2641Research Article

IntroductionThe vertebrate inner ear is a sensory organ important forbalance and hearing (Tilney et al., 1992). It develops from athickening in the embryonic ectoderm adjacent to the neuralplate called the otic placode (Barald and Kelley, 2004; Rileyand Phillips, 2003; Schlosser, 2006; Torres and Giraldez,1998). The inner ear is a unique sensory structure in that nearlyall cells derive from the otic placode itself, with the exceptionof neural crest-derived pigment cells and the secretoryepithelium of the cochlea (Noden and Van de Water, 1992;Torres and Giraldez, 1998). Once the placode has beeninduced, the thickened placodal ectoderm then undergoesmorphogenetic movements to invaginate and form the oticvesicle, which will give rise to the inner ear and neuronalprecursors. Neuroblasts differentiate within the ventromedialotic ectoderm, delaminate, and migrate to form thevestibulocochlear ganglion that innervates the inner ear(Fritzsch, 2003; Fritzsch et al., 2002). Subsequently, some cellswithin the ventromedial region are specified to become haircells of the saccular maculae, the acoustico-vestibular sensoryepithelium of the inner ear that is important for bothequilibrium and hearing (Bever et al., 2003). The apical aspectsof the mechanosensory hair cells develop an actin rich cuticularplate that anchor highly organized bundles of actin filaments,called stereocilia, which are integral to the detection of motionand sound (Tilney et al., 1992).

Multiple regulators of otic induction have recently come to

light, but little is known about the molecular events that controlthe complex morphogenetic processes required for inner eardevelopment and stereocilia formation. To better understandthese processes, we have studied the role of the actin regulatoryprotein Ena/VASP-like (Evl) during the development of theinner ear and its neuronal derivatives. Evl is a member of theEna/VASP family of actin regulatory proteins, which have beenshown to modulate dynamic actin processes including cellularadhesion and migration (Krause et al., 2003). Ena/VASP familymembers, which include Enabled (Ena), vasodilator stimulatedphosphoprotein (VASP) and Evl, share a highly conserveddomain structure including an amino-terminal Ena/VASPhomology 1 (EVH1) domain, followed by a proline-richdomain, and a carboxy-terminal EVH2 domain. The EVH1domain binds proteins containing a F/LPPPP amino acid motifand serves to localize Ena/VASP proteins to various subcellularlocations. The EVH2 domain functions to bind both G-actinand F-actin, allowing for the enrichment of Ena/VASP proteinsat sites of dynamic actin reorganization. The EVH2 domain isalso responsible for multimerization with other Ena/VASPproteins. Knockout studies in mouse have shown thatEna/VASP proteins play important roles in regulating multipleactin-dependent processes during development including axonguidance and neural tube closure (Lanier et al., 1999; Menzieset al., 2004), platelet aggregation (Aszodi et al., 1999;Halbrugge and Walter, 1989) and T cell activation andphagocytosis (Coppolino et al., 2001; Krause et al., 2000). In

The inner ear is derived from a thickening in the embryonicectoderm, called the otic placode. This structure undergoesextensive morphogenetic movements throughout itsdevelopment and gives rise to all components of the innerear. Ena/VASP-like (Evl) is an actin binding proteininvolved in the regulation of cytoskeletal dynamics andorganization. We have examined the role of Evl during themorphogenesis of the Xenopus inner ear. Evl (hereafterreferred to as Xevl) is expressed throughout otic vesicleformation and is enriched in the neuroblasts thatdelaminate to form the vestibulocochlear ganglion and inhair cells that possess mechanosensory stereocilia.Knockdown of Xevl perturbs epithelial morphology andintercellular adhesion in the otic vesicle and disruptsformation of the vestibulocochlear ganglion, evidenced byreduction of ganglion size, disorganization of the ganglion,and defects in neurite outgrowth. Later in embryogenesis,

Xevl is required for development of mechanosensory haircells. In Xevl knockdown embryos, hair cells of theventromedial sensory epithelium display multipleabnormalities including disruption of the cuticular plate atthe base of stereocilia and disorganization of the normalstaircase appearance of stereocilia. Based on these data, wepropose that Xevl plays an integral role in regulatingmorphogenesis of the inner ear epithelium and thesubsequent development of the vestibulocochlear ganglionand mechanosensory hair cells.

Supplementary material available online athttp://jcs.biologists.org/cgi/content/full/120/15/2641/DC1

Key words: Otic vesicle, Morphogenesis, Inner ear, Stereocilia,Mechanosensory hair cell, Vestibulocochlear ganglion

Summary

Regulation of otic vesicle and hair cell stereociliamorphogenesis by Ena/VASP-like (Evl) in XenopusSarah J. Wanner and Jeffrey R. Miller*Department of Genetics, Cell Biology and Development and Developmental Biology Center, University of Minnesota, Minneapolis, MN 55455, USA*Author for correspondence (e-mail: mille380@umn.edu)

Accepted 23 May 2007Journal of Cell Science 120, 2641-2651 Published by The Company of Biologists 2007doi:10.1242/jcs.004556

Jour

nal o

f Cel

l Sci

ence

2642

addition, recent work shows that Ena/VASP proteins regulateintegrin-based cell adhesion and motility during somitogenesisin Xenopus (Kragtorp and Miller, 2006). In vitro studies haveshown these proteins regulate actin dynamics and migration infibroblasts by controlling the amount and persistence of actinfilament polymerization (Bear et al., 2001; Bear et al., 2002).Together, these studies point to an important role for Ena/VASPproteins in the regulation of morphogenetic processesdependent upon dynamic actin reorganization and celladhesion.

Previously, we have shown that Xenopus Evl (hereafterreferred to as Xevl) is expressed strongly in the otic placodeand vesicle throughout early otic development (Wanner et al.,2005). The known role of this protein in regulating actindynamics and cell adhesion coupled with its expression in theotic tissues suggest that Xevl might play an important role inthe formation of the otic vesicle and inner ear components. Tobetter understand the role of Xevl in inner ear morphogenesis,we have more precisely defined Xevl expression within the oticvesicle and have determined the requirement for Xevl functionduring otic development. We show that Xevl is expressedthroughout the otic placode and is later enriched at theventromedial region of the otic vesicle that gives rise toneuroblasts of the vestibulocochlear ganglion and themechanosensory hair cells. Xevl protein is enriched at apicalcell-cell junctions in the otic vesicle epithelium, indelaminating neuroblasts and neurons of the vestibulocochlearganglion, and at the cuticular plate of mechanosensory haircells underlying the actin-rich stereocilia. Using a morpholinoto knockdown Xevl protein production we provide evidencethat Xevl is required for multiple facets of inner earmorphogenesis including establishment of epithelialmorphology and cell-cell adhesion in the otic vesicle. Inaddition, Xevl is necessary for development of thevestibulocochlear ganglion and proper stereocilia formation inmechanosensory hair cells. Together, these data establish animportant role for Xevl in the morphogenetic mechanisms thatregulate vertebrate inner ear development.

ResultsXevl expression in the developing inner earTo analyze the precise expression of Xevl throughout oticdevelopment we performed in situ hybridization analyses onsections of embryos at various stages. Xevl transcripts are firstobserved after neurulation (stage 20) throughout the thickenedectoderm of the otic placode (Wanner et al., 2005). As the oticplacode undergoes invagination, Xevl is expressed throughoutthe placode with the strongest expression in the ventromedialregion (Fig. 1B). Between stages 25 and 30, cells in theventromedial region of the otic vesicle undergo a change froman epithelial fate to a neuroblast fate, delaminate from the oticepithelium, and migrate to form the vestibulocochlear ganglion(Fig. 1A, vg), located between the otic vesicle and the neuraltube. At these stages, Xevl is expressed most intensely in theregion of delaminating neuroblasts (arrow in Fig. 1C). By stage35, Xevl continues to be expressed in the ventromedial regionof the otic vesicle from which mechanosensory hair cells willform (arrowhead in Fig. 1D). Also at this stage, robust Xevlexpression is found in the neuroblasts of the vestibulocochlearganglion (arrow in Fig. 1D). By stage 42, stereocilia are largelyformed and the vestibulocochlear ganglion is well defined with

neurites exiting the ganglion to innervate the otic vesicle(Fritzsch, 2003; Fritzsch et al., 2002). At this stage, Xevltranscripts are present at low levels in the vestibulocochlearganglion and are enriched in cells of the ventromedial sensoryepithelium (arrowhead in Fig. 1E). These data show that Xevlis expressed within regions of the otic vesicle associated withinvagination of the placode, delamination of neuroblasts andformation of stereocilia. This expression pattern suggests thatXevl may play an important role in the regulation of themorphogenetic processes controlling the formation anddevelopment of multiple components of the inner ear.

