THE JOURNAL 0 1993 by The American Society for Biochemistry

OF BIOLOGICAL CHEMISTRY and Molecular Biology, Inc.

Vol. 266, No. 13, Issue of May 5, pp. 9817-9623,1993 Printed in U. S. A.

Rapid Agonist-mediated Phosphorylation of m3-Muscarinic Receptors Revealed by Immunoprecipitation*

(Received for publication, October 14, 1992, and in revised form, January 21, 1993)

Andrew B. Tobin4 and Stefan R. Nahorski From the Department of Pharmacology and Therapeutics, Leicester University, P.O. Box 138, Medical Sciences Building, University Road, Leicester LE1 9HN, United Kingdom

A specific antiserum against the human m3-musca- rinic receptor subtype was made by subcloning a var- iant region of the third intracellular loop of the m3- receptor (Ser34s-Le~463) into a bacterial expression plasmid that produced a fusion protein with glutathi- one S-transferase. In immunoblot studies this anti- serum identified the human m3-receptor expressed in transfected Chinese hamster ovary (CHO) cells (CHO- m3 cells, 1343 fmol/mg protein) as a diffuse band at approximately 97-110 kDa. In vivo labeling of the ATP pool in CHO-m3 cells with [32P]orthophosphate followed by immunoprecipitation of solubilized m3- receptors revealed that the unstimulated receptor ex- isted in a phosphorylated form. Incubation of CHO-m3 cells with the cholinergic agonist carbachol (1 mM) increased the phosphorylated state of the receptor dra- matically, primarily at serine. The time course for agonist-dependent phosphorylation was very rapid oc- curring within seconds of agonist addition and was maintained for at least 30 min. The muscarinic antag- onist atropine (10 p ~ ) inhibited agonist-stimulated phosphorylation. Neither forskolin (10 p ~ ) nor the calcium ionophore, ionomycin (1 p ~ ) , had any effect on the state of phosphorylation of the m3-receptor, elim- inating a role for CAMP-dependent protein kinase and Ca2+/calmodulin-dependent protein kinase in the ago- nist-dependent phosphorylation of m3-receptors. 48- Phorbol 12@-myristate 13a-acetate (100 nM) did in- crease m3-receptor phosphorylation, an effect that was inhibited by the selective protein kinase C inhibitor RO-3 18220 (10 pM). However, agonist-stimulated m3-receptor phosphorylation was not inhibited by RO-318220 indicating that protein kinase C was not involved in agonist-induced m3-receptor phosphoryl- ation. In conclusion the phosphorylation of m3-recep- tors, in v ivo, was increased following the application of muscarinic agonist or PMA. The response to agonist was mediated via a kinase distinct from protein kinase C, protein kinase A and Ca2+/calmodulin dependent protein kinase, whereas the effect of 4@-phorbol 128- myristate 13a-acetate was mediated by protein kinase C.

Phosphorylation is a fundamental regulatory mechanism employed by a variety of cell surface receptors including

* This work was supported by a program grant from the Wellcome Trust. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ To whom correspondence should be addressed. Tel.: 533-522922; Fax: 533-523996.

growth factor receptors (e.g. insulin receptor, epidermal growth factor receptor, and somatomedin C) and G-protein- linked receptors. Probably the most extensively studied of this latter group of receptors is the p-adrenoceptor where agonist-mediated phosphorylation by CAMP-dependent pro- tein kinase (PKA)’ and p-adrenergic receptor kinase, results in rapid receptor desensitization (1). The mechanism of p- adrenoceptor desensitization is widely considered as a classi- cal model for the role of phosphorylation in receptor desen- sitization.

Generally, the phosphorylated form of a receptor is thought to be a less efficient activator of its effector enzyme and therefore represents a desensitised state of the receptor. Re- cent studies have demonstrated that, in addition to the p- adrenoceptor, a number of other G-protein-linked receptors exist as phosphoproteins in the desensitized state. Phos- phorylation of the al-adrenoceptor in smooth muscle cells, for example, is associated with a reduction in receptor number at the plasma membrane and decreased norepinephrine-me- diated phosphoinositide hydrolysis (2). Similarly, a correla- tion has been made between 5 H T - 1 ~ receptor phosphorylation in transfected CHO cells and a decrease in receptor-mediated inhibition of adenylate cyclase (3). However, in the case of CCK receptors coupled to phosphoinositidase C (PIC) in rat pancreatic acinar cells a functional correlate with rapid ago- nist-induced receptor phosphorylation, recently reported by Klueppelberg et al. (4), has yet to be made. Collectively, however, it would appear from these studies that receptor phosphorylation is commonly employed in the regulation of G-protein-linked receptors.

The cholinergic-muscarinic receptor family consists of five receptor subtypes that are coupled to their effectors via G- proteins. ml-, m3-, and m5-receptor subtypes are efficiently coupled to PIC, via a pertussis toxin-insensitive G,-protein, and m2- and m4-receptors are coupled primarily to the inhi- bition of adenylate cyclase via Gi-protein (for review see Ref. 5). Work by Kwatra et al. (6, 7) has provided clear evidence for agonist-mediated phosphorylation of the cyclase-linked chick heart m2-muscarinic receptor. However, evidence for phosphorylation of muscarinic receptor subtypes linked to PIC is considerably less substantial.

Burgoyne first implicated phosphorylation in the regulation of mammalian-muscarinic receptors by demonstrating that decreased muscarinic-antagonist binding to rat cerebral syn-

The abbreviations used are: PKA, CAMP-dependent protein ki- nase; PMA, 4P-phorbol l2g-myristate 13a-acetate; CHO, Chinese hamster ovary; PKC, protein kinase C; Ins(1,4,5)P3, inositol 1,4,5- trisphosphate; IPTG, isopropyl-0-D-thiogalactopyranosid; PIC, phos- phoinositidase C; PBS, phosphate-buffered saline; HPLC, high-per- formance liquid chromatography; GTPyS, guanosine 5’-3-0- (thio)triphosphate. The company that supplies RO-318220 only gives out its structure not the full chemical name.

