[CANCER RESEARCH 55, 2075-2080, May 15, 1995]

Radiation-induced Gj Arrest Is Selectively Mediated by the p53-WAFl/CiplPathway in Human Thyroid Cells1

Hiroyuki Namba, Takes! Hará,Tomoo Tukazaki, Kiyoshi Migita, Naofumi Ishikawa, Kunihiko Ito,Shigenobu Nagataki, and Shunichi Yamashita2

Department of Cell Physiology I H. N., T. H., T. T., S. Y.I, Atomic Disease Institute and First Department of Internal Medicine [K. M., S. N.J. Nagasaki University School ofMedicine, 1-12-4 Sakamoto, Nagasaki, 852 and Ito Hospital, ISO, Tokyo I N. 1., K. I.], Japan

ABSTRACT

We investigated the sensitivity and sequential events that take place inthyroid epithelial cells after irradiation. Cell survival ratios at a dose of 2Gy were 18 ±2.5%, 58 ±1.0%, 59 ±1.5%, and 98 ±1.8% in primarythyroid cells, papillary thyroid carcinoma cells, follicular thyroid carcinoma cells, and anaplastic thyroid carcinoma cells, respectively. Thyroidcarcinoma cell lines carrying mutations in the ¡>5.lgene were resistant toionizing radiation. Although irradiated cells were accumulated at G, inprimary thyroid cells even after low-dose irradiation (0.2 Gy), this phenomenon was not observed in the thyroid carcinoma cell lines. Wild-type

p53 expression in primary thyroid cell was increased following irradiation, but mutated p53 in the thyroid carcinoma cell lines was unchanged.To clarify the signal transduction in the Gt arrest following irradiation,levels of expression of the p53 putative downstream effectors GADD45and WAFl/Cipl were examined. Despite the consistent level of GADD45niRNA. the level of WAFl/Cipl transcripts was increased in a radiationdose-dependent manner in primary thyroid cells. This increase in the

WAFl/Cipl mRNA level was observed 30 min after irradiation andcontinued for at least 48 h. A mobility shift assay performed using thesequence of the putative p53 DNA binding site on the WAFl/Cipl andGADD45 genes as a probe showed that nuclear protein extracted fromprimary thyroid cells, anti-p53 antibody, and probe oligonucleotide-

bound complex was clearly shifted. An increase in binding activity of thep53/antibody/DNA complex was observed following irradiation. In contrast, the nuclear extract from thyroid carcinoma cells could not bind thespecific DNA site, suggesting that mutant p53 has lost its binding ability.Actinomycin D inhibited WAFl/Cipl and GADD45 mRNA levels andcycloheximide stimulated up-regulation of both basal mRNA levels, but an

additional increase of the mRNA expression following irradiation wasobserved only in the WAFl/Cipl gene. These data suggest that p53 inpostradiation acts at a transcriptional level on WAFl/Cipl gene expressionand that ¡lenovo protein synthesis is not required for this effect.

These results suggest that the p53-WAFl/Cipl pathway may play a

central role in induction of G, arrest following irradiation in humanthyroid epithelial cells.

INTRODUCTION

Ionizing radiation is a well-known DNA-damaging agent, but sen

sitivity to irradiation varies widely from organ to organ. Ionizingradiation induces tumorigenesis in radiosensitive organs includingbone marrow and the thyroid gland. Retrospective and epidemiológica! studies intensively performed since the 1950s have demonstratedthe existence of a positive relationship between radiation dose andthyroid diseases (1, 2). For example, an increase in the incidence ofthyroid disease was observed among atomic bomb survivors in Nagasaki and Hiroshima (3). Recently, attention is being focused on thehigh incidence of childhood thyroid cancer in Belarus following the

Received 11/29/94; accepted 3/20/95.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grants-in-Aid 06671039 (H. N.) and 06454340 (S. Y.)

from the Ministry of Education, Culture, and Science of Japan.2 To whom requests for reprints should be addressed.3 The abbreviations used are: Cdk, cyclin-dependent protein kinase; FBS, fetal bovine

serum; UCLA, University of California-Los Angeles; AT, ataxia telangiectasia.