Xevl depletion causes defects in otic vesicle morphologyTo address Xevl function in otic development we utilized amorpholino antisense oligonucleotide strategy to blocksynthesis of Xevl protein (Heasman et al., 2000). A translation-blocking antisense morpholino (XevlMO) was designedagainst the 5�UTR of Xevl upstream of the translational startsite. To verify inhibition of Xevl protein translation by theXevlMO, we generated an affinity-purified peptide antibodythat recognizes all three Xevl isoforms by western blot analysis(Fig. 2A). Injection of XevlMO caused a marked reduction inproduction of all Xevl isoforms compared with controlmorpholino injected (coMO) embryos (Fig. 2A). Levels of �-tubulin were unaffected by injection of the XevlMO (Fig. 2A).In addition, injection of two additional non-specificmorpholinos did not have an affect on Xevl levels (data notshown). Together, these data demonstrate that injection ofXevlMO specifically depletes Xevl protein duringdevelopment.

The effect of Xevl depletion on otic development was firstexamined by in situ hybridization analysis using thepanplacodal marker XEya1 (also known as eya1) (David et al.,

Journal of Cell Science 120 (15)

Fig. 1. Distribution of Xevl transcripts in the Xenopus inner ear.(A) Diagram of the otic region. (B-E) In situ hybridizations ontransverse sections through the otic region. The neural tube is at thetop of the panels, the otic vesicle is located ventrolateral to the neuraltube, and the vestibulocochlear ganglion resides between the oticvesicle and the neural tube. Nieuwkoop and Faber stages areindicated in the upper right corners. (B) Xevl is enriched in theventromedial region of the otic vesicle at stage 25. (C) At stage 30,Xevl continues to be enriched in the ventromedial region of the oticvesicle as well as in cells delaminating from this region (arrow).(D) At stage 35, Xevl expression is found in the ventromedial regionof the otic vesicle that will give rise to the sensory epithelium of thesaccular maculae (arrowhead) as well as in the vestibulocochlearganglion (arrow). (E) At stage 45, Xevl is enriched at the presumptivesensory epithelium (arrowhead) and is weakly expressed in thevestibulocochlear ganglion (arrow). ov, otic vesicle; vg,vestibulocochlear ganglion. Bar, 100 �m.

Jour

nal o

f Cel

l Sci

ence

2643Regulation of inner ear development by Xenopus Evl

2001). For these studies, XevlMO was injected unilaterally atthe 4-cell stage in a region fated to contribute to the otic vesicle.Co-injection of XevlMO with GFP mRNA was performed toassure specific targeting to the head region (data not shown).The uninjected contralateral side served as a control (Fig. 2D).This analysis revealed that expression of XEya1 was unaffectedby Xevl depletion at stage 20 indicating that Xevl is notrequired for induction of the otic placode. Analysis of XEya1expression at stage 35 revealed that 86% of embryos injectedwith XevlMO (n=121) showed an overall reduction in the sizeof the otic vesicle, measured by a decrease in the area of XEya1staining (Fig. 2B,E). The observed phenotype varied betweenembryos, with 72% displaying a strong phenotype (defined asthe otic vesicle being less than half the size of the contralateralcontrol), another 14% displaying a mild phenotype (the oticvesicle being misshapen and noticeably smaller than thecontralateral control), and 14% appeared normal (Fig. 2B).Although we performed our injections to optimize targeting ofthe morpholino to the otic vesicle, the morpholino may not bedistributed equally among all cells and this mosaicism likelyaccounts for the variability of the observed phenotypes. Rescueexperiments were performed to confirm the specificity of theXevl knockdown phenotype. Embryos were injected at the 4-

cell stage with the XevlMO, followed, at the 8-cell stage, byinjection of Xevl-GFP mRNA lacking the 5�UTR recognizedby the XevlMO (Fig. 2B,G). The uninjected contralateral sideserved as a control (Fig. 2F). These experiments showed thatexpression of Xevl-GFP resulted in a significant rescue of thephenotype (Fig. 2B,G; n=77). Expression of Xevl-GFPincreased the number of embryos with normal otic vesiclesfrom 14% to 43% with another 21% of embryos exhibiting amild phenotype. The incidence of embryos showing a strongphenotype decreased from 72% to 36%. The lack of a completerescue of the XevlMO-induced phenotype may result from thefact that the XevlMO was injected at the 4-cell stage whereasthe Xevl-GFP mRNA was injected at the 8-cell stage. Thisinjection method was used to avoid potential non-specificbinding of the XevlMO to the Xevl-GFP mRNA prior toinjection. The injection of Xevl-GFP mRNA at a later stage,however, may result in a more limited distribution of Xevl-GFPprotein relative to the XevlMO. Analysis of Xevl-GFPdistribution shows that the exogenous protein is expressed in amosaic pattern in the otic vesicle (Fig. S1 in supplementarymaterial). Thus, the potential incomplete overlap of XevlMOand Xevl-GFP distribution provides a likely explanation for theincomplete rescue of the morpholino-induced phenotype inthese studies. mRNA constructs for the other Xevl isoforms(Xevl-I and Xevl-H) (Wanner et al., 2005) were also tested andboth showed rescue capability similar to that of Xevl (data notshown). These results demonstrate the specificity of the Xevlknockdown strategy and suggest that whereas Xevl does notplay a role in otic placode induction, it is an important regulatorof otic development.

To better define the mechanism by which Xevl regulates oticdevelopment, we first analyzed how Xevl depletion leads to areduction in otic vesicle size. To test whether Xevl depletionaffects cell number in the otic vesicle, cell counts wereobtained from cross sections of control and Xevl-depleted oticvesicles stained for �-catenin to outline cell boundaries. Thesestudies showed that otic vesicles of control embryos contain77±3.16 cells (n=5) around their circumference. Xevl-depletedembryos displaying a mild phenotype possessed 74.8±4.6 cells(n=5; P=0.41, Student’s t-test) and embryos displaying astrong phenotype possessed 46±5.8 cells (n=7; P<0.0001,Student’s t-test) around their circumference. The reduction incell number was not the result of increased cell death, since thenumber of apoptotic cells observed by TUNEL in both controland Xevl-depleted and control embryos were similarthroughout otic vesicle development (Table S1 insupplementary material) and correlated well with apoptoticlevels previously reported in the Xenopus otic vesicle (Beverand Fekete, 1999; Leon et al., 2004).

Xevl is required for epithelial morphology and celladhesion in the otic vesicleIn our initial analysis of cell number, we observed that oticvesicles from Xevl-depleted embryos appeared misshapen andmany cells failed to adopt a columnar morphology suggestingthat Xevl may function to regulate cell shape and adhesionduring otic vesicle formation. To analyze whether Xevl playsa role in the formation and maintenance of the columnarepithelium of the otic vesicle, we analyzed the presence andpersistence of cell adhesion markers �-catenin, vinculin andoccludin in control and Xevl-depleted embryos. �-catenin

Fig. 2. Xevl knockdown disrupts otic vesicle development.(A) Western blot analysis using a Xevl polyclonal antibody shows amarked reduction in Xevl protein production in embryos injectedwith XevlMO compared with embryos injected with control MO(coMO). Levels of �-tubulin are unaffected by injection of theXevlMO. Numbers on right indicate molecular mass markers (kDa).(B) Quantitative analysis of Xevl knockdown and rescue experimentsindicating the percentage of embryos displaying perturbed oticvesicle development. (C-G) Head region of Xenopus embryos atstage 35 (C) Diagram showing the olfactory placode (ol), lensplacode (lens), otic vesicle (ov), epibranchial placodes (epi), andlateral line placodes (unlabeled). (D) XEya1 expression on theuninjected side of the embryo. (E) XEya1 expression on theXevlMO-injected side of the embryo. Otic vesicle size is reduced in86% of Xevl-depleted embryos (n=121) with 72% exhibiting astrong reduction in size and 14% displaying a mild reduction. Oticvesicle size was unaffected in 14% of injected embryos. (F) XEya1expression on the uninjected side of a rescued embryo. (G) XEya1expression on the side of the embryo injected with Xevl-GFP mRNAand XevlMO. Expression of Xevl-GFP results in rescue of XEya1expression with 43% displaying normal otic vesicles, 21% exhibitinga mild phenotype and 36% exhibiting a strong phenotype (n=77).Arrow marks the otic vesicle in D-G.