9817

9818 Phosphorylation of m3-Muscarinic Receptors

aptic membranes occurred only under phosphorylating con- ditions (8, 9). Since then, work on muscarinic receptors pu- rified from the porcine (10) and avian (11, 12) heart, and porcine cerebral cortex (13), have demonstrated that musca- rinic receptors can act as i n vitro substrates for PKC, PKA, and P-adrenergic receptor kinase. The physiological signifi- cance of these studies is, however, difficult to determine in light of the high concentrations of receptor/kinase used, the necessity to reconstitute the receptor in a simple pseudo- membrane environment, and the probability that these prep- arations possess more than one muscarinic receptor subtype.

Studies using tumor-promoting phorbol esters have une- quivocally established that PKC-mediated protein phos- phorylation plays a significant role in muscarinic receptor function. PKC activation in the neuroblastoma cell line SH- SY5Y, that expresses predominantly the m3-muscarinic receptor subtype (14), shifts the muscarinic receptor agonist affinity to the low affinity state (15). Furthermore, in a number of cell lines muscarinic receptor-mediated inositol phosphate production is diminished (16) and in some cases completely abolished (17, 18, 19) by pretreatment with phor- bo1 ester. It is not, however, possible to establish from these studies whether PKC is acting at the level of the receptor or downstream of the receptor. Hence, the question of whether muscarinic receptors, other than avian m2 receptors, are phosphorylated i n vivo has yet to be answered.

Using CHO cells transfected with the human m3-musca- rinic receptor cDNA we have recently identified a rapid de- sensitization event, in which, a 5-min pre-exposure to mus- carinic agonist reduces the peak inositol 1,4,5-trisphosphate (Ins(1,4,5)P3) response seen within the first few seconds of a subsequent application of agonist (20). In order to investigate the role receptor phosphorylation might play in m3-receptor desensitization we have raised an antiserum specifically to the m3-receptor subtype for use in immunoprecipitation stud- ies. Using this approach, we report here a rapid agonist- mediated phosphorylation of the m3-muscarinic receptor i n vivo.

EXPERIMENTAL PROCEDURES

Materials--a-Minimal essential medium, newborn calf serum, pen- icillin, streptomycin, fungazone, and tissue culture flasks were ob- tained from GIBCO. [32P]Orthophosphate (10 mCi/ml) and amplify from Amersham. Protein A-Sepharose CL-4B, glutathione-Sepharose affinity matrix, pGEX-2T, and DNA modification enzmyes were obtained from Pharmacia LKB Biotechnology Inc. Nitrocellulose was from S & S. Affi-Gel 10 was from Bio-Rad. [35S]Methionine (1000 Ci/mmol) was from ICN. X-ray film was from Genetic Research Instrumentation. All other reagents were obtained from Sigma.

Construction of Bacterial Expression Plasmid-Deoxynucleotide primers were prepared for use in the polymerase chain reaction to amplify a region of the human muscarinic m3-receptor cDNA coding for the third intracellular loop (%-loop) between Ser345 and inclusive. The deoxynucleotide primer sequences were as follows; 5'- primer CCCGGATCCCTGGAGAACTCCGCC; 3"primer CCCGA- ATTCCAGAGTGGCTTCCTTGAAG. The DNA fragment resulting from the polymerase chain reaction reaction contained a 5"BamHI site and a 3'-EcoRI site enabling the fragment to be subcloned into the BamHIIEcoRI sites of the bacterial expression plasmid pGEX- 2T (Pharmacia). This subcloning procedure produced the plasmid pEX-m3, where the region coding for amino acids Ser345-Leu463 of the m3-receptor were cloned down stream, and in frame, with the coding sequence for glutathione S-transferase contained in pGEX-2T. In- duction of pEX-m3 transformed Escherichia coli (DH5-a) with isopro- pyl-P-D-thiogalactopyranosid (1 mM) resulted in the production of a fusion protein of approximately 43.5 kDa (glutathione S-transferase = 27.5 kDa, Ser345-Le~463 = approximately 16 kDa). Fusion protein was purified over a glutathione-Sepharose affinity matrix (Pharma- cia) before being used for immunization.

Large Scale Bacterial Expression and Fusion Protein Purification- A 5-ml saturated culture of pEX-m3 transformed bacteria grown in

NZY medium supplemented with ampicillin (100 rg/ml) was used to inoculate 400 ml of NZY medium (minus ampicillin). The culture was allowed to reach log phase (Am = 0.6) before induction with IPTG (1 mM final). The induction was carried out for 4 h a t 37 "C (300 rpm) after which the bacteria were harvested by centrifugation (1200 X g for 10 mins, 4 "C), and the pellets were resuspended in 24 ml of ice-cold 10 mM Tris, 10% glycerol, 10 mM dithiothreitol (pH 7.5). Bacteria were lysed by sonication (3 X 10-s pulses at maximum setting with microprobe), and bacterial occlusion bodies were col- lected by centrifugation (40,000 X g for 10 mins, 4 "C). The pellet was dissolved in 8 M urea (20 ml) at room temperature for 15 min and then cleared by centrifugation (10,000 X g, 10 min, 4 "C). The sample was dialyzed against; (i) 1 M urea 2-4 h, (ii) 0.1 M urea overnight, and (iii) two changes of PBS over 4 h. The sample was placed over a 6-ml glutathione-Sepharose affinity column equilibrated with PBS, and the fusion protein was eluted with 10 ml of elution buffer (5 mM glutathione, 50 mM Tris, pH 8.0) collected in 2-ml fractions. The final yield of purified fusion protein from a 400-ml bacterial culture was 8 mg.

