), and TP53 mutation (28%), whereas TP53 mutation is the most frequent genetic
mutation (65%) implicated in secondary GBMs, followed by p16INK4a
deletion (19%) and EGFR
amplification (8%) [163]. Therefore, several genes have been implicated in the pathogenesis of
high-grade glioma, but the frequency of specific genetic aberrations differs significantly between
primary and secondary GBM.
More recently, genome-wide sequencing studies have identified other important genetic
aberrations commonly occurring in stage IV glioma, including homozygous deletion of PTEN,
NF1, RB1, and IDH1, as well as mutation or amplification of CDK4, PDGFRA, and MDM2
[164,165]. Furthermore, the signaling pathways more commonly altered in GBM were identified
as PI3K (88% of cases), p53 (87%), and Rb (78%) [164]. All three of the signaling pathways
were altered in 74% of cases [164]. These genomic analyses have helped to identify common
genetic aberrations occurring in the most aggressive form of glioma, thereby presenting genes
and signaling pathways that could be targeted by novel therapeutics and in animal models of the
disease.
Although the genetic changes associated with high-grade glioma have been well
characterized [164,165], it has also been recognized that extensive epigenetic changes are
involved. Epigenetic processes commonly implicated in cancer also apply to brain tumour
pathogenesis, such as aberrant hypermethylation of CpG islands in promoter regions of tumour
suppressor genes and altered histone modification. In a broad study investigating the gene
hypermethylation profiles of human cancers, the following genes were associated with
hypermethylated promoters in brain tumours (although the types of brain tumours were not
specified): MGMT (34% of samples), p16INK4A
(30%), TIMP3 (26%), p14ARF
(9%), and GSTP1
(5%) [166]. In glioma brain tumours, promoter hypermethylation silences the expression of
genes involved in cell cycle control (p16INK4A
and p15INK4b
) tumour suppression (RB1, VHL, and
RASSF1A), DNA repair and genome integrity (MGMT and MLH1), among other functions [167].
The heterogeneous methylation profile of high-grade gliomas is exemplified by another
study that identified several other genes as frequently hypermethylated in GBM, including
31
FZD9, TNFRSF10A, MEST, TES, and HOXA11 [168]. Interestingly, this study found that genes
with hypermethylated promoters in GBM are significantly enriched (41%, p < 0.001) for targets
of the Polycomb repressive complex (PRC)2 in ES cells [168]. This study, therefore, established
a link between promoter hypermethylation and PRC2 target genes in GBM. Furthermore, the
core component of PRC2, EZH2, and the PcG protein and oncogene, BMI1 (a member of PRC1),
were found to be overexpressed in GBM tumours, particularly in the CD133+ cancer stem cell
fraction, and were required for self-renewal [169]. Stable knockdown of BMI1 or EZH2 reduced
the clonogenic potential of GBM cells in vitro, while BMI1 knockdown reduced brain tumour
formation in vivo [169]. BMI1 typically targets the INK4A/ARF locus to suppress expression of
p16INK4A
and p14ARF
, but there is evidence that BMI1 may target other tumour suppressor
pathways in human and mouse glioma [112,169]. Furthermore, BMI1 may promote radiation
resistance in GBM by recruiting DNA damage response machinery, including ATM kinase and
γH2AX [170]. EZH2, the core component of PRC2, directly targets c-Myc in GBM and is
considered to be essential for BTSC self-renewal in vitro and tumour-initiating ability in vivo
[171]. Taken together, these studies show that PRC1 and PRC2, which regulate PcG target gene
expression through chromatin modification, may play a role in the maintenance of self-renewal
of cancer cells in high-grade glioma.
Aberrant promoter hypermethylation of genes encoding DNA repair enzymes has also
been associated with glioma pathogenesis. Silencing of the MGMT gene by promoter
hypermethylation occurs in approximately 40% of gliomas, but less frequently in non-glial
tumours, thereby reducing the expression levels of a key DNA repair enzyme and promoting
mutagenesis [109]. Loss of expression of MGMT results in a failure to remove alkyl groups
from guanine residues, which binds preferentially to thymine, resulting predominantly in G:C to
A:T transition mutations [109]. Aberrant promoter methylation and silencing of MGMT has
been implicated in the early stages of the transformation from low-grade gliomas to high-grade
secondary GBM, since hypermethylation occurs in 48% of low-grade diffuse astrocytomas and
in 75% of secondary GBM (compared to only 36% of primary GBM) [172]. Furthermore,
hypermethylation and silencing of MGMT is associated with increased G:C to A:T transition
mutations in the key tumour suppressor gene, TP53 [172]. For instance, 92% of secondary
GBMs with MGMT hypermethylation showed mutations in TP53, whereas only 25% of those
without MGMT hypermethylation harboured TP53 mutations [172]. Therefore,
32
hypermethylation of the promoter of MGMT, which encodes a key DNA repair enzyme,
promotes the accumulation of mutations in TP53 and perhaps other tumour suppressor genes.
Nevertheless, promoter hypermethylation of MGMT predicts a more favourable outcome
for patients treated with the common chemotherapeutic alkylating agent, temozolomide, since
alkyl adducts are not removed from guanine residues, thus triggering chemotherapy-induced
apoptosis of tumour cells [173,174]. Therefore, promoter hypermethylation and silencing of the
MGMT gene promotes the preservation of mutagenic alkylated nucleotides, but may also act as a
favourable prognostic marker when combined with alkylating drugs. In fact, GBM patients with
long-term survival (>2 years) more frequently harbour MGMT promoter hypermethylation than
classic GBM survivors (78% versus 39%) [167]. In addition, epigenetics may play a role in
recurrence of high-grade gliomas; approximately two thirds of relapsed GBMs show
significantly different DNA methylation patterns compared to the primary GBMs from which
they arose, primarily due to hypermethylation of promoters of pro-apoptotic genes [175]. The
identification of distinct epigenetic profiles associated with individual subtypes of glioma and
different tumour stages, or as predictive biomarkers, may encourage the development of novel
chemotherapeutic agents targeting DNA methylation or chromatin modification.
1.6.2 Mouse Glioma
Mouse models of cancer can be produced by exposure to carcinogens, targeted deletion or
mutation of tumour suppressor genes, forced expression of oncogenes, or a combination thereof.
Mouse models of glioma targeting the tumour suppressor p53 are clinically representative of the
human disease, since p53 signaling is inactivated in 87% of high-grade gliomas, with mutations
or homozygous deletions of TP53 occurring in 35% of GBM cases [164]. It has been shown that
homozygous or heterozygous deletion of the mouse p53 gene results in predisposition to various
types of cancer and 50% survival rates of approximately 20 weeks and >70 weeks, respectively
[176]. In p53-/-
mice, thymic lymphoma is the most common type of cancer, whereas sarcomas
most often occur in p53+/-
mice [176]. On the other hand, Cre-mediated deletion of p53 in cells
expressing the astrocytic cell marker, glial fibrillary acidic protein (GFAP), has been shown to
generate high-grade brain tumours with 90% penetrance and high specificity for malignant
gliomas (>85%, based on histopathology) [177]. Therefore, targeted deletion of p53 in the CNS
of mice is one molecular mechanism for the generation of high-grade malignant brain tumours.
33
In addition to targeted deletion of tumour suppressors, mouse models of glioma have
been reported that incorporate carcinogen treatment in utero. A common carcinogen for such
applications is the alkylating agent, N-ethyl-N-nitrosourea (ENU), which causes nucleotide
transitions, resulting in random point mutations [178]. Malignant gliomas are generally a rare
occurrence in p53-/-
mice, but ENU treatment of p53-/-
mice in utero generates gliomas in 50-
70% of p53-/-
mice with a median survival of approximately 10-12 weeks [179,180]. However,
this mouse model does not generate glioma exclusively, and the mice also succumb to
lymphoma, leukemia, sarcoma, and lung cancer [179,180]. The incidence of glioma formation is
increased if p53 knockout is targeted exclusively to the CNS; our lab has previously shown that
the Nestin-Cre mediated deletion of p53 in the CNS of mice combined with ENU treatment at
e13.5 causes 100% brain tumour incidence, 91% of which were identified histologically as high-
grade malignant gliomas, with a median survival of 19.3 weeks and the absence of other tumour
types [180]. Similar to human gliomas, the primary mouse gliomas were phenotypically
heterogeneous, with a high percentage (>70%) of these cells express markers of NSCs (Nestin+
and Sox2+), while a minority of cells express the mature cell markers of astrocytes (S100β
+),
neurons (Map2+), and oligodendrocytes (CNPase
+) [180]. Sorting for the cell surface marker
CD15 enriched for the clonogenic population, with tumours occurring in vivo from the orthotopic
injection of as few as 1,000 cells [180]. Stem cell lines derived from the mouse model of glioma
are associated with gene expression patterns that show similarities to both the typical cancer
genotype as well as the normal NSC program [180,181]. Most strikingly, the gene expression
profile of brain tumour stem cells correlates closely to the expression pattern of normal NSCs,
suggesting that there are relatively few changes in gene expression between normal and tumour
stem cells and that epigenetics play a significant role in the tumourigenic phenotype of these
cells. The CNS-specific deletion of p53, combined with ENU treatment in utero constitutes,
therefore, a clinically-representative and effective chemical-genetic mouse model of high-grade
glioma.
1.6.3 Brain Tumour Stem Cells
Cancer stem cells have been identified in human brain tumours and are likely responsible for
tumour progression and recurrence [143,182]. Dissociating and culturing primary adult or
pediatric brain tumours in standard neural stem cell conditions (serum-free medium with EGF
and bFGF) produced neurospheres that were phenotypically similar to normal neural stem cells
34
in terms of self-renewal and differentiation into neurons, astrocytes, and oligodendrocytes under
appropriate conditions (growth factor withdrawal or addition of serum) [3,143,183,184,185].
The neurospheres grown from primary brain tumours engrafted in NOD/SCID mice
subcutaneously or intracranially and regenerated tumours that were phenotypically similar to the
primary human tumour [182].
Brain tumour stem cells (BTSCs) can be prospectively isolated from primary human
tumours by sorting for the neural stem cell surface marker, CD133 (Prominin-1) [12,143].
BTSCs comprise a subpopulation of cells within a primary tumour; CD133+ cells constitute a
range of 3.5-46% of cells in a human tumour, with higher tumour grades generally containing a
higher CD133+ fraction [143,182]. In fact, CD133
+ CSCs in GBM are associated with increased
radiation resistance compared to the non-CSCs comprising the tumour bulk, with CSCs
activating Chk1/2 DNA damage checkpoint kinases and the downstream damage response
machinery [158]. BTSCs have potent tumour initiating-ability in xenograft models; the injection
of as few as one hundred CD133+ BTSCs resulted in the formation of phenotypically
heterogeneous and serially transplantable brain tumour in NOD/SCID recipients, whereas 105
CD133- cells engrafted in the brain, but did not form tumours [182]. CD133 therefore enriches
for tumour-initiating cells.
Although it remains possible that other cell surface or intracellular markers identify CSCs
within brain tumours, CD133 is considered the most reliable marker of BTSCs. In mouse
models of glioma and medulloblastoma, sorting for CD15/SSEA-1 enriches for clonogenic cells
in vitro and tumour-initiating cells in vivo [180,186,187]. Markers such as CD15/SSEA-1 or
autofluorescence have been used to enrich for human glioma tumour-initiating cells in vitro and
in vivo [188,189]. Interestingly, autofluorescent glioma-initiating cells were found not only to
express Sox2, but also Nanog and Oct4, although these findings remain controversial in the field
[189].
BTSCs have many phenotypic similarities to normal NSCs, including the expression of
NSC markers (Nestin, Sox2, CD133) and the ability to self-renew or differentiate to produce
neurons, astrocytes, and oligodendrocytes. The regulation of self-renewal and differentiation of
BTSCs and normal NSCs is mediated by many of the same signaling pathways, including BMP,
Hedgehog and Notch. Increased BMP signaling has been shown to reduce BTSC proliferation
35
and tumour-initiating ability, and promote neuronal differentiation in vitro and in vivo [190].
Hedgehog and Notch signaling also regulate normal NSC self-renewal and differentiation;
blockade of these pathways in BTSCs reduces self-renewal in vitro and tumour-initiating ability
in vivo [132,191]. BTSCs and normal NSCs can also be cultured as cell lines in vitro as
neurospheres or in adherent conditions on a matrix of poly-L-ornithine and laminin; adherent
culture conditions result in a more homogeneous cell population and offer some practical
advantages regarding infection, transfection, and clonal isolation [181]. Glioma BTSC lines can
also initiate aggressive malignant brain tumours in NOD/SCID mice upon injection of as few as
100 cells [181]. Therefore, the discovery of a tumour-initiating cell in human brain tumours and
the ability to isolate BTSCs based on the expression of CD133 allows for their expansion and
manipulation in vitro so that their genetics and epigenetics can be studied in depth.
1.7 Thesis Rationale, Hypothesis, and Specific Aims
1.7.1 Rationale
Cancer arises from a combination of genetic and non-genetic changes, including epigenetic
aberrations, all of which contribute to the neoplastic phenotype. Reprogramming somatic cell
nuclei by SCNT, cell fusion, or transcription factor-mediated methods dramatically alters the
epigenetic state of cells, resulting in a change in developmental potential [32]. The ability to
reprogram mouse models of medulloblastoma and melanoma by SCNT suggests that
reprogrammed cancer cell nuclei can direct normal development and that the neoplastic
phenotype can be at least partially attenuated [136,137]. In addition, normal mouse NSCs can be
reprogrammed by one or more transcription factors to generate iPS cells [86,89]. The gene
expression profile of mouse BTSCs correlates closely to the expression pattern of normal NSCs,
which may make mouse BTSCs amenable to reprogramming to the pluripotent state with few
exogenous factors. This study will provide an opportunity to assess the influence of induced
pluripotency on the self-renewal, differentiation, and tumour-initiating ability of BTSCs.
1.7.2 Hypothesis
We propose that CSCs, which are the driving force of brain tumour growth, can be
reprogrammed to pluripotency by the ectopic expression of a defined set of transcription factors
(Oct4, Klf4, Sox2, and c-Myc). Reprogramming BTSCs may alter the epigenetic contribution to
36
the neoplastic phenotype and suppress tumourigenicity. If successful, this study will allow a
better understanding of the relative contributions of DNA genetic changes and non-genetic
cancer-associated changes to neoplastic behaviour.
1.7.3 Specific Aims
The overall goal of this project was to characterize BTSCs derived from a mouse model of
glioma in terms of pluripotency marker expression, and to generate iPS cells from BTSCs and
appropriate control NSCs by ectopic expression of transcription factors. A thorough molecular,
phenotypic, and functional characterization of the resulting iPS cell lines was performed,
including the assessment of in vitro and in vivo differentiation potential. Future experiments
involve the complete phenotypic characterization of NSC generated from the re-differentiation of
BTSC-derived iPS cell lines, which will also be assessed for tumourigenicity by in vivo
injections. The tumour-forming capacity of iPS cell-derived NSCs will be compared to that of
the BTSCs from which they were derived, with the goal of determining whether resetting the
epigenetic program of glioma BTSCs attenuates tumourigenicity. Comparing the gene
expression profiles of these cells may also aid in identifying novel genes or pathways that are
altered or differentially regulated in glioma tumours.
37
Chapter 2
2 Materials and Methods
2.1 Characterization of Mouse Glioma Stem Cell Lines
2.1.1 Mouse Glioma Stem Cells
Our lab previously developed a clinically representative chemical-genetic mouse model of
glioma involving the Cre-mediated deletion of p53 in the central nervous system [180]. Nestin-
Cre;p53+/-
male mice were time-mated with p53flox/flox
females, which were then administered the
chemical carcinogen N-ethyl-N-nitrosourea at e13.5. This resulted in 100% spontaneous brain
tumour incidence in the offspring by 6 months of age [180]. Glioma stem cell lines were
established from dissection and dissociation of unsorted tumours and were grown in adherent
serum-free conditions, as described below.
2.1.2 Cell Culture and Differentiation
Mouse GNS and normal NS cell lines were grown as adherent monolayers in vitro in mouse
NSC medium (serum-free DMEM/F12 (1:1) with 2 µg/mL heparin, 20ng/ml EGF and 20ng/ml
bFGF with 2 µL laminin (Sigma, L2020) per 1 mL of culture medium on Primaria tissue culture
dishes (BD Biosciences) as previously described [3,181]. Cells were grown in a 37°C incubator
with 5% CO2 and cultures were replated every three days, with a split ratio of approximately 1 in
4. Cells were replated by mild dissociation treatment with 0.5-1 mL of Accutase (Sigma,
A6964) for approximately 5 minutes at 37°C, resuspended in DMEM, centrifuged, and
resuspended in complete NSC medium, from which approximately one quarter of the volume
was placed in a new dish and supplemented with 2 µL laminin per 1 mL of culture medium.
Serum-based differentiation was carried out in mouse NSC medium without growth factors,
supplemented with 10% fetal bovine serum (FBS; Gibco, 16000-044).
2.1.3 RNA Isolation and Reverse-Transcriptase PCR
Cells were lysed directly on the tissue culture dish with RLT buffer (Qiagen, 79216) containing
10 µL/mL β-mercaptoethanol, collected with a cell scraper, and frozen at -80°C for RNA
extraction. RNA was extracted with the QIAshredder (Qiagen, 79656) and RNeasy Mini Kit
38
(Qiagen, 74106) according to the manufacturer’s instructions. An on-column DNase digestion
step was included (Qiagen, 79254). Synthesis of cDNA was carried out with Transcriptor
Reverse Transcriptase (Roche, 03 531 295 001) according to the manufacturer’s protocol, using
1 µg of RNA and oligo dT primers. PCRs were carried out for 35 cycles with primers to detect
Nanog, Oct4, Rex1, Klf4, Sox2, c-Myc, and GAPDH. Quantitative RT-PCR was carried out by
Stephanie Dobson (a rotation student in the lab) to assess the levels of expression of L-Myc, Klf4,
Klf2, Nanog, Sox2, Oct4, Klf5, and c-Myc in the glioma stem cell lines, p53-/-
NSCs, p53+/+
NSCs, and J1 mouse ES cells. See Appendix 1 for all primer sequences.
2.1.4 Alkaline Phosphatase Staining
Alkaline phosphatase staining was carried out for the three glioma NS cell lines, p53+/+
NS, and
p53-/-
NS cell lines, with J1 mouse ES cells and MEFs as positive and negative controls,
respectively, as described elsewhere [192]. Briefly, cells were fixed with 4% formaldehyde at
room temperature for 15 minutes, washed with PBS, and stained with a solution of 1 mg/mL Fast
Red TR hemi(zinc chloride) salt (Sigma, F8764) and 0.4 mg/mL naphthol phosphate disodium
salt (Sigma, N7255) in 0.1 M Tris-HCl, pH 8.6 for approximately 5 minutes. The enzymatic
product couples with the Fast Red TR salt to generate a red fluorescent azo dye adduct that can
be visualized by light or fluorescence microscopy [193]. Cells were washed several times with
PBS and stored in 4% formaldehyde for visualization with a Leica DMIL microscope fitted with
a Leica DC500 camera for imaging.