Jour

nal o

f Cel

l Sci

ence

2644

localizes to adherens junctions (Scott and Yap, 2006), vinculinis found in both adherens junctions and focal adhesions(Ziegler et al., 2006), and occludin is a major component oftight junctions (Furuse et al., 1993). In control embryos, �-catenin outlines the cells of the otic vesicle and is enrichedapically at adherens junctions (Fig. 3A,A�). Similarly, vinculin(Fig. 3B,B�) and occludin (Fig. 3C,C�) are also enrichedapically in control embryos. In Xevl-depleted embryos, cellshape was perturbed such that cells of the otic epithelium failto establish a columnar morphology (Fig. 3D-F). Along withperturbation of cell shape, Xevl depletion correlated withdecreased levels of �-catenin at adherens junctions in 69% ofinjected embryos (Fig. 3D,D�; n=29). Likewise, Xevl depletionreduced the levels vinculin (Fig. 3E,E�) and occludin (Fig.3F,F�) at adherens junctions and tight junctions, respectively.These phenotypes can be rescued by injection of Xevl mRNA(data not shown), indicating that the loss of epithelial integrityis specific to knockdown of Xevl in the otic vesicle.

The observed defects in cell morphology and localization ofjunctional proteins suggest that Xevl may play a role inregulating cell adhesion during otic vesicle morphogenesis. Totest this idea we examined the localization of Xevl protein uponformation of the otic vesicle at stage 35. We found that Xevllocalizes to sites of cell-cell contact (Fig. 4A) and is enrichedapically in the otic vesicle epithelium (arrow in Fig. 4A).

Additionally, Xevl staining is enhanced in the ventromedialregion of the otic epithelium where mechanosensory hair cellslater form (arrowhead in Fig. 4A). Since Xevl localizes tocellular adhesions and Ena/VASP proteins have been shown tobe important factors in cellular adhesion (Krause et al., 2003),we performed an aggregation assay to directly examinewhether Xevl regulates cell-cell adhesion in the oticepithelium. We found that dissociated otic vesicles fromuninjected embryos were able to form large aggregates,demonstrating their ability to form strong intercellularadhesions (Fig. 4B). By contrast, cells from Xevl-depleted oticvesicles formed small loosely adherent aggregates (Fig. 4C).Together, these data indicate that Xevl is required forestablishment of epithelial morphology and cellular adhesionin the otic vesicle.

Xevl is required for vestibulocochlear ganglion formationIn situ hybridization also detected strong Xevl expression inneuronal precursors, the vestibulocochlear ganglion andmechanosensory hair cells, suggesting that Xevl may play arole in controlling the development of these components of theinner ear later in development. To identify potential roles forXevl in later developmental events, we analyzed therequirement for Xevl in development of the vestibulocochlearganglion and mechanosensory hair cells. In these experiments,we limited our analyses to embryos displaying mild defects inoverall otic vesicle size and shape in order to better discerndirect, versus indirect, affects of Xevl depletion on late oticdevelopment.

First, we analyzed in detail the distribution of Xevl proteinin the otic vesicle during development of the vestibulocochlearganglion and mechanosensory epithelium. We found that Xevlprotein is strongly expressed in the vestibulocochlear ganglionand is enriched at the apical aspect of cells in the otic vesiclesensory epithelium (Fig. 5A, red in C). These sensory regionsof the developing inner ear were colabeled with islet-1, atranscription factor that is one of the earliest markers of innerear neural progenitors and sensory neurons (Fig. 5B, green inC). Xevl is also found in the cell bodies and projections ofsensory neurons of the vestibulocochlear ganglion that

Journal of Cell Science 120 (15)

Fig. 3. Xevl regulates epithelial morphology in the otic vesicle.Confocal images of whole-mount preparations showing (A,A�) �-catenin, (B,B�) vinculin, and (C,C�) occludin immunostaining in theotic vesicle. Uninjected otic vesicles at stage 35 comprise a hollowsphere of columnar epithelial cells. (A-C) The otic epitheliumexhibits apical-basal polarity with enhanced �-catenin, vinculin andoccludin localization at apical junctions (arrows). (D-F) Xevldepletion results in a smaller otic vesicle, disruption of columnarmorphology, and loss of apical localization of (D,D�) �-catenin,(E,E�) vinculin and (F,F�) occludin. Arrows in A-F mark regionsshown at higher magnification in A�-F�. Bars, 50 �m.

Fig. 4. Xevl is required for cellular adhesion. (A) Confocal image ofa whole-mount embryo at stage 35, showing Xevl immunostaining inthe otic vesicle; a higher magnification image shown in A�. Xevl isenriched apically throughout the otic vesicle epithelium (arrow) andat cellular adhesions. Xevl is also highly expressed in theventromedial sensory epithelium where mechanosensory hair cellsform (arrowhead). (B) Dissociated otic vesicles from uninjectedstage 35 embryos form large aggregates. (C) By contrast, otic vesiclecells from XevlMO-injected embryos form smaller and more looselyadherent aggregates. Insets in B and C show higher magnification ofthe aggregates indicated by dashed boxes. Bars, 50 �m.

Jour

nal o

f Cel

l Sci

ence

2645Regulation of inner ear development by Xenopus Evl

innervate the otic vesicle and hindbrain (Fig. 5D, red in F). Thelocalization of Xevl in neurons was confirmed bycolocalization of Xevl with neurofilament (Fig. 5E, green inF), a component of the neural cytoskeleton and a marker forall neurons (Al-Chalabi and Miller, 2003). The localization of

Xevl to cells of the vestibulocochlear ganglion and otic vesiclesensory epithelium are consistent with a role for Xevl inregulating the formation of sensory structures of the inner earand neural innervation of the otic vesicle.

Neuroblasts are first observed in the otic epithelium duringinvagination and later delaminate and migrate medially anddorsally to form the vestibulocochlear ganglion (Liu et al.,2000; Van de Water, 1988). To determine whether neuroblastdifferentiation or migration is affected by loss of Xevl, weexamined expression of XNeuroD (also known as neuroD), afactor that controls neuronal differentiation and survival in theinner ear (Kim et al., 2001; Lee et al., 1995; Liu et al., 2000).XNeuroD is expressed in the vestibulocochlear ganglion and inthe neuronal precursors in the region of the developingventromedial sensory epithelium of the otic vesicle at stage 25.Neither XNeuroD expression in the otic vesicle epithelium nordelamination of differentiated neuronal precursors was affectedby Xevl depletion since the number of XNeuroD-positive cellsfound in the otic vesicle epithelium in both control and Xevl-depleted embryos were similar during these stages (Table 1).However, compared with control embryos (Fig. 6A), thevestibulocochlear ganglion in Xevl-depleted embryos issmaller and expression of XNeuroD in the ganglion is markedlyreduced (Fig. 6B). TUNEL experiments indicate that the

Fig. 5. Xevl localizes to sensory structures of the inner ear. Confocalimaging of frozen sections of stage 35 embryos. Dorsal is up and theotic vesicle is to the right in all images. (A) Xevl is present in thevestibulocochlear ganglion (arrow) as well as in cells within the oticvesicle sensory epithelium (arrowhead). (B) Islet-1 localization in thevestibulocochlear ganglion (arrow) and within the otic vesiclesensory epithelium (bracket). (C) The merged image reveals Xevl(red) is more strongly expressed in the cells that also have strongislet-1 staining (green). DAPI staining is in blue. (D-F) Xevl (D, redin F) colocalizes with neural neurofilament (nf; E, green in F) inneurons of the vestibulocochlear ganglion and the neurites thatextend to innervate the otic vesicle epithelium (arrowhead in F) andthe hindbrain (arrow in F). Bar, 20 �m.

Table 1. NeuroD-positive cells during neuroblastdelamination

Stage Control XevlMO n P value

28 1.5±1.5 1.5±1.5 2 1.0 30/31 3.3±2.1 2.6±1.7 7 0.9235 7.0±1.7 5.6±1.6 10 0.99

Average number of NeuroD-positive cells (mean ± s.d.) observed during(stage 28-31) and after (stage 35) neuroblast delamination from the oticvesicle epithelium are similar between controls and Xevl-depleted oticvesicles. n denotes number of embryos analyzed at each stage. P values wereobtained by Student’s t-test.

Fig. 6. Vestibulocochlearganglion size and organization isperturbed by Xevl depletion.Dorsal is up and the otic vesicleis to the right in all images. (A)Expression of XNeuroD in thevestibulocochlear ganglion(arrow) and ventromedial sensoryepithelium (arrowhead) of controlstage 35 embryos. (B) Xevldepletion diminishes the size ofthe vestibulocochlear ganglion(arrow) and reduces the amountof XNeuroD-positive cells in thesensory epithelium and thevestibulocochlear ganglion. TheXevl-depleted otic vesicle alsoexhibits a loss of columnar morphology in the thickened sensory epithelium compared with the control otic vesicle (arrowhead, 100% affected;n=9). (C-H) Confocal images of vibrotome-sectioned embryo at stage 42 showing islet-1 (C,F; red in E,H) and laminin (D,G; green in E,H)immunostaining of the vestibulocochlear ganglion. (F,H) Xevl depletion causes a reduction in the number of islet-1-labeled cells and an overallreduction in the size of the vestibulocochlear ganglion (arrow). (G,H) In addition, the laminin-rich matrix surrounding the vestibulocochlearganglion (arrow) is disrupted in Xevl-depleted embryos. Bar, 20 �m. A longer exposure time was necessary for the Xevl-depleted otic vesicleto show islet-1 in the vestibulocochlear ganglion, making islet-1 levels appear higher in the neural tube and otic vesicle of Xevl-depletedembryos compared with controls.