Chernobyl nuclear reactor accident (4). These findings suggest thationizing radiation is a strong trigger for induction of human thyroidtumors. However, the molecular mechanisms of the physiologicalresponses of thyroid cells to ionizing radiation are still unclear. Cellcycle progression is regulated at several checkpoints (5). Ionizingradiation slows growth by inducing delays in G]-S and G2-M. Radi

ation elicits a signal that leads to the activation of a variety of cellularresponses including induction ofc-fos, c-jun, c-myc, and CADD genes

(6). Alternatively, there may be multiple regulatory pathways controlling genes expressed in response to the observed growth arrest.

Recent genetic studies have demonstrated that the G, cell cyclearrest following irradiation is p53 dependent (7-9). Ionizing radiation

elicited an increase in p53 protein levels by a posttranscriptionalmechanism and activation of the G, checkpoint only in cells withwild-type p53 (7, 10, 11). The loss of this p53-dependent checkpoint

after irradiation has important implications in tumorigenesis becausecells lacking wild-type p53 progress into the S-phase without repair

ing the DNA damage (7, 11). Indeed, mutation of the p53 gene wasfound almost without exception in undifferentiated thyroid tumors(12), which often develop after radiation therapy to differentiatedthyroid tumors (13), and are highly resistant to radiation therapy.

Wild-type p53 modulates transactivation via two different mecha

nisms. First, p53 interacts with cellular proteins such as SV40 large Tantigen (14), CCAAT binding factor (15), and the 95-kDa protein

encoded by the mdm.2 gene (16). Second, p53 can bind to specificDNA sequences on several target genes and promote their transcription (14, 17). Among these downstream effector genes, the humanGADD and WAFl/CipI/p21 genes are considered to be most likely tobe cell cycle regulatory genes (6, 18, 19).

The GADD genes were originally identified by their coordinateinduction following growth arrest and DNA damage in Chinese hamster ovary cells (9, 11, 18, 20). The induction of each GADD genevaries according to the type of DNA-damaging agents. Among these

genes, GADD45 was strongly induced by irradiation doses as low as0.5 Gy in human leukemia cell lines and a fibroblast cell line using dotblot analysis (21, 22). The presence of the p53 consensus bindingsequence in the third intron of the human GADD45 gene suggests adirect role of p53 in its induction.

On the other hand, the WAF1 cDNA was cloned from a subtractedlibrary derived from a p53-transfected tumor cell line, indicating that

WAF1 acts as a downstream effector of p53 (18). Another groupisolated the same gene from a Cdk3-interacting protein cDNA library

and designated this gene dpi (23). WAFl/Cipl was demonstratedto be a binding inhibitor of multiple Cdks-cyclin complexes and to

block their kinase activity, resulting in inhibition of phosphorylationof the retinoblastoma gene product, a negative regulator of the cellcycle.

Since the cells used in studies to examine the response to ionizingradiation are carcinoma cell lines with multiple genetic abnormalitiesor fibroblast which are relatively radioresistant, the physiologicalresponse to ionizing radiation of normal human epithelial cells remains to be elucidated. Furthermore, the downstream involvement ofp53 in radiation-induced human thyroid damage is unclear.

2075

on June 6, 2018. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

RADIATION-INDUCED G, ARREST IN HUMAN THYROID CELLS

In the present study, we investigated the regulation of cell cyclecheckpoints in human thyroid epithelial cells after irradiation. For thispurpose, we assayed primary cultured thyroid cells carrying normalwild-type p53 and thyroid carcinoma cell lines harboring mutant p53

genes for cell cycle arrest in G, following irradiation and their abilityto evoke a normal response to mediators of p53.

MATERIALS AND METHODS

Cell Culture. For primary thyroid cells, thyroid tissues were obtained bysubtotal thyroidectomy from patients with hyperthyroid Graves' disease. Thy

roid cells were isolated and 99% of the obtained cells were confirmed to be ofthyroid epithelial origin as described previously (24). Human papillary andfollicular thyroid carcinoma cell lines, designated NPA and WRO, respectively, were kindly provided by Dr. G. Juillard (UCLA, Los Angeles, CA; Ref.25). A previous study demonstrated that NPA and WRO cells have p53mutations at codon 266 (GGA to GTA) and codon 223 (CCT to CTT),respectively (12). The human anaplastic cell line FRO, which shows low p53expression, was obtained from Dr. J. A. Fagin (UCLA; Ref. 12). These cellswere incubated with RPMI 1640 medium supplemented with 10% FBS.