2.1.5 MTT Assay
Cells were seeded at a density of 2,000 cells per well in stem cell conditions (serum-free NSC
medium with EGF and bFGF) or growth factor-free medium with 10% (v/v) heat-inactivated
serum in 96-well tissue culture plates with 2 µL laminin per 1 mL of medium. Proliferation was
measured on days 5, 10, and 14 by adding 10 µL of 5 mg/mL MTT reagent (Roche, 11 465 007
001) to each well and incubating at 37°C for 4 hours. MTT solubilization buffer (10% SDS in
0.01 M HCl) was added at a volume of 100 µL per well and incubated overnight at 37°C.
Spectrophotometry was carried out at 575 nm using a Versamax microplate reader (Molecular
Devices, Sunnyvale, CA) and analyzed using SoftMax Pro software (Molecular Devices).
39
2.2 Mouse iPS Cell Induction
2.2.1 EOS Lentiviral Infection
The early transposon promoter and Oct4 and Sox2 enhancer (EOS) lentivirus was produced as
described elsewhere and was provided by Dr. Akitsu Hotta from the Ellis Lab [192,194].
Twenty-four well plates were coated with 0.01% poly-L-ornithine (PLO; Sigma, P4957) for
approximately 20 minutes, washed with PBS, and coated with 5 µg/mL laminin in PBS
overnight. Target cells (GNS3, p53+/+
NS, and p53-/-
cell lines) were seeded at a density of
20,000 cells per well of a 24-well plate and infected the following day with 1 µl of EOS
lentivirus or PGK-GFP lentivirus in 500 µl of complete mouse NS cell medium containing 4
µg/mL polybrene (Sigma, 107689). The virus-containing medium was removed and replaced
with fresh mouse NS cell medium approximately 24 hours post-infection. GFP expression was
visualized using a Zeiss Axiovert 200M fluorescence microscope to assess infection efficiency
and cells were expanded into 6-well plates 5 days after infection. EOS-infected cell stocks were
frozen in complete mouse NS cell culture medium containing 10% (v/v) DMSO.
2.2.2 Retrovirus Production and Infection
The Platinum-E (Plat-E) packaging cell line was used to produce retroviruses and was cultured in
DMEM containing 10% (v/v) heat-inactivated FBS, 0.1 mM nonessential amino acids (Gibco,
11140-050), 1 µg/mL puromycin, and 10 µg/mL blasticidin. Plat-E cells were seeded at a
density of 2x106 cells in T-25 flasks and transfected with 10 µg of one of the following plasmids
using Opti-MEM I media (Gibco, 31985-070) and Lipofectamine 2000 (Invitrogen, 52887)
according to the manufacturer’s instructions: pMX-mOct4, pMX-mKlf4, pMX-mSox2, pMX-
mcMyc, or pMX-mRFP. Plat-E medium was replaced with complete mouse neural stem cell
medium supplemented with 0.1 mM nonessential amino acids approximately 16 hours after
transfection. Target cells were seeded at a density of 1x105
cells in 6-well plates coated with
0.01% PLO and 5 µg/mL laminin in PBS as previously described and infected with retroviruses
approximately 24 hours later. Briefly, viral supernatants were filtered through 0.45 µm low
protein binding filters (Pall Life Sciences, 4184) and viral cocktails were produced containing
two factors (Oct4 + Klf4), three factors (Oct4 + Klf4 + Sox2), or four factors (Oct4 + Klf4 +
Sox2 + c-Myc) with equal volumes of each factor and 4 µg/mL polybrene. Low-passage CD1
MEFs were infected with 3- and 4-factor combinations of retroviruses as a control.
40
Approximately 24 hours post-infection, the virus-containing medium was replaced with fresh
mouse neural stem cell medium and RFP expression was visualized using a Zeiss Axiovert 200M
fluorescence microscope.
2.2.3 Isolation and Maintenance of iPS Cell Colonies
Two days after retrovirus infection, 1x105 cells infected with two, three, or four factors were
seeded on Mitomycin C-treated e15.5 MEF feeder layers in 100 mm tissue culture dishes
containing mouse ES cell medium consisting of Glasgow Minimum Essential Medium (GMEM;
Gibco, 11710-035) supplemented with 10% (v/v) heat-inactivated ES certified FBS (Gibco,
16141-079), 0.1 mM MEM nonessential amino acids (Gibco, 11140-050), 1 mM sodium
pyruvate (Gibco, 11360-070), 0.1 mM β-mercaptoethanol, and 100 units/mL recombinant human
LIF (Millipore, LIF1005). Approximately 4-6 weeks after infection, iPS colonies were isolated
from induction plates by manually picking colonies with a 27G needle, aspirating the colony
with a pipette, dissociating colonies in 0.025% trypsin-EDTA for approximately 10 minutes, and
replating dissociated colonies on fresh e15.5 MEF feeder layers in 24-well plates.
Approximately 3-5 days later, colonies were trypsinized and expanded to 12-well plates and
subsequently to 6-well plates, at which point iPS cell lines were frozen in complete ES cell
medium containing 10% (v/v) DMSO.
Mouse ES and iPS cell lines were routinely grown on Mitomycin C-treated e15.5 MEF
feeder layers in tissue culture dishes in mouse ES cell medium. Cells were propagated by
treatment with 0.025% trypsin-EDTA for approximately 5 minutes at 37°C, inactivating the
trypsin with an equal volume of complete medium, and replating cells on fresh feeder layers at a
split ratio of 1:10 to 1:15. The culture medium was replaced daily. For RNA extraction, feeder
depletion was performed by trypsinizing cells, inactivating trypsin by adding a 10-fold greater
volume of complete ES cell medium, and plating the cell suspension in 100 mm Nunclon Δ
tissue culture dishes (Thermo Scientific, 150350) for two sequential incubations of 10 minutes at
37°C to allow the MEFs to adhere to the plastic. Mouse ES and iPS cell lines were grown in
feeder-free conditions in 6-well plates (Corning, 3516) coated with 0.1% gelatin.
Dual inhibitor (2i) treatment was carried out in complete ES culture medium with 1 µM
PD0325901 (Santa Cruz Biotechnology, sc-205427) and 3 µM CHIR99021 (Stemgent, 04-0004)
or twice as concentrated (2i[2X]) to inhibit MAPK signaling and GSK3β, respectively [22,195].
41
2.3 Molecular Characterization of iPS Cell Lines
2.3.1 Immunocytochemistry
Cells were seeded in 24-well plates (Falcon, 353047) coated with 0.1% gelatin and fixed in 4%
PFA for 10 minutes at room temperature two days later. Fixed cells were permeabilized with
0.2% NP-40 for 15 minutes at room temperature, washed in PBS, and blocked in 10% NGS for 1
hour at room temperature. Primary antibodies were diluted in 5% NGS and incubated overnight
at 4°C, as follows: rabbit anti-Nanog (1:500) (Abcam, ab80892); rabbit anti-Oct4 (1:500)
(Abcam, ab19857); rabbit anti-GFAP (1:1,000) (Dako, Z0334); mouse anti-Nestin (1:1,000) (BD
Pharmingen, 556309). Following three washes with PBS, secondary antibodies were diluted in
5% NGS and incubated at room temperature for 1 hour: anti-rabbit::A488 (1:500)
(Invitrogen/Molecular Probes, A11008) or anti-mouse::A488 (1:500) (Invitrogen/Molecular
Probes, A11029). After three washes with PBS, 1X DAPI (0.5 µg/mL) in fluorescent mounting
medium (Dako, S3023) was placed on glass coverslips and inverted onto the cells in each well.
All fluorescence imaging was performed on a Zeiss Axiovert 200M fluorescence microscope
with a Zeiss AxioCam HRm camera and analyzed using AxioVision software.
2.3.2 Quantitative RT-PCR
RNA extraction (following feeder depletion) and cDNA synthesis were performed as previously
described. Quantitative RT-PCR was carried out for 45 cycles using a Chromo4 DNA Engine
gradient cycler (PTC-200, MJ Research) and the data was analyzed with Opticon Monitor 3
software. See Appendix 1 for the list of primers used to detect exogenous retroviral vector
expression in iPS cell lines.
2.4 In Vitro Differentiation
2.4.1 Embryoid Body Assays
Mouse ES and iPS cell lines were grown in feeder-free conditions in 6-well plates (Corning,
3516) coated with 0.1% gelatin for three passages to deplete cultures of MEF feeder cells.
Embryoid body assays were initiated by seeding cells at a density of 2x106 cells in 10 mL of
mouse ES medium without LIF in 100 mm polystyrene Petri dishes (Fisher Scientific, 0875712).
The culture medium was changed every 2 days by transferring the cell suspension to a 15 mL
conical tube with a 10 mL pipette, allowing the EBs to settle to the bottom of the tube for
42
approximately 5 minutes, and carefully aspirating the old medium. The EBs were gently
resuspended in 10 mL of fresh ES medium (without LIF) and transferred to a new 100 mm Petri
dish. EBs were visualized and imaged using a Leica DMIL light microscope with a Leica
DC500 camera. After 8 days in suspension culture, approximately 5-10 EBs were seeded in ES
medium (without LIF) in each well of a 24-well plate coated with 0.1% gelatin. The culture
medium was changed every 2 days and the adherent EBs were imaged using a Zeiss Axiovert
200M fluorescence microscope with a phase contrast filter and a Zeiss AxioCam HRm camera.
2.4.2 Immunocytochemistry for Germ Layer Markers
Embryoid bodies seeded in gelatin-coated 24-well plates were fixed after 6 days in adherent
conditions and permeabilized as previously described. Cells were blocked in 5% BSA for 1 hour
at room temperature and primary antibodies were incubated in 0.5% BSA overnight at 4°C as
follows: mouse anti-GATA4 (1:100) (Santa Cruz Biotechnology, sc-25310); rabbit anti-Alpha
Smooth Muscle Actin (1:100) (Abcam, ab5694); goat anti-Brachyury (1:20) (R&D Systems,
AF2085); mouse anti-Nestin (1:500) (BD Pharmingen, 556309); rabbit anti-βIII Tubulin (1:500)
(Abcam, ab52901). After three PBS washes, the appropriate secondary antibodies were
incubated in 0.5% BSA for 1 hour at room temperature, each at a dilution of 1:500: anti-
mouse::A568 (Invitrogen/Molecular Probes, A11004), anti-mouse::A488 (Invitrogen/Molecular
Probes, A11029), anti-rabbit::A568 (Invitrogen/Molecular Probes, A11036), anti-rabbit::A488
(Invitrogen/Molecular Probes, A11008), or anti-goat::A488 (Invitrogen/Molecular Probes,
A11055). After three washes with PBS, coverslips were mounted and the cells were visualized
as previously described.
2.5 In Vivo Differentiation
2.5.1 Teratoma Assays
All mouse procedures were carried out by Lilian Lee in accordance with the Hospital for Sick
Children’s Animal Care Committee guidelines. For intracranial injections, 2.5x105 cells in a
volume of 2.5 µl of PBS were injected into the frontal cortex of 5.5 week old female NOD/SCID
mice. The injection coordinates were 4 mm anterior of lambda, 2 mm to the right of the midline,
and 4.5-5.0 mm in depth. Subcutaneous injections were carried out three days later with cells of
one greater passage number. For subcutaneous injections, 1.5x106 cells were prepared in 50 µl
43
of PBS, to which 50 µL of Matrigel were added (growth factor reduced; BD Biosciences,
354230). Each cell line was injected into the dorsal flank of 6 week old female NOD/SCID
mouse (one injection per side). Tumour formation was monitored over the course of 12 weeks,
and animals demonstrating symptoms were sacrificed by CO2 asphyxiation. Tumours were fixed
in 4% PFA overnight at 4°C and stored in 70% ethanol at 4°C until processed.
2.5.2 Histology and Immunohistochemistry
Tissue sections were generated using standard protocols for paraffin-embedded tissues, and
hematoxylin and eosin (H&E) staining was performed by standard methods.
Immunohistochemistry was carried out on paraffin-embedded sections of tumours or brains
following heat-mediated antigen retrieval. Briefly, deparaffinized sections were heated in citric
acid buffer (pH 6.0) in a pressure cooker, cooled and blocked in 5% BSA for one hour at room
temperature. Immunohistochemistry was performed using the following antibodies: mouse anti-
GATA4 (1:500) (Santa Cruz Biotechnology, sc-25310); rabbit anti-Alpha Smooth Muscle Actin
(1:500) (Abcam, ab5694); goat anti-Brachyury (1:20) (R&D Systems, AF2085); mouse anti-
Nestin (1:500) (BD Pharmingen, 556309); rabbit anti-GFAP (1:1,000) (Dako, Z0334).
Following three PBS washes, the appropriate secondary antibodies listed above were incubated
in 0.5% BSA for 1 hour at room temperature, each at a dilution of 1:500. Sections were washed
twice with PBS, stained with 1X DAPI in PBS for 10 minutes, washed briefly with PBS,
mounted in fluorescent mounting medium, and visualized as previously described.
2.6 Directed Differentiation to Neural Stem Cells
Directed differentiation of iPS and ES cells to generate NSCs was induced in serum-free
adherent conditions, as described elsewhere [11,196,197]. In brief, iPS and J1 mouse ES cell
lines were grown in feeder-free conditions in 6-well plates (Corning, 3515) coated with 0.1%
gelatin for three passages to remove MEF feeder cells from the cultures. ES and iPS cells were
seeded at a density of 1x104 cells/cm
2 in T25 flasks (Falcon, 353109) coated with 0.1% gelatin in
complete mouse ES cell medium. Approximately 24 hours later, the culture medium was
removed and replaced with N2B27 medium, consisting of a 1:1 mixture of DMEM/F12
supplemented with modified N2 (25 µg/mL insulin, 100 µg/mL apotransferrin, 6 ng/mL
progesterone, 16 µg/mL putrescine, 30 nM sodium selenite, and 50 µg/mL bovine serum
albumin fraction V) and Neurobasal medium (Gibco, 21103) supplemented with B27 (Gibco,
44
17504). Fresh N2B27 medium was replenished every 2 days. After 7 days, 3x106 cells were
replated in uncoated 100 mm Nunclon Δ tissue culture dishes (Thermo Scientific, 150350) in NS
expansion medium consisting of mouse NeuroCult basal medium (Stem Cell Technologies,
05700) supplemented with modified N2 and 10 ng/mL of both EGF and bFGF. The culture
medium was replenished 3 days later. Five days after the transfer to NSC expansion medium
containing EGF and FGF, cellular aggregates growing in suspension were collected, pelletted by
gravity, and dissociated by accutase treatment for approximately 10 minutes. Cells were seeded
in 100 mm Primaria tissue culture dishes (Falcon, 353803) in NSC expansion medium
supplemented with 2 µL laminin per 1 mL of medium. Two days later, cells were replated in
Primaria tissue culture dishes coated with PLO/laminin as previously described to establish NSC
lines. Early passage iPS and ES cell-derived NS-like cell lines were frozen in NSC expansion
medium with 10% (v/v) DMSO for future experiments.
45
Chapter 3
3 Results
I generated all of the data and figures in the Results section; Figure S1 in Appendix 2 was
produced by Stephanie Dobson, a rotation student that I supervised in the laboratory.
3.1 Characterization of Mouse Glioma Stem Cell Lines
3.1.1 Mouse Glioma Stem Cells Express Neural Stem Cell Markers, but
Not Core Pluripotency Markers
The expression of pluripotency factors was assessed in the three glioma stem cell lines derived
from independent tumours arising in the mouse model of glioma (GNS1, GNS2, and GNS3), and
in non-neoplastic p53-/-
NS, and p53+/+
NS cell lines. RT-PCR analysis showed that all five of
the cell lines grown in stem cell conditions (serum-free medium containing EGF and bFGF)
failed to express the core pluripotency factors Nanog, Rex1, and Oct4, but expressed the neural
stem cell-associated factors Sox2, Klf4, and c-Myc at levels comparable to J1 mouse ES cells
(Figure 4). The expression of pluripotency factors was also assessed in medium containing 10%
serum to determine whether the expression levels of Sox2, Klf4, and c-Myc were maintained in
differentiation conditions. It was found that the cell lines continued to express Sox2, Klf4, and c-
Myc transcripts when grown in serum-containing medium for one week, despite strong induction
of expression of differentiated markers [180].
The results were validated by quantitative RT-PCR analysis to detect the expression of L-
Myc, Klf4, Klf2, Nanog, Sox2, Oct4, Klf5, and c-Myc (Appendix 2, Figure S1). Quantitative RT-
PCR confirmed that Nanog and Oct4 expression levels are essentially undetectable in glioma
stem cells and normal NSCs (with the exception of low detection levels in GNS2 in
differentiation conditions). Expression levels of L-myc, Sox2, and particularly c-Myc were
increased in glioma stem cells and normal NSCs compared to ES cells. Klf4 expression
increased in differentiation conditions in two of the three glioma stem cell lines relative to ES
cells. Therefore, mouse glioma stem cells express the same reprogramming-associated factors
(Sox2, Klf4, and c-Myc) as normal neural stem cells, but fail to express genes associated with the
core pluripotency program (Nanog, Rex1, and Oct4). The expression of endogenous Nanog,
46
Rex1, and Oct4 would therefore be an ideal readout to assess the pluripotency of these cells after
reprogramming.
Figure 4. Mouse glioma stem cell lines express neural stem cell-associated factors, but do
not express RNA encoding core pluripotency-associated factors.
The three mouse glioma stem cell lines (GNS1, GNS2, and GNS3), p53-/-
NS, and p53+/+
NS
cell lines failed to express the core pluripotency-associated factors Nanog, Rex1, and Oct4
in stem cell conditions (serum-free medium with EGF and bFGF) and in differentiation
conditions (medium containing 10% serum). The five cell lines expressed the neural stem
cell-associated factors Sox2, Klf4, and c-Myc in stem cell conditions or differentiation
conditions at levels comparable to J1 mouse ES cells (used as a positive control), as detected
by RT-PCR. GAPDH was a housekeeping gene used as a technical control.
47
3.1.2 Mouse Glioma Stem Cells Express Alkaline Phosphatase
Alkaline phosphatase (AP) staining is used as a rapid and nonspecific assay to differentiate
between pluripotent ES cells and differentiated cells such as fibroblasts, since ES cells express
AP, whereas differentiated cells fail to express this enzyme. The product of the hydrolysis
reaction catalyzed by AP couples with the Fast Red TR salt to generate a red fluorescent
compound that can be visualized by light or fluorescence microscopy.
The three mouse glioma stem cell lines grown in stem cell conditions expressed relatively
high levels of AP compared to J1 mouse ES cells, whereas the p53+/+
and p53-/-
NS cell lines did
not express detectable levels of AP (Appendix 2, Figure S2). Growing the glioma NS, p53+/+
NS, and p53-/-
NS cell lines in medium containing 10% serum significantly reduced AP
expression (Appendix 2, Figure S3). The detection of AP expression in the GNS cell lines in
stem cell conditions, therefore, made this an unreliable assay to use in subsequent experiments
involving reprogrammed cells.