Jour

nal o

f Cel

l Sci

ence

2646

reduced size of the vestibulocochlear ganglion is not due toincreased cell death of neuronal precursors or cells of thevestibulocochlear ganglion (Table S1 in supplementarymaterial).

Because of the reduced size of the vestibulocochlearganglion, we examined in more detail the effects of Xevldepletion on the development of the vestibulocochlear ganglionand inner ear sensory neurons. Islet-1 is expressed in thedelaminating cells of the otic ectoderm and vestibulocochlearganglion cells (arrow in Fig. 6C, red in E) (Li et al., 2004a).Upon Xevl depletion, the vestibulocochlear ganglion ismarkedly smaller with fewer islet-1-labeled cells and the islet-1-positive cells of the ganglion are more disorganized than incontrols (arrow in Fig. 6F, red in H). Furthermore, we foundthat Xevl depletion also affects the distribution of theextracellular matrix protein laminin. In control embryos,a laminin-rich extracellular matrix surrounds thevestibulocochlear ganglion (arrow in Fig. 6D, green in E). Bycontrast, Xevl depletion resulted in disruption of lamininmatrix deposition around the ganglion (arrow in Fig. 6G, greenin H).

Neurofilament expression was also examined to determinethe effect of Xevl knockdown on the number and distributionof sensory projections innervating the inner ear. In controlembryos, strong neurofilament staining is seen in associationwith sensory projections (Fig. 7A, green in B). Xevl depletionresulted in a reduction in the number of neurites within thevestibulocochlear ganglion and surrounding the otic vesiclenear the ventromedial sensory epithelium (Fig. 7C, green in D).In addition, the remaining projections in Xevl-depletedembryos were shorter than controls. Together theseexperiments reveal a role for Xevl in the formation andorganization of the vestibulocochlear ganglion as well as thesubsequent development of neurites that emanate from theganglion.

Xevl regulates sensory epithelium and stereociliaformationTo analyze the role of Xevl in the development of the sensoryepithelium of the inner ear, we studied the precise localizationof Xevl within the otic vesicle at stages when specializedmechanosensory hair cells and stereocilia have formed. Theseanalyses showed that Xevl is enriched apically within the cellbody (Fig. 8A,C, red in B and D) and at the cuticular platethat lies at the base of the stereocilium (Fig. 8E, red in F).The apical location of Xevl in mechanosensory hair cells isthe same as that of the membrane cytoskeletal proteinspectrin (Fig. 8G, red in H), which is an integral component

Journal of Cell Science 120 (15)

Fig. 7. Neurite outgrowth is reduced in Xevl-depleted otic vesicles.Vibrotome sections of the otic vesicle region of stage-35 embryoswith dorsal oriented up and the otic vesicle to the right in eachimage. (A,B) Uninjected embryos exhibit extensive neurofilament-positive projections into the vestibulocochlear ganglion (arrowhead)and the ventromedial sensory epithelium (arrow) of the otic vesicle.(C,D) Xevl-depleted otic vesicles exhibit shorter and fewer sensoryprojections in both the vestibulocochlear ganglion (arrowhead) andthe sensory epithelium (arrow). Neurofilament is shown in green inB,D. Preparations were co-stained with spectrin (red in B,D) tooutline cell boundaries. Bar, 50 �m.

Fig. 8. Xevl depletion in hair cells disrupts spectrin localization andstereocilia formation. (A-D) Images of frozen sectioned embryoswith dorsal oriented up and the otic vesicle on the right of eachimage. (A) Xevl is present in hair cells of the ventromedial sensoryepithelium and is enriched at the apical aspect of these cells (arrow).(B) Xevl (red) and actin (phalloidin; green) colocalize at the apicalregion of hair cells (arrow) at the base of stereocilia. (C,D) Highermagnification view of Xevl localization in hair cells (arrows)showing the colocalization of Xevl (red) and actin (green) at theapical margin of the hair cells. (E,F) Image of a dissected otic vesicleshowing that Xevl (E, red in F) localizes to the cuticular plate at thebase of each actin-rich stereocilium (green in F). (G) Images offrozen sectioned embryos showing that spectrin is localized to thecuticular plate at the apical region of hair cells (arrow). (H) Spectrin(red) is at the base of each stereocilium and colocalizes with actin(green) at the apical membrane of hair cells in uninjected embryos.(I) In XevlMO-injected embryos, spectrin levels at the cuticular plateare markedly reduced and hair cells lose their columnar shape(arrowhead). (J) Xevl depletion also results in a reduction in actinstaining (green) at the apical portion of hair cells and few stereociliaare present. Spectrin is shown in red in the merged image. Bars, 20�m, except for E and F where bar, 5 �m.

Jour

nal o

f Cel

l Sci

ence

2647Regulation of inner ear development by Xenopus Evl

of the cuticular plate (Drenckhahn et al., 1991; Raphael et al.,1994). Previous studies have demonstrated a directinteraction between Evl and spectrin (Bournier et al., 2006;Rotter et al., 2005) suggesting that Xevl and spectrin mayinteract at these sites. In support of this idea, hair cells inXevlMO-injected embryos show a marked reduction in bothspectrin and actin at the cuticular plate (Fig. 8I,J, Fig. 9C-E).Furthermore, loss of spectrin at the cuticular plate correlatedwith defects in stereocilia (Fig. 8I,J, Fig. 9C-E). Thus, Xevlis enriched at the cuticular plate and its function is requiredfor the proper localization of spectrin and actin to thisstructure.

Actin filaments provide the structural framework forstereocilia and the length of actin filaments in stereocilia istightly regulated, building a staircase-like pattern ofprogressively longer stereocilia (arrows in Fig. 9A). In Xevl-depleted embryos, however, we observed a range ofphenotypes from absence of stereocilia bundles to stereociliathat appeared disorganized, displaying a ‘splayed’ morphology(Fig. 9B). Stereocilia in Xevl-depleted embryos were alsosignificantly shorter than controls and all of them wereapproximately the same length, lacking the normal staircaseappearance. Stereocilia in control embryos are on average6.95±0.73 �m in length (n=18) whereas stereocilia in Xevl-depleted embryos are on average 3.60±0.72 �m in length(n=13; P<0.0001, Student’s t-test). Loss of spectrin at the baseof Xevl-depleted stereocilia correlated with the splayed andlack of staircase appearance of stereocilia (Fig. 9D,E),suggesting that there may be a link between defects in thecuticular plate and stereocilia formation.

To further examine the role of Xevl in regulating actinorganization in stereocilia we examined espin distribution incontrol and Xevl-depleted embryos. Espin is an actin-bundlingprotein that is present in stereocilia bundles where it appearsto play an important role in regulating steady state length ofactin filaments in stereocilia (Bartles et al., 1996; Bartles et al.,1998; Li et al., 2004b; Sekerková et al., 2004; Rzadzinska etal., 2005; Sekerková et al., 2006). In control embryos, strongespin staining is seen in association with stereocilia (Fig. 9F).In Xevl-depleted embryos, espin staining is greatly diminished

within the stereocilia (Fig. 9G,H). Together, these data provideevidence that Xevl is a key factor for the development ofmechanosensory hair cells and formation of stereocilia in theinner ear.

DiscussionCoordination of molecular events that control cell adhesion,migration and polarity are critical for inner ear developmentand stereocilia formation. Our results show that Xevl is a factorthat is integral to multiple aspects of inner ear morphogenesisin Xenopus embryos. Xevl is expressed throughout inner eardevelopment in both ectodermal and neural lineages and atlater stages is enriched in the hair cells of the presumptivesaccular maculae. We have shown that Xevl is critical for theregulation of the morphogenetic events that occur throughoutotic development. In the absence of Xevl, the formation of theotic vesicle is altered, as seen by defects in cellular adhesionand loss of the columnar morphology of the otic epithelium.The vestibulocochlear ganglion is also affected by loss of Xevlfunction, evident in the reduction in ganglion size, overalldisorganization, and decreased neurite outgrowth. The effectsof a Xevl knockdown are also evident later in inner eardevelopment, as the cuticular plate is abnormal and stereociliaare shorter and have a splayed appearance. These findingshighlight the importance of Xevl in development of the oticvesicle, vestibulocochlear ganglion and mechanosensory haircells.