Radiation Sensitivity of Thyroid Cells. Thyroid cells were plated in a100-mm cell culture dish at a cell density of 100 cells/dish. The cells wereirradiated using a EXS-300 gamma irradiator (200 kV, 15 mA, filter 0.5 mm

aluminum + 0.5 mm copper, 0.47 Gy/min; Toshiba, Tokyo, Japan) for anappropriate length of time to deliver a preselected dose (0.2, 0.5, 2, 5, or 10Gy) and incubated with medium containing FBS. Two weeks later, cells werestained by May-Grunwald-Giemsa staining and colonies larger than 5 mm

were counted, except primary thyroid cells in which colonies counting morethan 10 cells were counted.

Cell Cycle Analysis. The method of cell cycle analysis was describedpreviously (26). Briefly, after the appropriate doses of irradiation, the cellswere maintained in medium supplemented with 3% FBS throughout theexperiment for 24 h. The cells were then fixed at 4°Cwith 70% ethanol for 12h. After fixation, the cells were washed twice with PBS and incubated at 37°C

for 1 h with 20 ¡i\of 1 g/liter RNase (Sigma Chemical Co., St. Louis, MO).After centrifugation, the cells were resuspended in 2 \i\ of 50 mg/liter pro-

pidium iodine (Sigma) in PBS for at least 1 h then analyzed by flow cytometry.An argon ion laser flow cytometer (Profile model; Coulter Electronics, Hialeah,FL) was used, with an excitation wavelength of 488 nm. Red fluorescence wasquantified with a photomultiplier masked with a 610-nm-long band pass filter.Cells (2 X IO4) were collected at a sample flow rate of 10 ml/min.

Western Blotting. Anti-p53 mAbs PAb 421 and PAb 1801 were obtained

from Oncogene Science Inc. (Uniondale, NY). Cells were scraped and suspended in Laemmli sample buffer [62 mM Tris (pH 6.8), 10% glycerol, 2%SDS, 5% ß-mercaptoethanol, and 0.003% bromophenol blue] at 0.1 X IO6

cells/fil. After boiling, cellular proteins were separated by 10% SDS-PAGE(20 ¡u= 2 X IO6 cell equivalents loaded/lane) and transferred onto Immobilen

membranes (Millipore, Bedford, MA). Following blocking, blots were incubated for 1 h at room temperature with a mixture of the anti-p53 antibodies

PAb 421 and PAb 1801 at 0.1 jag/ml each. Blots were then washed, incubatedfor 1 h at room temperature with horseradish peroxidase-conjugated goatanti-mouse IgG (Pierce Chemical Company, Rockford, IL), and autoradio-graphed using enhanced chemiluminescence according to the manufacturer's

instructions (ECL detection system; Amersham Co., Arlington Heights, IL).RNA Isolation and Northern Blot Analysis. After the cells (1 X IO6)

were irradiated and incubated for the preselected time, total RNA was preparedusing the acid guanidine isothiocyanate method. Northern blot analysis wasperformed as described previously (27). Blots were exposed to X-ray film for

24 h with an intensifier screen, and densitometric analysis was performed usinga BAS 2000 (Fuji Film Co., Tokyo, Japan). In a separate series of experiments,thyroid cells were preincubated for 15 min in the presence of actinomycin D(5 /ig/ml) or cycloheximide (20 /j.g/ml) before irradiation (2 Gy). Afterirradiation, culture was continued for 4 h with either actinomycin D orcycloheximide. The p53 cDNA used for the probe was kindly provided by Dr.J. A. Fagin (UCLA). The WAFl/Cipl and GADD45 probes were generated byreverse transcription-PCR from primary thyroid cells, respectively, and confirmed by sequencing using a 373A DNA sequencing system (Applied Bio-

system Japan, Tokyo, Japan). Both of the cDNAs were completely identified

with ones as reported previously (18, 19). The blots were rehybridized with

cyclophilin cDNA.Electropnoretic Gel Mobility Shift Assays. The double-stranded p53WAF

(GAACATGTCCCAACATGTTG) sequence (6) and p53GADD (GAACAT-

GTCTAAGCATGCTG) sequence (11) were synthesized and labeled using themethods described previously (28). Nuclear extracts were prepared as described by Funk et al. (29). Samples contained [-y-32P]-p53WAFor p53 GADD

(0.5 ng), nuclear extract (30 fig), sonicated salmon sperm DNA (1 /xg;Pharmacia LKB Biotech, Inc., Piscataway, NJ), and were adjusted to a finalvolume of 25 /u,lwith buffer A [20 min HEPES (pH 7.6), 20% glycerol, 10 HIMsodium chloride, 1.5 mM magnesium chloride, 0.2 mM EDTA, 1 mM DTT, and1 mM phenylmethylsulfonyl fluoride]. Antibodies PAb 421 or PAb 1801 wereused at 100 ng/assay. Binding assays were performed with incubation for 20min at 25°C.A 5-jj.l aliquot of each reaction was loaded onto 4% nondena-

turing polyacrylamide gels and run at 120 V for 2 h. Gels were then dried andexposed to X-ray film.

