relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de...

26

Transcript of relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de...

Page 1: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 2: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 3: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 4: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 5: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 6: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 7: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 8: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 9: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 10: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 11: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 12: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 13: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 14: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 15: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 16: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 17: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 18: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 19: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 20: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 21: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 22: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 23: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 24: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 25: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction
Page 26: relais-audiovisuel.comrelais-audiovisuel.com/genopole/Dogru.pdf · Moving the "Centre de Biotechnologie Huningue" to a multiple products facility Symposium Genopole Bioproduction

CARREFOUR OUEST-genopole® 27 janvier 2004 Université Rennes 1 LE VOLET FORMATION DE OUEST-genopole®

CARREFOUR OUEST-genopole® 27 janvier 2004 Université Rennes 1 LE VOLET FORMATION DE OUEST-genopole®

IGEM and The Registry Synthetic Biology Genopole Randy Rettberg, Dec. 16, 2010.

IGEM and The Registry Synthetic Biology Genopole Randy Rettberg, Dec. 16, 2010.

The Elite Provider Vigene Bioproduction Cell & Gene · PDF fileVigene Bioproduction ... Lentivirus GMP Production Batch Size- up to 5E12 IFU ... (TFF/ultracentrifugation) - In-house

The Elite Provider Vigene Bioproduction Cell & Gene · PDF fileVigene Bioproduction ... Lentivirus GMP Production Batch Size- up to 5E12 IFU ... (TFF/ultracentrifugation) - In-house

Bioproduction of bioactive compounds screening of bioproduction conditions of free living microalgae and lichen symbionts

Bioproduction of bioactive compounds screening of bioproduction conditions of free living microalgae and lichen symbionts

Integrating Continuous and Batch Operations for Efficient ...fplreflib.findlay.co.uk/.../bioproduction/Joseph-McLaughlin-Pfizer.pdf · Efficient Initial Clinical Manufacturing of

Integrating Continuous and Batch Operations for Efficient ...fplreflib.findlay.co.uk/.../bioproduction/Joseph-McLaughlin-Pfizer.pdf · Efficient Initial Clinical Manufacturing of

Cytoscape An open-source software platform for the ...videos.rennes.inria.fr/genopole/bioInfo2007/schwikowski/07... · Benno Schwikowski Cytoscape An open-source software platform

Cytoscape An open-source software platform for the ...videos.rennes.inria.fr/genopole/bioInfo2007/schwikowski/07... · Benno Schwikowski Cytoscape An open-source software platform

New Signaling pathways and cell cycle: modeling control mechanismsvideos.rennes.inria.fr/genopole/bioInfo2008/Nolwen_Le... · 2009. 1. 8. · TGF‐β signaling pathway • Extracellular

New Signaling pathways and cell cycle: modeling control mechanismsvideos.rennes.inria.fr/genopole/bioInfo2008/Nolwen_Le... · 2009. 1. 8. · TGF‐β signaling pathway • Extracellular

Genopole enterprises · 2014-09-30 · Genopole® enterprises Séquençage complet d’Arabidopsis thaliana \ Mise en place du programme d’épigénomique \ Séquençage du génome

Genopole enterprises · 2014-09-30 · Genopole® enterprises Séquençage complet d’Arabidopsis thaliana \ Mise en place du programme d’épigénomique \ Séquençage du génome

Holistic bioengineering: rewiring central metabolism for ... · Review Article Holistic bioengineering: rewiring central metabolism for enhanced bioproduction Selçuk Aslan1, Elad

Holistic bioengineering: rewiring central metabolism for ... · Review Article Holistic bioengineering: rewiring central metabolism for enhanced bioproduction Selçuk Aslan1, Elad

From genes to ecosystems, From the laboratory into the community, From the West towards Europe… Presentation of OUEST-genopole ® December 2008.

From genes to ecosystems, From the laboratory into the community, From the West towards Europe… Presentation of OUEST-genopole ® December 2008.

Analysis of biological sequences using Markov Chains and Hidden Markov Models Bernard PRUM, La genopole – Evry – France prum@genopole.cnrs.fr Colloque.

Analysis of biological sequences using Markov Chains and Hidden Markov Models Bernard PRUM, La genopole – Evry – France [email protected] Colloque.

Pfenex : A Fermentation Platform based on Pseudomonas ...fplreflib.findlay.co.uk/images/pdf/bioproduction/Deisy-Corredor-Pfenex.pdf · Fermentation Development Multiple strains each

Pfenex : A Fermentation Platform based on Pseudomonas ...fplreflib.findlay.co.uk/images/pdf/bioproduction/Deisy-Corredor-Pfenex.pdf · Fermentation Development Multiple strains each

Bioprocessing films - Thermo Fisher Scientifictools.thermofisher.com/content/sfs/brochures/FlyerSUTFilmIntegrati… · Bioprocessing films Films for all your bioproduction needs Thermo

Bioprocessing films - Thermo Fisher Scientifictools.thermofisher.com/content/sfs/brochures/FlyerSUTFilmIntegrati… · Bioprocessing films Films for all your bioproduction needs Thermo

Genopole Gp Gb Bymassai

Genopole Gp Gb Bymassai

Synthetic Biology present & future a view from Genopole François Képès & Françoise ...ec.europa.eu/health/sites/health/files/dialogue... · 2016. 11. 25. · Scientific Director:

Synthetic Biology present & future a view from Genopole François Képès & Françoise ...ec.europa.eu/health/sites/health/files/dialogue... · 2016. 11. 25. · Scientific Director:

Eingeladene Vorträge und Seminare - ruhr-uni-bochum.de...genomics”, Epigenomics project, Genopole and Envry University, Envry. 19.04.2007 Systems Chemistry: The physical organic

Eingeladene Vorträge und Seminare - ruhr-uni-bochum.de...genomics”, Epigenomics project, Genopole and Envry University, Envry. 19.04.2007 Systems Chemistry: The physical organic

05 AntonyLeBechec newvideos.rennes.inria.fr/genopole/bioInfo2007/lebechec/05_AntonyLeBechec.pdf2 tggcaactgctgcatgactgctagctgatcgagtacaaactgctgcatgactgctagca101111010001110001010001100110010111011101001110100011100010100011001100101110110110011

05 AntonyLeBechec newvideos.rennes.inria.fr/genopole/bioInfo2007/lebechec/05_AntonyLeBechec.pdf2 tggcaactgctgcatgactgctagctgatcgagtacaaactgctgcatgactgctagca101111010001110001010001100110010111011101001110100011100010100011001100101110110110011

Bioproduction/ Separation

Bioproduction/ Separation

IP, Licensing, & Open Source in Synthetic Biology: Perspectives …relais-audiovisuel.com/genopole/Gregory_Schreiber.pdf · • Prevent others from filing patents and blocking you

IP, Licensing, & Open Source in Synthetic Biology: Perspectives …relais-audiovisuel.com/genopole/Gregory_Schreiber.pdf · • Prevent others from filing patents and blocking you

Bioproduction and Evaluation of Renewable Butyl Acetate as ...

Bioproduction and Evaluation of Renewable Butyl Acetate as ...