Epithelial integrity of the otic vesicle is regulated by XevlOur analysis indicates that Xevl plays an integral role in thedevelopment of the otic vesicle epithelium. We find that Xevldepletion results in a decrease in the size of the otic vesicle atearly stages that, in embryos displaying a strong phenotype,appears to be due to a decrease in cell number. The observeddecrease in cell number does not appear to be due to defectsin otic placode induction or increased cell death. Instead, ourdata are consistent with the idea that Xevl depletion disruptscell adhesion, which may lead to the loss of loosely adherentcells during placode invagination and vesicle formation. Thisidea is supported by the localization of Xevl to sites of cell-

Fig. 9. Xevl is required for stereociliaformation. Confocalimmunofluorescence images ofdissected Xenopus otic vesicles atstage 45 stained with actin(phalloidin; A,B, red in C-H),spectrin (green in C-E) and espin(green in F-H). (A) Uninjected oticvesicles possess stereocilia with astaircase of actin filaments (arrows).(B) XevlMO-injected otic vesicleshave shorter stereocilia that are moreuniform in length and exhibit asplayed appearance (arrows).(C) Uninjected otic vesicles possessstrong spectrin localization at thecuticular plate (arrow). (D,E) Xevl-depleted embryos display a decreasein spectrin staining (arrows) thatcorrelate with defects in stereocilia morphology. (F) In uninjected embryos, espin staining is strongly associated with stereocilia (arrow).(G,H) Xevl depletion causes a reduction in espin levels in stereocilia (arrow). Bars, 5 �m.

Jour

nal o

f Cel

l Sci

ence

2648

cell contact in the otic epithelium and the requirement for Xevlin promoting optimal cell-cell adhesion of otic epithelial cells.The observed loss of columnar morphology of the otic vesicleepithelium coupled with a decrease in the levels of the junctionmarkers �-catenin, vinculin and occludin further supports thismodel. Loss of cadherin-2, a component of adherens junctions,also results in reduced otic vesicle size (Babb-Clendenon et al.,2006), underscoring the importance of cellular adhesions inotic vesicle morphogenesis.

Xevl controls vestibulocochlear ganglion formationThe otic placode is unique to the cranial placodes as it givesrise to both the neural and ectodermal components of the finalstructure. In addition to its role in the ectoderm, our studiesindicate that Xevl function is critical for development of thevestibulocochlear ganglion. Xevl is enriched in theventromedial region of the otic vesicle where neuroblasts arespecified and delaminate and Xevl depletion causes significantchanges in the overall organization and size of thevestibulocochlear ganglion. Additionally, Xevl is highlyexpressed in the vestibulocochlear ganglion, and loss of Xevlresults in a reduction in ganglion size and fewer XNeuroD-labeled neuroblasts. Defects in a number of processesincluding, cell fate specification, cell death, cell migration orcell adhesion could explain these phenotypes. Our experimentsshow that depleted and control otic vesicles have a similarnumber of neuroblasts in the epithelium, indicating that neitherspecification of neuronal fate nor proliferation is altered byXevl knockdown. In addition, both depleted and controlembryos possess a similar number of XNeuroD-labeled cellsdelaminating from the vesicle. Furthermore, TUNEL analysisindicated that cell death does not account for the decreased sizeof the vestibulocochlear ganglion. Instead, our data areconsistent with the idea that Xevl may be required for themigration of neuronal precursors to their targets and/or theaggregation of cells to form the ganglion. An abundance ofstudies have demonstrated an important role for Ena/VASPproteins in regulating cell migration (Hoffman et al., 2006;Krause et al., 2003; Kwiatkowski et al., 2003; Menzies et al.,2004; Sechi and Wehland, 2004; Withee et al., 2004),indicating that Xevl may control neuroblast migration bycoordinating cytoskeletal dynamics at the leading edge. Insupport of a role for Xevl in modulating cell adhesion, we haveshown that Xevl-depleted otic cells exhibit an impaired abilityto aggregate. The importance of cellular adhesions investibulocochlear ganglion formation has been demonstratedin a recent study, where loss of cadherin-2 function resulted ina similar reduction in vestibulocochlear ganglion size (Babb-Clendenon et al., 2006). Additionally, Xevl-depletedvestibulocochlear ganglia show a greatly reduced anddisorganized laminin-rich matrix surrounding the gangliasuggesting that Xevl may also regulate integrin-basedadhesion. A number of studies have shown that inside-outregulation of integrin activity is dependent on an intact actincytoskeleton (Pankov et al., 2000; Wu et al., 1995; Zaidel-Baret al., 2003). Since Ena/VASP proteins are thought to modulatethe interactions between cell surface receptors and the actincytoskeleton (Gitai et al., 2003; Hoffman et al., 2006; Jenzoraet al., 2006; Kwiatkowski et al., 2003; Scott et al., 2006), Xevlmay modulate linkages between the actin cytoskeleton and cellsurface adhesion receptors necessary for cell migration,

adhesion and matrix assembly during formation of thevestibulocochlear ganglion.

Once the vestibulocochlear ganglion has formed, neurons ofthe ganglion send out processes to targets in the ventromedialsensory epithelium and to nuclei within the hindbrain (Fritzschet al., 2002). We found that Xevl is enriched in these sensoryprojections and Xevl depletion causes a significant reductionin the number and length of neurofilament-labeled projectionsin the ventromedial sensory epithelium. The reduction insensory projection number is likely due to a decrease inneuroblasts in the ganglia, which in turn form fewerprotrusions. The decrease in sensory projection length can beexplained by a requirement for Xevl in modulating actinorganization and dynamics in developing neuronal processes.In support of this idea, Ena/VASP proteins have well-established roles in regulating neurite outgrowth andpathfinding (Bashaw et al., 2000; Gitai et al., 2003; Goh et al.,2002; Lanier et al., 1999; Li et al., 2005; Menzies et al., 2004).An alternative model is that impaired migration ofdelaminating neuroblasts in Xevl-depleted embryos affects thedeposition of extracellular cues that serve to guide neuritesback to the ventromedial sensory epithelium. This idea issupported by work in mice which revealed that neuroblastsdelaminate from the same region that their projections laterinnervate, suggesting that neuroblasts deposit guidance cuesfor neurites to find their proper target (Carney and Silver, 1983;Fritzsch et al., 2002). Together, our data have uncovered arequirement for Xevl in the development of vestibulocochlearneurons, although further studies are required to define theprecise role Xevl plays in their development and pathfinding.

Role of Xevl in regulating development ofmechanosensory hair cells and stereociliaProper stereocilia formation is integral to hearing and balancein vertebrates (Tilney et al., 1992). Stereocilia are unique actin-rich structures with a distinct graded staircase appearance ofthe bundles and lateral link connections between bundles. Thestaircase appearance of the stereocilia bundles is controlled byactin incorporation at the stereocilia tip that is scaled to therespective length of the bundles; longer bundles having higherlevels of actin treadmilling than shorter bundles (Lin et al.,2005). The organized arrangement of stereocilia is maintainedby cadherin-based cross-bridges that link stereocilia bundlestogether (El-Amraoui and Petit, 2005) and the cuticular platethat anchors the base of the bundles to the apical actin cortex(DeRosier and Tilney, 1989).

In the present study, we found that Xevl is stronglyexpressed in hair cells of the otic vesicle and is enrichedapically at the base of the stereocilium in the cuticular plate.Depletion of Xevl resulted in a significant decrease instereocilia length, failure of stereocilia to establish a staircaseappearance, and disruption of espin localization in stereocilia.One explanation of these findings is that some defects in haircell and stereocilia formation could be an indirect affect ofXevl depletion on cell adhesion and morphology. However, thelocalization of Xevl to the base of stereocilia and the knownroles of Ena/VASP proteins in the regulation of actin dynamicssuggest that Xevl may play a direct role in stereociliaformation. Potential mechanisms by which Xevl could controlstereocilia formation include regulation of actin dynamics instereocilia, modulation of cross-bridges between adjacent

Journal of Cell Science 120 (15)

Jour

nal o

f Cel

l Sci

ence

2649Regulation of inner ear development by Xenopus Evl

stereocilia, and formation of the cuticular plate. Although aspecific function for Xevl in stereocilia is possible,immunolocalization studies failed to consistently detect Xevlprotein in stereocilia. Thus, our data favor a model in whichXevl functions at the cuticular plate to promote anchoring ofstereocilia in the apical actin cortex. In support of this model,Xevl is enriched at the cuticular plate and Xevl depletionresults in a loss of spectrin and actin from this structure. Thecuticular plate serves as an anchor for actin filaments instereocilia and provides support to keep the stereocilia upright(DeRosier and Tilney, 1989; Tilney and DeRosier, 1986; Tilneyet al., 1983). Spectrin is thought to form cross-bridges betweenactin filaments within the cuticular plate, anchoring stereociliabundles to the apical aspect of hair cells (Drenckhahn et al.,1991; Scarfone et al., 1988; Ylikoski et al., 1992). Thus, theloss of Xevl and spectrin from the cuticular plate may result ina loss of structural integrity of the stereocilia bases causing theactin bundles to be shorter and take on a splayed appearance.Interestingly, spectrin can directly bind Evl though its EVH1domain and the two proteins colocalize at filopodial tips andthe leading edge of lamellipodia (Bournier et al., 2006). Thus,Xevl may act to recruit or maintain spectrin localization at thecuticular plate. Assembly of the cuticular plate would thensupport proper architecture of the stereocilia bundles. Althoughthis interpretation is consistent with our data, further work isrequired to determine the precise role for Xevl in regulatingstereocilia formation.

