Mol Gen Genet (1991) 228:281-286 0026892591002403 MGG

© Springer-Verlag 1991

Regulation of metallocarboxypeptidase inhibitor gene expression in tomato Belinda Martineau, Kevin E. McBride and Catherine M. Houck

Calgene, Inc., 1920 Fifth Street, Davis, CA 95616, USA

Received January 30, t 991

Summary. Tomato fruits contain a metallocarboxypepti- dase inhibitor (MCPI) the sequence of which has already been determined. Here we report the isolation of a toma- to cDNA clone that encodes the mature MCPI protein as well as an N-terminal signal peptide for entry into the secretory system and an eight amino acid carboxy- terminal extension. MCPI RNA is present at very high levels in anthesis stage ovaries and decreases quite rapid- ly during fruit development. MCPI protein accumula- tion reflects the pattern of MCPI RNA accumulation in fruit, consistent with a transcriptional control of MCPI gene activity. In leaves, the levels of MCPI RNA and protein are very low. Wounding of the leaves causes a dramatic (100-fold) increase in steady-state level of MCPI RNA without a concomitant increase in MCPI protein level suggesting a control at the post-transcrip- tional or translational level of gene expression. Genomic DNA blot hybridization data indicate that MCPI in to- mato may be encoded by a single gene.

Key words: Tomato - Fruit development - Wound-in- ducible expression - Post-transcriptional regulation

Introduction

Proteins isolated from potato tubers (Ryan et al. 1974) and ripe tomato fruit (Hass and Ryan 1980) specifically inhibit the pancreatic metalloexopeptidases, carboxy- peptidases A and B, via the formation of inhibitor-en- zyme complexes (Rees and Lipscomb 1982). These me- tallocarboxypeptidase inhibitor (MCPI) proteins are fur- ther characterized by their low molecular weights (ca. 4200 daltons), and the presence of multiple cysteine resi- dues involved in disulfide linkages and consistent with the extreme physical stability of MCPI protein (Ryan et al. 1974). The potato and tomato proteins are remark- ably conserved as evidenced by 70% primary protein sequence homology (Hass and Hermondson 1981) as well as by the strong immunological cross-reactivity of antiserum raised against potato MCPI with tomato MCPI (Hass and Ryan 1980).

Offprint requests to: B. Martineau

In addition to the relatively high concentrations of MCPI found in tubers, closely related but distinct forms of MCPI have also been found to accumulate, to varying extents, in potato leaves, stems and buds (Hass et al. 1979). It has also been reported that accumulation of MCPI protein in potato leaves is increased two- to three- fold in response to mechanical wounding (Graham and Ryan 1981). To date, however, none of the carboxypepti- dases identified in solanaceous plants are known to be inhibited by MCPI (Walker-Simmons and Ryan 1980; Ryan 1981). [Doi et al. (1980) have reported that a me- talloenzyme similar to pancreatic carboxypeptidases A and B is present in rice seedlings.] The endogenous func- tion of MCPI is, therefore, not known. It has been sug- gested, however, that plant proteinase inhibitors are in- volved in plant defense against insect attack (Ryan 1973, 1989). A recent report indicates that expression of a ser- ine proteinase inhibitor, Inhibitor II, in transgenic tobac- co plants does confer resistance to Manduca sexta larvae (Johnson et al. 1989).

In our pursuit of genes involved in tomato fruit devel- opment we have identified and characterized a tomato MCPI cDNA clone. We report here the results of our studies on the developmentally regulated and wound- stimulated expression of the tomato MCPI gene. Addi- tional unusual aspects of the post-transcriptional regula- tion of MCPI gene expression in wounded leaves are also presented and discussed.

Materials and methods

Plant material. Tomato plants (Lycopersicon esculentum cv. UC82B), grown under standard greenhouse condi- tions, were used as the source of ovaries, fruit and leaves for all developmental studies. Flowers were tagged at anthesis and developing fruit collected at specific times thereafter. Ovaries described as '° pre-anthesis" were tak- en from flower buds that were judged to be 1-3 days from opening. All tissues were harvested directly into liquid nitrogen and stored at - 7 0 ° C until used.