Immunization and Antisera Purification-Primary immunization of two New Zealand White rabbits was carried out by subcutaneous injection (six sites pre-animal) of 1.5 ml of fusion protein (0.6 mg/ ml) suspended in an equal volume of complete Freund's adjuvant. Booster immunizations were carried out every 4 weeks by i.v. injection of 1 ml of fusion protein. Test bleeds were taken 2 weeks after each immunization. Blood was allowed to clot at room temperature and then centrifuged (10,000 X g, 15 min, 4 "C). Serum was collected and tested for immunoreactivity in immunoblots of bacterial extracts from pEX-m3-transformed, pGEX-ST-transformed, and nontrans- formed bacteria. Animals were sacrificed by cardiac puncture after seven immunizations. Antibodies were purified from serum proteins by protein A-Sepharose affinity chromatography. Antibodies raised to epitopes on the glutathione S-transferase portion of the fusion protein were then removed by passing the antisera through a gluta- thione S-transferase affinity column. This was prepared by cross- linking bacterially expressed glutathione S-transferase to Affi-Gel 10 matrix (Bio-Rad). During antisera characterization acetone powders from transformed and nontransformed E. coli were prepared as de- scribed previously (22). The results described throughout this publi- cation were obtained using one of the antiserum designated 332.

Immunoblot Studies-Membranes from nontransfected CHO cells and cells transfected with human m3-receptor cDNA (21) were pre- pared in the following way. Cells were harvested in PBS, 0.5 mM EDTA and pelleted. The pellet was resuspended in 10 ml of homog- enization buffer (10 mM Tris, 10 mM EDTA (pH 7.4) + protease inhibitors (10 pg/ml aprotinin, 10 pg/ml soybean trypsin inhibitor, 1 pg/ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride)) per con- fluent flask of cells. Cells were homogenized with a 1 X 12-s pulse in an Ultraturrax and centrifuged at 40,000 X g for 15 min (4 "C). Membranes were resuspended in homogenization buffer to a final concentration of 1 mg of protein/ml. Membrane-associated proteins were resolved on 8% SDS-PAGE and electroblotted on S & S nitro- cellulose at 0.65 mAmp/cmZ gel for 1 h. Blots were blocked in TBST (20 mM Tris, 500 mM NaCl, 0.05% Tween-20, pH 7.5) + 5% non-fat dried milk for 1 h at room temperature or 4 "C overnight. Antiserum 332 (1:600) diluted in TBST + 5% non-fat dried milk was then applied for 1-2 h at room temperature. Blots were washed in TBST and incubated with secondary antibody (goat-anti rabbit IgG-alkaline phosphatase conjugated; 1:5000 dilution) for 30-40 min at room temperature. Blots were washed, and immunoreactivity was visualized using a standard protocol.

In Vivo 35S-Labeling and Immunoprecipitation-Confluent flasks of CHO or CHO-m3 cells (175 cm2) were washed in methionine-free medium (supplemented with 100 mM HEPES, pH 7.4). TO each flask of cells 100 pCi of [35S]methionine in 10 ml of methionine-free/ HEPES medium was added, and the cells were incubated for 4 h at 37 "c . Cells were then washed in PBS and harvested using PBS/O.5 mM EDTA and pelleted, and membranes were prepared as described above. Membranes were resuspended in solubilization buffer (10 mM Tris, 10 mM EDTA, 500 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 0.5% deoxycholate (pH 7.4) + protease's inhibitors) SO that the protein concentration = 1 mg of protein/ml. Membranes were soh- bilized on ice for 30 min and then cleared by centrifugation in a Microfuge. Solubilized receptors (500 pl) were immunoprecipitated by incubation with antiserum 332 (10 pl) for 1 h at 4 "c. Isolation of immune complexes was carried out using protein A-Sepharose beads (50 ~ l ) , essentially as described by Harlow and Lane (22). Proteins were resolved on 8% SDS-PAGE, gels were impregnated with Amplify

Phosphorylation of m3-Muscarinic Receptors 9819

(Amersham), dried, and subjected to autoradiography (-70 "C) using blue sensitive x-ray film (GRI) with intensifying screens.

Immunoblot Studies of Bacterial Extracts-1-ml saturated bacterial cultures were pelleted in a microcentrifuge and resuspended in 200 pl of Tris 10 mM, 10% glycerol (pH 7.4). To this suspension 200 pl of SDS-PACE (X 2) sample buffer was added, and an aliquot was resolved by 12% SDS-PAGE. Transfer on to nitrocellulose and blot- ting were carried out as described above except that the primary antiserum was used at a 1:5000 dilution.

In Vivo 3zP-Lubeling and Immunoprecipitation-CHO cells were harvested using PBS/O.5 mM EDTA and washed twice in phosphate free Krebs/HEPES buffer (composition (in millimolar): 118 NaCI, 4.3 KCI, 1.17 MgSO,. 7Hz0, 1.3 CaCI2.2Hz0, 0.34 NaHC03, 11.7 glucose, 10 mM HEPES (pH 7.4)) and resuspended to 1-3 X lo6 cells/ ml in phosphate-free Krebs/HEPES buffer. [32P]Orthophosphate (50 pCi/ml) was then added, and the cell suspension was aliquoted into 1-ml aliquots before being left to incubate for 60 min at 37 "C. Stimulatory agents (e.g. 1 mM carbachol) were then added directly to the cell suspensions. Stimulation was terminated by either rapid centrifugation, aspiration of medium, and application of 1 ml of ice- cold phosphate-free Krebs/HEPES medium or, in the case of the carbachol-stimulated time course, 5 ml of ice-cold phosphate-free Krebs/HEPES buffer was added directly to the cell suspension. Cells were then harvested and resuspended in 1 ml of solubilization buffer and left on ice for 30 min. The sample was then cleared by centrifu- gation in a Microfuge, and 2 pl of purified antiserum 332 was added for 60 min. The immune complexes were isolated on protein A- Sepharose beads and resolved by 8% SDS-PAGE. The gels were dried and subjected to autoradiography.