In summary, our data provide evidence that Xevl plays anintegral role in the development of the vertebrate inner ear.Xevl is required for establishment of epithelial morphology inthe otic vesicle, formation of the vestibulocochlear ganglion,and development of mechanosensory hair cell stereocilia. Ourfindings together with the known role of Ena/VASP proteins inregulating actin dynamics indicate that Xevl function in innerear development probably depends on its ability to control actinarchitecture during morphogenesis of the inner ear. Manygenes associated with inner ear development and humandeafness function to control actin dynamics, underscoring theimportance of regulating cytoskeletal organization for normalinner ear morphogenesis. Future studies will help define howthese genes work together to control inner ear development aswell as the morphogenesis of other vertebrate sensory cellscontaining microvilli and how the absence of these genes leadsto defects in the detection of chemical and mechanical stimuli.

Materials and MethodsEmbryos and microinjectionsXenopus laevis embryos were obtained by fertilizing eggs from females injectedwith human chorionic gonadotropin (Sigma). Eggs were dejellyed with 2% cysteineand cultured in 0.33�MMR (Sive et al., 2000). Embryos were staged according tothe method of Nieuwkoop and Faber (Nieuwkoop and Faber, 1994). Xevl 5�UTRmorpholino (XevlMO, CCGCTTTCTCCTTGGTATCTTCTGT) and standardcontrol morpholino were purchased from GeneTools. Morpholinos (5-20 ng) wereinjected into one dorsal animal blastomere targeting the otic placode primordia atthe 4- or 8-cell stages. Xevl-GFP capped mRNA missing the 5�UTR recognized byXevlMO was synthesized in vitro using the SP6 mMessage Machine kit (Ambion).Xevl-GFP was generated by PCR and ligated into pCST+GFPN1. For rescueexperiments XevlMO (5 ng) was injected as described above at the 4-cell stage andwas followed by injection of Xevl-GFP mRNA (0.5 ng) at the same site at the 8-cell stage. Injections of XevlMO and Xevl-GFP mRNA were done in this mannerto avoid any possible non-specific binding of the morpholino to the Xevl-GFPmRNA prior to injection.

In situ hybridization and TUNEL assayEmbryos were fixed at the appropriate stage with MEMFA (MEM salts and 3.7%

formaldehyde) and whole-mount in situ hybridization was performed as describedpreviously (Harland, 1991) using DIG-labeled RNA probes and BM Purple(Roche) as an alkaline phosphatase substrate. Antisense DIG-labeled probes weresynthesized using cDNA encoding XEya1 (David et al., 2001) and the 3� portionof Xevl (Wanner et al., 2005). Specificity was confirmed by using thecorresponding sense riboprobes. MEMFA-fixed embryos were also used for TdT-mediated dUTP-biotin nick end-labeling (TUNEL) using TdT purchased formGibco-BRL, following the manufacturer’s instructions. For histology, stainedembryos were dehydrated, embedded in TissuePrep2 paraffin mix (Fisher), and cutinto 10 �m sections using a rotary microtome.

Antibody production and western blot analysisAnti-Xevl polyclonal antibodies were raised against a peptide corresponding toamino acids 277-295 (C-LLAKRRKAASYTDKPGDKK) conjugated to KLH(Sigma Genosys). Anti-Xevl antibodies were affinity purified using Xevl peptidecoupled to SulfoLink beads (Pierce). For western blot analyses, embryos wereinjected with morpholinos at the 4-cell stage in both dorsal blastomeres (5ng/blastomere). Control and morpholino-injected embryos were collected at stage35, homogenized in ice cold Triton lysis buffer (20 mM Tris pH 7.5, 150 mM NaCl,1 mM ethylenediaminetetraacetic acid, 1 mM EDTA, 0.5% Triton X-100),supplemented with protease inhibitors (1 mM phenylmethyl sulfonyl fluoride, 1 mMpepstatin, 10 �g/ml leupeptin and 10 �g/ml aprotinin). Approximately one embryoequivalent was loaded per lane on a 12% polyacrylamide gel and blotted to nylonmembrane (Bio-Rad). Blots were blocked in 5% milk in TBS + 0.1% Tween 20 andprobed with anti-Xevl antibodies at a 1:500 dilution for 5 hours at room temperature,washed, and incubated with goat anti-rabbit horseradish peroxidase-conjugatedantibodies (1:5000; Jackson Immunolabs). Signal was detected using SuperSignalWest Pico Chemiluminescent Substrate (Pierce) and exposed to X-OMAT LS film(Kodak). Blots were probed with anti-�-tubulin antibody for 1 hour (1:200; E7,DSHB, Iowa City, IA) as a loading control.

Immunofluorescence and subcellular localization studiesEmbryos were fixed with 4% paraformaldehyde in PBST (for Xevl, actin, spectrinand espin), 4% paraformaldehyde in PEM buffer (10 mM Pipes pH 7.4, 1 mMEDTA, 1 mM MgCl2) at 4°C overnight (for actin and espin), or Dent’s fixative (Siveet al., 2000) at 4°C overnight (for �-catenin and neurofilament). Dent-fixed embryoswere then rehydrated and all embryos were incubated in 10% BSA in PBST at roomtemperature for 1 hour to block non-specific binding. Antibodies used for staininginclude: �-catenin (1:100; Zymed, San Francisco, CA), islet-1 (1:25; DSHB, IowaCity, IA), laminin (1:100; Sigma), neurofilament (1:100; 3A10, DSHB), Xevl(1:10), spectrin (1:100) (Giebelhaus et al., 1987), espin (1:100) (Sekerková et al.,2003), occludin (1:100) (Cordenonsi et al., 1997) and vinculin (1:25; DSHB, IowaCity, IA). Fluorescent labeling was performed using Alexa Fluor 488- and AlexaFluor 568-labeled goat anti-mouse and goat anti-rabbit antibodies (1:200; MolecularProbes). Alexa Fluor 488- and Alexa Fluor 568-phalloidin (1:100; MolecularProbes) were used to visualize actin, and DAPI (1:2000; Molecular Probes) wasused to visualize DNA. Whole mounts and all preparations without phalloidinstaining were run through two final washes in 100% methanol before clearing inBA/BB (benzyl alcohol/benzyl benzoate, 1:2) and mounting on Sylgard slides forviewing. Vibrotome-sectioned specimens were rehydrated, embedded in 4% agarose(ISC BioExpress), cut into 200 �m sections, and stained as described. For frozensections, embryos were embedded in Tissue-Tek OCT compound (Fisher), cut into10 �m sections, stained on slides through the same series of steps as describedexcept that sections were preserved using Crystalmount (for actin, spectrin andXevl; Fisher). Images were obtained using a Zeiss spinning disc confocalmicroscope and image analysis was performed using Adobe Photoshop. Averagestereocilia length was measured using ImageJ software and P values were calculatedusing Student’s t-test.

Aggregation assayTwenty otic vesicles were dissected from both uninjected and XevlMO-injectedembryos anesthetized at stage 35 and collected in agarose-coated dishes containing1� Ca2+/Mg2+-free Ringers solution. Otic vesicles were dissociated using 2 mg/mlcollagenase for 20 minutes at room temperature followed by manual dissociationusing a pipette. The otic cell suspension was then washed three times with 1�Steinberg’s solution and maintained for up to 5 hours in 1� Steinberg’s alternating5 minutes on an orbital shaker and 30 minutes without shaking to allow forreaggregation.