Studies of wound induction were conducted as pre- viously described (Graham et al. 1986) using UC82B seedlings as well as L. esculentum cv. Bonnie Best, the

282

cultivar used by Graham et al. (1986). Briefly, the first set of true leaves of seedlings approximately 5 cm in height were crushed with a pair of hemostats at the distal end of each leaflet. This procedure was repeated, succes- sive wounds being produced basipetally, once hourly for 4 h. Wounded leaves were harvested directly into liquid nitrogen 8 h after the first wound was inflicted.

RNA isolation and cDNA cloning. The synthesis of cDNA, from poly(A) + RNA prepared as described (Mansson et al. 1985) from ovaries of pre-anthesis stage tomato flowers, was carried out using a BRL cDNA Cloning Kit (BRL, Bethesda, Md). EcoRI linkers (New England Biolabs, Beverly, Mass.) were added to the re- sulting double-stranded cDNA (Huynh et al. 1985). The cDNA was then ligated into the EcoRI site of the phage Lambda ZAP (Stratagene, LaJolla, Calif.) and packaged (GigaPack Gold, Stratagene).

DNA sequencing. Bluescript plasmids containing the to- mato cDNA inserts were excised from the Lambda ZAP phages using a helper phage system (Stratagene). The DNA sequences of the cDNA inserts were determined using the dideoxy technique (Sanger et al. 1977) on dou- ble-stranded plasmid templates. Identification of the pZ70 clone as encoding the MCPI protein from L. escu- lentum was made by comparison of the deduced amino acid sequence with protein sequences entered in the Pro- tein Identification Resources (PIR) database using the Intelligenetics IFIND program. Hydropathy analysis was done by the method of Kyte and Doolittle (1982).

RNA and DNA gel blots. RNA isolations for blot analy- ses were carried out using the method of Ecker and Da- vis (1987) with the addition of an overnight precipitation in 1 mM MgCI2, 2 M LiC1 at 4 ° C and a subsequent ethanol precipitation. RNA samples were separated by electrophoresis in formaldehyde/agarose gels (Geliebter 1987) and immobilized on Nytran membranes (Schleicher & Schuell, Keene, N.H.). DNA was isolated and Southern blots prepared as described (Martineau et al. 1989). DNA and RNA blot hybridizations were performed using 32p-labeled probes produced by the random priming technique (using the kit available from Boehringer Mannheim Biochemicals, Indianapolis, Ind.). Conditions for filter prehybridization, hybridiza- tion and washing were as previously described (Mansson et al. 1985).

Preparation and screening of genomic library. A genomic library was constructed from L. esculentum cv. UC82B DNA that had been partially digested with the restric- tion endonuclease Sau3A and established in the lambda phage vector, Lambda FIX, according to the supplier's instructions (Stratagene, LaJolla, Calif.). This library was screened using 32p-labeled pZ70 cDNA insert as a probe using standard techniques (Maniatis et al. 1982). A genomic clone containing approximately 14.5 kb of sequence from the tomato genome which hybridized to pZ70 was isolated. Phage DNA was isolated (Gross- berger 1987) and the tomato genomic DNA insert was

mapped using restriction enzymes following standard techniques (Maniatis et al. 1982).

Antibody preparation and protein gel blot analysis. Rabbit antiserum was raised against a purified potato MCPI (Calbiochem, San Diego, Calif.). Rabbits were given an initial injection of 0.5 mg MCPI and then three subse- quent 0.25 mg boosts at 3 week intervals. Antiserum was harvested 10 days following the third boost.