Following isolation of the immune complex on protein-A Sepharose beads the supernatant did not contain any immunoreactivity towards the m3-receptor when tested in immunoblots. This is in contrast to supernatants obtained from control immunoprecipitates where anti- serum 332 was omitted. These data indicate that the majority (>80%, the estimated detection limit of this procedure) of the m3-receptor had been immunoprecipitated which is equivalent to -0.35 pmol of receptor/million cells.

Determination of Specific Activity of ATP Pool in CHO-m3 C e h - Following labeling of intracellular ATP pools with [R2P]orthophos- phate, as described above, CHO-m3 cells were washed (1 X ) in ice- cold phosphate-free Krebs/HEPES buffer and resuspended in ho- mogenization buffer. Cells were lysed by rapid freezing in ethanol/ dry ice slurry. Cell debris was cleared by centrifugation, and the total ATP content together with the activity associated with ATP was determined by isolating ATP on a Partisil lOSAX anionic exchange HPLC column. Sample or standard was loaded in a total injection volume of 2 ml. A gradient of 0-100% 1 M NHIHzP04 (pH 3.7) was run over 60 min (1 ml/min). Under these conditions, intracellular ATP runs as a single peak with a retention time of 30 min and is detected by UV absorbance (254 nm). Using this approach the specific activity of the ATP pool was determined to be 840 & 161 cpm/pmol ATP (n = 3).

Phosphoamino Acid Analysis-Immunoprecipitated radiolabeled receptors were excised from dried gels and extracted in 0.05 M ammonium bicarbonate (pH 7.3-7.6). Sample was trichloroacetic acid (lOO%)-precipitated, lyophilized, and hydrolyzed in 6 N HCI for 1 h at 110 "C. Samples were then lyophilized, and phosphoamino acids were resolved by one-dimensional thin-layer electrophoresis in a 50:156:1794, 88% formic acid:glacial acetic acidHzO buffer (pH 1.9), essentially as described by Cooper et al. (23).

Miscellaneo&q-Protein concentrations were assayed using the Bradford method (26). Densitometric analysis of autoradiographs were carried out on a LKB Ultrascan XL I laser densitometer.

RESULTS

Characterization of the &-receptor Antiserum 332"Im- munization of rabbits with a fusion protein (Fig. 1) consisting of glutathione S-transferase fused at its C-terminal end with a variant portion of the third intracellular loop of the m3- muscarinic receptor (Ser346-Le~463), produced a high titer anti- serum (designated 332) within seven immunizations. Crude antiserum a t 1:5000 dilution identified a single band corre- sponding to the fusion protein in pEX-m3 transformed bac- teria and to glutathione S-transferase in pGEX-2T (the par- ent vector) transformed bacteria (Fig. 2). No immunoreactiv-

47 -

33 -

m E

W X

u aJ L - L 3 n

24 - FIG. 1. 8% SDS-PAGE of crude bacter id lysaatee prepared

from pEX-m3 and pGEX-ST transformed bacteria. Prior to lyses bacteria were stimulated with k 1 mM IPTG for 4 h at 37 'C (300rpm) to induce expression of the fusion protein in pEX-m3 transformed bacteria (running at approximately 43.5 kDa) and glu- tathione S-transferase ((;ST) in pCEX-2T-transformed E. coli (run- ning at 27.5 kDa). The far right-hond lane is a sample of purified fusion protein prepared on a glutathione affinity column (see text). Proteins were resolved by 12% SDS-PACE. Positions of prestained molecular mass markers are indicated in kDa.

A 8 C 1 2 - 3 1 2"3 , 1 2 3

- 1

47- " -.

33-

24-

FIG. 2. Immunoblota using crude antiserum ( A ) , antiserum purified over a glutathione S-transferase affinity column to remove antibodies specific to glutathione S-transferase ( B ) and purified antiserum preabsorbed with acetone powder derived from pEX-m.7 trannformed bacteria (C). I ~ n e I . lysate from bacteria expressing fusion protein; Innc. 2, lysate from bacteria expressing glutathione S-transferase; lone 3 , lysates from non-trans- formed bacteria. Proteins were resolved by 12% SDS-PAGE. Posi- tions of prestained molecular mass markers are indicated in kDa.

ity was detected in nontransformed E. coli (Fig. 2). Purification of the antiserum over a glutathione S-transferase affinity column removed antibodies raised to epitopes on glutathione S-transferase as evident by the loss in immuno- reactivity to extracts from pGEX-2T transformed E. coli (Fig. 2 B ) . Immunoreactivity was, however, maintained for the fu- sion protein demonstrating the presence of m3-receptor an- tibodies. Immunoreactivity to the fusion protein was com- pletely removed followingpreabsorption of the antiserum with acetone powder from pEX-m3 transformed bacteria (Fig. 2C) but was unaffected by preabsorption with acetone powder derived from pGEX-2T transformed and nontransformed E. coli.

Since antiserum 332 was raised against a variant region of the m3-receptor, it was anticipated to be selective for the m3-

9820 Phosphorylation of m3-Muscarinic Receptors

receptor subtype. Fig. 3 demonstrates that antiserum 332 specifically reacted with the membrane preparation from CHO-m3 cells but not with preparations from CHO cells transfected with ml-, m2-, m4-, and m5-receptor cDNAs. In Fig. 3 the membranes were normalized to 1 mg of protein/ml before being load on to 8% SDS-PAGE gel. Similar results to that in Fig. 4 were obtained if the membranes were normalized to give an equal number of expressed receptors per lane.