The authors acknowledge James Bartles (NorthwesternUniversity), Sandra Citi (University of Geneva), Gerhard Schlosser(University of Bremen), Randall Moon (University of Washington)and Naoko Koyano (University of Minnesota) for generouslyproviding reagents used in this work. We also thank members of theMiller lab for numerous discussions and insightful comments. Thiswork was supported by NIH Pre-Doctoral Training Grant HD07480(S.J.W.).

Jour

nal o

f Cel

l Sci

ence

2650

ReferencesAl-Chalabi, A. and Miller, C. C. (2003). Neurofilaments and neurological disease.

BioEssays 25, 346-355.Aszodi, A., Pfeifer, A., Ahmad, M., Glauner, M., Zhou, X. H., Ny, L., Andersson, K.

E., Kehrel, B., Offermanns, S. and Fassler, R. (1999). The vasodilator-stimulatedphosphoprotein (VASP) is involved in cGMP- and cAMP-mediated inhibition ofagonist-induced platelet aggregation, but is dispensable for smooth muscle function.EMBO J. 18, 37-48.

Babb-Clendenon, S., Shen, Y. C., Liu, Q., Turner, K. E., Mills, M. S., Cook, G. W.,Miller, C. A., Gattone, V. H., 2nd, Barald, K. F. and Marrs, J. A. (2006). Cadherin-2 participates in the morphogenesis of the zebrafish inner ear. J. Cell Sci. 119, 5169-5177.

Barald, K. F. and Kelley, M. W. (2004). From placode to polarization: new tunes in innerear development. Development 131, 4119-4130.

Bartles, J. R., Wierda, A. and Zheng, L. (1996). Identification and characterization ofespin, an actin-binding protein localized to the F-actin-rich junctional plaques of Sertolicell ectoplasmic specializations. J. Cell Sci. 109, 1229-1239.

Bartles, J. R., Zheng, L., Li, A., Wierda, A. and Chen, B. (1998). Small espin: a thirdactin-bundling protein and potential forked protein ortholog in brush border microvilli.J. Cell Biol. 143, 107-119.

Bashaw, G. J., Kidd, T., Murray, D., Pawson, T. and Goodman, C. S. (2000). Repulsiveaxon guidance: Abelson and Enabled play opposing roles downstream of theroundabout receptor. Cell 101, 703-715.

Bear, J. E., Krause, M. and Gertler, F. B. (2001). Regulating cellular actin assembly.Curr. Opin. Cell Biol. 13, 158-166.

Bear, J. E., Svitkina, T. M., Krause, M., Schafer, D. A., Loureiro, J. J., Strasser, G.A., Maly, I. V., Chaga, O. Y., Cooper, J. A., Borisy, G. G. et al. (2002). Antagonismbetween Ena/VASP proteins and actin filament capping regulates fibroblast motility.Cell 109, 509-521.

Bever, M. M. and Fekete, D. M. (1999). Ventromedial focus of cell death is absent duringdevelopment of Xenopus and zebrafish inner ears. J. Neurocytol. 28, 781-793.

Bever, M. M., Jean, Y. Y. and Fekete, D. M. (2003). Three-dimensional morphology ofinner ear development in Xenopus laevis. Dev. Dyn. 227, 422-430.

Bournier, O., Kroviarski, Y., Rotter, B., Nicolas, G., Lecomte, M. C. and Dhermy,D. (2006). Spectrin interacts with EVL (Enabled/vasodilator-stimulatedphosphoprotein-like protein), a protein involved in actin polymerization. Biol. Cell98, 279-293.

Carney, P. R. and Silver, J. (1983). Studies on cell migration and axon guidance in thedeveloping distal auditory system of the mouse. J. Comp. Neurol. 215, 359-369.

Coppolino, M. G., Krause, M., Hagendorff, P., Monner, D. A., Trimble, W.,Grinstein, S., Wehland, J. and Sechi, A. S. (2001). Evidence for a molecularcomplex consisting of Fyb/SLAP, SLP-76, Nck, VASP and WASP that links the actincytoskeleton to Fcgamma receptor signalling during phagocytosis. J. Cell Sci. 114,4307-4318.

Cordenonsi, M., Mazzon, E., De Rigo, L., Baraldo, S., Meggio, F. and Citi, S. (1997).Occludin dephosphorylation in early development of Xenopus laevis. J. Cell Sci. 110,3131-3139.

David, R., Ahrens, K., Wedlich, D. and Schlosser, G. (2001). Xenopus Eya1 demarcatesall neurogenic placodes as well as migrating hypaxial muscle precursors. Mech. Dev.103, 189-192.

DeRosier, D. J. and Tilney, L. G. (1989). The structure of the cuticular plate, an in vivoactin gel. J. Cell Biol. 109, 2853-2867.

Drenckhahn, D., Engel, K., Hofer, D., Merte, C., Tilney, L. and Tilney, M. (1991).Three different actin filament assemblies occur in every hair cell: each contains aspecific actin crosslinking protein. J. Cell Biol. 112, 641-651.

El-Amraoui, A. and Petit, C. (2005). Usher I syndrome: unravelling the mechanismsthat underlie the cohesion of the growing hair bundle in inner ear sensory cells. J. CellSci. 118, 4593-4603.

Fritzsch, B. (2003). Development of inner ear afferent connections: forming primaryneurons and connecting them to the developing sensory epithelia. Brain Res. Bull. 60,423-433.

Fritzsch, B., Beisel, K. W., Jones, K., Farinas, I., Maklad, A., Lee, J. and Reichardt,L. F. (2002). Development and evolution of inner ear sensory epithelia and theirinnervation. J. Neurobiol. 53, 143-156.

Furuse, M., Hirase, T., Itoh, M., Nagafuchi, A., Yonemura, S., Tsukita, S. andTsukita, S. (1993). Occludin: a novel integral membrane protein localizing at tightjunctions. J. Cell Biol. 123, 1777-1788.

Giebelhaus, D. H., Zelus, B. D., Henchman, S. K. and Moon, R. T. (1987). Changesin the expression of alpha-fodrin during embryonic development of Xenopus laevis. J.Cell Biol. 105, 843-853.

Gitai, Z., Yu, T. W., Lundquist, E. A., Tessier-Lavigne, M. and Bargmann, C. I.(2003). The netrin receptor UNC-40/DCC stimulates axon attraction and outgrowththrough enabled and, in parallel, Rac and UNC-115/AbLIM. Neuron 37, 53-65.

Goh, K. L., Cai, L., Cepko, C. L. and Gertler, F. B. (2002). Ena/VASP proteins regulatecortical neuronal positioning. Curr. Biol. 12, 565-569.

Halbrugge, M. and Walter, U. (1989). Purification of a vasodilator-regulatedphosphoprotein from human platelets. Eur. J. Biochem. 185, 41-50.

Harland, R. M. (1991). In situ hybridization: an improved whole-mount method forXenopus embryos. Methods Cell Biol. 36, 685-695.

Heasman, J., Kofron, M. and Wylie, C. (2000). Beta-catenin signaling activitydissected in the early Xenopus embryo: a novel antisense approach. Dev. Biol. 222,124-134.

Hoffman, L. M., Jensen, C. C., Kloeker, S., Wang, C. L., Yoshigi, M. and Beckerle,

M. C. (2006). Genetic ablation of zyxin causes Mena/VASP mislocalization, increasedmotility, and deficits in actin remodeling. J. Cell Biol. 172, 771-782.

Jenzora, A., Behrendt, B., Small, J. V., Wehland, J. and Stradal, T. E. (2006). PREL1provides a link from Ras signalling to the actin cytoskeleton via Ena/VASP proteins.FEBS Lett. 580, 455-463.

Kim, W. Y., Fritzsch, B., Serls, A., Bakel, L. A., Huang, E. J., Reichardt, L. F., Barth,D. S. and Lee, J. E. (2001). NeuroD-null mice are deaf due to a severe loss of theinner ear sensory neurons during development. Development 128, 417-426.

Kragtorp, K. A. and Miller, J. R. (2006). Regulation of somitogenesis by Ena/VASPproteins and FAK during Xenopus development. Development 133, 685-695.

Krause, M., Sechi, A. S., Konradt, M., Monner, D., Gertler, F. B. and Wehland, J.(2000). Fyn-binding protein (Fyb)/SLP-76-associated protein (SLAP),Ena/vasodilator-stimulated phosphoprotein (VASP) proteins and the Arp2/3 complexlink T cell receptor (TCR) signaling to the actin cytoskeleton. J. Cell Biol. 149, 181-194.

Krause, M., Dent, E. W., Bear, J. E., Loureiro, J. J. and Gertler, F. B. (2003).Ena/VASP proteins: regulators of the actin cytoskeleton and cell migration. Annu. Rev.Cell Dev. Biol. 19, 541-564.

Kwiatkowski, A. V., Gertler, F. B. and Loureiro, J. J. (2003). Function and regulationof Ena/VASP proteins. Trends Cell Biol. 13, 386-392.