Tissue samples (0.5 g) were ground to a fine powder under liquid nitrogen and added to 2 ml of extraction buffer (0.1 M potassium phosphate, pH 6.8, 0.15 M NaC1, 10 mM EDTA, 0.3% Tween 20, 0.1% Triton X- 100, 10 mM dithiothreitol and 10 mM thiourea). After thawing, samples were subjected to further extraction in a ground glass homogenizer. The homogenates were centrifuged at 13 000 g for 10 rain at 4 ° C and the protein concentration in each supernatant was determined by the method of Bradford (1976). Samples containing 25 gg of total protein were subjected to Tricine-SDS- polyacrylamide gel electrophoresis (PAGE) using the 4%T 3%C stacking, 10%T 3%C spacer, and 16.5%T 3%C separating gel system of Schagger and von Jagow (1987). Following electrophoresis, the polypeptides were transferred to nitrocellulose by electroblotting in a 25 mM TRIS base, 192 mM glycine, 20% methanol buffer as described (Burnette 1981). Filters were blocked in TTBS (50 mM TRIS-HC1, pH 7.5, 200 mM NaC1, 0.05% Tween 20) with 1% bovine serum albumin for 2 h at room temperature. MCPI antiserum was added to the blocking solution at a 1:200 dilution and the filters incubated another 2 h at room temperature. Fol- lowing three 5 rain washes in TTBS, alkaline phospha- tase conjugated goat anti-rabbit antibody (Promega Bio- tec, Madison, Wis.) was added at a 1:4000 dilution in the same solution and incubated at room temperature for 30 min. The filters were subjected to three 5 rain washes in TTBS and placed in alkaline phosphatase re- action buffer (100raM TRIS-HC1, pH9.5, 100mM NaC1, 50 mM MgC12) containing nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP) color development reagents (BRL, Gaithersburg, Md). After bands had fully developed, the reaction buffer was decanted and the filters rinsed with water and dried.

Results

Tomato MCPI cDNA identification

A tomato ovary cDNA library was screened by differen- tial plaque hybridization (Maniatis et al. 1982) using 32P-labeled cDNA probes made from pre-anthesis ovary mRNA, leaf mRNA and mRNA isolated from whole seedlings (roots, stems and leaves). One clone, desig- nated pZ8, was chosen because it hybridized to the ovary cDNA probe and not to the leaf and seedling cDNA probes. A second ovary library that contained signifi- cantly longer cDNA was screened with a pZ8 probe and the longest hybridizing cDNA clone, designated pZ70, was chosen for further study.

a

1 ATTATTATTACCATGGCACAAAAATTTACTATCCTTTTCACCATTCTCCTTGTGGTTATT 60

~AlaGlnLysPheThrIleLeuPheThrIleLeuLeuValValIle

l a t h e Protein J t a z t I

61 GCTGCTC~C~TGTGATGGCAC~GATGCAACTCTC~CG~CTTTTTCAGC~TATGAT 120 AlaAlaGlnAspValMETAlaGlnAspAlaThrLeuThrLysLeuPheGlnGlnTyrAsp

121 CCAGTTTGTCACAAACCTTGCTCAACACAAGACGATTGTTCTGGTGGTACGTTCTGTCAG 180

ProValCysHisLysProCysSerThrGlnAspAspCysSerGlyGlyThrPheCysGln

Mature Protein End ]

181 GCCTGTTGGAGGTTCGCGGGGACATGTGGGCCCTATGTTGGGCGCGCCATGGCCATAGGC 240

AlaCysTrpArgPheAlaGlyThrCysGlyProTyrValGlyArgAlaMETAlaIleGly

241 GTGTGATTACAATTTCGTTGTTCTTCTTTTTCGACTTTTTAATCCCAAGTGAATAAAGTC 300

Val

301 TAATTCGAAAAAGAAGAAAAAAGTATCTATGTCTGAGTTATATGTTTTGTGGCTAATAAG 360

361 AAATCGACTATGCTTGTTGATTTGATAAAAATTATGTCATTAGGGTGTGATATGTAATCA 420

421 TCAAATTAAAT AAAAATCATCGCATTGTGTGTG 554

b

-3 o +3 -----,----,----,----,----,-----,-----,-----

***..

°*

*.*

*..*.°*o..°o***

.°*o*°**.**°****** **********************

*************************

*************************

**************************

******************************

********************************

*****************************

***********************

o.....**

°**.

°o

.....

.o.*°

*.....°.

**o***.. ****°***...

..°°..*°.*....

**.*o****

°.°o.* .......

*°°

°**

.°0..°°*

.o.°°......

.*****.***.