Immunoblot and Immunoprecipitation Studies of CHO-m3 Cells-Purified antiserum 332 identified a diffuse immuno- reactive band at approximately 97-110 kDa in immunoblots of membrane preparations from CHO cells expressing recom- binant human m3-receptors (CHO-m3 cells 1343 k 46.8 fmol/ mg protein (20, 21)). The antiserum showed no immunoreac- tivity toward nontransfected CHO cells (Fig. 4, lane A ) .

Immunoprecipitation of solubilized CHO-m3 membranes from cells where the protein content had been ubiquitously radiolabeled with [35S]methionine revealed a diffuse band running at approximately 97-110 kDa (Fig. 4, lane R). This band was present in immunoprecipitates from CHO-m3 cells but not from nontransfected CHO cells. Furthermore, this band was exactly superimposable with the specific immuno- reactive band identified in immunoblots from CHO-m3 cell membranes, therefore identifying this band as immunoprecip- itated m3-receptor. Note also the specific band in CHO-m3 immunoprecipitate running a t approximately 200 kDa. This may represent an m3-receptor complex; this possibility is presently under investigation.

In Viuo Phosphorylation of the m3-receptor-Immunopre- cipitation of the m3-receptor from CHO-m3 cells radiolabeled with [32P]orthophosphate revealed that the m3-receptor exists as a phosphoprotein under basal conditions (Fig. 5). Car- bachol treatment (15 min; l mM) increased the incorporation of 32P label into immunoprecipitated m3-receptors (Fig. 5). The stoichiometry of phosphorylation increased from an es- timated -0.20 mol of phosphate/mol receptor to -2.0 mol of phosphate/mol receptor (n = 3). Stimulation of nontrans- fected CHO cells for an equal time period showed no detect- able immunoprecipitated proteins. The inclusion of the mus- carinic receptor antagonist atropine (10 p ~ ) , 10 min prior to agonist application, dramatically inhibited phosphorylation of the m3-receptor (Fig. 6). The effect of 1 mM carbachol was not, however, completely inhibited by atropine. This probably reflects the high concentration of carbachol used since the effect of 0.1 mM carbachol was completely inhibited by atro- pine at 10 p~ (data not shown).

The time course for m3-receptor phosphorylation was ex- tremely rapid occurring within seconds of agonist application

A B C D E F F"""

106 80

49

FIG. 3. Immunoblot of membrane preparations from non- transfected CHO cells (lane A ) and from CHO cells expressing recombinant m l - (lane B ) , m2- (lane C), m3- (lane D) , m4- (lane E ) , and mS- (lane F ) receptor subtypes. 10 pg membrane protein/lane. Proteins were resolved by 8% SDS-PAGE. Positions of prestained molecular mass markers are indicated in kDa.

A m E 4 n v u m -

9 2

68

0

kDa A B C D

FIG. 4. a, immunoblot uaing purified antiserum 332 (1:600 dilu- tion) to identify the m3-receptor in a CHO-m3 cell membrane prep- aration. 10 pg membrane protein/lane. Lane I , CHO-m3 cell mem- branes; lane 2, nontransfected CHO cell membranes. b, immunopre- cipitation of solubilized memhrane proteins from cells metabolically labeled with [%]methionine. Lune A, total soluhilized membrane proteins from CHO-m3 cells; lane R, total soluhilized memhrane proteins from nontransfected CHO cells: lane C, immunoprecipitated proteins from CHO-m3 cell membranes; lane D, immunoprecipitated proteins from nontransfected CHO cell membranes. Proteins were resolved by 8% SDS-PAGE. Positions of preatained molecular mass markers are indicated in kDa.

and being maintained for a t least 30 min (Fig. 7). Phosphoamino acid analysis revealed that following agonist

stimulation for 15 min the majority of the incorporated "P label was present as phosphoserine (Fig. 8).

Characterization of the &-receptor Kinase"m3-receptor phosphorylation is not increased by the calcium ionophore, ionomycin (1 p ~ ) , or by stimulation of adenylate cyclase with forskolin (10 pM, Fig. 9). Pretreatment with thapsigargin (2 p ~ ) , an inhibitor of intracellular Ca2'-ATPase ('251, for 15 min prior to agonist application, a procedure reported to discharge intracellular Ins( 1,4,5)P3-sensitive calcium stores (25), had no effect on the ability of carbachol to enhance phosphorylation of the m3-receptor (Fig. 9). m3-receptor phosphorylation is, however, increased dramatically by treat- ment with the active phorbol ester PMA (100 nM). Inclusion of the selective PKC inhibitor RO-381220 (10 p ~ ) 10 min prior to phorbol ester addition completely inhibits PMA- mediated m3-receptor phosphorylation but, significantly, has no effect on agonist-mediated phosphorylation (Fig. 9).

DISCUSSION

The primary finding reported here is that m3-muscarinic receptors expressed in transfected CHO cells undergo rapid serine phosphorylation following agonist receptor occupation. Although previous studies, using purified preparations from cardiac and nervous tissue, have demonstrated that musca- rinic receptors can act as in vitro substrates to a number of protein kinases (10-13). this report represents the first dem- onstration that a specific muscarinic receptor subtype coupled to phosphoinositide hydrolysis is phosphorylated in uiuo. This

Phosphorylation of m3-Muscarinic Receptors 982 1

lo 1

FIG. 5. Immunoprecipitation of saP-labeled m3-receptors demon- strating enhanced receptor phos- phorylation following a 16-min ap- plication of carbachol (1 mM). Lanes A , R, and C in the autoradiograph were analyzed by desensitometry (x-axis units are arbitrary). Lane A , nontransfected CHO cells stimulated with carbachol for 15 min; lane U, CHO-m3 cells minus carbachol; lane C, CHO-m3 cells stimu- lated with carbachol for 15 min. Proteins were resolved by 8% SDS-PACE. Posi- tion of prestained molecular mass mark- ers are indicated in kDa.