3.1.3 Serum Alters the Growth Rate of Glioma and Normal Neural Stem Cells
Preliminary reprogramming experiments resulted in overgrowth of non-reprogrammed glioma
stem cells in the induction plates, so the growth rates of the three glioma stem cell lines, p53-/-
NS, and p53+/+
NS cell lines were examined in stem cell conditions (serum-free medium
supplemented with EGF and bFGF) and differentiation conditions (growth factor-free medium
supplemented with 10% serum). The cell lines GNS1 and GNS2 had similar growth rates in
stem cell and differentiation conditions, whereas the GNS3 cell line grew significantly slower in
medium containing serum than in serum-free medium (Figure 5). The GNS3 cell line was
therefore selected for subsequent reprogramming experiments, in order to optimize differential
growth of non-reprogrammed and reprogrammed cells in serum-containing ES cell medium
during the induction process.
48
Figure 5. Serum alters the growth rate of glioma stem cell and neural stem cell lines.
The proliferation of one of the three glioma stem cell lines (GNS3) is reduced in serum-
containing medium compared to mouse NSC (mNSC) culture conditions, similar to p53-/-
and p53+/+
NSC lines. The GNS3 cell line was therefore chosen for reprogramming
experiments. Values are means ± SEM; * denotes p<0.05 based on Student’s t-test.
49
3.2 Defined Factors Can Reprogram Mouse Glioma Stem Cells
3.2.1 Induction of Reprogramming with Four Transcription Factors
Preliminary experiments involving the piggyBac-mediated reprogramming of GNS1, GNS2, and
GNS3 with Oct4 and Klf4 did not yield any iPS cell lines, since the glioma stem cell lines grew
too rapidly in serum-containing media; therefore, non-reprogrammed cells took over the culture.
Also, selection for the expression of the Oct4 plasmid or the EOS vector with hygromycin or
puromycin, respectively, proved to be challenging, since the glioma stem cell lines are
intrinsically highly resistant to both hygromycin and puromycin, and the MEF feeder layers are
not resistant at such high concentrations. Colonies with characteristic iPS cell morphology were
not generated from the glioma NS, p53-/-
NS, or p53+/+
NS cell lines infected with EOS, after the
piggyBac-mediated transposition of Oct4 and Klf4.
Subsequent reprogramming attempts involved the retroviral-mediated transduction of
GNS3 with combinations of two, three, and four of the reprogramming factors. Two-factor and
three-factor inductions of GNS3 without c-Myc did not generate iPS cell colonies that could be
manually isolated from the induction plate, since the glioma stem cells continued to proliferate
during the 4-6 week induction period and overtook any colonies that might have formed. The
addition of c-Myc as a reprogramming factor increased the efficiency at which colonies were
generated and reduced the amount of time required for the emergence of iPS cell colonies that
were large enough to be picked. CD1 MEFs were reprogrammed in parallel and generated iPS
cell-like colonies from three- and four-factor inductions (without and with c-Myc). Even though
it was not possible to isolate iPS cell colonies from two- or three-factor infections of GNS3,
colonies resembling iPS cells were isolated from four-factor infections of GNS3, p53+/+
NS, and
p53-/-
cell lines (Table 1). Some of the iPS cell lines were derived from EOS-infected cells,
while others were not.
50
Cell Line Number of
Colonies Picked
Number of Clones
(12-well plate stage)
Number of Clones
(final 6-well plate stage)
GNS3
GNS3-EOS
30
36
12
7
6
4
p53-/- NS
p53-/- NS-EOS
48
18
12
4
7
3*
p53+/+ NS
p53+/+-NS-EOS
CD1 (MEFs)
24
42
24
13
16
15
2
7
12
Table 1. Summary of the isolation of iPS cell colonies derived from four-factor inductions
and the number of clones derived.
(* Indicates clones that had lost typical iPS cell morphology.)
51
3.2.2 Induced Pluripotent Stem Cell Lines Express Pluripotency Factors, but Not Neural Stem Cell or Astrocytic Cell Markers
Approximately 4-6 weeks after infecting GNS3, p53+/+
NS, and p53-/-
NS cell lines with pMX-
based retroviruses encoding Oct4, Klf4, Sox2, and c-Myc, and culture on feeders in medium
containing serum and LIF, iPS colonies were isolated and expanded in culture. The majority of
the iPS cell lines had silenced retroviral RFP expression, whereas others failed to fully silence
RFP, indicating that different degrees of reprogramming had been achieved. Nanog and Oct4
protein expression was detected by immunocytochemistry, but at lower levels compared to J1
mouse ES cells (Figure 6A). Eight p53-/-
NS-iPS, four p53+/+
NS-iPS, and six GNS-iPS cell lines
were selected for RT-PCR analysis, which revealed the activation of expression of endogenous
pluripotency factors, Nanog, Oct4, and Rex1 in some of the clones (Figure 6B). CD1 MEFs
were reprogrammed in parallel and generated iPS-cell like colonies that were isolated, the
majority of which expressed Nanog (Appendix 2, Figure S4).
The iPS cell lines that were chosen for subsequent experiments and further
characterization (p53-/-
NS-iPS1, p53-/-
NS-iPS2, p53+/+
NS-iPS1, p53+/+
NS-iPS2, GNS-iPS1,
and GNS-iPS2) were selected based on expression of endogenous pluripotency factors and
maintenance of iPS cell-like morphology. Candidate iPS cell lines that failed to generate iPS cell
colonies after several passages in culture were discarded. Two of the iPS cell lines (GNS-iPS2
and p53+/+
NS-iPS2) were derived from EOS-infected cells, although no GFP+ colonies were
observed. Failure to activate EOS expression was attributed to low infection efficiency of the
EOS lentivirus.
Dual inhibition of MAPK and GSK3 signaling by treatment with the 2i cocktail enhanced
Nanog expression in the GNS-iPS2 cell line, as detected by quantitative RT-PCR analysis [195]
(Figure 6C). The p53-/-
NS-iPS1 cell line had been treated with 2i prior to RT-PCR analysis.
Nanog expression was also enhanced in CD1 MEF-derived iPS cell lines as a result of 2i
treatment, as detected by end-point RT-PCR analysis (Appendix 2, Figure S4).
52
A
B C
Figure 6. Molecular characterization of iPS cell lines reveals the expression of core
pluripotency-associated factors.
(A) Representative figures of the morphology of p53+/+
NS-iPS, p53-/-
NS-iPS, and GNS-iPS
cell lines that have silenced retroviral RFP expression. Low levels of Nanog and Oct4
protein expression were detected by immunocytochemistry (with DAPI nuclear staining
inset). J1 mouse ES cells are shown as a positive control. (B) The expression of
endogenous pluripotency factors (Nanog, Rex1, and Oct4), as detected by RT-PCR. MEFs
and J1 mouse ES cells were used as negative and positive controls, respectively. The iPS
cell lines chosen for subsequent experiments (labeled clones 1 and 2) are highlighted by
dashed boxes. The p53-/-
NS-iPS1 and GNS-iPS2 cell lines had been treated with 2i and
2i[2X], respectively. (C) Nanog expression was enhanced in a glioma-derived iPS cell line
by dual inhibition (2i) of MAPK signaling and GSK3β by 1 µM PD0325901 and 3µM
CHIR99021, respectively, as determined by quantitative RT-PCR. Values are means ±
SEM for three biological replicates; * denotes p<0.05 (Student’s t-test).
53
The expression levels of the neural stem cell marker Nestin and the astrocytic cell marker
GFAP were assessed by immunocytochemistry in mouse ES cell culture conditions. The
reprogrammed cells and J1 mouse ES cells failed to express Nestin, and only rare cells stained
positive for GFAP (Figure 7A). Control experiments for p53+/+
NS and GNS3 cell lines were
carried out in stem cell conditions (serum-free medium with EGF and bFGF) in parallel with
differentiation conditions (growth factor-free medium with 10% serum). Both cell lines
expressed Nestin in stem cell conditions, but the expression of this neural stem cell marker was
reduced upon growth factor withdrawal and serum addition (Figure 7B). This was especially
apparent for the glioma stem cell line, which did not express detectable levels of Nestin in
differentiation conditions. By contrast, the wild type NSCs and GNS3 cell line expressed low
levels of GFAP in stem cell conditions and significantly higher levels of the astrocytic cell
marker in differentiation conditions. Since mouse ES cell medium contains serum, it can be
concluded that the reprogrammed cells did not retain phenotypic marker memory of the cell of
origin, since the iPS cell colonies did not express the astrocytic cell marker GFAP.
54
A
B
Figure 7. Reprogrammed neural stem cells and glioma stem cells fail to express neural
stem cell or astrocytic cell markers.
(A) Immunocytochemistry revealed negligible expression of the neural stem cell marker
Nestin and rare cells expressing the astrocytic cell marker GFAP in reprogrammed cell
lines, similar to J1 mouse ES cells. (B) Control experiments showing the reduced
expression of Nestin and increased expression of GFAP in p53+/+
NS and GNS3 cell lines in
differentiation conditions (10% serum) compared to stem cell conditions.
55
3.2.3 Retroviral Silencing in Reprogrammed Cell Lines
Pluripotent stem cells and fully-reprogrammed iPS cells silence retroviral vector expression
[198]. The expression levels of retroviral transcripts encoding exogenous Oct4, Klf4, Sox2, and
c-Myc were assessed by quantitative RT-PCR for the six iPS cells lines selected, control four
factor-infected cell lines, and J1 mouse ES cells (Figure 8). The data for each iPS cell line was
compared to the expression levels of the respective control cell line using RNA harvested within
one week of infection with the four factor (4F) retroviral cocktail and normalized to GAPDH.
The results from three biological replicates suggest that the expression of the retroviral
vector encoding Oct4 was silenced in both of the glioma-derived and p53-/-
NSC-derived iPS cell
lines. Both of the GNS-iPS cell lines silenced exogenous Sox2 and c-Myc expression, although
only GNS-iPS1 silenced exogenous Klf4 expression. The two p53-/-
NSC-derived iPS cell lines
failed to silence the expression of retroviruses encoding Klf4, Sox2, and c-Myc. Both of the
p53+/+
NSC-derived iPS cell lines failed to silence any retroviral vector expression, with p53+/+
NS-iPS2 showing increased retroviral vector expression of all four of the exogenous factors
compared to the freshly infected 4F control. It should be taken into account that the 4F controls
were not sorted to isolate the population of cells with successful viral integration; therefore, the
bulk culture may reflect lower retroviral expression, since only approximately 80% infection
efficiency was obtained. The iPS cell colonies from which the cell lines were derived, on the
other hand, presumably arose as a result of successful viral integrations, so the majority of cells
in the bulk iPS cell lines contained the retroviral vectors.
56
Figure 8. Analysis of retroviral vector expression in iPS cell lines.
The expression of exogenous (Exo) retroviral vectors encoding Oct4, Klf4, Sox2, and c-Myc
was analyzed by quantitative RT-PCR for glioma NS (GNS)-derived iPS p53-/-
NS-derived,
and p53+/+
NS-iPS cell lines. The expression levels are shown relative to the appropriate
freshly infected four factor (4F) control cell line. J1 mouse ES cells are shown as a negative
control and have <0.01 fold expression relative to the 4F control. Varying degrees of
retroviral vector silencing were observed, with both of the GNS-iPS cell lines silencing the
majority of the retroviruses (with the exception of exo-Klf4 in GNS-iPS2). Exo-Oct4 was
silenced in both of the p53-/-
NS-iPS cell lines, but they failed to silence the expression of the
other retroviral vectors. Both of the p53+/+
NS-iPS cell lines failed to silence retroviral
vector expression. The results were obtained from three biological replicates normalized to
GAPDH; values are means ± SEM.
J1
57
3.3 Altered Differentiation Potential of p53-Deficient iPS Cells
3.3.1 Induced Pluripotent Stem Cell Lines Generate Embryoid Bodies with Reduced Endodermal Differentiation in vitro
Embryoid body (EB) assays were used to test the in vitro differentiation capacity of the iPS cell
lines derived from GNS3, p53+/+
NS, and p53-/-
NS cell lines. All of the iPS cell lines that were
tested formed EBs in suspension culture in serum-containing medium without LIF and produced
differentiated outgrowths of cells when grown in adherent conditions on gelatin (Figure 9A).
The EBs formed from glioma-derived iPS cell lines were more irregularly-shaped than those
formed from p53+/+
or p53-/-
NS cells or from ES cells. The non-reprogrammed GNS3, p53+/+
NS, and p53-/-
NS cell lines from which the iPS cells were derived failed to form embryoid
bodies under the same culture conditions after being transferred from stem cell culture conditions
(serum-free media with EGF and FGF) or from ES culture conditions (serum-containing media
with LIF). The GNS3 cells adhered to the dishes and did not form aggregates in suspension,
whereas the majority of the p53+/+
NS and p53-/-
NS cells died, especially when cells experienced
LIF withdrawal after being transferred from serum-containing medium with LIF to EB medium
without LIF. Therefore, embryoid body formation was a property associated with only the
reprogrammed cell lines and not the parental cell lines.
Immunocytochemistry was performed for the embryoid body differentiation assays.
After 8 days of suspension culture and 6 days of adherent culture conditions, embryoid bodies
were stained for markers of endoderm (GATA4), mesoderm (α-Smooth Muscle Actin), and
ectoderm (Nestin and βIII Tubulin) (Figure 9B). Cells staining for ectoderm and mesoderm
lineage markers were detected for all of the iPS cell lines, but endodermal lineage markers were
less readily detected. The in vitro differentiation of J1 mouse ES cells was carried out in parallel
and revealed the definitive presence of GATA4+ cells, which suggests that cells of the
endodermal lineage were generated by differentiated J1 cells, but that the iPS cell lines may have
a preference for the mesodermal and ectodermal lineages during in vitro differentiation.
The expression of markers of mesoderm (Flk1 and Brachyury), endoderm (Sox17 and
GATA4), and ectoderm (Nestin and Sox1) was also assessed by end-point RT-PCR for feeder-
depleted ES and iPS cell lines in ES cell conditions (serum-containing medium with LIF; Figure
58
10A) and EBs after 4 and 8 days in suspension culture in differentiation conditions (serum-
containing medium with LIF; Figure 10B). The amplification of Flk1 and Nestin transcripts in
ES cell conditions occurred for the majority of the iPS cell lines tested, in addition to J1 mouse
ES cells, which also expressed detectable levels of all of the other germ layer markers. This
suggests that some spontaneous differentiation may have occurred in culture and that low levels
of transcripts encoding differentiated cell markers may have been present. Upon removal of LIF
in differentiation conditions, additional germ layer markers were detected in the iPS cell-derived
EBs, including Sox17 and Sox1, in addition to Flk1 and Nestin. Although Brachyury was only
detected in ES cell-derived EBs at day 4, Flk1 was detected in both of the glioma stem cell-
derived iPS and one p53+/+
NSC-derived iPS cell lines. Similarly, GATA4 was only detected in
ES cell-derived EBs, but another endodermal cell marker, Sox17, was detected at relatively high
levels in GNS-iPS2 and both of the p53+/+
NS-iPS cell lines. Nestin and Sox1 were detected in
all of the EB populations after 8 days in differentiation conditions. Interestingly, EBs formed
from one of the glioma stem cell-derived iPS cell lines (GNS-iPS2) expressed markers of
mesoderm (Flk1), endoderm (Sox17) and ectoderm (Nestin and Sox1) after 8 days in
differentiation conditions. Similarly, EBs formed from p53+/+
NS-iPS2 or J1 ES cells expressed
these four germ layer markers, with J1-derived EBs also expressing Brachyury and GATA4. The
minimal expression of germ layer markers by p53-/-
NSC-derived iPS cell lines suggests that a
potential blockage in differentiation may have occurred.
59
A
B
Figure 9. Glioma stem cell-derived iPS cell lines form EBs and generate cells of
mesodermal and ectodermal lineages in vitro, as detected by immunostaining.
(A) EBs were formed in suspension culture in serum without LIF for each of the iPS cell
lines tested (top panels) and produced differentiated outgrowth of cells when grown in
adherent conditions on gelatin-coated dishes (bottom panels). Representative figures are
shown. (B) Representative figures of immunocytochemistry performed for adherent EBs.
Differentiated cells stained positive for the mesodermal marker α-Smooth Muscle Actin
(αSMA), whereas the endodermal marker GATA4 was only detected in the outgrowth from
EBs formed from J1 mouse ES cells. Ectodermal cells were detected in all of the EB assays,
based on the expression of the neural lineage markers Nestin and βIII Tubulin (βIII Tub).
60
A
B
Figure 10. Differentiated cell markers are detectable at the transcript level in
undifferentiated iPS and ES cell populations, but are enhanced during EB differentiation.
(A) Undifferentiated iPS cell lines expressed detectable Flk1 and Nestin at the transcript
level, whereas ES cells (J1) expressed low levels of additional differentiation markers, even
in the presence of LIF. (B) Markers of mesodermal, endodermal, and ectodermal cells
were expressed by iPS cell lines and J1 cells after 4 or 8 days in differentiation conditions
(serum-containing medium without LIF). Of note, EBs formed from GNS-iPS2 expressed
Flk1, Sox17, Nestin, and Sox1 after 8 days in differentiation conditions.
61
3.4 p53-Deficient iPS Cell Lines Generate Highly Undifferentiated Tumours
Teratoma assays were carried out to assess in vivo differentiation of the iPS cell lines, by the
subcutaneous injection of 1.5x106 cells into the dorsal flank of NOD/SCID mice, with J1 mouse
ES cells injected as a positive control. Subcutaneous tumours were obtained for each iPS cell
line injected and for J1 mouse ES cells with a latency of 2-6 weeks (Table 2). The glioma stem
cell-derived and p53-/-
NSC-derived iPS cell lines grew at similar rates as J1 cells, whereas the
p53+/+
NSC-derived iPS cell lines grew slowest in vivo. Visible growths were produced in the
dorsal flanks of NOD/SCID mice and the tumours had similar gross pathology (Figure 11). Non-
reprogrammed GNS3 cells generated a tumour at one of the two subcutaneous injection sites.
No tumours were obtained from the subcutaneous injection of p53-/-
or p53+/+
NSCs, or for
mouse embryonic fibroblasts, which were injected as a negative control. The tumour-initiating
capacity of the iPS cell lines in the forebrain was assessed by injecting 2.5x105 cells
intracranially into NOD/SCID mice, which resulted in tumour formation for 4 of the 6 iPS cell
lines (representing each genotype) in 2.5-12 weeks (Table 2). The intracranial injection of 1x105
of the non-reprogrammed glioma stem cells had previously been carried out and tumours were
generated in 3.5-8 weeks in NOD/SCID mice [180]. Intracranial tumours were not generated
from the injection of non-reprogrammed p53-/-
or p53+/+
NSCs in NOD/SCID recipients.
Histological analysis of the tumours was carried out following H&E staining (Figure 12).