*....**.**.oo

*.....**°*o.*

*o .....*

**.

**

° * * ° *

. ° . ° * * *

° ° ° . , . °

° * ° ° ° ° o . ° ° . * *

° . . ° * ° * . . . , ° ° o * * o ° °

. ° ° ° ° * ° ° ° ° * ° * ° ° ° . ° . °

* ° o o ° , * ° ° * * * * * * * ~ o ° ° . .

Fig. 1 a and b. Nucleotide sequence and hydropathy plot of metallo- carboxypeptidase inhibitor (MCPI) cDNA clone pZ70. a The de- duced amino acid residues are shown below the nucleotide triplets. The start and end of the mature tomato MCPI protein sequence (Hass and Hermondson 1981) are indicated. The N-terminal methi- onine residue, the TGA stop codon and putative polyadenylation signals (AATAAA) are underlined. Poly(A) tracts were found at

283

The complete sequence of the MCPI c D N A clone, pZ70, is shown in Fig. 1 a. Primer extension analysis re- vealed that this c D N A clone was 19 nucleotides short of representing the full-length MCPI transcript at the 5' end. Sequencing of the transcript from a preparation of total R N A isolated from ovaries (data not shown) confirmed that no additional methionine codons exist upstream from the first methionine codon shown in Fig. 1 a. The pZ70 clone did not have a poly(A) tract at its 3' end. However, several shorter c D N A clones in- cluding pZ8 had poly(A) tails of up to 50 nucleotides in length. Two distinct sites for poly(A) addition were identified by comparing the sequences of five clones that did have poly(A) tracts. The location of the first site is indicated in Fig. 1 ; a second site is located two nucleo- tides beyond the 3' end of the pZ70 cDNA.

Clone pZ70 contains an open reading frame coding for the entire 37 amino acid mature MCPI protein se- quence (Hass and Hermondson 1981) as well as an addi- tional N-terminal sequence 32 amino acids in length. The open reading frame encoded by the pZ70 c D N A also contains an extension of 8 amino acids beyond the carboxyl-terminus of the published MCPI amino acid sequence (Hass and Hermondson 1981). A hydropathy plot (Kyte and Doolittle 1982) of the polypeptide precur- sor encoded by the pZ70 c D N A is shown in Fig. 1 b. The N-terminal 32 amino acid region contains a typical hydrophobic signal sequence associated with transport of the nascent polypeptide across the rough endoplasmic reticulum (von Heijne 1983). Implementation of von Heijne's (1983) rules for predicting signal sequence cleav- age sites indicates that the N-terminal 32 amino acid region may also contain a pro-domain sequence. The polypeptide extension beyond the C-terminus of the ma- ture protein is also quite hydrophobic.

Developmental regulation of M C P I gene expression

We examined MCPI gene expression during early toma- to fruit development. As shown in the R N A gel blot in Fig. 2 a, MCPI R N A accumulation is highest in toma- to ovaries during the period coinciding with the opening of the flower (anthesis). We have estimated, by compari- son with known amounts of MCPI R N A transcribed in vitro, that MCPI R N A makes up approximately 0.02% of the total cellular R N A in the ovary at this stage of its development (data not shown). MCPI R N A is also very abundant in ovaries during the several days prior to and the day or so following anthesis. The level of MCPI R N A accumulation drops significantly (ap- proximately tenfold) 2 days after anthesis and stays fair- ly constant at this lower level throughout the first 3 weeks of fruit development (see Fig. 2 a).

the end of most MCPI cDNA clones beginning two bases beyond the 3' end of this clone. One MCPI cDNA clone had a poly(A) tract beginning at the position indicated by the space after position 431. b The ordinate indicates the hydropathic index (Kyte and Doolittle 1982). The N-terminus (solid line) and C-terminus (broken line) of the mature protein (Hass and Hermondson 1981) are indi- cated

284

& 03

~- ¢j)