Statistical Analysis. Data are presented as mean ±SE. Statistical analyseswere performed using Student's paired or unpaired t test, as appropriate.

RESULTS

Cell Survival following Irradiation. Human primary culturedthyroid cells and three human thyroid cell lines (WRO, NPA, andFRO) were examined for their sensitivity to ionizing radiation. Thefollicular thyroid carcinoma cell line WRO, papillary thyroid carcinoma cell line NPA, and anaplastic thyroid carcinoma cell line FROare known to have p53 gene mutations: codon 223 (CCT to CAT), 266(GGA to GTA), and a low level of p53 expression due to an unknownmechanism, respectively (12). As shown Fig. 1, the proportion ofsurviving cultured primary thyroid cells, NPA, WRO, and FRO cellsat a dose of 2 Gy were 18 ±2.5%, 58 ±1.0%, 59 ±1.5%, and98 ±1.8%, respectively.

Radiation-induced G, Arrest in Primary Thyroid Cells. To

investigate the cell cycle stage following irradiation at various doses,the DNA content of the cells was examined by flow cytometry.A decrease in the percentage of cells in S-phase was observed after irradiation in a dose-dependent manner in primary thyroid cells

100«

5CD

•Primary Thyrocyte•WRO Cell•NPA Cell

•FRO Cell

468Radiation Doses (Gy)

10

Fig. 1. Sensitivity of thyroid cells to ionizing radiation. To examine survival curves ofcells exposed to ionizing radiation, primary thyroid cells (O); anaplastic thyroid carcinoma cells, FRO (A); follicular carcinoma cells, WRO (A); and papillary thyroid carcinoma cells, NPA (D), were plated at a density of 100 cells/100-mm dish. The cells were

irradiated at various doses and incubated for 2 weeks with medium containing 3% FBS,and colonies were then counted. The percentile ratios compared with untreated cells areindicated. Points represent the means of three to five experiments; bars. SEs.

2076

on June 6, 2018. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

RADIATION-INDUCED G, ARREST IN HUMAN THYROID CELLS

Table 1 Cell cycle analysis of primary thyroid cells and thyroid carcinoma cell Unesfollowing irradiation"

p»Cellline (cell type)statusPrimarythyroid cellwt/wt*NPA

wt/mut''(papillary

carcinoma)WRO

mut'V-(follicular

carcinoma)FRO

-/-(anaplastic

carcinoma)Radiation

dose(Gy)00.20.52.000.52.05.000.52.05.000.52.05.0Cellcycle (% ofcells)G0

+G,85.8

±3.590.3±3.193.2

±2.995.4±2.963.7±2.776.4±4.069.3±3.950.8±3.880.5±3.870.3±4.460.9±4.347.6±4.463.3±3.060.5±2.962.8±3.463.3±3.1S10.112.96.7

±2.43.7±3.02.1±2.221.1

±9.111.2±7.710.8

±6.211.6+5.810.3±7.414.0±6.616.1

±6.717.5±7.018.2±4.220.0±4.620.3±3.917.8±4.9G2

+M3.1

±2.62.0±2.61.2±2.30.7±2.313.9±4.810.3±6.215.7±6.034.5±4.86.8±5.213.1

±5.519.6±4.929.4±5.815.3±3.618.4

±8.815.5±3.815.5±4.2

" Human thyroid cells were treated with various doses of irradiation (0, 0.2, 0.5, 2.0,

and 5.0 Gy). After incubation for 24 h, the cells were stained with propidium iodine andthen analyzed by flow cytometry. The percentages of cells in the various cell phases areshown for each sample (values are mean ±SD).

h The p53 status in the thyroid cell lines used here was quoted from a previous

report (13).' wt, wild type; mut, mutation; -, deletion.

p53 mutation codon 266 (Gly* p53 mutation codon 223 (Pro -

Glu).Leu).