END OF GEL Distance from origin ORIGIN

lo 1 A B PI I P I I c D

FIG. 6. Immunoprecipitation of saP-labeled m3-receptorn demon- strating inhibition of carbachol (1 mM) stimulated m3-receptor phos- phorylation by atropine (10 pM). CHO-rn3 cells were either stimulated without ( A ) or with (R) carbachol for 15 min. Solubilized memhrane proteinn were then immunoprecipitated with im- mune (I) or preimmune ( P I ) antiserum 332. Atropine applied 10 min prior to carbachol addition inhibited the phos- phorylation mediated by agonist (C). Lane I), nontransfected CHO cells ntim- ulated for 15 min with carbachol; lanes AUI, U W , and C were analyzed by den- sitometry (x-axis units are arbitrary). Proteins were renolved by 8% SDS- PAGE.

END OF GEL Distance from origin ORIGIN

has been made possible by the use of an m3-receptor specific antiserum, employed in immunoprecipitation studies to facil- itate the single step purification of m3-receptors.

The recombinant human m3-receptor expressed in CHO cells (CHO-m3 (21)) was identified in immunoblots as a diffuse band running at approximately 97-110 kDa (see Fig. 4). The size of the m3-receptor reported here is in close agreement with that identified from labeling studies using the muscarinic ligand [3H]pr~pylben~ilylcholine mustard (26,27)

that covalently binds to muscarinic receptors. Since the amino acid backbone for the human m3-receptor has a molecular mass of 66 kDa. the high molecular weight of the m3-receptor expressed in CHO-m3 cells probably reflects post-transla- tional modification of the receptor. There are four potential N-glycosylation sites (Am-X-Ser/Thr) at the N-terminal ta i l of the human m3-receptor, and at the C-terminal tail, cysteine 559, is thought to be a site of palmitylation (5). Interestingly, treatment of CHO-m3 cells with muscarinic agonist for 30

9822 Phosphorylation of m3-Muscarinic Receptors

0 2” 5” 10”l’ 5’ 15’30’ U 8

FIG. 7. Time course for agonist-dependent phosphorylation of the m3-receptor. Lane CHO, nontransfected CHO cells stimu- lated for 15 min with carbachol (1 mM).

4 PHOSPHATE

id SERIN[-

4 TYROSINE/ THREONINE

4 ORIGIN - +

FIG. 8. Phosphoamino acid analysis of phosphorylated m3- receptor protein isolated from CHO-m3 cells stimulated with 2 1 mM carbachol. Position of phosphoserine, phosphotyrosine, and phosphothreonine were determined by running cold standards (2 pg) and staining with ninhydrin.

lnl FIG. 9. Characterization of the m3-receptor kinases. a: lanes

A, control, nonstimulated, CHO-m3 cells; lane B, 1 mM carbachol stimulation for 15 min; lane C , PMA (100 nM) stimulation for 15 min; lane D, forskolin (10 p ~ ) stimulation for 15 min; lane E , thapsigargin (2 PM) pretreatment for 15 min followed by carbachol stimulation for 15 min; lane F, RO-318220 (10 p ~ ) applied 10 min prior to carbachol stimulation for 15 min. b lane G, control, nonstimulated CHO-m3 cells; lane H, PMA treatment for 15 min; lane I , RO-318220 applied 10 min before a 15-min stimulation with PMA; lane J , ionomycin (1 BM) 15 min. The results are representative of two to three experiments with each reagent.

min did not change the gel mobility of the m3-receptor in immunoblots suggesting that phosphorylation is not a major contributing factor to the high molecular weight of m3- receptors.

Immunoprecipitation studies isolated a diffuse band from [D6S]methionine-labeled CHO-m3 cells that ran at approxi- mately 97-110 kDa and that was exactly superimposable with the immunoreactive band in immunoblots of CHO-m3 mem- branes. This immunoprecipitated band was not present in nontransfected CHO cells. These data demonstrate that the antiserum could successfully isolate m3-receptors in a single step from CHO-m3 cells where the protein content had been ubiquitously radiolabeled.

Following in oiuo labeling of the ATP pool with [“PI orthophosphate, phosphorylation of m3-receptors in CHO- m3 cells could be followed by immunoprecipitation and au- toradiography. We demonstrate here that under basal condi- tions the m3-receptor exists as a phosphoprotein. Stimulation of intact CHO-m3 cells with 1 mM carbachol for 15 min dramatically increases the phosphorylated state of the recep- tor. The stoichiometry of phosphorylation increased from -0.20 mol of phosphate/mol of receptor in the nonstimulated state to -2.0 mol of phosphate/mol receptor. This effect was inhibited by the muscarinic antagonist atropine. Agonist- dependent m3-receptor phosphorylation occurred with a rapid (seconds) time course. Phosphoamino acid analysis revealed that enhanced phosphorylation occurred primarily on serine. These data, together with the fact that nontransfected CHO cells stimulated with carbachol for 15 min contained no immunoprecipitated radiolabeled proteins, indicates that phosphorylation of the m3-receptor is enhanced by agonist occupation of the receptor.