I ..C

2 3 4 5 6 7 I0 14 17 21

0.5kb

Fig. 2a and b. MCPI mRNA accumulation a during fruit develop- ment and b as a consequence of mechanical wounding. Total RNA isolated from ovary/fruit tissue of each stage of development (numbers refer to days post-anthesis) and from wounded and non- wounded (control) leaf tissue was loaded in the lanes. RNA blot analysis was conducted as described in Materials and methods us- ing 32p-labeled DNA insert from pZ70 as a probe. Five micro- grams of total RNA was loaded into each of the first 13 lanes depicted in a; 10 gg of total RNA was loaded into each of the remaining lanes depicted in a. The autoradiograph represented by

The accumulation of MCPI RNA during fruit ripen- ing was also examined. The results of this RNA gel blot experiment (shown in Fig. 2a) indicated that MCPI RNA does not accumulate to detectable levels in fruit after the immature green stage (approximately 3 weeks post-anthesis). Other transcripts known to accumulate in ripe tomato fruit were readily detected using the same RNA gel blot (J. Pear and C.M. Houck, unpublished data). We have repeated this experiment and obtained similar results; in RNA isolated from ripe tomato fruit we cannot detect MCPI RNA.

Wound-induced expression of MCPI RNA

The finding that other proteinase inhibitors are wound induced (Graham et al. 1986) prompted us to investigate the possibility that the tomato MCPI gene was wound inducible. Young tomato plants were consequently wounded with a pair of hemostats according to the pro- tocol of Graham et al. (1986) and used for RNA isola- tion and RNA gel blot analysis. The results, shown in Fig. 2b, clearly demonstrate that accumulation of toma- to MCPI RNA is wound induced. The intensity of the hybridization signal from RNA isolated from wounded leaves of both UC82B and Bonnie Best tomato plants is similar to that observed in anthesis stage tomato ovar- ies (see Fig. 2a). Hybridization of the MCPI gene probe to RNA isolated from non-wounded leaves of both culti- vars was observed on longer exposures of the filter repre- sented by Fig. 2b. We estimate that the increase in the hybridization signal between non-wounded and wounded leaf RNA preparations in this experiment is approximately 100-fold for both cultivars.

Wound-induced accumulation o f M C P I R N A is not reflected in protein levels

To determine whether M C P I p ro te in levels reflect the M C P I R N A levels we had observed in ovaries and w o u n d e d leaves, M C P I pro te in f rom these tissues was measured immunologica l ly . Cons is ten t with the develop-

b Bonnle Best UC82B

4J

O,5kb

the last six lanes m a was exposed approximately ten times longer than the autoradiograph depicted by the first 13 lanes in a in an effort to detect any MCPI RNA accumulation in ripening fruit. Approximately 10 gg of total RNA from anthesis stage ovaries and 20 gg of total RNA from each of the various leaf samples was loaded in the lanes depicted in b. The apparent difference in electrophoretic mobility of the hybridizing bands observed in b is probably due to overloading of the lanes containing leaf RNA (data not shown)

mental pattern of MCPI RNA accumulation, MCPI protein appears to accumulate to very high levels in ov- ary tissue (2%-5% of the total cellular protein) and is present at a level below the limit of our detection (<0.4% of the total cellular protein) in ripe fruit (Fig. 3). These results are consistent with a transcription- al control of gene expression. Contrasting results were obtained with wounded leaves where MCPI protein lev- els do not reflect MCPI RNA levels. We could not detect MCPI protein in extracts of wounded leaves (Fig. 3) al- though the MCPI RNA level in wounded leaves is roughly equivalent to that found in ovary tissue (Fig. 2).

Analysis of MCPI gene number in tomato

DNA gel blot analysis of UC82B genomic DNA was carried out using the pZ70 cDNA insert as a probe.

ug cpl oO , g

o 6 d ¢5

- -43 - - 25 - - 18 - -14 - - 6

- - 3 Fig. 3. MCPI protein accumulation in tomato tissues. Extracts con- taining 25 gg of total protein were subjected to Tricine-SDS-poly- acrylamide gel electrophoresis (PAGE), transferred to a nitrocellu- lose membrane and probed with rabbit anti-MCPI antibody as described in Materials and methods. The arrow indicates the mobi- lity of mature MCPI. MCPI from potato tubers was used as a standard. The presence of multiple bands in the tissue sample lanes is related to the specificity of the antiserum since these bands (but not the lower molecular weight MCPI band) are also observed when pre-immune serum is used as a probe (data not shown)