(Table 1). Primary thyroid cells irradiated at 2 Gy were almost all inGO + GÌ(93.2 ±2.9%). G, arrest was induced following irradiationof primary cultured thyroid cells. In contrast, G, arrest after irradiation did not occur in all thyroid carcinoma cells and G2 arrest wasobserved in WRO and NPA cells.

p53 Protein Induction by Irradiation in Primary Thyroid Cells.We examined the levels of expression of p53 protein after irradiationin primary cultured thyroid cells and thyroid carcinoma cells byWestern blotting. Following irradiation at doses over 0.5 Gy, theabundance of wild-type p53 protein increased markedly in primary

thyroid cells (Fig. 2A). In contrast, mutant p53 proteins expressed inWRO and NPA cells were abundant without irradiation, and the levelswere unchanged after irradiation. (Fig. 2, B and C). Expression of p53was not observed in FRO cells (Fig. 2D).

Induction of the WAFl/Cipl Gene but not the GADD45 Gene byIrradiation in Thyroid Cells. WAFl/Cipl mRNA expression wasincreased rapidly after irradiation in primary thyroid cells. In the casesof thyroid carcinoma cells, the basal expression was approximately

3-fold lower than in the primary thyroid cells (Fig. 3, upper panel).

Although a slight induction of WAF1 mRNA expression by irradiation was observed in the papillary thyroid carcinoma cell line NPA,which has a p53 codon 266 mutation, the levels were unchanged in theanaplastic thyroid carcinoma cell line FRO, which shows a lack of p53expression. In contrast, GADD45 and p53 mRNAs in all cell typeswere expressed constitutively and their levels were unchanged following irradiation at least up to a dose of 5.0 Gy exposure (Fig. 3,middle panel). Interestingly, the level of GADD45 expression inthyroid carcinoma cells, which have a mutation in the p53 gene, wassimilar to that observed in primary thyroid cells.

As shown in Fig. 1 and Table 1, G, arrest was already observed atnonlethal doses of exposure in primary thyroid cells. Therefore, weexamined the induction of WAFl/Cipl mRNA by low-dose radiation

exposure (Fig. 44). The increases in WAFl/Cipl mRNA levels wereradiation dose dependent, and the induction was observed with irradiation doses as low as 0.5 Gy. As shown in the time course experiment in Fig. 45, increases in the WAFl/Cipl mRNA level weredetected as early as 0.5 h after exposure to 2 Gy. Maximum levels ofWAFl/Cipl mRNA were observed at 2 h following irradiation, and theresponse was prolonged until at least 48 h after irradiation. In contrast,p53 and GADD45 mRNAs were not induced after irradiation.

Increased Binding of Nuclear Extracts of Primary Cells to thePutative p53 Binding Site on WAFl/Cipl and GADD Genes afterIrradiation. To further support the role of p53 in radiation-induced

responsiveness, we performed mobility shift assays with nuclear extracts from thyroid cells. The oligomers used, p53WAF and p53GADD,

were the p53-binding site sequence upstream of the WAFl/Cipl gene

and in the third intron of the GADD45 gene, respectively. This assayexploits the ability of wild-type p53 to bind to specific DNA se

quences (28, 30). The bands of nuclear protein extracted from primarycultured thyroid cells bound to p53WAF or p53GADDwere not visible,

but a mAb allowed visualization of the DNA binding activity. Whenthe oligomer p53WAF was used as probe, addition of PAb 1801

showed the appearance of a supershifted band (Fig. 5A, Lane 2). Thissupershifted band was lost after addition of excess unlabeled p53WAF

oligonucleotide (Fig. 5/4, Lane 3), but not after addition of an equivalent amount of an unrelated oligonucleotide (Fig. SA, Lane 4). WhenPAb 1801 was replaced with PAb 421 (Fig. 5A, Lane 5), antibody-induced size shift was slightly observed. In contrast, p53GADDshowed

a supershifted band with nuclear extracts and antibodies PAb 421 afterirradiation (Fig. 5C, Lane 2). Different epitopes are recognized by

Dose(Gy) 0 0.5 2 5B

0 0.5 2 5

53kDa

Fig. 2. p53 protein levels in primary thyroid cells andthyroid carcinoma cell lines following irradiation. Thyroid cells were harvested at 8 h after irradiation. Nuclearextracts from 2 X IO6 cells were analyzed by immuno-

blotting with p53 antibodies PAb 421 and 1801. A,primary thyroid cells; B, NPA cells; C, WRO cells; D,FRO cells. Irradiation doses were 0 (Lane I ), 0.5 (Lane2), 2 (Lane 3), and 5 (Lane 4) Gy. The size of the bandwas 53 kDa.