The primary tumour in the mouse model was identified as a high-grade malignant glioma. The
non-reprogrammed GNS3 cells produced an anaplastic brain phenotype tumour following
injection into the brain or subcutaneous space of immune-deficient mice. The subcutaneous
tumours produced from the injection of p53-/-
NSC-derived iPS and glioma stem cell-derived iPS
cell lines were highly undifferentiated, resembling primitive malignant tumours. These tumours
were anaplastic, with a high nuclear to cytoplasmic ratio. A p53+/+
NSC-derived iPS cell line
also generated a highly undifferentiated tumour, whereas another p53+/+
NSC-derived iPS cell
line produced a differentiated subcutaneous tumour, similar to the teratoma produced from the
injection of J1 mouse ES cells. These teratomas contained structures representative of the three
germ layers, such as neural rosettes or keratinizing epithelium (ectoderm), gut-like epithelium
(endoderm), and cartilage or muscle (mesoderm). Phenotypically similar forebrain tumours were
62
generated for each sample injected intracranially. Taken together, these results suggest that p53
status may play a role in the differentiation of iPS cell lines in vivo.
Cell Line Subcutaneous Tumours Intracranial Tumours
GNS-iPS 2 weeks (2/2) 2.5 weeks (2/2)
p53-/-
NS-iPS 2-2.5 weeks (2/2) 5 weeks (1/2)
J1 Mouse ES 2.5 weeks (1/1) 3 weeks (1/1)
Parental GNS 3 weeks (1/1) 3.5-8 weeks* (1/1)
p53+/+
NS-iPS 4.5-6 weeks (2/2) 12 weeks (1/2)
p53-/-
NS (0/1) (0/1)
p53+/+
NS (0/1) (0/1)
MEFs (0/1) ND
Table 2. Summary of the latency of subcutaneous and intracranial tumour formation.
NOD/SCID mice were sacrificed 2-6 weeks after the subcutaneous injection of 1.5x106 cells
in the dorsal flank or 2.5-12 weeks after the intracranial injection of 2.5x105 cells in the
forebrain, due to tumour formation. Non-reprogrammed p53-/-
and p53+/+
NSCs failed to
form subcutaneous or intracranial tumours. MEFs were injected subcutaneously as a
negative control and failed to generate tumours. Data indicates the number of cell lines
generating tumours/number of cell lines injected. *Obtained from previous experiments
[180]; ND, not determined.
63
A
B
Figure 11. Reprogrammed NSCs and glioma stem cells generate subcutaneous tumours
with similar macroscopic appearance.
(A) Representative images of the growths generated 2 weeks after the subcutaneous
injection of 1.5x106 reprogrammed glioma stem cells (GNS-iPS1 and GNS-iPS2) in the
dorsal flanks of NOD/SCID recipients (arrows point to tumours). (B) The reprogrammed
cell lines generated 2-6 weeks after the subcutaneous injection of p53-/-
NS-iPS cells (#1 and
2), GNS-iPS cells (#3 and 4), p53+/+
NS-iPS cells (#5 and 6), J1 mouse ES cells (#7), and the
parental non-reprogrammed glioma stem cell line (#10).
64
Figure 12. Glioma stem cell-derived iPS cell lines generate highly undifferentiated tumours
in vivo.
The primary high-grade malignant mouse glioma generated glioma stem cell lines that
produced anaplastic tumours when injected subcutaneously or orthotopically into
NOD/SCID mice. Tumours generated from p53-/-
NSC-derived iPS cell lines (p53-/-
NS-
iPS2 shown) and glioma stem cell-derived iPS cell lines were atypical, undifferentiated, and
exhibited large regions of necrosis. One p53+/+
NSC-derived iPS cell line generated highly
undifferentiated tumours, whereas the other p53+/+
NSC-derived iPS cell line produced
differentiated tumours similar to those produced from the injection of J1 mouse ES cells.
These tumours contained structures representative of multiple germ layers.
65
3.5 Reprogrammed Glioma-Derived iPS Cell Lines Have Reduced Astrocytic Differentiation in vivo
In order to confirm the presence or absence of differentiated cells in the teratomas,
immunohistochemical analysis was carried out using markers of the three germ layers: Nestin
and GFAP (ectoderm), GATA4 (endoderm), and α-Smooth Muscle Actin (mesoderm).
Immunohistochemical analysis of the subcutaneous and intracranial tumours revealed similar
results, regardless of the injection site, and showed significantly different differentiation
capacities between the reprogrammed cell lines (Figure 13). One of each of the p53+/+
and p53-/-
NS cell-derived iPS lines generated tumours with extensive differentiation to generate GATA4+
endoderm, α-Smooth Muscle Actin+ (αSMA
+) mesoderm, and Nestin
+ ectoderm, whereas the
markers were less frequently detected in tumours generated from the other p53+/+
NS cell-
derived iPS cell line, albeit still detected. The other p53-/-
NS cell-derived iPS cell line and both
of the glioma stem cell-derived iPS cell lines generated tumours that did not contain any
GATA4+ cells (Figure 13A), suggesting impaired endodermal differentiation in vivo. Tumours
formed from the injection of glioma stem cell-derived iPS cell lines showed reduced expression
of the astrocytic cell marker, GFAP, in comparison to tumours generated from the non-
reprogrammed GNS cell line or from p53-/-
NSC-derived iPS cells (Figure 13B). GFAP
expression was also absent from forebrain tumours generated from the intracranial injection of
glioma stem cell-derived iPS cells. These results suggest that reprogrammed glioma stem cells
have reduced differentiation potential in vitro and in vivo, although the analysis of additional
glioma stem cell-derived iPS cell lines may be required to strengthen this finding.
66
A
B
Figure 13. Glioma stem cell-derived iPS cell lines generate tumours expressing
mesodermal and ectodermal cell markers, but have significantly reduced astrocytic
differentiation.
(A) Immunohistochemistry shows the expression of markers of endoderm (GATA4) and
mesoderm (αSMA). Glioma stem cell-derived iPS cell lines form tumours that fail to
differentiate into endodermal cells. (B) Immunohistochemistry reveals that glioma stem
cell-derived iPS cell lines have reduced expression of the astrocytic cell marker GFAP in
vivo compared to the non-reprogrammed glioma stem (GNS) cell line or J1 mouse ES cells.
67
3.6 Re-Differentiation of Glioma-Derived iPS Cell Lines to a Neural Stem Cell Fate
The directed neural re-differentiation of the iPS cell lines was carried out in parallel with J1
mouse ES cells in serum-free adherent conditions to establish iPS cell-derived NSC lines
[11,196,197]. Significant cell death was observed when the cells were transferred from ES cell
conditions to N2B27, which normally occurs when cells are transferred from serum-containing
medium to serum-free conditions [197]. Immunostaining for Nestin and Oct4 on days 3 and 5 of
culture in N2B27 medium showed that Nestin expression increased and Oct4 expression
decreased slightly by the fifth day in N2B27 conditions compared to ES cell conditions (Figure
14A). On the seventh day of culture in N2B27 medium, the cells were transferred to NSC
expansion medium containing EGF and bFGF, and spherical aggregates of cells formed within
three days. The spheres were dissociated and cells adhered to PLO/laminin-coated tissue culture
dishes. The early-passage NS-like cells showed typical NSC bipolar morphology (Figure 14B)
and proliferated in serum-free NSC conditions in the presence of EGF and bFGF.
Taken together, the results suggest that BTSCs derived from a clinically-representative
mouse model of glioma are amenable to reprogramming with a defined set of transcription
factors. The resulting glioma stem cell-derived iPS cell lines activated the expression of
endogenous pluripotency factors and silenced the expression of exogenous reprogramming
factors. Reprogrammed glioma stem cells formed EBs that expressed endodermal, mesodermal,
and ectodermal cell markers at the transcript level and generated undifferentiated tumours in
vivo. Preliminary directed re-differentiation experiments of the reprogrammed cell lines suggest
that NS-like cells can be generated from CSC-derived iPS cell lines.
68
A
B
Figure 14. Preliminary directed re-differentiation experiments generated Nestin+ cells with
neural stem cell-like morphology.
(A) Preliminary immunocytochemistry results of directed re-differentiation experiments to
generate neural stem cells from GNS-iPS cells suggest that Nestin expression increased,
while Oct4 expression decreased slightly during the first 5 days in N2B27 medium. Day
zero represents the starting population in ES cell medium. (B) Phase contrast images of
iPS cell-derived NS-like cells expanded in NSC conditions (serum-free medium with EGF
and bFGF). The appearance of bipolar NSC morphology suggests the directed
differentiation to a NSC fate.
69
Chapter 4
4 Discussion and Future Directions
4.1 Summary of Principle Findings
This project has shown a proof-of-principle that mouse glioma stem cells, which fail to express
defining pluripotency factors Nanog, Oct4, and Rex1, can be reprogrammed by retroviral-
mediated transduction of Oct4, Klf4, Sox2, and c-Myc, to generate iPS cell lines that express
these endogenous factors. The reprogrammed cells formed EBs, expressed ectodermal and
mesodermal cell markers at the protein level and formed undifferentiated teratomas in vivo.
Although incomplete differentiation of the BTSC-derived iPS cell lines was observed in vitro
and in vivo, this could be attributed to several factors, such as a partially reprogrammed state or
the preexisting aberrant epigenetic or genetic program of the parental glioma stem cells.
Although the acquisition of endogenous Nanog and Oct4 expression may not fully define a true
pluripotent state, the data in this thesis suggest that at least one type of CSC can be remarkably
changed in its phenotypic behaviour and also in its lineage potential by transduction with a
defined set of transcription factors. Future studies will be required to understand the factors that
may contribute to a functional pluripotent state in reprogrammed CSCs and to assess the relative
genetic and non-genetic contributions to the neoplastic phenotype of glioma.
4.2 Why Reprogram Brain Tumour Stem Cells?
The rationale for reprogramming BTSCs is that it enables the study of the relative genetic and
non-genetic contributions to the neoplastic phenotype of brain tumours. Any genetic or non-
genetic change favourably regulating the survival of cells by conferring the ability to replicate
indefinitely, evade apoptosis, or prevent differentiation and senescence would promote the
abnormal clonal expansion of CSCs. If the genetic program of CSCs remains intact as these
cells differentiate to generate non-CSCs comprising the tumour bulk, epigenetics are evidently
involved in the differentiation of CSCs.
Differentiation therapy, therefore, is an attractive concept for cancer treatment if cancer is
considered as a stem cell hierarchy. It has been shown, for instance, that the treatment of human
GBM cells in vitro with BMP4 reduces proliferation, induces neural differentiation, and depletes
70
the CD133+ CSC fraction, without affecting overall cell viability [190]. BMP4 treatment in vitro
or in vivo reduced the tumour-initiating capacity of GBM cells by inducing their differentiation
[190]. Similarly, the transcription factor-mediated reprogramming of GI cancer cells to the
pluripotent state caused the resulting iPS cells to be more highly sensitive to chemotherapy and
differentiation-inducing treatment [139]. These studies suggest that the epigenetic program of
cancer cells may influence the susceptibility of these cells to chemotherapeutic agents or
differentiation-inducing chemicals, which could be applied in the clinic as cancer treatments.
Reprogramming cancer cells may enable the reactivation of the expression of aberrantly
hypermethylated and silenced genes, including tumour suppressor genes, which would restore
normal growth control. It has been shown that the transcription factor-mediated reprogramming
of transformed human cells reactivates stable expression of the tumour suppressor gene p16INK4A
(CDKN2A) in the resulting iPS cells by erasing aberrant epigenetic marks, thereby restoring
normal cell cycle control [199]. Regions of DNA with de novo methylation were enriched for
PcG targets and were generally demethylated as a result of reprogramming [199]. In addition to
the p16INK4A
gene, 24 other gene promoters that are often hypermethylated in cancer were
demethylated during the reprogramming process, including the promoters of RASSF1, VHL,
FHIT, and GATA5 [199]. These findings suggest that aberrant CpG island hypermethylation of
tumour suppressor gene promoters can be erased during the reprogramming process in a manner
that parallels the removal of developmentally-related epigenetic marks. This study, however,
relied on the use of telomerase-immortalized human embryonic lung fibroblasts, which silence
p16INK4A
(CDKN2A) after extensive culturing [199]. These transformed cells fail to grow in soft
agar and are non-tumourigenic in immune-compromised mice, which is only suggestive of a
premalignant phenotype, and not a malignant phenotype [199]. Therefore, conducting a similar
study with primary human or mouse CSCs was of primary importance.
This thesis involved the reprogramming of BTSCs that, according to the Cancer Stem
Cell Hypothesis, are the cells responsible for the initiation and maintenance of tumour growth.
We developed a chemical-genetic mouse model of glioma that we believe is clinically relevant;
the CNS-specific deletion of p53 in the mouse model is representative of the human disease,
since p53 signaling is altered in 87% of high-grade glioma [164]. The chemical-genetic
approach to modeling the human disease in the mouse is ideal, since tumours arise spontaneously
as a result of mutagenesis, and not as a result of targeting additional oncogenes or tumour
71
suppressors. By reprogramming mouse glioma BTSCs, the cells directly involved in the
initiation and maintenance of tumour growth can be studied.
4.3 Mouse Glioma Stem Cells are Amenable to Reprogramming
Mouse BTSCs derived from the chemical-genetic mouse model of glioma have a NSC-related
gene expression program, expressing Sox2, c-Myc, and Klf4 at similar levels as NSCs. Mouse
glioma stem cells, however, fail to express a pluripotency-associated program involving Nanog,
Oct4, and Rex1. This was initially detected by end-point RT-PCR and confirmed with
quantitative RT-PCR analysis. These results suggest that the self-renewal of mouse glioma stem
cells is regulated by a NSC-related program, likely driven by c-Myc, and not a pluripotent ES
cell-related signature. The similarities between glioma stem cells and normal NSCs, such as the
expression of the reprogramming factors Sox2, c-Myc, and Klf4 was initially hypothesized to
facilitate the generation of iPS cells from BTSCs with few exogenous factors, since adult mouse
NSCs had been reprogrammed with Oct4 and Klf4 or Oct4 alone [86,89]. However, technical
difficulties arose, such as the ability of the mouse glioma stem cells to proliferate extensively
during prolonged culture in serum-containing medium and their high intrinsic resistance to
selection agents such as puromycin and hygromycin. The preliminary piggyBac-mediated
reprogramming attempts with one or two factors, therefore, were unsuccessful, primarily due to
overgrowth of non-reprogrammed glioma stem cells. The GNS3 cell line, which grows more
slowly than GNS1 or GNS2 in culture conditions containing serum, was selected for subsequent
reprogramming experiments. Retroviral-mediated reprogramming of GNS3 with four exogenous
factors yielded more favourable results, since the inclusion of exogenous c-Myc generated iPS
cell-like colonies that could be isolated more readily from the induction plates. The appearance
of colonies with morphology characteristic of iPS cells suggested that the retroviral-mediated
reprogramming of glioma stem cells, p53+/+
and p53-/-
NSCs, and CD1 MEFs with four factors
was successful.
The molecular characterization of the resulting iPS cell lines revealed the expression of
core pluripotency factors, including endogenous expression of Nanog, Oct4, and Rex1. Fewer
iPS cell lines derived from BTSCs activated the expression of all three of the pluripotency
factors; in fact, endogenous Oct4 expression was only detected for one of the six GNS-iPS cell
lines. Nanog expression was considered the most important marker of pluripotency, since it is
72
essential for the transition to the pluripotent state and is activated late in the process of
reprogramming mouse somatic cells [29,30]. The results were consistent with the finding that
p53 deficiency promotes reprogramming, since a higher proportion of p53-deficient NSC-
derived iPS cell lines expressed Nanog and generally at higher levels than the other iPS cell
lines. Although the glioma stem cells were also p53-deficient, Nanog expression was not
enhanced in BTSC-derived iPS cell lines. Treatment with the 2i cocktail of chemicals was
attempted, which consists of 1 µM PD0325901 and 3 µM CHIR99021 to inhibit MAPK
signaling and GSK3β, respectively, to promote complete reprogramming of mouse somatic cells
[195]. Treatment with 2i promoted Nanog expression in CD1 MEF-derived iPS cell lines, as
detected by end-point RT-PCR, and in a glioma stem cell-derived iPS cell line, as detected by
quantitative RT-PCR. The fold change in Nanog expression was only statistically significant if
2i treatment was carried out with twice the usual concentration of these inhibitors, which may
reflect the intrinsic drug resistance of CSCs. Relatively low levels of Nanog and Oct4 were
detected in the reprogrammed cell lines at the protein level by immunocytochemistry, whereas
Nestin (a marker of NSCs) and GFAP (a marker of astrocytic cells) were not detected. The non-
reprogrammed NSCs and glioma stem cell lines express high levels of GFAP in serum-
containing medium, whereas the reprogrammed cell lines significantly downregulated GFAP
expression, even in ES cell medium containing serum. Taken together, these results show that
the expression of endogenous core pluripotency genes (Nanog, Oct4, and Rex1) was activated in
the reprogrammed cell lines, and the expression of NSC and differentiated astrocytic cell
markers (Nestin and GFAP) was reduced. This may reflect the removal of developmentally-
regulated epigenetic marks and erasure of the epigenetic memory of the cell of origin.
4.4 Reprogrammed Cell Lines Show Varying Degrees of Retroviral Silencing
Different levels of transgene expression of exogenous Oct4, Klf4, Sox2, and c-Myc were detected
by quantitative RT-PCR in the iPS cell lines derived from BTSCs, p53+/+
NSCs, and p53-/-
NSCs.
Retroviral silencing is a property of pluripotent stem cells, including iPS cells, and has been
proposed to indicate complete reprogramming of somatic cells [198]. Exogenous Oct4
expression was silenced in each of the iPS cell lines derived from p53-deficient cells (BTSCs
and NSCs), which may reflect the enhanced ability to generate iPS cells from p53-deficient cells.
The glioma stem cell-derived iPS cell lines showed some retroviral silencing, whereas the p53-/-
73
NSC-derived iPS cell lines failed to silence the expression of retroviruses encoding Klf4, Sox2,
and c-Myc. Both of the p53+/+
NSC-derived iPS cell lines failed to silence the expression of all
of the exogenous reprogramming factors, although four-factor iPS cell lines derived from wild
type NSCs have been shown to silence Oct4, Klf4, Sox2 and c-Myc transgenes [86]. The results
suggest that it was possible to derive iPS cell lines from mouse glioma stem cells, p53+/+
NSCs,
and p53-/-
NSCs, although the varying extent of retroviral silencing in each cell line suggests that
different degrees of reprogramming may have been achieved.
4.5 Analysis of the Differentiation Capacity of iPS Cell Lines
The initial indication that the reprogrammed cells had acquired new differentiation capabilities in
vitro was the results of the EB assays. Only the reprogrammed cell lines formed spherical EB-
like structures similar to those formed from J1 mouse ES cells in suspension culture in serum-
containing medium without LIF. The non-reprogrammed GNS3, p53+/+
NS, and p53-/-
NS cell
lines failed to form EBs and either adhered to the uncoated plastic dishes or died when
transferred from standard NSC medium or serum-containing medium to EB culture conditions.
The expression of various germ layer markers was assessed at the transcript level by RT-
PCR and at the protein level by immunostaining. At the transcript level, Sox17 (a marker of
endodermal cells) was detected at relatively high levels in EBs formed from one of the two
BTSC-derived iPS cell lines, as well as both of the p53+/+
NSC-derived iPS cell lines, and at low
levels in the p53-/-
NSC-derived iPS cell lines. The expression of this marker was detected at
much lower levels in the undifferentiated controls. The expression of ectodermal cell markers
(Nestin and Sox1) was detected in all of the cell lines at various time points in EB differentiation.