285

w I_

E I _U - r

2 3 k b

20kb

6kb

b X S XR HRSH R H H P X H B S X

I I I I I I I I [ I I I I k

2kb I I

Fig. 4a and b. Analysis of MCPI gene copy number, a UC82B tomato leaf DNA (15 ~g) was digested with the indicated restric- tion enzymes and DNA blot analysis conducted as described in Materials and methods using 32P-labeled DNA insert from pZ70 as a probe, b Restriction map of Lycopersicon esculentum cv UC82B MCPI genomic clone. Abbreviations : B, BamHI; G, BglII ; H, HindIII; R, EcoRI; S, SalI; X, XbaI; P, SphI

Individual DNA samples digested with the restriction enzymes BamHI, EcoRI and HindIII each produced one hybridizing band of 23, 20 and 6 kb approximate molec- ular weight, respectively (see Fig. 4). The restriction map of an MCPI genomic clone, isolated and purified by virtue of its hybridization to the pZ70 cDNA, is also shown (Fig. 4b). The DNA fragment lengths indicated on the map are consistent with those obtained from the genomic DNA gel blot analysis shown in Fig. 4a. Hy- bridization of the genomic clone with a pZ70 probe was localized to a 2 kb J~baI-HindIII fragment (black box in Fig. 4b). The intensities of the bands produced by tomato genomic DNA gel blot analysis were also com- pared with those produced when a dilution series of pZ70 plasmid DNA was included in an experiment simi- lar to the one shown in Fig. 4a (data not shown). The results of this dilution series as well as those of the exper- iments shown in Fig. 4 suggest that only one MCPI gene is present in the haploid tomato genome.

D i s c u s s i o n

We have described the preparation, isolation and identi- fication of a cDNA clone encoding tomato MCPI. We have shown that mRNA encoding this inhibitor accumu- lates and decays following a precise developmental time- table in tomato fruit (Fig. 2). MCPI protein follows a similar pattern of accumulation; high levels in ovaries and levels below our limit of detection in ripe fruit (Fig. 3). In fruit, MCPI gene expression appears to be tightly regulated at least, if not primarily, at the level of gene transcription and/or mRNA stability.

Based on the sensitivity of our RNA blot experiments

we were not surprised that we did not detect MCPI pro- tein accumulation in ripe fruit. However, we were aware of the fact that tomato MCPI protein had been original- ly isolated, in amounts approaching 0.05% of total fruit protein, from mature fruit tissues (Hass and Ryan 1980). This discrepancy probably relates to the relative insensit- ivity of our protein gel blot assay, which can only detect MCPI if it constitutes at least 0.4% of the total protein (Fig. 3). We attribute the presence of MCPI protein in ripe fruit, despite the lack of detectable MCPI RNA accumulation in fruit of the mature green stage or later (Fig. 2), to the extreme stability (slow turnover) of this small disulfide-linked protein (Ryan et al. 1974).

As compared with the situation in fruit, regulation of MCPI gene expression in tomato leaves is quite differ- ent. First, expression is triggered by an environmental stimulus instead of a developmental program. Second, while very high levels of MCPI RNA (approaching those found in ovaries) accumulate in wounded leaves, no MCPI protein is detectable (compare Figs. 2 and 3). Bishop et al. (1984) have also referred to a lack of MCPI protein in wounded tomato leaves. This difference in MCPI protein accumulation in ovaries as opposed to wounded leaves is striking (see Fig. 3) and indicative of some post-transcriptional mechanism of MCPI gene regulation specific to wounded leaves. It is possible that MCPI RNA in wounded leaves may require a further '" elicitor" to trigger association with polyribosomes and translation. Light serves as such an elicitor of transla- tional initiation for certain photosynthetic genes in amaranth cotyledons (Berry et al. 1990). Alternatively, it may be the case that MCPI RNA is translated in wounded tomato leaves but that the protein is turned over quickly or structurally changed, perhaps as it car- ries out its function in planta. Studies of MCPI gene regulation in potato, where accumulation of MCPI pro- tein does occur in wounded leaves (Graham and Ryan 1981) may provide an interesting contrast in the elucida- tion of the mechanism of MCPI gene regulation in toma- to leaves.