1234

Dose (Gy) 0 0.5 2 5

1234

0 0.5 2 5

53kDa

2342077

1234

on June 6, 2018. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

RADIATION-INDUCED G, ARREST IN HUMAN THYROID CELLS

Dose (Gy)

Primary cell

I I0 2.0 5.0 10

NPA FRO

I 1 T \0 2.0 5.0 10 0 2.0 5.0 10

Fig. 3. WAFl/Cipl, P53, and GADD45 mRNAlevels in primary thyroid cells and in thyroid cancercell lines following irradiation. Total cellular RNAwas isolated from primary thyroid cells, papillarythyroid carcinoma cell line NPA, and anaplasticthyroid carcinoma cell line FRO 4 h after exposureto various doses (2, 5, and 10 Gy) of ionizingradiation. Panels, WAFl/Cipl mRNA (2.1 kilo-

bases), p53 mRNA (2.6 kilobases), GADD45cDNA (1.4 kilobases), and cyclophilin mRNA (0.8kilobases), respectively.

•••••

2.1kb

•2.6kb

1.4kb

§•••••••••••-0.8kb

1234 5678 9 10 11 12

antibodies PAb 421 (which recognizes an epitope in the COOHterminus of p53) and PAb 1801 (which recognizes the NH2 terminusof p53; Ref. 31). We investigated whether the increased levels of p53in the primary thyroid cells after irradiation reflected increases insequence-specific p53-DNA binding activity. Fig. 5ßshows the re

sults of irradiating primary cultured thyroid cells at various doses. Asnegative and positive controls, HL-60 cells, which are null mutantswith respect to the p53 gene (Fig. 5ß,Lane I), and wild-type p53expression vector-transfected HL-60 cells (Fig. 5ß,Lane 2) wereused, respectively. Increases in intensity of the p53-DNA bindingband were observed in 0.2-Gy irradiated primary thyroid cells (Fig.

5ß,Lane 4) compared to nonirradiated cells (Fig. 5ß,Lane 3).Maximum increases in p53-DNA binding were detected at 0.5 Gy(Fig. 5ß,Lane 5). Induction of p53-WAFl/Cipl gene binding by

irradiation, therefore, occurred at low, nonlethal doses and might

0.5 2.0 5.0

Dose (Gy)10.0 0 0.5 2 4 8 12 24 36 48

Time (Hours post irradiation)

Fig. 4. Change in the level of mRNA expression of WAFl/Cipl, pSj, and CADD45genes following irradiation. Primary cultured thyroid cells were harvested 4 h afterirradiation. A, dose response of WAFl/Cipl (D), p53 (0), and GADD45 (O) mRNAlevels following low-dose irradiation. Total cellular RNA was isolated from primary

thyroid cells 4 h after exposure to various doses (0.2, 0.5, and 2.0 Gy) of ionizingradiation, fl, time course of WAFl/Cipl (D), p53 (0), and GADD45 (O) mRNA levels.Total cellular RNA was isolated from primary cultured thyroid cells at various timesfollowing 2 Gy irradiation. All mRNA levels were quantified by densitometry andnormalized to levels of cyclophilin mRNA levels. Means from two separate experimentsare shown.

represent a physiological response of cells to low levels of DNAdamage because less than 10% of the cells were killed at 0.2 Gy (Fig.1). In contrast, no band was observed even at 5.0 Gy in NPA or FROcells. The absence of binding of p53 to p53WAF oligomer is consid

ered to be due to low p53 protein levels in FRO cells and to mutationat codon 266 in the DNA binding region of the protein in NPA cells.