Activation of m3-receptors in CHO-m3 cells results in a rapid rise in Ins(1,4,5)P3 that correlates with an increase in free intracellular calcium (20). This is consistent with the established role of Ins(1,4,5)P3 acting at the Ins(1,4,5)P3 receptor to mobilize intracellular calcium stores (28). An attractive candidate, therefore, for the m3-receptor kinase is calcium/calmodulin-dependent protein kinase, particularly since previous studies have suggested a role for calcium/ calmodulin in the regulation of muscarinic receptors from rat cerebral cortex (9, 29). However, the data does not support this hypothesis, since application of the calcium ionophore, ionomycin, a t concentrations that increase free intracellular calcium had no effect on m3-receptor phosphorylation. Fur- thermore, pretreatment of CHO-m3 cells with thapsigargin a t a concentration that would discharge intracellular calcium stores (25 ) thus inhibiting the sharp rise in intracellular calcium triggered by m3-receptor mediated Ins(1,4,5)Pa gen- eration, did not effect agonist-dependent receptor phosphoryl- ation.

Ins(1,4,5)P3 is one of two products of phosphoinositide 4,s- bisphosphate hydrolysis, the other being diacylglycerol which is a potent activator of PKC (30). There is now considerable evidence linking PKC activation with the regulation of mus- carinic receptor function and in particular with receptor de- sensitization. Short term (15 min) treatment of the astrocy- toma cell line 1321N1, for example, completely eliminates muscarinic receptor-mediated inositol phosphate accumula- tion (19). Similarly, PMA pretreatment of fibroblasts express- ing recombinant m3-receptors reduces muscarinic-mediated PIC responses to undetectable levels (17). Despite the fact that muscarinic receptor stimulation results in activation of PKC (as determined by translocation of PKC to the plasma membrane (31)) the mechanism of agonist-mediated receptor desensitization is distinct from PKC-dependent receptor de-

Phosphorylation of m3-Muscarinic Receptors 9823

sensitization. Agonist-mediated desensitization is generally attributed to muscarinic receptor sequestration and down- regulation (32-34), which is in contrast to PKC-mediated desensitization that appears to occur independently of a de- crease in cell surface receptor number (Refs. 15-17, although see Ref. 31). Furthermore, purified heart muscarinic receptors have been shown to act as in vitro substrates for PKC (1 1). In reconstitution studies designed to investigate the interac- tion between heart muscarinic receptors and Go. It has re- cently been reported that the PKC phosphorylated form of heart muscarinic receptors is less able to mediate GTPyS binding and GTPase activity of Go (35). It appears, therefore, that PKC acting at the level of the receptor can effect mus- carinic receptor/(=-protein interactions in vitro (11, 35).

In the present study we demonstrate that the phorbol ester, PMA, is able to enhance the phosphorylation of m3-receptors in CHO-m3 cells. This effect is mediated by PKC since the selective PKC inhibitor RO-318220 (36) is able to completely inhibit the action of PMA. However, at the same concentra- tion, RO-318220, does not effect agonist-mediated receptor phosphorylation demonstrating that the kinase activated by agonist occupation of m3-receptors is not PKC. It is possible that PKC and the kinase that phosphorylates the agonist- occupied muscarinic receptor phosphorylate the receptor at different sites and that this is the basis for the different mechanisms of agonist-mediated and PKC-mediated receptor desensitization.

Early studies on rat brain synaptic membranes suggested that PKA is involved in muscarinic receptor regulation (8). Furthermore, reconstituted avian m2 receptors are phos- phorylated, in vitro, by PKA in an agonist-dependent manner if Gi-protein is introduced into the reconstituted system (10). Since muscarinic receptors coupled to PIC are known to stimulate adenylate cyclase activity in some cell types (see Ref. 5 ) we tested the ability of forskolin, a potent activator of adenylate cyclase, to enhance the phosphorylation of the m3- receptor. At a high dose, forskolin did not increase m3- receptor phosphorylation therefore eliminating PKA’s direct involvement in m3-receptor phosphorylation.

It appears, from these data, that the kinase responsible for agonist-dependent m3-receptor phosphorylation is distinct from PKA, PKC, and calcium/calmodulin-dependent protein kinase. The same properties have been reported for the kinase involved in the phosphorylation of the cyclase-linked avian heart m2 receptor (7). This raises the possibility that a single kinase phosphorylates m3- and m2-receptors (and possibly ml-, m4-, and m5-receptors). Clearly further detailed char- acterization of the m3-receptor kinase and m2-receptor kinase are required to clarify this point.

Based on analogy with the P-adrenergicladenylate cyclase system, receptor phosphorylation is intuitively linked with receptor desensitization. Phosphorylation of the m2 receptor is associated with a decrease in receptor affinity and a decrease in carbachol-mediated negative inotropic effect (6, 7). Simi- larly, agonist-dependent phosphorylation of the al-adreno- ceptor in muscle cells (2) is associated with receptor internal- ization.

A recent study from our laboratory has identified the de- sensitization of m3-receptor-mediated PIC responses follow- ing a short 5-min pre-exposure of CHO-m3 cells to muscarinic agonist (20). The desensitization response involves both a diminution of m3-receptor-mediated Ins( 1,4,5)P3 production and increases in free intracellular calcium (20). The rapid onset of m3-receptor desensitization and m3-receptor phos- phorylation suggests that the two process may be linked,

although, clearly further studies are necessary. We are pres- ently assessing the activity of m3-receptor mutants lacking putative phosphorylation sites in an attempt to dissect the role that agonist-mediated phosphorylation may play in m3- receptor regulation.

In summary, this study demonstrates: (i) m3-receptors identified in immunoblots of membranes prepared from CHO cells expressing recombinant m3-receptors exist as a diffuse band at 97-110 kDa suggesting the receptor undergoes post- translational modification; (ii) in the resting state the m3- receptor in vivo is a phosphoprotein; (iii) following agonist stimulation the phosphorylation state of the m3-receptor is dramatically enhanced with a very rapid time course (sec- onds); (iii) the agonist-dependent muscarinic receptor kinase involved phosphorylates the m3-receptor on serine and ap- pears to be distinct from PKC, PKA, and Ca*’/calmodulin- dependent protein kinase; (iv) PKC-activation increased m3- receptor phosphorylation in an agonist-independent manner.