The deduced primary sequence of the protein encoded by our cDNA clone provided a clue that may relate to protein localization and/or stability. The hydrophobic C-terminal extension region (see Fig. 1 b) is reminiscent of a similar region observed in the primary protein se- quences of the vacuolar proteins, wheat germ agglutinin (Raikhel and Wilkins 1987) and barley lectin (Lerner and Raikhel 1989). The possibility that the tomato MCPI C-terminal extension region is necessary for va- cuolar sorting, as has been demonstrated for the barley lectin C-terminal pro-domain (Wilkins et al. 1990; Bed- narek et al. 1990) is especially intriguing in light of the fact that MCPI in potato leaves has been localized to mesophyll cell vacuoles (Hollander-Czytko et al. 1985). On the other hand, the MCPI extension may function to keep the inhibitor inactive until the appropriate devel- opmental stage or until it reaches the proper subcellular location. Whether this hydrophobic extension region (or any other region of the protein sequence) contains infor- mation required for protein stability or localization, or merely reflects MCPI vulnerability to cellular proteases awaits further studies.

286

We have presented evidence that MCPI in L. esculen- turn cv. UC82B is encoded by a single gene and we have isolated an MCPI genomic clone from this cultivar (Fig. 4). Plant transformation experiments, analogous to those recently reported by Keil et al. (1990) for Protein- ase Inhibitor II from potato, will provide us with a means to demonstrate definitively that one MCPI gene is responsible for the different patterns of MCPI gene expression evident in tomato fruit and leaves. In addi- tion, expression of antisense MCPI RNA could be ex- plored as a means to define the function of the gene product in planta. We hope such studies will also indi- cate the role MCPI may play in plant resistance to insect or herbivore attack.

Acknowledgments. We thank R. Rose for DNA sequencing, A. Jones for RNA sequencing and primer extension analysis, A. Kon- ing and J. Pear for providing us with hybridization membranes containing tomato DNA and mature fruit RNA, respectively, and C. McGuire for excellent care of greenhouse-grown plants. We also thank M.J. Chrispeels, E.P. Geiduschek, D. Helinski, C.K. Shewmaker, D.M. Stalker and especially W.R. Hiatt for critical reading of the manuscript. This work was supported in part by Campbell Soup Co.

References

Bednarek SY, Wilkins Tt-I, Dombrowski JE, Raikhel NV (1990) A carboxyl-terminal propeptide is necessary for proper sorting of barley lectin to vacuoles of tobacco. Plant Cell 2:1145-1155

Berry JO, Breiding DE, Klessig DF (1990) Light-mediated control of translational initiation of ribulose-l,5-bisphosphate carbox- ylase in Amaranth cotyledons. Plant Cell 2 : 795-803

Bishop PD, Pearce G, Bryant JE, Ryan CA (1984) Isolation and characterization of the proteinase inhibitor-inducing factor from tomato leaves. J Biol Chem 259:13172-13177

Bradford MM (1976) A rapid and sensitive method for the quanti- ration of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254

Bumette WN (1981) "Western blotting": Electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal Biochem 112:195-203

Doi E, Komori N, Natoba T, Morita Y (1980) Some properties of carboxypeptidases in germinating rice seeds and rice leaves. Agric Biol Chem 44:77-83

Ecker JR, Davis RW (1987) Plant defense genes are regulated by ethylene. Proc Natl Acad Sci USA 84: 5202-5206

Geliebter J (1987) Dideoxynucleotide sequencing of RNA and un- cloned cDNA. Focus 9:5-8

Graham JS, Ryan CA (1981) Accumulation of a metallocarboxy- peptidase inhibitor in leaves of wounded potato plants. Bio- chem Biophys Res Comm 101:1164-1170

Graham JS, Hall G, Pearce G, Ryan CA (1986) Regulation of synthesis of proteinase inhibitors I and II mRNAs in leaves of wounded tomato plants. Planta 169:399-405

Grossberger D (1987) Minipreps of DNA from bacteriophage lambda. Nucleic Acids Res 15: 6737