Effects of Cycloheximide and Actinomycin D on the Level ofWAFl/Cipl and GADD45 mRNA. To evaluate the roles of transcription and translation in WAFl/Cipl expression following irradiation, inhibitors of protein synthesis (cycloheximide) and RNA synthesis (actinomycin D) were used. Previous studies showed thatactinomycin D acts as a DNA-intercalating agent which induces DNA

strand breaks in a manner similar to irradiation (32) and causes G,arrest accompanied by a significant increase in p53 protein levelswhen incubated with cells for more than 20 h (10). Therefore, wechose 4 h as the incubation time with actinomycin D. Pretreatment ofactinomycin D inhibited baseline WAFl/Cipl expressions and significantly prevented the radiation-induced increase of the WAFl/Cipl

mRNA (Fig. 6A). Treatment with cycloheximide induced a markedincrease in both baseline WAF1 and GADD45 expressions comparedwith control cells. The radiation-stimulated WAFl/Cipl mRNA level

in primary thyroid cells was not prevented by cycloheximide. Stimulationby cycloheximide to the WAFl/Cipl mRNA was also observed in NPAcells (Fig. 6ß).Radiation did not affect GADD45 mRNA in the thyroidcells treated either with actinomycin D or cycloheximide.

DISCUSSION

In the present study, we analyzed the effects of ionizing radiationon human thyroid epithelial cells. G, arrest occurred after irradiationin human primary cultured thyroid cells accompanied by increasedlevels of wild-type p53. In contrast, G2 arrest was observed in two

thyroid carcinoma cell lines with p53 mutations without pausing inG,. These results suggest that radiation-induced G, arrest is p53

dependent but G2 arrest is independent in these cell lines (33, 34).Ionizing radiation induced G, arrest following a rapid augmentation inthe levels of wild-type p53 due to an increase in the stability inprimary thyroid cells. Increases of p53-DNA binding activity to both

2078

on June 6, 2018. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

RADIATION-INDUCED G, ARREST IN HUMAN THYROID CELLS

A Bo. u)

to-M

HL-60 PT NPA FRO- I

• 885 0 5.0 0 0.2 0.5 2.0 5.0 0 5.0 0 5.0

-

n0 5.0

Uu

•

12345 1234 567 8 9 10 11 1

Fig. 5. Mobility shift assays with the p53 binding site and nuclear extracts from thyroid cells following irradiation. A, nuclear extracts were incubated with labeled p53WAI"oligonucleotides with either anti-p53 antibody PAb 421 (Lane 5) or PAb 1801 (Lanes 2-4). A 10-fold Mexcess of unlabeled p53WAI' oligonucleotide (Lane 3) or unlabcled nonspecificoligonuclcotide (Lane 4) was added as indicated. Only the 3~P-labeled p53WA1"oligonucleotide was elcctrophoresed in Lane I. B, nonirradiated cells (Lanes 1-3. 8. and 10) and cells

irradiated al various doses (Lane 4, 0.2 Gy; Lane 5, 0.5 Gy; Lane 6, 2.0 Gy; and Lanes 7, 9 and //, 5.0 Gy) were harvested at 4 h after irradiation. Nuclear extracts from control HL-60cells (Lane /), wild-type p53 expression vector-transfected HL-60 cells (Lane 2), primary cultured thyroid cells (Lanes 3-7), papillary thyroid carcinoma cells. NPA (Lanes 8 and 9),and anaplastic thyroid carcinoma cells, FRO (Limes IÃœand //), were incubated with labeled p53WAI oligonucleotide and then analyzed. C, p53<>AOI>was used instead of p53WAF asa probe. Nuclear extracts from nonirradiated thyroid cells (Lane I) and 5-Gy irradiated cells (Lane 2) were incubated with labeled p53<iAD" oligonuclcotide and PAb 421. Arrows,

positions of the p53/DNA/antibody complex.

GADD45 and WAFI/CipI genes following irradiation were observedand pretreatment of actinomycin D caused the inhibition of the post-

radiation mRNA induction, indicating that the activation of the WAFl/dpi gene expression after irradiation was regulated at the transcrip-

tional level. Similar results have been reported previously; theputative p53 binding site on the CADD45 gene was shown to bindbaculovirus-produced p53 protein in vitro at least as strongly as the

optimal sequence derived by screening synthetic oligonucleotides(11), and the WAFl/Cipl promoter-reporter construct, including the

putative p53 binding site, was activated only in the presence ofwild-type p53 (19). Nuclear proteins extracted from a papillary thy

roid carcinoma cell line (NPA) and from an anaplastic thyroid carcinoma cell line (FRO) showing lack of p53 expression could not bindto the p53 binding sequence. These results are in agreement with thelow levels of WAFl/Cipl mRNA expression in both cells.