Brachyury (a marker of mesodermal cells) and GATA4 (a marker of endodermal cells) were only
detected in EBs formed from J1 mouse ES cells, whereas expression of the mesodermal cell
marker Flk1 was detected in EBs formed from glioma stem cells, p53-/-
NSCs, and p53+/+
NSCs.
Brachyury expression was only detected in EBs at day 4 of differentiation, but not at day 8,
which is consistent with the established kinetics of expression of this marker, since Brachyury
expression peaks at day 3 of differentiation of mouse ES cells but is undetectable by RT-PCR by
day 5 [200]. One of the glioma stem cell-derived iPS cell lines expressed markers of mesoderm
(Flk1), endoderm (Sox17) and ectoderm (Nestin and Sox1) at the transcript level after 8 days in
differentiation conditions, suggesting that a pluripotent phenotype was achieved. Also, EBs
74
formed from one of the p53+/+
NSC-derived iPS cell lines expressed these four germ layer
markers, similar to EBs formed from ES cells (which also expressed Brachyury and GATA4).
Immunostaining revealed that the iPS cell-derived EBs expressed α-Smooth Muscle Actin (a
marker of mesodermal cells) and Nestin and βIII tubulin (markers of ectodermal cells) in
adherent conditions. The expression of GATA4 (a pan-endodermal cell marker) was only
detected in EBs formed from differentiated mouse ES cells, although the assessment of the
expression of additional endodermal cell markers at the protein level may be required. The
failure of the EBs to express GATA4 transcript or protein may be indicative of incomplete
endodermal differentiation. Nanog regulates endodermal differentiation by preventing
extraembryonic endodermal differentiation; Nanog-deficient mouse ES cells upregulate GATA4
and GATA6 expression and differentiate into extraembryonic endodermal cells [23]. Therefore,
achieving low endogenous levels of Nanog expression in the reprogrammed cell lines would
predict increased differentiation into GATA4+ cells, which was not observed. The minimal
expression of germ layer markers by p53-/-
NSC-derived iPS cell lines at the transcript level
suggests that a blockage in differentiation occurred.
Nevertheless, these results call into question the fidelity of germ layer markers in
assessing pluripotency, since the expression of both mesoderm markers (Brachyury and Flk1) or
both endoderm markers (Sox17 and GATA4) did not always occur in the same samples.
Furthermore, the detection of differentiated cell markers occurred at the transcript level in ES
cell conditions in the presence of LIF, which promotes the undifferentiated self-renewal of
mouse ES cells [19,20]. The detection of transcripts encoding differentiated cell markers in
presumably non-differentiating conditions can be attributed to the high sensitivity of end-point
RT-PCR amplifying basal levels of expression in undifferentiated cells or rare transcripts present
due to the spontaneous differentiation of a minority of cells. Even though Nestin expression was
detected at the transcript level in the majority of the iPS cell lines and J1 cells in ES cell
conditions, this NSC marker was not detected at the protein level by immunocytochemistry. It
would be beneficial to carry out epigenetic analyses, such as bisulphite sequencing at the
promoters of Nestin and GFAP to determine whether epigenetic memory is present and whether
the reprogrammed cells have retained memory of the cell type of origin.
The differentiation capacity of the reprogrammed cell lines was also assessed in vivo by
subcutaneous and intracranial injections with subsequent histological and immunohistochemical
75
analysis. Highly undifferentiated, atypical tumours were generated from the injection of each of
the p53-/-
NSC-derived and glioma stem cell-derived iPS cell lines, as determined by histological
analysis. However, the p53-/-
NS-iPS2 cell line formed tumours that stained positive for markers
of mesoderm (α-Smooth Muscle Actin), endoderm (GATA4), and ectoderm (Nestin), whereas
p53-/-
NS-iPS1 and both of the GNS-iPS cell lines failed to generate tumours with GATA4+ cells.
One of the p53+/+
NSC-derived iPS cell lines also generated undifferentiated tumours, whereas
the other produced highly differentiated tumours with structures representative of the three germ
layers, similar to teratomas formed from J1 mouse ES cells. It should be noted that blood vessels
express αSMA, although vascular αSMA+ cells were readily distinguished from αSMA
+ tumour
cells based on morphology and the presence of autofluorescent erythrocytes. Furthermore, this
mesodermal cell marker is expressed in mesenchymal cells such as smooth muscle, which may
originate from neural crest cells [33]. The expression of additional mesodermal markers of non-
mesenchymal cells and non-neural ectodermal markers should be assessed to establish a
definitive differentiation profile of the reprogrammed cells.
Furthermore, the glioma stem cell-derived iPS cell lines formed subcutaneous and
intracranial tumours that failed to show GFAP+ cells, which was in stark contrast to the tumours
formed from the injection of the non-reprogrammed glioma stem cell line or J1 mouse ES cells.
The non-reprogrammed GNS3 cell line produced tumours with high GFAP expression, which is
consistent with previous results from our laboratory suggesting that this cell line is biased toward
a glial phenotype in vivo [180]. The reprogrammed glioma stem cell lines even failed to
generate GFAP+ astrocytic cells in the forebrain niche. These results suggest that the
reprogrammed glioma stem cell lines may have a blockage in astrocytic differentiation in vivo,
which may represent a suppression of the endogenous lineage commitment of the parental
glioma stem cells, although additional in vivo experiments are required to strengthen this finding.
The preliminary directed re-differentiation of the iPS cell lines generated cells with
typical NSC morphology that proliferated in adherent conditions in serum-free medium with
EGF and bFGF. An increase in Nestin and slight decrease in Oct4 staining was observed during
the directed re-differentiation procedure, suggesting that lineage commitment was in progress.
Future experiments will assess the expression of neural stem cell markers and pluripotency
factors, and will evaluate the multipotent differentiation capacity of the putative NSC lines.
76
4.6 Interplay between Retroviral Silencing, p53 Status, and In Vivo Differentiation Potential
Retroviral silencing of exogenous expression of Oct4, Klf4, Sox2, and c-Myc is generally thought
to be required for the differentiation of iPS cells in vivo [30,198]. The constitutive ectopic
expression of the four reprogramming factors may prevent the differentiation of iPS cells in
teratomas by disrupting the endogenous signaling pathways involved in regulating differentiation
[30]. For instance, Sox2 suppresses endodermal and mesodermal differentiation, but promotes
neural ectodermal differentiation [28]. Oct4 has the converse role in promoting endodermal and
mesodermal differentiation while suppressing neural ectodermal differentiation [28]. The role of
c-Myc in the maintenance of pluripotency is through the repression of primitive endoderm
differentiation [201]. Therefore, it is likely that the sustained overexpression of retroviral
vectors encoding the reprogramming factors may influence the differentiation capacity of the iPS
cell lines.
A surprising result was the extensive differentiation of the p53+/+
NS-iPS1 cell line,
which expressed exogenous reprogramming factors, following subcutaneous or intracranial
injection in vivo. Large regions of cells stained positive for each of the germ layer markers
assessed. This is inconsistent with the literature, which suggests that the downregulation of
transgene expression of Oct4, Klf4, Sox2, and c-Myc is required for the differentiation of iPS
cells in vivo [30]. However, the overexpression of Oct4 has been shown to promote primitive
endodermal and mesodermal differentiation [24]. This may account for the increased
endodermal and mesodermal differentiation observed when the p53+/+
NS-iPS1 cell line was
injected in vivo, since this cell line failed to silence exogenous Oct4 expression. However, the
role of Sox2 in suppressing endodermal and mesodermal differentiation was not corroborated by
the results of this study, since high exogenous Sox2 expression in p53+/+
NS-iPS1 did not prevent
the differentiation of endodermal and mesodermal cells in vivo [28].
The tumours generated from the subcutaneous or intracranial injection of the
reprogrammed cell lines showed varying degrees of differentiation, which seemed to be
regulated largely by p53 status. In contrast to the differentiated tumours generated by the p53+/+
NS-iPS1 cell line, the p53-deficient GNS-iPS cell lines, which had silenced exogenous
expression of the four reprogramming factors, generated highly undifferentiated tumours. The
77
growths resembled primitive malignant tumours, showing high nuclear to cytoplasmic ratio and
failing to show any structures representative of the three germ layers, based on histological
analysis. This blockage in differentiation was independent of retroviral silencing and was
therefore attributed to p53 deficiency, genetic lesions or epigenetic aberrations suppressing
differentiation. Similar undifferentiated tumours were obtained from the injection of p53-
deficient NSC-derived iPS cell lines, which had silenced exogenous Oct4 expression, but
continued to express Klf4, Sox2, and c-Myc transgenes. Although some endodermal
differentiation was detected in vivo for the p53-deficient NSC-derived iPS cell lines based on the
expression of the endodermal cell marker GATA4, these tumours did not show any structures
representative of the three germ layers upon histological analysis. This may be indicative of
impaired differentiation capacity, likely mediated by p53 status or ectopic expression of other
reprogramming factors.
It has been shown that p53 deficiency, combined with transduction of c-Myc, generates
growths consisting primarily of undifferentiated tissues, with only small areas of differentiated
cells, thus resembling tumours [72]. Nevertheless, p53-deficient iPS cells generated from four
factor inductions are able to form chimeric mice, although incomplete silencing of exogenous
expression of retroviral c-Myc may account for the observation that chimeras were not viable
past seven weeks [72]. The overall expression levels of Klf4, Sox2, and c-Myc are higher in p53-
deficient iPS cells derived from four-factor inductions than in p53-deficient iPS cells derived
from three-factor inductions (omitting c-Myc) or in p53-heterozygous iPS cells [72]. They
suggest that exogenous c-Myc expression may prevent retroviral silencing in iPS cells with a
p53-deficient background, although this hypothesis and the mechanism by which c-Myc acts to
suppress retroviral silencing remain to be confirmed conclusively.
4.7 Reprogramming Mouse Versus Human Cells
The mouse system offers the advantage in reprogramming experiments, since the attainment of
complete reprogramming can be verified by creating chimeric mice and assessing germline
transmission. Human GBM stem cell lines grown in similar adherent culture conditions could
also be reprogrammed in parallel with patient-matched fibroblasts to compare the gene
expression profiles of the resulting iPS cell lines. This would help to identify any cancer-specific
genetic or epigenetic changes that may be involved in the neoplastic phenotype or may prevent
78
reprogramming to pluripotency. Furthermore, although primary tumour samples can be obtained
from human brain cancer, the normal NSCs that may give rise to these tumours are inaccessible.
Being able to model genetic changes in NSCs differentiated from BTSC-derived iPS cells using
this reprogramming and re-differentiation strategy may be a means to understand the influence of
cancer-associated genetic changes on NSC behaviour. As well, reprogramming normal patient
fibroblasts into iPS cells and re-differentiating to produce NSCs will allow us to interrogate
patient specific cancer genetic changes on the behaviour of NSCs, which are a potential cell of
origin for human brain tumours. For example, the patient’s own oncogenic changes could be
introduced into their reprogrammed NSCs to see which lesion or combination of mutations
contributes to human NSC transformation.
In human iPS experiments, however, teratoma assays are the best indication of
pluripotency, but these experiments are not standardized and fail to indicate the degree of
reprogramming that was achieved, since even partially reprogrammed iPS cells generate
teratomas [192,202]. As a result, an open-access bioinformatic assay was developed to assess
the pluripotency of human iPS cell lines based on the comparison of their genome-wide
expression profile to that of approximately 450 human ES cells, iPS cell lines, stem cell lines,
differentiated cells, and developing and adult tissues [203]. This resource will provide an
extremely valuable tool to assess the quality and pluripotency of human iPS cell lines in the
future. As the only in vivo measure of pluripotency in human iPS cells is the teratoma assay,
there remains controversy over the definition of pluripotency in reprogrammed cells.
4.8 Defining the Reprogrammed State
The reprogrammed state of iPS cells may be especially difficult to define in the context of cancer
cells as the reprogramming target, since cancer cells are associated with both genetic and
epigenetic aberrations. The induction of Nanog expression may not confer functional
pluripotency in cancer cell-derived iPS cells, due to the potential for genetic lesions or abnormal
epigenetic marks in key differentiation-regulating genes in cancer cells. Furthermore, copy
number variations, mutations, or amplifications of lineage determining genes in cancer cells
could result in cell death of a particular lineage during in vitro differentiation of CSC-derived
iPS cell lines. In addition, in the chemical-genetic mouse model of glioma, in utero treatment
with the carcinogen ENU resulted in genetic mutations in the BTSCs, some of which may affect
79
the ability of these cells to be reprogrammed to pluripotency, particularly if epigenetic regulators
are aberrantly expressed. If genes involved in chromatin remodeling and gene expression
regulation, such as those encoding PcG proteins, are mutated or have altered expression levels in
cancer cells, it would be reasonable to hypothesize that the ability of these cells to be
reprogrammed to the pluripotent state may be altered or that the differentiation profile of cancer
cell-derived iPS cells may be affected. For instance, the expression of the PcG protein and
oncogene, Bmi1, is essential for the development of mouse glioma and is highly enriched in the
CD133+ BTSC population in human glioma, which makes it a potential candidate to regulate
differentiation in glioma stem cell-derived iPS cells [112,169]. Furthermore, the INK4A/ARF
locus is silenced in iPS and ES cells, but Bmi1 has an established role in regulating cellular
differentiation in an INK4A/ARF-independent manner in both mouse and human glioma, which
further supports its potential role in regulating differentiation in iPS cells. A role for Bmi1 in the
induction of pluripotency has also been established; it was recently shown that MEFs could be
reprogrammed by retroviral transduction of Bmi1 to generate NS-like cells, which were then
reprogrammed with Oct4 alone to generate germline-competent iPS cells [204]. Chemical
activation of sonic hedgehog signaling in MEFs enhanced the expression of Bmi1, Sox2, N-Myc,
and Klf4, and exogenous Oct4 was sufficient to reprogram these cells to the iPS cell state [204].
It is believed that Bmi1 has two main roles in promoting the generation of iPS cells, through the
suppression of the INK4A/ARF locus (which encodes p16INK4a
and p19ARF
) and by enhancing the
expression of Sox2 and N-Myc [204]. The role of Bmi1 in regulating the differentiation of iPS
cells remains to be confirmed.
In addition, epigenetic memory of the cell type of origin and permanent genetic mutations
may complicate reprogramming studies involving cancer cells [63]. Epigenetic memory occurs
when epigenetic marks, such as DNA methylation, are retained in reprogrammed cells and
reflect the somatic cell type from which they were derived [63]. These residual epigenetic marks
confer different gene expression profiles and promote the differentiation of reprogrammed cells
along lineages associated with the somatic tissue of origin, while suppressing commitment to
other lineages of differentiation [63,64]. Epigenetic memory is generally associated with early-
passage human and mouse iPS cells and can be erased by prolonged culture, differentiation and
serial reprogramming, or as a result of treatment with HDAC inhibitors or DNMT inhibitors
[63,64]. Early- and late-passage (p4 versus p>10) mouse iPS cells have similar properties,
80
including the promoter demethylation and expression of endogenous pluripotency genes, and
formation of teratomas and chimeras [64]. Although both classes of iPS cells are transgene-
independent, early-passage iPS cells harbour epigenetic memory and are therefore
transcriptionally distinguishable from late-passage iPS cells and have biased differentiation
toward the tissue type of origin [64]. By contrast, partially reprogrammed cells are dependent
upon the expression of exogenous pluripotency factors, fail to express endogenous pluripotency
factors, and form teratomas but not chimeras [64]. The differentiation experiments in this thesis
were carried out with late-passage iPS cell lines (p>10), but it may be beneficial to repeat
differentiation experiments after extended time in culture to ensure the complete erasure of
epigenetic memory. Furthermore, reprogramming-associated mutations involving genes
implicated in cancer have been identified in human iPS cells [80]. Similarly, human iPS cells
harbour de novo copy number variations and genomic deletions of tumour suppressor genes
[81,82]. These findings show that not only epigenetic modifications, but also permanent genetic
alterations are involved in reprogramming somatic cells to the pluripotent state, which may
complicate the study of genetics and epigenetics in CSC-derived iPS cells.
4.9 Core Pluripotency Network Versus c-Myc Network in Cancer
The putative ES cell signature attributed to the gene expression profiles of aggressive human
cancers remains controversial in the cancer field. Some groups have recognized an ES cell-like
gene expression program in aggressive human tumours, based on the overexpression of genes
targeted by Nanog, Oct4, and Sox2, with c-Myc identified as the activator of the ES cell program
[119,205]. However, it was not determined whether the putative ES cell signature exists in rare
CSCs or in bulk tumour cells, which makes it difficult to draw any conclusions relating to the
functional implications of this signature [205]. The proposed ES cell signature in epithelial
cancers was interpreted to represent the dedifferentiation of cancer cells to an ES cell-like state
[205]. However, a significant proportion of genes targeted by Nanog, Oct4, and Sox2 are also
regulated by c-Myc, which suggests that a pluripotency signature is in fact a c-Myc signature
[120]. A recent study attributed the similarities between the gene expression profiles of human
cancer and ES cells to a common transcriptional network regulated by c-Myc [120]. The
conflicting studies concurred, however, that PcG target genes were repressed in human cancers,
similar to ES cells, thereby confirming a role for PRC proteins in cancer initiation or progression
[119,120]. Nevertheless, the extensive overlap between the network regulated by c-Myc and the
81
core pluripotency network governed by Nanog, Oct4, and Sox2 makes it extremely difficult to
identify a true ES cell signature in cancer.
The findings of this study support the concept that c-Myc, and not the core pluripotency
network of Nanog, Oct4, and Sox2, regulates gene expression in mouse glioma stem cells. The
gene expression profiles of human and mouse glioma stem cells were found to align closely with
those of human and mouse normal NSCs [180]. Two distinct gene expression patterns were
identified when mouse glioma stem cells and p53-/-
NSCs were compared to p53+/+
NSCs: a p53-
deficient signature and a glioma signature [180]. Interestingly, the p53-deficient signature
shared by glioma stem cells and p53-/-
NSCs was enriched for genes implicated in p53, apoptosis,
and MAPK signaling pathways, whereas the glioma-associated signature was represented by the
enrichment for transcripts involved in various human cancers, metabolic pathways, insulin and
mTOR signaling, and ubiquitin-mediated proteolysis, among others [180]. No enrichment for
pluripotency-related gene expression was detected. It is likely that enriching for CSCs would
effectively diminish the putative ES cell signature in cancer cells and further enhance the
prevalence of the c-Myc regulatory network.