Lanier, L. M., Gates, M. A., Witke, W., Menzies, A. S., Wehman, A. M., Macklis, J.D., Kwiatkowski, D., Soriano, P. and Gertler, F. B. (1999). Mena is required forneurulation and commissure formation. Neuron 22, 313-325.

Lee, J. E., Hollenberg, S. M., Snider, L., Turner, D. L., Lipnick, N. and Weintraub,H. (1995). Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix protein. Science 268, 836-844.

Leon, Y., Sanchez-Galiano, S. and Gorospe, I. (2004). Programmed cell death in thedevelopment of the vertebrate inner ear. Apoptosis 9, 255-264.

Li, H., Liu, H., Balt, S., Mann, S., Corrales, C. E. and Heller, S. (2004a). Correlationof expression of the actin filament-bundling protein espin with stereociliary bundleformation in the developing inner ear. J. Comp. Neurol. 468, 125-134.

Li, H., Liu, H., Sage, C., Huang, M., Chen, Z. Y. and Heller, S. (2004b). Islet-1expression in the developing chicken inner ear. J. Comp. Neurol. 477, 1-10.

Li, W., Li, Y. and Gao, F. B. (2005). Abelson, enabled, and p120 catenin exert distincteffects on dendritic morphogenesis in Drosophila. Dev. Dyn. 234, 512-522.

Lin, H. W., Schneider, M. E. and Kachar, B. (2005). When size matters: the dynamicregulation of stereocilia lengths. Curr. Opin. Cell Biol. 17, 55-61.

Liu, M., Pereira, F. A., Price, S. D., Chu, M. J., Shope, C., Himes, D., Eatock, R. A.,Brownell, W. E., Lysakowski, A. and Tsai, M. J. (2000). Essential role ofBETA2/NeuroD1 in development of the vestibular and auditory systems. Genes Dev.14, 2839-2854.

Menzies, A. S., Aszodi, A., Williams, S. E., Pfeifer, A., Wehman, A. M., Goh, K. L.,Mason, C. A., Fassler, R. and Gertler, F. B. (2004). Mena and vasodilator-stimulatedphosphoprotein are required for multiple actin-dependent processes that shape thevertebrate nervous system. J. Neurosci. 24, 8029-8038.

Nieuwkoop, P. D. and Faber, J. (1994). Normal Table of Xenopus laevis (Daudin): ASystematical and Chronological Survey of the Development from the Fertilized Egg tillthe End of Metamorphosis. New York: Garland.

Noden, D. M. and Van de Water, T. R. (1992). Genetic analyses of mammalian eardevelopment. Trends Neurosci. 15, 235-237.

Pankov, R., Cukierman, E., Katz, B. Z., Matsumoto, K., Lin, D. C., Lin, S., Hahn,C. and Yamada, K. M. (2000). Integrin dynamics and matrix assembly: tensin-dependent translocation of alpha(5)beta(1) integrins promotes early fibronectinfibrillogenesis. J. Cell Biol. 148, 1075-1090.

Raphael, Y., Athey, B. D., Wang, Y., Lee, M. K. and Altschuler, R. A. (1994). F-actin,tubulin and spectrin in the organ of Corti: comparative distribution in different celltypes and mammalian species. Hear. Res. 76, 173-187.

Riley, B. B. and Phillips, B. T. (2003). Ringing in the new ear: resolution of cellinteractions in otic development. Dev. Biol. 261, 289-312.

Rotter, B., Bournier, O., Nicolas, G., Dhermy, D. and Lecomte, M. C. (2005). AlphaII-spectrin interacts with Tes and EVL, two actin-binding proteins located at cell contacts.Biochem. J. 388, 631-638.

Rzadzinska, A., Schneider, M., Noben-Trauth, K., Bartles, J. R. and Kachar, B.(2005). Balanced levels of Espin are critical for stereociliary growth and lengthmaintenance. Cell Motil. Cytoskeleton 62, 157-165.

Scarfone, E., Dememes, D., Perrin, D., Aunis, D. and Sans, A. (1988). Alpha-fodrin(brain spectrin) immunocytochemical localization in rat vestibular hair cells. Neurosci.Lett. 93, 13-18.

Schlosser, G. (2006). Induction and specification of cranial placodes. Dev. Biol. 294, 303-351.

Scott, J. A. and Yap, A. S. (2006). Cinderella no longer: alpha-catenin steps out ofcadherin’s shadow. J. Cell Sci. 119, 4599-4605.

Scott, J. A., Shewan, A. M., den Elzen, N. R., Loureiro, J. J., Gertler, F. B. and Yap,A. S. (2006). Ena/VASP proteins can regulate distinct modes of actin organization atcadherin-adhesive contacts. Mol. Biol. Cell 17, 1085-1095.

Sechi, A. S. and Wehland, J. (2004). ENA/VASP proteins: multifunctional regulators ofactin cytoskeleton dynamics. Front. Biosci. 9, 1294-1310.

Sekerková, G., Loomis, P. A., Changyaleket, B., Zheng, L., Eytan, R., Chen, B.,Mugnaini, E. and Bartles, J. R. (2003). Novel espin actin-bundling proteins arelocalized to Purkinje cell dendritic spines and bind the Src homology 3 adapter proteininsulin receptor substrate p53. J. Neurosci. 23, 1310-1319.

Sekerková, G., Zheng, L., Loomis, P. A., Changyaleket, B., Whitlon, D. S., Mugnaini,E. and Bartles, J. R. (2004). Espins are multifunctional actin cytoskeletal regulatory

Journal of Cell Science 120 (15)

Jour

nal o

f Cel

l Sci

ence

2651Regulation of inner ear development by Xenopus Evl

proteins in the microvilli of chemosensory and mechanosensory cells. J. Neurosci. 24,5445-5456.

Sekerková, G., Zheng, L., Mugnaini, E. and Bartles, J. R. (2006). Differentialexpression of espin isoforms during epithelial morphogenesis, stereociliogenesis andpostnatal maturation in the developing inner ear. Dev. Biol. 291, 83-95.

Sive, H. L., Grainger, R. M. and Harland, R. M. (2000). Early Development of Xenopuslaevis: A Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor LaboratoryPress.

Tilney, L. G. and DeRosier, D. J. (1986). Actin filaments, stereocilia, and hair cells ofthe bird cochlea. IV. How the actin filaments become organized in developingstereocilia and in the cuticular plate. Dev. Biol. 116, 119-129.

Tilney, L. G., Egelman, E. H., DeRosier, D. J. and Saunder, J. C. (1983). Actinfilaments, stereocilia, and hair cells of the bird cochlea. II. Packing of actin filamentsin the stereocilia and in the cuticular plate and what happens to the organization whenthe stereocilia are bent. J. Cell Biol. 96, 822-834.

Tilney, L. G., Tilney, M. S. and DeRosier, D. J. (1992). Actin filaments, stereocilia, andhair cells: how cells count and measure. Annu. Rev. Cell Biol. 8, 257-274.

Torres, M. and Giraldez, F. (1998). The development of the vertebrate inner ear. Mech.Dev. 71, 5-21.

Van de Water, T. R. (1988). Tissue interactions and cell differentiation: neurone-sensorycell interaction during otic development. Development Suppl. 103, 185-193.

Wanner, S. J., Danos, M. C., Lohr, J. L. and Miller, J. R. (2005). Molecular cloningand expression of Ena/Vasp-like (Evl) during Xenopus development. Gene Expr.Patterns 5, 423-428.

Withee, J., Galligan, B., Hawkins, N. and Garriga, G. (2004). Caenorhabditis elegansWASP and Ena/VASP proteins play compensatory roles in morphogenesis and neuronalcell migration. Genetics 167, 1165-1176.

Wu, C., Keivens, V. M., O’Toole, T. E., McDonald, J. A. and Ginsberg, M. H. (1995).Integrin activation and cytoskeletal interaction are essential for the assembly of afibronectin matrix. Cell 83, 715-724.

Ylikoski, J., Pirvola, U. and Lehtonen, E. (1992). Distribution of F-actin and fodrin inthe hair cells of the guinea pig cochlea as revealed by confocal fluorescencemicroscopy. Hear. Res. 60, 80-88.

Zaidel-Bar, R., Ballestrem, C., Kam, Z. and Geiger, B. (2003). Early molecular eventsin the assembly of matrix adhesions at the leading edge of migrating cells. J. Cell Sci.116, 4605-4613.

Ziegler, W. H., Liddington, R. C. and Critchley, D. R. (2006). The structure andregulation of vinculin. Trends Cell Biol. 16, 453-460.

Jour

nal o

f Cel

l Sci

ence