Acknowledgments-We are grateful to Dr. N. Buckley (National Institutes of Health, Mill Hill, London) for providing CHO cell transfects and Dr. R. Wojcikiewicz for many helpful discussions.

1.

2.

3. 4.

5.

6. 7.

8.

10. 9.

11. 12.

13. 14.

15.

16.

17.

18. 19.

20.

21.

22.

23.

24. 25.

26.

27. 28. 29.

30. 31.

32.

33. 34.

35.

36.

REFERENCES Hausdorff, W. P., Caron, M. G., and Lefkowitz, R. J. (1990) FASEB J 4 ,

Leeh-Lundherg, L. M. F., Cotecchia, S., DeBlasi, A,, Caron, M. G., and

Raymond, J. (1991) J. Biol. Chem. 266,14747-14753 Klueppelberg, U. G., Gates, L. K., Gorelick, F. S., and Miller L. J. (1991)

Hulme, E. C., Birdsall, N. J. M., and Buckley, N. J. (1990) Annu. Rev.

Kwatra, M. M., and Hosey, M. M. (1986) J. Biol. Chem. 261,12429-12432 Kwatra, M. M., h u n g , E., Maan, A. C., McMahon, K. K., Ptasienski, J.,

Burgoyne, R. (1980) FEBS Lett. 122,288-292 Green, R., and Hosey, M. M. (1987) J. Biol. Chem. 262,16314-16321

Burgoyne, R. (1981) FEBS Lett. 127,144-148 Rosenhaum, L. C., Malencik, D. A., Anderson, S. R., Tota, M. R., and

Richardson, R. M., and Hosey, M. M. (1990) Biochemistry 29,8555-8561 Kwatra, M. M., Benovic, J. L., Caron, M. G., Lefkowitz, R. J., and Hosey,

Haga, K., Haga, T., and Ichiyama, A. (1990) J. Neurochem. 6 4 , 1639-1644 Wall, S. J., Yasuda, R. P., Li, M., and Wolfe, B. B. (1991) Mol. Phurmacol.

Serra. M.. Smith. T. L.. and Yamamura. H. I. (1986) Biochem. BioDhvs.

2881-2889

Lefkowitz, R. J. (1987) J. Biol. Chem. 262,3098-3105

J. Biol. Chern. 266,2403-2408

Phurmncol. Toxicol. 3 0 , 633-673

Schimerlik, M. I. (1987) Biochemistry 26,8183-8188

M. M. (1989) Biochemistry 28,4543-4547

4 0 , 783-789

Res. Cokmun. 140,160-166

J. (1985) Biochem. Biophvs. Res. Commun. 127,310-317

. . I _

Vicentini, L. M., Virgilio, F. D., Amhrosini, A,, Pozzan, T., and Meldolesi,

Felder, C.,’Poulter, M. 0.; and Wess, J. (1992) Proc: Natl. Acad. Sci. Li. S. A.

Kopp, R., Mayer, P., and Pfeiffer, A. (1990) Biochern. J. 269,73-78 Orellana, S. A,, Solski, P. A,, and Brown, J. H. (1985) J. Biol. Chem. 2 6 0 ,

Tohin, A. B, Lambert, D. G., and Nahorski, S. R. (1992) Mol. Phnrmucol.

Buckley, N. J., Bonner, T. I., Buckley, C. M., and Brann M. R. (1989) Mol.

Harlow, E., and Lane D. (1984) Antibodies: A Laboratory Manual, Cold

Cooper, J. A., Sefton, B. M., and Hunter, T. (1983) Methods Enzymol. 9 9 ,

8 9 , 509-513

5236-5239

42,1042-1048

Phurrnacol. 35,469-476

Spring Harbor Laboratory, Cold Spring Harbor, NY

Bradford, M. M. (1976) Anal. Biochem. 72 , 248-252 Thastrup, O., Cullen, P. J., Drobak, B. K., Hanley, M. R., and Dawson, A.

Buck, M. A,, and Fraser, C . M. (1990) Biochem. Bcophys. Res. Commun.

Fisher, S. K., and Heacock, A. M. (1988) J. Neurochem. 50,984-987 Berridge, M. J., and Imine, R. F. (1989) Nature 3 4 1 , 197-204 Ho, A. K. S., and Wang, J. H. (1985) Biochem. Biophys. Res. Cornmun.

Nishizuka, Y. (1988) Nature 334,661-665 Liles, W. C., Hunter, D. D., Meier, K. E., and Nathanson, N. M. (1986) J.

Harden, K. T., Petch, L. A,, Traynelis, S. F., and Waldo G. L. (1985) J.

Thompson, A. K., and Fisher, S. K. (1991) J. Biol. Chem. 266,5004-5010 Thompson, A. K., and Fisher, S. K. (1990) J. Phnrmacol. Exp. Ther. 2 5 2 ,

383-402

P. C. (1990) Proc. Natl. Acud. Sci. U. S. A. 87,2466-2470

173,666-672

133,1193-1200

Biol. Chem. 261,5307-5313

Bid. Chem. 2 6 0 , 13060-13066

7 A A - 7 K 3

Richardson, R. M., Ptasienski, J., and Hosey, M. M. (1991) J. Bid. Chem.

Davis, P. D., Hill, C. H., Keech, E., Lawton, G., Nixon, J. S., Sedgwick, A. 2 6 7 , 10127-10132

D., Wadsworth, J., Westmacott, D., and Wilkinson, S. E. (1989) FEBS Lett. 259,61-63

,” .”