Additional evidence supporting the importance of the c-Myc network in mouse glioma
stem cells is the finding that these cells express neural stem cell-related transcripts, such as Sox2,
c-Myc, and Klf4. Although these transcription factors have a role in reprogramming somatic
cells to the pluripotent state, they are also expressed in adult mouse neural stem cells and are,
therefore, not ES cell-specific transcription factors [86]. Sox2, which is considered to be part of
the core transcriptional network in ES cells (in addition to Nanog and Oct4), regulates the
maintenance of self-renewal and multipotent differentiation in NSCs in a manner that parallels
its role in ES cells, but without activating the core pluripotency network. Indeed, mouse glioma
stem cells fail to express the pluripotency factors, Nanog, Oct4, and Rex1, even though they
express relatively high levels of Sox2. This suggests that Sox2 expression does not activate the
core pluripotency network in mouse glioma stem cells. Furthermore, the cell surface marker
SSEA-1/CD15 and the enzyme alkaline phosphatase are expressed by mouse glioma stem cells
and ES cells, but these markers are by no means specific to pluripotent cells and do not reflect
any functional similarity between glioma stem cells and ES cells. In fact, although SSEA-1
enriches for clonogenic cells in vitro and tumour-initiating cells in vivo in mouse models of
glioma and medulloblastoma, the functional role of this marker in the context of cancer remains
82
unclear [180,186,187]. Therefore, the results support the importance of a NSC-related c-Myc
network, but not a core pluripotency network involving Nanog and Oct4, in mouse glioma stem
cells.
4.10 Expression of Pluripotency Factors in Human Glioma
Due to the relatively low efficiency of generating iPS cells through transcription factor-mediated
reprogramming, it could be argued that a rare population of cells may be more amenable to
reprogramming, potentially due to the expression of pluripotency-associated factors. The
expression of core pluripotency factors, Nanog and Oct4, has been detected in primary human
GBM tumours in a small cohort of studies, although the function of these factors in GBM
pathogenesis remains elusive [132,133,189,206,207,208]. Levels of Oct4 transcript and protein
expression were found to correlate with glioma grade, with high-grade GBM expressing greater
amounts of Oct4 than low-grade astrocytomas [207]. It has been hypothesized, therefore, that
the augmented malignancy of GBM is a result of reactivated expression of stem cell genes, such
as Oct4, although this remains to be shown conclusively [133]. It has been shown that the
expression of neural stem cell markers (Nestin and Sox2) remains unaltered in human glioma
cells in vivo and in vitro, whereas pluripotency factor expression (Nanog and Oct4) occurs in
vivo, but is lost after approximately 20 passages in vitro [133]. The cause for the downregulated
expression of Nanog and Oct4 in human GBM cells in vitro is not clear. Our lab has detected
Oct4 protein in primary human GBM tumours [209], but not at the transcript level in mouse
glioma stem cells in vitro, as shown in this study by end-point RT-PCR and quantitative RT-
PCR. Therefore, it is unlikely that a subset of mouse glioma stem cells exists that is more
amenable to reprogramming due to the expression of core pluripotency factors.
The functional role of Nanog and Oct4 expression in human glioma has not been
established. Nanog was found to regulate proliferation of CD133+ cells sorted from primary
human GBM tumours and was essential for tumour initiation in vivo [208]. In an elegant
competition experiment involving lentiviral-mediated fluorescent labeling of primary GBM cells
combined with Nanog knockdown using short hairpin RNA, GFP-control or GFP-shNanog were
injected intracranially with RFP-control cells [208]. Without Nanog knockdown, the resulting
tumours were a combination of GFP+ and RFP
+ cells, whereas the injection of RFP-control and
GFP-shNanog cells resulted in tumours consisting entirely of RFP+ cells, with GFP-shNanog
83
cells unable to engraft and form tumours [208]. These results suggest that Nanog expression is
required for the engraftment and tumour-initiating capability of human GBM cells in orthotopic
xenograft experiments.
The self-renewal of CD133+ cells sorted from primary human GBM tumours and
increased expression of human ES cell markers, including Nanog, Oct4, and c-Myc, were
promoted in hypoxic (2% oxygen) conditions [206,210]. The functional relevance of the
enhanced expression of Nanog, Oct4 and c-Myc in hypoxic conditions is not clear, since
upregulation of these ES cell markers were not only seen in CD133+ CSCs sorted from primary
human GBM tumours, but also in CD133- cells [210]. Hypoxia stabilizes hypoxia inducible
factor alpha (HIFα) subunits and allows the HIF complex to bind to hypoxia response elements
and activate the expression of target genes, including c-Myc and Oct4 [210]. It is likely that the
misexpression of ES cell-related transcription factors in glioma is a result of the hypoxic
activation of aberrant gene expression programs and has very little functional implication in
pluripotency; the CSCs responsible for tumour growth and maintenance do not form teratomas in
vivo containing tissues derived from the three germ layers. Although cells from primary human
GBM tumours may express detectable levels of Nanog and Oct4 transcript or protein, it is
unlikely that the levels of expression are similar to those occurring in pluripotent human ES
cells. It is probable that a balance of the transcription factors belonging to the core pluripotency
network (Nanog, Oct4, and Sox2) is required for functional pluripotency.
The expression of pluripotency factors, particularly Oct4, in human gliomas and other
types of cancer is complicated by the fact that several pseudogenes and splice variants exist.
This has been confirmed for the human Oct4 gene, but not the mouse Oct4 gene. The expression
of three distinct Oct4 pseudogenes has been detected at the transcript and protein levels in
primary samples and cell lines derived from human glioma and breast cancer [211,212].
Conversely, Oct4 was not detected in these tumour types, among others, by
immunohistochemistry of tissue arrays [129,130]. Although the Oct4 pseudogenes have high
sequence homology to the human Oct4 gene, they encode protein products that do not have the
same function in promoting pluripotency and self-renewal of cells [211]. Furthermore, through
alternative splicing, three isoforms of the Oct4 protein can be generated: Oct4A, Oct4B, and
Oct4B1 [213,214]. The Oct4A isoform is the classic Oct4 protein involved in the maintenance
of pluripotent self-renewal in ES and EC cells, whereas the Oct4B isoform is expressed in non-
84
pluripotent somatic cells and has no established function in sustaining the self-renewal of ES
cells [213,214]. Oct4A and Oct4B possess a DNA binding domain, whereas Oct4B1 lacks a
portion of this domain and has no established function, although it is expressed in ES and EC
cells and is downregulated during differentiation [214]. The presence of multiple pseudogenes
and splice variants of Oct4 raise the possibility of false-positive results at the transcript and
protein levels if primers or antibodies are not selected carefully to identify the classic Oct4A
variant [215]. In fact, studies in which Oct4 expression was detected at the transcript level in
human cancer cells using primers to amplify sequences common to both Oct4A and Oct4B, such
as one study claiming that human embryonic genes are re-expressed in cancer, may simply be
detecting Oct4B or a pseudogene of Oct4 [215,216]. Similarly, Nanog encodes ten processed
pseudogenes in the human, three of which can be expressed, and only two pseudogenes in the
mouse in addition to the bona fide Nanog protein product [217]. Therefore, the expression of
pseudogenes and splice variants, particularly for the human Oct4 gene, complicates the study of
this pluripotency factor in human somatic tumours.
4.11 Future Directions
The glioma stem cell-derived iPS and appropriate control iPS cell lines generated from this
project will be a valuable resource in carrying out important experiments in the future. A
potential caveat is that additional iPS cell lines derived from other glioma stem cell lines and
different tumour types may be required to strengthen the findings of this study. Ideally, the
glioma stem cell-derived and control iPS cell lines should show equivalent degrees of
reprogramming. Furthermore, non-integrating methods of generating iPS cells should be
employed to minimize the genetic effects of reprogramming to pluripotency. It may be
beneficial to repeat the reprogramming experiments and replace exogenous c-Myc with L-Myc,
which has been shown to promote more efficient reprogramming with less potent neoplastic
transformation than c-Myc [84]. It remains to be shown whether different primary brain tumour
samples can be reprogrammed more fully or whether genetic lesions block complete
reprogramming.
The molecular and functional characterization of the iPS cell-derived NSC lines obtained
in this study will be carried out to assess the expression of neural stem cell markers and to
determine whether the cells are multipotent and can generate neurons, astrocytes, and
85
oligodendrocytes upon growth factor withdrawal in vitro. Global DNA methylation analysis,
bisulphite sequencing of candidate promoter regions of pluripotency-associated genes (Nanog
and Oct4) and NSC-associated genes (Nestin and GFAP), and chromatin immunoprecipitation
coupled with high-throughput sequencing to detect histone modifications can be carried out to
compare the epigenetic patterns of the non-reprogrammed glioma stem cells, iPS cell lines, and
iPS cell-derived NSC lines. An important experiment to be performed involves the genomic
DNA sequencing of the iPS cell lines and the original cell lines from which they were derived, in
order to identify potential reprogramming-associated mutations [80]. This will not only provide
an assessment of the genetic mutations that may have occurred as a result of retroviral
integration, but will also identify mutations in the non-reprogrammed glioma stem cells, which
were induced by ENU treatment in the chemical-genetic mouse model of glioma. In addition,
microarray analysis of the non-reprogrammed glioma stem cells, iPS cells, and iPS-derived
NSCs must be carried out to compare the gene expression profiles of the various cell types. In
combination with the sequencing data, the comparison of the gene expression profiles of the non-
reprogrammed glioma stem cells and iPS-derived NSCs, in particular, would help to elucidate
the epigenetic changes occurring during reprogramming and subsequent re-differentiation of
cancer cells. Intracranial injections will be carried out for the iPS cell-derived NSCs and
parental glioma stem cell lines to study tumourigenicity. These experiments will allow us to
study the relative contributions of genetic and non-genetic factors to the cancer phenotype and
will aid in determining whether reprogramming mouse glioma stem cells alters their tumour-
initiating ability.
86
Appendices
5 Appendix 1. Supplemental Methods
5.1 Primer Sequences
The following primer sequences were used to amplify transcripts for RT-PCR and quantitative
RT-PCR (qRT-PCR) applications.
Supplemental Table 1. Primer sequences used in this study.
Target Primer Sequence Annealing
Temp (°C)
Application
Nanog
for: ACACTGACATGAGTGTGGGTCTTCC
63
RT-PCR
rev: GCAGGTCTTCAGAGGAAGGGCGAG
Oct4 for: CACGAGTGGAAAGCAACTCA
rev: TGGGAAAGGTGTCCCTGTAG
60 RT-PCR
Endogenous
Oct4
for: TCTTTCCACCAGGCCCCCGGCTC
rev: TGCGGGCGGACATGGGGAGATCC
60 RT-PCR
Klf4 for: TACCCCTACACTGAGTCCCG
rev: GTGTGGGTGGCTGTTCTTTT
53 RT-PCR
Sox2 for: ATACAAGGGAATTGGGAGGG
rev: AAACAAGACCACGAAAACGG
58 RT-PCR
c-Myc for: GGACTGTATGTGGAGCGGTT
rev: TCGTCTGCTTGAATGGACAG
58 RT-PCR
Rex1 for: GGAAGAAATGCTGAAGGTGGAGAC 55 RT-PCR
rev: AGTCCCCATCCCCTTCAATAGC
Flk1 for: TAGGTGCCTCCCCATACCCTGG
rev: TGGCCGGCTCTTTCGCTTACTG
60 RT-PCR
Brachyury for: TAATGGAGGAACCGGGGGACTGC
rev: TGTCCGCATAGGTTGGAGAGCTGT
60 RT-PCR
Sox17 for: TATGGTGTGGGCCAAAGACGA
rev: AACGCCTTCCAAGACTTGCCT
60 RT-PCR
GATA4 for: CTGGAAGACACCCCAATCTC
rev: CACAGGCATTGCACAGGTAG
60 RT-PCR
Nestin for: AACTCTCGCTTGCAGACACCTG
rev: AGGTGCTGGTCCTCTGGTATCC
60 RT-PCR
Sox1 for: TTCCCCAGGACTCCGAGGCG
rev: GCTGTGTGCCTCCTCTGCGG
60 RT-PCR
87
GAPDH for: AACTTTGGCATTGTGGAAGG
rev: ACACATTGGGGGTAGGAACA
60
58-60
RT-PCR
qRT-PCR
Nanog
for: TTCTTGCTTACAAGGGTCTGC
rev: AGAGGAAGGGCGAGGAGA
60 qRT-PCR
Oct4 for: ACATCGCCAATCAGCTTGG
rev: AGAACCATACTCGAACCACATCC
60 qRT-PCR
Rex1 for: TCTTCTCTCAATAGAGTGAGTGTGC
rev: GCTTTCTTCTGTGTGCAGGA
60 qRT-PCR
Klf4 for: GCACACCTGCGAACTCACAC 60 qRT-PCR
rev: CCGTCCCAGTCACAGTGGTAA
Klf2 for: CTCAGCGAGCCTATCTTGCC
rev: CAGACCGTCCAATCCCATGG
60 qRT-PCR
Klf5 for: ATTCGCCAACTCTCCCACCT
rev: TCGCCCGTATGAGTCCTCAG
60 qRT-PCR
Sox2 for: ACAGATGCAACCGATGCACC 60 qRT-PCR
rev: TGGAGTTGTACTGCAGGGCG
c-Myc for: CCACCAGCAGCGACTCTGA 60 qRT-PCR
rev: TGCCTCTTCTCCACAGACACC
L-Myc for: GGACGGCACTCCTAGTCTGG
rev: GGTGACTGGCTTTCGGATGT
60 qRT-PCR
Exogenous
Oct4
for: TCTCCCATGCATTCAAACTG
rev: CTTTTATTTTATCGTCGACC
58 q-RT-PCR
Exogenous
Klf4
for: CCACCTTGCCTTACACATGA
rev: CTTTTATTTTATCGTCGACC
58 qRT-PCR
Exogenous
Sox2
for: CTCCGGGACATGATCAGC
rev: CTTTTATTTTATCGTCGACC
58 qRT-PCR
Exogenous
cMyc
for: TGAGGAAACGACGAGAACA
rev: CCCTTTTTCTGGAGACTAAATAAA
58 qRT-PCR
88
6 Appendix 2. Supplemental Figures
6.1 Quantitative RT-PCR Results of Pluripotency Factor Expression
Figure S1. Glioma stem cell lines express L-Myc and neural stem cell-associated factors,
but do not express Nanog or Oct4.
Quantitative RT-PCR results showing the expression levels of reprogramming-associated
factors in glioma stem cell lines (GNS1, GNS2, and GNS3), p53-/-
NS, and p53+/+
NS in stem
cell conditions (serum-free medium with EGF and bFGF) and differentiation conditions
(with 10% serum). Fold expression is shown relative to J1 (ES) cells. Overexpression of c-
Myc was frequently detected in glioma stem cells and normal NSCs. The data represents
the average from triplicate readings and was generated while supervising Stephanie
Dobson, a rotation student in the lab.
89
6.2 Alkaline Phosphatase Expression in Mouse Glioma Stem Cell Lines
A B
Figure S2. Glioma stem cells, but not normal neural stem cells, express alkaline
phosphatase in stem cell conditions.
(A) The three mouse glioma stem cell lines express alkaline phosphatase (AP) when grown
in neural stem cell conditions (serum-free medium with EGF and bFGF), as detected by
light microscopy (middle column) or fluorescence microscopy (right column). (B) Normal
neural stem cells grown in stem cell conditions fail to express AP, regardless of p53 status.
J1 mouse ES cells and MEFs were used as a positive and negative control, respectively.
90
A B
Figure S3. Glioma stem cells and normal neural stem cells fail to express alkaline
phosphatase in differentiation conditions.
(A) The three mouse glioma stem cell lines do not express detectable levels of alkaline
phosphatase (AP) when grown in differentiation conditions (medium with 10% serum), as
detected by light microscopy (middle column) or fluorescence microscopy (right column).
(B) Normal neural stem cells grown in differentiation conditions fail to express AP,
regardless of p53 status. J1 mouse ES cells and MEFs were used as a positive and negative
control, respectively.
91
6.3 Nanog Expression in MEF-Derived iPS Cell Lines
Figure S4. MEF-derived iPS cell lines express Nanog and 2i treatment enhances Nanog
expression.
Nanog expression was detected by RT-PCR in 6 iPS cell lines derived from the four-factor
infection of CD1 MEFs. Six additional MEF-derived iPS cell lines were treated with
DMSO (D) or 2i. Treatment with 2i was found to enhance Nanog expression in some of the
MEF-derived iPS cell lines, as detected by end-point RT-PCR. J1 ES cells and three-factor
infected MEF-derived iPS cells (3F iPS, obtained from the Ellis Lab) were used as positive
controls, with MEFs as a negative control.
92
References
1. Fuchs E (2009) The tortoise and the hair: slow-cycling cells in the stem cell race. Cell 137:
811-819.
2. Altman J (1963) Autoradiographic investigation of cell proliferation in the brains of rats and
cats. Anat Rec 145: 573-591.
3. Reynolds BA, Weiss S (1992) Generation of neurons and astrocytes from isolated cells of the
adult mammalian central nervous system. Science 255: 1707-1710.
4. Morshead CM, Reynolds BA, Craig CG, McBurney MW, Staines WA, et al. (1994) Neural
stem cells in the adult mammalian forebrain: a relatively quiescent subpopulation of
subependymal cells. Neuron 13: 1071-1082.
5. Weiss S, Reynolds BA, Vescovi AL, Morshead C, Craig CG, et al. (1996) Is there a neural
stem cell in the mammalian forebrain? Trends Neurosci 19: 387-393.
6. Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A (1999) Subventricular
zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97: 703-716.
7. Eriksson PS, Perfilieva E, Bjork-Eriksson T, Alborn AM, Nordborg C, et al. (1998)
Neurogenesis in the adult human hippocampus. Nat Med 4: 1313-1317.
8. Scadden DT (2006) The stem-cell niche as an entity of action. Nature 441: 1075-1079.
9. Doetsch F, Petreanu L, Caille I, Garcia-Verdugo JM, Alvarez-Buylla A (2002) EGF converts
transit-amplifying neurogenic precursors in the adult brain into multipotent stem cells.
Neuron 36: 1021-1034.
10. Kuhn HG, Winkler J, Kempermann G, Thal LJ, Gage FH (1997) Epidermal growth factor
and fibroblast growth factor-2 have different effects on neural progenitors in the adult rat
brain. J Neurosci 17: 5820-5829.
11. Conti L, Pollard SM, Gorba T, Reitano E, Toselli M, et al. (2005) Niche-independent
symmetrical self-renewal of a mammalian tissue stem cell. PLoS Biol 3: e283.
12. Uchida N, Buck DW, He D, Reitsma MJ, Masek M, et al. (2000) Direct isolation of human
central nervous system stem cells. Proc Natl Acad Sci U S A 97: 14720-14725.
13. Capela A, Temple S (2002) LeX/ssea-1 is expressed by adult mouse CNS stem cells,
identifying them as nonependymal. Neuron 35: 865-875.
14. Evans MJ, Kaufman MH (1981) Establishment in culture of pluripotential cells from mouse
embryos. Nature 292: 154-156.
15. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, et al. (1998)
Embryonic stem cell lines derived from human blastocysts. Science 282: 1145-1147.
93
16. Ying QL, Nichols J, Chambers I, Smith A (2003) BMP induction of Id proteins suppresses
differentiation and sustains embryonic stem cell self-renewal in collaboration with
STAT3. Cell 115: 281-292.
17. Williams RL, Hilton DJ, Pease S, Willson TA, Stewart CL, et al. (1988) Myeloid leukaemia
inhibitory factor maintains the developmental potential of embryonic stem cells. Nature
336: 684-687.