Hass GM, Hermondson MA (1981) Amino acid sequence of a carboxypeptidase inhibitor from tomato fruit. Biochemistry 20 : 2256-2260

Hass GM, Ryan CA (1980) Carboxypeptidase inhibitor from ri-

pened tomatoes: purification and properties. Phytochemistry 19:1329-1333

Hass GM, Derr JE, Makus DJ 61979) Distribution of carboxypep- tidase isoinhibitors in the potato plant. Plant Physiol 64:1029- 1031

Hollander-Czytko H, Andersen JK, Ryan CA (1985) Vacuolar lo- calization of wound-induced carboxypeptidase inhibitor in po- tato leaves. Plant Physiol 78 : 76-79

Huynh TV, Young RA, Davis RW (1985) Constructing and screen- ing cDNA libraries in ,~gtl0 and 2gt11. In: Glover DM (ed) DNA cloning: A practical approach, vol I. IRL Press, Oxford, pp 49-78

Johnson R, Narvaez J, An G, Ryan CA (1989) Expression of pro- teinase inhibitors I and II in transgenic tobacco plants: Effects on natural defense against Manduca sexta larvae. Proc Natl Acad Sci USA 86:9871-9875

Keil M, Sanchez-Serrano J, Schell J, Willmitzer L (1990) Localiza- tion of elements important for the wound-inducible expression of a chimeric potato proteinase inhibitor II-CAT gene in trans- genic tobacco plants. Plant Cell 2 : 61-70

Kyte J, Doolittle RF (1982) A simple method for displaying the hydropathic character of a protein. J Mol Biol 157:105-132

Lerner DR, Raikhel RV 61989) Cloning and characterization of root-specific barley lectin. Plant Physiol 91 : 124-129

Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning, a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York

Mansson PE, Hsu D, Stalker DM (1985) Characterization of fruit- specific cDNAs from tomato. Mol Gen Genet 200:356-361

Martineau B, Smith H J, Dean C, Dunsmuir P, Bedbrook L, Mets LJ (1989) Expression of a C3 plant Rubisco SSU gene in regen- erated C4 Flaveria plants. Plant Mol Biol 13 : 419-426

Raikhel NV, Wilkins TA (1987) Isolation and characterization of a cDNA clone encoding wheat germ agglutinin. Proe Natl Acad Sci USA 84:6745-6749

Rees DC, Lipscomb WN (1982) Refined crystal structure of the potato inhibitor complex of carboxypeptidase A at 2.5 A resolu- tion. J Mol Biol 160:475-498

Ryan CA (1973) Proteolytic enzymes and their inhibitors in plants. Annu Rev Plant Physiol 24:173-196

Ryan CA (1981) Proteinase inhibitors. In: Marcus A (ed) The biochemistry of plants, vol 6. Academic Press, New York, pp 351-370

Ryan CA (1989) Proteinase inhibitor gene families: Strategies for transformation to improve plant defenses against herbivores. Bioessays 10:20-24

Ryan CA, Hass GM, Kuhn RW (1974) Purification and properties of a carboxypeptidase inhibitor from potatoes. J Biol Chem 249 : 5495-5499

Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain termination inhibitors. Proc Natl Acad Sci USA 74:5463- 5467

Schagger H, von Jagow G (1987) Tricine-sodium dodecyl sulfate- polyacrylamide gel electrophoresis for the separation of pro- teins in the range from 1 to 100 kDa. Anal Biochem 166: 368- 379

von Heijne G (1983) Patterns of amino acids near signal-sequence cleavage sites. Eur J Bioehem 133:1%21

Walker-Simmons M, Ryan CA (1980) Isolation and properties of carboxypeptidase from leaves of wounded tomato plants. Phy- tochemistry 19:43-47

Wilkins TA, Bednarek SY, Raikhel NV (1990) Role of propeptide glycan in post-translational processing and transport of barley lectin to vacuoles in transgenic tobacco. Plant Cell 2:301-313

Communicated by E. Meyerowitz

Note added in proof. The L. esculentum MCPI cDNA sequence has been assigned the accession number X59282 in the EMBL Data Library.