18. Smith AG, Heath JK, Donaldson DD, Wong GG, Moreau J, et al. (1988) Inhibition of
pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336:
688-690.
19. Niwa H, Ogawa K, Shimosato D, Adachi K (2009) A parallel circuit of LIF signalling
pathways maintains pluripotency of mouse ES cells. Nature 460: 118-122.
20. Hall J, Guo G, Wray J, Eyres I, Nichols J, et al. (2009) Oct4 and LIF/Stat3 additively induce
Kruppel factors to sustain embryonic stem cell self-renewal. Cell stem cell 5: 597-609.
21. Zhang P, Andrianakos R, Yang Y, Liu C, Lu W (2010) Kruppel-like factor 4 (Klf4) prevents
embryonic stem (ES) cell differentiation by regulating Nanog gene expression. The
Journal of biological chemistry 285: 9180-9189.
22. Ying QL, Wray J, Nichols J, Batlle-Morera L, Doble B, et al. (2008) The ground state of
embryonic stem cell self-renewal. Nature 453: 519-523.
23. Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, et al. (2003) The homeoprotein
Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell
113: 631-642.
24. Niwa H, Miyazaki J, Smith AG (2000) Quantitative expression of Oct-3/4 defines
differentiation, dedifferentiation or self-renewal of ES cells. Nature genetics 24: 372-376.
25. Boyer LA, Lee TI, Cole MF, Johnstone SE, Levine SS, et al. (2005) Core transcriptional
regulatory circuitry in human embryonic stem cells. Cell 122: 947-956.
26. Chambers I (2004) The molecular basis of pluripotency in mouse embryonic stem cells.
Cloning and stem cells 6: 386-391.
27. Shi W, Wang H, Pan G, Geng Y, Guo Y, et al. (2006) Regulation of the pluripotency marker
Rex-1 by Nanog and Sox2. The Journal of biological chemistry 281: 23319-23325.
28. Thomson M, Liu SJ, Zou LN, Smith Z, Meissner A, et al. (2011) Pluripotency factors in
embryonic stem cells regulate differentiation into germ layers. Cell 145: 875-889.
29. Silva J, Nichols J, Theunissen TW, Guo G, van Oosten AL, et al. (2009) Nanog is the
gateway to the pluripotent ground state. Cell 138: 722-737.
94
30. Brambrink T, Foreman R, Welstead GG, Lengner CJ, Wernig M, et al. (2008) Sequential
expression of pluripotency markers during direct reprogramming of mouse somatic cells.
Cell stem cell 2: 151-159.
31. Chambers I, Silva J, Colby D, Nichols J, Nijmeijer B, et al. (2007) Nanog safeguards
pluripotency and mediates germline development. Nature 450: 1230-1234.
32. Yamanaka S, Blau HM (2010) Nuclear reprogramming to a pluripotent state by three
approaches. Nature 465: 704-712.
33. Le Lievre CS, Le Douarin NM (1975) Mesenchymal derivatives of the neural crest: analysis
of chimaeric quail and chick embryos. Journal of embryology and experimental
morphology 34: 125-154.
34. Gurdon JB, Wilmut I (2011) Nuclear transfer to eggs and oocytes. Cold Spring Harbor
perspectives in biology 3.
35. Briggs R, King TJ (1952) Transplantation of living nuclei from blastula cells into enucleated
frogs' eggs. Proc Natl Acad Sci USA 38: 455-463.
36. Gurdon JB (1962) Adult frogs derived from the nuclei of single somatic cells. Developmental
biology 4: 256-273.
37. Gurdon JB (1962) The developmental capacity of nuclei taken from intestinal epithelium
cells of feeding tadpoles. Journal of embryology and experimental morphology 10: 622-
640.
38. Hochedlinger K, Jaenisch R (2002) Monoclonal mice generated by nuclear transfer from
mature B and T donor cells. Nature 415: 1035-1038.
39. Harris H, Miller OJ, Klein G, Worst P, Tachibana T (1969) Suppression of malignancy by
cell fusion. Nature 223: 363-368.
40. Blau HM, Chiu CP, Webster C (1983) Cytoplasmic activation of human nuclear genes in
stable heterocaryons. Cell 32: 1171-1180.
41. Blau HM, Pavlath GK, Hardeman EC, Chiu CP, Silberstein L, et al. (1985) Plasticity of the
differentiated state. Science 230: 758-766.
42. Chiu CP, Blau HM (1985) 5-Azacytidine permits gene activation in a previously
noninducible cell type. Cell 40: 417-424.
43. Tada M, Tada T, Lefebvre L, Barton SC, Surani MA (1997) Embryonic germ cells induce
epigenetic reprogramming of somatic nucleus in hybrid cells. The EMBO journal 16:
6510-6520.
44. Tada M, Takahama Y, Abe K, Nakatsuji N, Tada T (2001) Nuclear reprogramming of
somatic cells by in vitro hybridization with ES cells. Current biology : CB 11: 1553-
1558.
95
45. Pereira CF, Terranova R, Ryan NK, Santos J, Morris KJ, et al. (2008) Heterokaryon-based
reprogramming of human B lymphocytes for pluripotency requires Oct4 but not Sox2.
PLoS genetics 4: e1000170.
46. Bhutani N, Brady JJ, Damian M, Sacco A, Corbel SY, et al. (2010) Reprogramming towards
pluripotency requires AID-dependent DNA demethylation. Nature 463: 1042-1047.
47. Schneuwly S, Klemenz R, Gehring WJ (1987) Redesigning the body plan of Drosophila by
ectopic expression of the homoeotic gene Antennapedia. Nature 325: 816-818.
48. Gehring WJ (1996) The master control gene for morphogenesis and evolution of the eye.
Genes to cells : devoted to molecular & cellular mechanisms 1: 11-15.
49. Davis RL, Weintraub H, Lassar AB (1987) Expression of a single transfected cDNA converts
fibroblasts to myoblasts. Cell 51: 987-1000.
50. Vierbuchen T, Ostermeier A, Pang ZP, Kokubu Y, Sudhof TC, et al. (2010) Direct
conversion of fibroblasts to functional neurons by defined factors. Nature 463: 1035-
1041.
51. Pang ZP, Yang N, Vierbuchen T, Ostermeier A, Fuentes DR, et al. (2011) Induction of
human neuronal cells by defined transcription factors. Nature: doi:10.1038/nature10202.
52. Toma JG, Akhavan M, Fernandes KJ, Barnabe-Heider F, Sadikot A, et al. (2001) Isolation of
multipotent adult stem cells from the dermis of mammalian skin. Nature cell biology 3:
778-784.
53. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic
and adult fibroblast cultures by defined factors. Cell 126: 663-676.
54. Okita K, Ichisaka T, Yamanaka S (2007) Generation of germline-competent induced
pluripotent stem cells. Nature 448: 313-317.
55. Wernig M, Meissner A, Foreman R, Brambrink T, Ku M, et al. (2007) In vitro
reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature 448: 318-324.
56. Tokuzawa Y, Kaiho E, Maruyama M, Takahashi K, Mitsui K, et al. (2003) Fbx15 is a novel
target of Oct3/4 but is dispensable for embryonic stem cell self-renewal and mouse
development. Molecular and cellular biology 23: 2699-2708.
57. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, et al. (2007) Induction of
pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131: 861-872.
58. Yamanaka S (2009) A fresh look at iPS cells. Cell 137: 13-17.
59. Wernig M, Lengner CJ, Hanna J, Lodato MA, Steine E, et al. (2008) A drug-inducible
transgenic system for direct reprogramming of multiple somatic cell types. Nature
biotechnology 26: 916-924.
96
60. Hanna J, Saha K, Pando B, van Zon J, Lengner CJ, et al. (2009) Direct cell reprogramming is
a stochastic process amenable to acceleration. Nature 462: 595-601.
61. Yamanaka S (2009) Elite and stochastic models for induced pluripotent stem cell generation.
Nature 460: 49-52.
62. Lister R, Pelizzola M, Kida YS, Hawkins RD, Nery JR, et al. (2011) Hotspots of aberrant
epigenomic reprogramming in human induced pluripotent stem cells. Nature 471: 68-73.
63. Kim K, Doi A, Wen B, Ng K, Zhao R, et al. (2010) Epigenetic memory in induced
pluripotent stem cells. Nature 467: 285-290.
64. Polo JM, Liu S, Figueroa ME, Kulalert W, Eminli S, et al. (2010) Cell type of origin
influences the molecular and functional properties of mouse induced pluripotent stem
cells. Nature biotechnology 28: 848-855.
65. Esteban MA, Wang T, Qin B, Yang J, Qin D, et al. (2010) Vitamin C enhances the
generation of mouse and human induced pluripotent stem cells. Cell stem cell 6: 71-79.
66. Yoshida Y, Takahashi K, Okita K, Ichisaka T, Yamanaka S (2009) Hypoxia enhances the
generation of induced pluripotent stem cells. Cell stem cell 5: 237-241.
67. Huangfu D, Maehr R, Guo W, Eijkelenboom A, Snitow M, et al. (2008) Induction of
pluripotent stem cells by defined factors is greatly improved by small-molecule
compounds. Nature biotechnology 26: 795-797.
68. Huangfu D, Osafune K, Maehr R, Guo W, Eijkelenboom A, et al. (2008) Induction of
pluripotent stem cells from primary human fibroblasts with only Oct4 and Sox2. Nature
biotechnology 26: 1269-1275.
69. Utikal J, Polo JM, Stadtfeld M, Maherali N, Kulalert W, et al. (2009) Immortalization
eliminates a roadblock during cellular reprogramming into iPS cells. Nature 460: 1145-
1148.
70. Kawamura T, Suzuki J, Wang YV, Menendez S, Morera LB, et al. (2009) Linking the p53
tumour suppressor pathway to somatic cell reprogramming. Nature 460: 1140-1144.
71. Marion RM, Strati K, Li H, Murga M, Blanco R, et al. (2009) A p53-mediated DNA damage
response limits reprogramming to ensure iPS cell genomic integrity. Nature 460: 1149-
1153.
72. Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, et al. (2009) Suppression of induced
pluripotent stem cell generation by the p53-p21 pathway. Nature 460: 1132-1135.
73. Li H, Collado M, Villasante A, Strati K, Ortega S, et al. (2009) The Ink4/Arf locus is a
barrier for iPS cell reprogramming. Nature 460: 1136-1139.
97
74. Woltjen K, Michael IP, Mohseni P, Desai R, Mileikovsky M, et al. (2009) piggyBac
transposition reprograms fibroblasts to induced pluripotent stem cells. Nature 458: 766-
770.
75. Zhou H, Wu S, Joo JY, Zhu S, Han DW, et al. (2009) Generation of induced pluripotent stem
cells using recombinant proteins. Cell stem cell 4: 381-384.
76. Okita K, Nakagawa M, Hyenjong H, Ichisaka T, Yamanaka S (2008) Generation of mouse
induced pluripotent stem cells without viral vectors. Science 322: 949-953.
77. Yu J, Hu K, Smuga-Otto K, Tian S, Stewart R, et al. (2009) Human induced pluripotent stem
cells free of vector and transgene sequences. Science 324: 797-801.
78. Warren L, Manos PD, Ahfeldt T, Loh YH, Li H, et al. (2010) Highly efficient
reprogramming to pluripotency and directed differentiation of human cells with synthetic
modified mRNA. Cell stem cell 7: 618-630.
79. Anokye-Danso F, Trivedi CM, Juhr D, Gupta M, Cui Z, et al. (2011) Highly Efficient
miRNA-Mediated Reprogramming of Mouse and Human Somatic Cells to Pluripotency.
Cell stem cell 8: 376-388.
80. Gore A, Li Z, Fung HL, Young JE, Agarwal S, et al. (2011) Somatic coding mutations in
human induced pluripotent stem cells. Nature 471: 63-67.
81. Hussein SM, Batada NN, Vuoristo S, Ching RW, Autio R, et al. (2011) Copy number
variation and selection during reprogramming to pluripotency. Nature 471: 58-62.
82. Laurent LC, Ulitsky I, Slavin I, Tran H, Schork A, et al. (2011) Dynamic changes in the copy
number of pluripotency and cell proliferation genes in human ESCs and iPSCs during
reprogramming and time in culture. Cell stem cell 8: 106-118.
83. Nakagawa M, Koyanagi M, Tanabe K, Takahashi K, Ichisaka T, et al. (2008) Generation of
induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nature
biotechnology 26: 101-106.
84. Nakagawa M, Takizawa N, Narita M, Ichisaka T, Yamanaka S (2010) Promotion of direct
reprogramming by transformation-deficient Myc. Proceedings of the National Academy
of Sciences of the United States of America 107: 14152-14157.
85. Maekawa M, Yamaguchi K, Nakamura T, Shibukawa R, Kodanaka I, et al. (2011) Direct
reprogramming of somatic cells is promoted by maternal transcription factor Glis1.
Nature 474: 225-229.
86. Kim JB, Zaehres H, Wu G, Gentile L, Ko K, et al. (2008) Pluripotent stem cells induced
from adult neural stem cells by reprogramming with two factors. Nature 454: 646-650.
87. Hester ME, Song S, Miranda CJ, Eagle A, Schwartz PH, et al. (2009) Two factor
reprogramming of human neural stem cells into pluripotency. PloS one 4: e7044.
98
88. Kim JB, Greber B, Arauzo-Bravo MJ, Meyer J, Park KI, et al. (2009) Direct reprogramming
of human neural stem cells by OCT4. Nature 461: 649-643.
89. Kim JB, Sebastiano V, Wu G, Arauzo-Bravo MJ, Sasse P, et al. (2009) Oct4-induced
pluripotency in adult neural stem cells. Cell 136: 411-419.
90. Shi Y, Do JT, Desponts C, Hahm HS, Scholer HR, et al. (2008) A combined chemical and
genetic approach for the generation of induced pluripotent stem cells. Cell stem cell 2:
525-528.
91. Knudson AG, Jr. (1971) Mutation and cancer: statistical study of retinoblastoma.
Proceedings of the National Academy of Sciences of the United States of America 68:
820-823.
92. Knudson AG, Jr. (1977) Mutation and cancer in man. Cancer 39: 1882-1886.
93. Esteller M (2008) Epigenetics in cancer. The New England journal of medicine 358: 1148-
1159.
94. Gal-Yam EN, Saito Y, Egger G, Jones PA (2008) Cancer epigenetics: modifications,
screening, and therapy. Annual review of medicine 59: 267-280.
95. Jones PA, Laird PW (1999) Cancer epigenetics comes of age. Nature genetics 21: 163-167.
96. Jones PA (1996) DNA methylation errors and cancer. Cancer research 56: 2463-2467.
97. Nan X, Ng HH, Johnson CA, Laherty CD, Turner BM, et al. (1998) Transcriptional
repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase
complex. Nature 393: 386-389.
98. Jones PL, Veenstra GJ, Wade PA, Vermaak D, Kass SU, et al. (1998) Methylated DNA and
MeCP2 recruit histone deacetylase to repress transcription. Nature genetics 19: 187-191.
99. Kouzarides T (2007) Chromatin modifications and their function. Cell 128: 693-705.
100. Li E, Bestor TH, Jaenisch R (1992) Targeted mutation of the DNA methyltransferase gene
results in embryonic lethality. Cell 69: 915-926.
101. Okano M, Xie S, Li E (1998) Cloning and characterization of a family of novel mammalian
DNA (cytosine-5) methyltransferases. Nature genetics 19: 219-220.
102. Okano M, Bell DW, Haber DA, Li E (1999) DNA methyltransferases Dnmt3a and Dnmt3b
are essential for de novo methylation and mammalian development. Cell 99: 247-257.
103. Feinberg AP, Vogelstein B (1983) Hypomethylation distinguishes genes of some human
cancers from their normal counterparts. Nature 301: 89-92.
104. Coulondre C, Miller JH, Farabaugh PJ, Gilbert W (1978) Molecular basis of base
substitution hotspots in Escherichia coli. Nature 274: 775-780.
99
105. Li E, Beard C, Jaenisch R (1993) Role for DNA methylation in genomic imprinting. Nature
366: 362-365.
106. Laird PW, Jackson-Grusby L, Fazeli A, Dickinson SL, Jung WE, et al. (1995) Suppression
of intestinal neoplasia by DNA hypomethylation. Cell 81: 197-205.
107. Feinberg AP (1993) Genomic imprinting and gene activation in cancer. Nature genetics 4:
110-113.
108. Beaulieu N, Morin S, Chute IC, Robert MF, Nguyen H, et al. (2002) An essential role for
DNA methyltransferase DNMT3B in cancer cell survival. The Journal of biological
chemistry 277: 28176-28181.
109. Esteller M, Hamilton SR, Burger PC, Baylin SB, Herman JG (1999) Inactivation of the
DNA repair gene O6-methylguanine-DNA methyltransferase by promoter
hypermethylation is a common event in primary human neoplasia. Cancer research 59:
793-797.
110. Esteller M (2006) Epigenetics provides a new generation of oncogenes and tumour-
suppressor genes. British journal of cancer 94: 179-183.
111. Jacobs JJ, Kieboom K, Marino S, DePinho RA, van Lohuizen M (1999) The oncogene and
Polycomb-group gene bmi-1 regulates cell proliferation and senescence through the ink4a
locus. Nature 397: 164-168.
112. Bruggeman SW, Hulsman D, Tanger E, Buckle T, Blom M, et al. (2007) Bmi1 controls
tumor development in an Ink4a/Arf-independent manner in a mouse model for glioma.
Cancer Cell 12: 328-341.
113. Lessard J, Sauvageau G (2003) Bmi-1 determines the proliferative capacity of normal and
leukaemic stem cells. Nature 423: 255-260.
114. Lee TI, Jenner RG, Boyer LA, Guenther MG, Levine SS, et al. (2006) Control of
developmental regulators by Polycomb in human embryonic stem cells. Cell 125: 301-
313.
115. Widschwendter M, Fiegl H, Egle D, Mueller-Holzner E, Spizzo G, et al. (2007) Epigenetic
stem cell signature in cancer. Nature genetics 39: 157-158.
116. Kaminskas E, Farrell A, Abraham S, Baird A, Hsieh LS, et al. (2005) Approval summary:
azacitidine for treatment of myelodysplastic syndrome subtypes. Clinical cancer research
: an official journal of the American Association for Cancer Research 11: 3604-3608.
117. Dey P (2006) Chromatin remodeling, cancer and chemotherapy. Current medicinal
chemistry 13: 2909-2919.
118. Lane AA, Chabner BA (2009) Histone deacetylase inhibitors in cancer therapy. Journal of
clinical oncology : official journal of the American Society of Clinical Oncology 27:
5459-5468.
100
119. Ben-Porath I, Thomson MW, Carey VJ, Ge R, Bell GW, et al. (2008) An embryonic stem
cell-like gene expression signature in poorly differentiated aggressive human tumors.
Nature genetics 40: 499-507.
120. Kim J, Woo AJ, Chu J, Snow JW, Fujiwara Y, et al. (2010) A Myc network accounts for
similarities between embryonic stem and cancer cell transcription programs. Cell 143:
313-324.
121. Tlsty TD (2011) Phenotypic plasticity in human somatic cells. Plenary Talk, ISSCR 9th
Annual Meeting, Toronto, Canada.
122. Hendrix MJ, Seftor EA, Hess AR, Seftor RE (2003) Vasculogenic mimicry and tumour-cell
plasticity: lessons from melanoma. Nature reviews Cancer 3: 411-421.
123. Ricci-Vitiani L, Pallini R, Biffoni M, Todaro M, Invernici G, et al. (2010) Tumour
vascularization via endothelial differentiation of glioblastoma stem-like cells. Nature 468:
824-828.
124. Wang R, Chadalavada K, Wilshire J, Kowalik U, Hovinga KE, et al. (2010) Glioblastoma
stem-like cells give rise to tumour endothelium. Nature 468: 829-833.
125. Kleinsmith LJ, Pierce GB, Jr. (1964) Multipotentiality of Single Embryonal Carcinoma
Cells. Cancer research 24: 1544-1551.
126. Mintz B, Illmensee K (1975) Normal genetically mosaic mice produced from malignant
teratocarcinoma cells. Proceedings of the National Academy of Sciences of the United
States of America 72: 3585-3589.
127. Papaioannou VE, McBurney MW, Gardner RL, Evans MJ (1975) Fate of teratocarcinoma
cells injected into early mouse embryos. Nature 258: 70-73.
128. Rosner MH, Vigano MA, Ozato K, Timmons PM, Poirier F, et al. (1990) A POU-domain
transcription factor in early stem cells and germ cells of the mammalian embryo. Nature
345: 686-692.
129. Gidekel S, Pizov G, Bergman Y, Pikarsky E (2003) Oct-3/4 is a dose-dependent oncogenic
fate determinant. Cancer cell 4: 361-370.
130. Looijenga LH, Stoop H, de Leeuw HP, de Gouveia Brazao CA, Gillis AJ, et al. (2003)
POU5F1 (OCT3/4) identifies cells with pluripotent potential in human germ cell tumors.
Cancer research 63: 2244-2250.
131. Ezeh UI, Turek PJ, Reijo RA, Clark AT (2005) Human embryonic stem cell genes OCT4,
NANOG, STELLAR, and GDF3 are expressed in both seminoma and breast carcinoma.
Cancer 104: 2255-2265.
132. Clement V, Sanchez P, de Tribolet N, Radovanovic I, Ruiz i Altaba A (2007)
HEDGEHOG-GLI1 signaling regulates human glioma growth, cancer stem cell self-
renewal, and tumorigenicity. Curr Biol 17: 165-172.
101
133. Holmberg J, He X, Peredo I, Orrego A, Hesselager G, et al. (2011) Activation of neural and
pluripotent stem cell signatures correlates with increased malignancy in human glioma.
PloS one 6: e18454.
134. Ji J, Werbowetski-Ogilvie TE, Zhong B, Hong SH, Bhatia M (2009) Pluripotent
transcription factors possess distinct roles in normal versus transformed human stem
cells. PloS one 4: e8065.
135. McKinnell RG, Deggins BA, Labat DD (1969) Transplantation of pluripotential nuclei from
triploid frog tumors. Science 165: 394-396.
136. Li L, Connelly MC, Wetmore C, Curran T, Morgan JI (2003) Mouse embryos cloned from
brain tumors. Cancer research 63: 2733-2736.
137. Hochedlinger K, Blelloch R, Brennan C, Yamada Y, Kim M, et al. (2004) Reprogramming
of a melanoma genome by nuclear transplantation. Genes & development 18: 1875-1885.
138. Blelloch RH, Hochedlinger K, Yamada Y, Brennan C, Kim M, et al. (2004) Nuclear cloning
of embryonal carcinoma cells. Proceedings of the National Academy of Sciences of the
United States of America 101: 13985-13990.
139. Miyoshi N, Ishii H, Nagai K, Hoshino H, Mimori K, et al. (2010) Defined factors induce
reprogramming of gastrointestinal cancer cells. Proceedings of the National Academy of
Sciences of the United States of America 107: 40-45.
140. Carette JE, Pruszak J, Varadarajan M, Blomen VA, Gokhale S, et al. (2010) Generation of
iPSCs from cultured human malignant cells. Blood 115: 4039-4042.
141. Bonnet D, Dick JE (1997) Human acute myeloid leukemia is organized as a hierarchy that
originates from a primitive hematopoietic cell. Nat Med 3: 730-737.
142. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF (2003) Prospective
identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 100: 3983-
3988.
143. Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, et al. (2003) Identification of a
cancer stem cell in human brain tumors. Cancer Res 63: 5821-5828.
144. Gibbs CP, Kukekov VG, Reith JD, Tchigrinova O, Suslov ON, et al. (2005) Stem-like cells
in bone sarcomas: implications for tumorigenesis. Neoplasia 7: 967-976.
145. Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ (2005) Prospective identification
of tumorigenic prostate cancer stem cells. Cancer Res 65: 10946-10951.
146. Fang D, Nguyen TK, Leishear K, Finko R, Kulp AN, et al. (2005) A tumorigenic
subpopulation with stem cell properties in melanomas. Cancer Res 65: 9328-9337.
147. Ricci-Vitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M, et al. (2007) Identification
and expansion of human colon-cancer-initiating cells. Nature 445: 111-115.
102
148. Eramo A, Lotti F, Sette G, Pilozzi E, Biffoni M, et al. (2007) Identification and expansion
of the tumorigenic lung cancer stem cell population. Cell Death Differ.
149. Prince ME, Sivanandan R, Kaczorowski A, Wolf GT, Kaplan MJ, et al. (2007)
Identification of a subpopulation of cells with cancer stem cell properties in head and
neck squamous cell carcinoma. Proc Natl Acad Sci U S A 104: 973-978.
150. Li C, Heidt DG, Dalerba P, Burant CF, Zhang L, et al. (2007) Identification of pancreatic
cancer stem cells. Cancer Res 67: 1030-1037.
151. Wu C, Wei Q, Utomo V, Nadesan P, Whetstone H, et al. (2007) Side population cells
isolated from mesenchymal neoplasms have tumor initiating potential. Cancer Res 67:
8216-8222.
152. Lerner BH (2004) Sins of omission--cancer research without informed consent. N Engl J
Med 351: 628-630.
153. Moore AE, Rhoads CP, Southam CM (1957) Homotransplantation of human cell lines.
Science 125: 158-160.
154. Brunschwig A, Southam CM, Levin AG (1965) Host resistance to cancer. Clinical
experiments by homotransplants, autotransplants and admixture of autologous leucocytes.
Ann Surg 162: 416-425.
155. Wang JC, Dick JE (2005) Cancer stem cells: lessons from leukemia. Trends Cell Biol 15:
494-501.
156. Donnenberg VS, Donnenberg AD (2005) Multiple drug resistance in cancer revisited: the
cancer stem cell hypothesis. J Clin Pharmacol 45: 872-877.
157. Dean M, Fojo T, Bates S (2005) Tumour stem cells and drug resistance. Nat Rev Cancer 5:
275-284.
158. Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, et al. (2006) Glioma stem cells promote
radioresistance by preferential activation of the DNA damage response. Nature 444: 756-
760.
159. Notta F, Mullighan CG, Wang JC, Poeppl A, Doulatov S, et al. (2011) Evolution of human
BCR-ABL1 lymphoblastic leukaemia-initiating cells. Nature 469: 362-367.
160. Merchant TE, Pollack IF, Loeffler JS (2010) Brain tumors across the age spectrum: biology,
therapy, and late effects. Semin Radiat Oncol 20: 58-66.
161. Louis DN, Ohgaki H, Wiestler OD, Cavenee WK, Burger PC, et al. (2007) The 2007 WHO
classification of tumours of the central nervous system. Acta Neuropathol 114: 97-109.
162. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, et al. (2005) Radiotherapy plus
concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 352: 987-996.
103
163. Ohgaki H, Kleihues P (2007) Genetic pathways to primary and secondary glioblastoma. The
American journal of pathology 170: 1445-1453.
164. McLendon R, Friedman A, Bigner D, Van Meir EG, Brat DJ, et al. (2008) Comprehensive
genomic characterization defines human glioblastoma genes and core pathways. Nature
455: 1061-1068.
165. Parsons DW, Jones S, Zhang X, Lin JC, Leary RJ, et al. (2008) An integrated genomic
analysis of human glioblastoma multiforme. Science 321: 1807-1812.
166. Esteller M, Corn PG, Baylin SB, Herman JG (2001) A gene hypermethylation profile of
human cancer. Cancer research 61: 3225-3229.
167. Martinez R, Schackert G (2007) Epigenetic aberrations in malignant gliomas: an open door
leading to better understanding and treatment. Epigenetics : official journal of the DNA
Methylation Society 2: 147-150.
168. Martinez R, Martin-Subero JI, Rohde V, Kirsch M, Alaminos M, et al. (2009) A
microarray-based DNA methylation study of glioblastoma multiforme. Epigenetics :
official journal of the DNA Methylation Society 4: 255-264.
169. Abdouh M, Facchino S, Chatoo W, Balasingam V, Ferreira J, et al. (2009) BMI1 sustains
human glioblastoma multiforme stem cell renewal. The Journal of neuroscience : the
official journal of the Society for Neuroscience 29: 8884-8896.
170. Facchino S, Abdouh M, Chatoo W, Bernier G (2010) BMI1 confers radioresistance to
normal and cancerous neural stem cells through recruitment of the DNA damage
response machinery. The Journal of neuroscience : the official journal of the Society for
Neuroscience 30: 10096-10111.
171. Suva ML, Riggi N, Janiszewska M, Radovanovic I, Provero P, et al. (2009) EZH2 is
essential for glioblastoma cancer stem cell maintenance. Cancer research 69: 9211-9218.
172. Nakamura M, Watanabe T, Yonekawa Y, Kleihues P, Ohgaki H (2001) Promoter
methylation of the DNA repair gene MGMT in astrocytomas is frequently associated
with G:C --> A:T mutations of the TP53 tumor suppressor gene. Carcinogenesis 22:
1715-1719.
173. Esteller M, Garcia-Foncillas J, Andion E, Goodman SN, Hidalgo OF, et al. (2000)
Inactivation of the DNA-repair gene MGMT and the clinical response of gliomas to
alkylating agents. The New England journal of medicine 343: 1350-1354.
174. Hegi ME, Diserens AC, Gorlia T, Hamou MF, de Tribolet N, et al. (2005) MGMT gene
silencing and benefit from temozolomide in glioblastoma. The New England journal of
medicine 352: 997-1003.
175. Martinez R, Setien F, Voelter C, Casado S, Quesada MP, et al. (2007) CpG island promoter
hypermethylation of the pro-apoptotic gene caspase-8 is a common hallmark of relapsed
glioblastoma multiforme. Carcinogenesis 28: 1264-1268.
104
176. Jacks T, Remington L, Williams BO, Schmitt EM, Halachmi S, et al. (1994) Tumor
spectrum analysis in p53-mutant mice. Curr Biol 4: 1-7.
177. Wang Y, Yang J, Zheng H, Tomasek GJ, Zhang P, et al. (2009) Expression of mutant p53
proteins implicates a lineage relationship between neural stem cells and malignant
astrocytic glioma in a murine model. Cancer Cell 15: 514-526.
178. Nolan PM, Hugill A, Cox RD (2002) ENU mutagenesis in the mouse: application to human
genetic disease. Briefings in functional genomics & proteomics 1: 278-289.
179. Oda H, Zhang S, Tsurutani N, Shimizu S, Nakatsuru Y, et al. (1997) Loss of p53 is an early
event in induction of brain tumors in mice by transplacental carcinogen exposure. Cancer
Res 57: 646-650.
180. Ward RJ, Dirks PB (2010) Unpublished.
181. Pollard SM, Yoshikawa K, Clarke ID, Danovi D, Stricker S, et al. (2009) Glioma stem cell
lines expanded in adherent culture have tumor-specific phenotypes and are suitable for
chemical and genetic screens. Cell Stem Cell 4: 568-580.
182. Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, et al. (2004) Identification of human
brain tumour initiating cells. Nature 432: 396-401.
183. Ignatova TN, Kukekov VG, Laywell ED, Suslov ON, Vrionis FD, et al. (2002) Human
cortical glial tumors contain neural stem-like cells expressing astroglial and neuronal
markers in vitro. Glia 39: 193-206.
184. Hemmati HD, Nakano I, Lazareff JA, Masterman-Smith M, Geschwind DH, et al. (2003)
Cancerous stem cells can arise from pediatric brain tumors. Proc Natl Acad Sci U S A
100: 15178-15183.
185. Galli R, Binda E, Orfanelli U, Cipelletti B, Gritti A, et al. (2004) Isolation and
characterization of tumorigenic, stem-like neural precursors from human glioblastoma.
Cancer Res 64: 7011-7021.
186. Read TA, Fogarty MP, Markant SL, McLendon RE, Wei Z, et al. (2009) Identification of
CD15 as a marker for tumor-propagating cells in a mouse model of medulloblastoma.
Cancer Cell 15: 135-147.
187. Ward RJ, Lee L, Graham K, Satkunendran T, Yoshikawa K, et al. (2009) Multipotent
CD15+ cancer stem cells in patched-1-deficient mouse medulloblastoma. Cancer Res 69:
4682-4690.
188. Son MJ, Woolard K, Nam DH, Lee J, Fine HA (2009) SSEA-1 is an enrichment marker for
tumor-initiating cells in human glioblastoma. Cell Stem Cell 4: 440-452.
189. Clement V, Marino D, Cudalbu C, Hamou MF, Mlynarik V, et al. (2010) Marker-
independent identification of glioma-initiating cells. Nat Methods 7: 224-228.
105
190. Piccirillo SG, Reynolds BA, Zanetti N, Lamorte G, Binda E, et al. (2006) Bone
morphogenetic proteins inhibit the tumorigenic potential of human brain tumour-
initiating cells. Nature 444: 761-765.
191. Fan X, Khaki L, Zhu TS, Soules ME, Talsma CE, et al. (2010) NOTCH pathway blockade
depletes CD133-positive glioblastoma cells and inhibits growth of tumor neurospheres
and xenografts. Stem Cells 28: 5-16.
192. Hotta A, Cheung AY, Farra N, Vijayaragavan K, Seguin CA, et al. (2009) Isolation of
human iPS cells using EOS lentiviral vectors to select for pluripotency. Nature methods
6: 370-376.
193. Cox WG, Singer VL (1999) A high-resolution, fluorescence-based method for localization
of endogenous alkaline phosphatase activity. The journal of histochemistry and
cytochemistry : official journal of the Histochemistry Society 47: 1443-1456.
194. Hotta A, Cheung AY, Farra N, Garcha K, Chang WY, et al. (2009) EOS lentiviral vector
selection system for human induced pluripotent stem cells. Nature protocols 4: 1828-
1844.
195. Silva J, Barrandon O, Nichols J, Kawaguchi J, Theunissen TW, et al. (2008) Promotion of
reprogramming to ground state pluripotency by signal inhibition. PLoS biology 6: e253.
196. Ying QL, Stavridis M, Griffiths D, Li M, Smith A (2003) Conversion of embryonic stem
cells into neuroectodermal precursors in adherent monoculture. Nature biotechnology 21:
183-186.
197. Ying QL, Smith AG (2003) Defined conditions for neural commitment and differentiation.
Methods in enzymology 365: 327-341.
198. Hotta A, Ellis J (2008) Retroviral vector silencing during iPS cell induction: an epigenetic
beacon that signals distinct pluripotent states. Journal of cellular biochemistry 105: 940-
948.
199. Ron-Bigger S, Bar-Nur O, Isaac S, Bocker M, Lyko F, et al. (2010) Aberrant epigenetic
silencing of tumor suppressor genes is reversed by direct reprogramming. Stem cells 28:
1349-1354.
200. Fehling HJ, Lacaud G, Kubo A, Kennedy M, Robertson S, et al. (2003) Tracking mesoderm
induction and its specification to the hemangioblast during embryonic stem cell
differentiation. Development 130: 4217-4227.
201. Smith KN, Singh AM, Dalton S (2010) Myc represses primitive endoderm differentiation in
pluripotent stem cells. Cell stem cell 7: 343-354.
202. Muller FJ, Goldmann J, Loser P, Loring JF (2010) A call to standardize teratoma assays
used to define human pluripotent cell lines. Cell stem cell 6: 412-414.
106
203. Muller FJ, Schuldt BM, Williams R, Mason D, Altun G, et al. (2011) A bioinformatic assay
for pluripotency in human cells. Nature methods 8: 315-317.
204. Moon JH, Heo JS, Kim JS, Jun EK, Lee JH, et al. (2011) Reprogramming fibroblasts into
induced pluripotent stem cells with Bmi1. Cell research.
205. Wong DJ, Liu H, Ridky TW, Cassarino D, Segal E, et al. (2008) Module map of stem cell
genes guides creation of epithelial cancer stem cells. Cell stem cell 2: 333-344.
206. Heddleston JM, Li Z, McLendon RE, Hjelmeland AB, Rich JN (2009) The hypoxic
microenvironment maintains glioblastoma stem cells and promotes reprogramming
towards a cancer stem cell phenotype. Cell cycle 8: 3274-3284.
207. Du Z, Jia D, Liu S, Wang F, Li G, et al. (2009) Oct4 is expressed in human gliomas and
promotes colony formation in glioma cells. Glia 57: 724-733.
208. Zbinden M, Duquet A, Lorente-Trigos A, Ngwabyt SN, Borges I, et al. (2010) NANOG
regulates glioma stem cells and is essential in vivo acting in a cross-functional network
with GLI1 and p53. The EMBO journal 29: 2659-2674.
209. Gallo M, Dirks PB (2011) Unpublished.
210. Mathieu J, Zhang Z, Zhou W, Wang AJ, Heddleston JM, et al. (2011) HIF Induces Human
Embryonic Stem Cell Markers in Cancer Cells. Cancer research 71: 4640-4652.
211. Zhao S, Yuan Q, Hao H, Guo Y, Liu S, et al. (2011) Expression of OCT4 pseudogenes in
human tumours: lessons from glioma and breast carcinoma. The Journal of pathology
223: 672-682.
212. Suo G, Han J, Wang X, Zhang J, Zhao Y, et al. (2005) Oct4 pseudogenes are transcribed in
cancers. Biochemical and biophysical research communications 337: 1047-1051.
213. Cauffman G, Liebaers I, Van Steirteghem A, Van de Velde H (2006) POU5F1 isoforms
show different expression patterns in human embryonic stem cells and preimplantation
embryos. Stem cells 24: 2685-2691.
214. Atlasi Y, Mowla SJ, Ziaee SA, Gokhale PJ, Andrews PW (2008) OCT4 spliced variants are
differentially expressed in human pluripotent and nonpluripotent cells. Stem cells 26:
3068-3074.
215. Liedtke S, Stephan M, Kogler G (2008) Oct4 expression revisited: potential pitfalls for data
misinterpretation in stem cell research. Biological chemistry 389: 845-850.
216. Monk M, Holding C (2001) Human embryonic genes re-expressed in cancer cells.
Oncogene 20: 8085-8091.
217. Booth HA, Holland PW (2004) Eleven daughters of NANOG. Genomics 84: 229-238.