Although we could not detect a supershifted band in our mobilityshift assay, a slight increase in the WAFl/Cipl mRNA levels following irradiation in NPA cells may be due to incomplete activation bythe heterozygous p53 status; one mutant alíeleand one wild-type

alíeleof the p53 gene. An efficient transactivation to a CAT reportercontaining a p53-DNA binding site has been already confirmed by

transfection study in NPA cells (35). DNA binding activity and thetranscriptional activation functions of p53 mutants in tumor cellsmight be dependent on the specific site of the missense mutations

acquired in the p53 gene and in target sequences of p53 in the genome.Considering the differences in radiosensitivity between these cell lines(NPA cells being more sensitive than FRO cells), variations in mutation sites may cause the observed variety of radiosensitivity amongtumors.

Despite the increased binding activity, we found no induction ofGADD45 mRNA following irradiation in primary cultured thyroidcells. GADD45 is thought to be related to radiosensitivity in thecancer-prone disease AT. Fibroblast cells from patients with ATsyndrome have been shown to be deficient in the ionizing radiation-

mediated induction of p53 protein and the GADD45 gene (11). Patients with AT syndrome may have a defect in a gene designated as ATwhose product induces p53 through as yet undefined translational orposttranslational mechanisms (9). The AT-p53-GADD45 pathway is

thought to be one of the main response pathways in the induction ofG, arrest following irradiation in human fibroblast. Although themechanism of the different regulation of CADD45 gene expressionbetween fibroblast and thyroid epithelial cells is obscure, there areseveral possible explanations. First, cell- or tissue-specific cofactorsmay inhibit the transcription of the GADD45 gene after p53-DNAbinding in thyroid cells. Second, since p53-DNA binding activity in

vitro does not equal the activity in vivo, a higher dose of irradiation,more than 10 Gy, may be needed for the induction of gene expression.Third, abundant expression of the GADD45 gene observed in thyroid

Fig. 6. Effects of irradiation and/or actinomycin D orcycloheximide on WAFl/Cipl and GADD45 mRNAlevels in primary thyroid cells. The primary thyroidcells (A) and NPA cells (B) were preincubated with 5/ig/ml actinomycin D (Lanes 3 and 4) or 20 fig/mlcycloheximide (Lanes 5 and 6) for 15 min. After irradiation (2 Gy; Lanes 2, 4, and 6) or without irradiation(Lanes I, 3, and 5), incubation was continued for 4 h.and then cells were harvested for mRNA extractionwhich was then subjected to Northern blot analysis.Upper panel. WAFl/Cipl mRNA (2.1 kilobases).Middle panel, GADD45 mRNA (1.4 kilobases). Lowerpanel, rehybridized blot with cyclophilin cDNA(0.8 kilobases).

Cont

Dose (Gy) 0

Act D CHX B Cont Act D CHX

020202

-2.1kb

-1.4kb

-0.8kb

2 3

2079

123456

on June 6, 2018. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

RADIATION-INDUCED G, ARREST IN HUMAN THYROID CELLS

carcinoma cell lines which have a mutation of the p53 gene may bereflected by p53 independent regulation. This finding suggests the existence of two separate pathways for the induction of GADD45, onedependent and one independent of p53 (22). The induction of GADD45in thyroid cells may be fully activated by the p53-independent pathway.

This lack of induction of the GADD45 mRNA following irradiationmay be one of the determinants of the relative radiosensitivity ofprimary thyroid cells compared with fibroblasts.

In contrast, WAFl/Cipl mRNA was markedly increased after irradiation even at a low dose (0.2 Gy). WAFl/Cipl forms multiple quaternarycomplexes with regulatory subunits called cyclins (cyclins A to E),proliferating cell nuclear antigen, and a group of related enzymes knownas the cyclin-dependent protein kinases (CDC2 and CDK2 to CDK5;

Refs. 16, 19, and 36). The cell cycle kinase complexes comprise theprimary effectors of cell cycle progression, further regulation of which isachieved by both activating and inhibitory phosphorylation of the CDKsubunits (37). Proliferating cell nuclear antigen and WAFl/Cipl/p21protein are lost from the complexes in many cells lacking functional p53(36, 38). Through reconstitution and overexpression studies, it has beenshown that the cyclin D/CDK4/p21 complexes inhibit retinoblastinomaphosphorylation and caused cell cycle arrest (36). The inhibitory activityof cyclin E-Cdk2 kinase following irradiation was also shown to bereduced with an anti-WAFl/Cipl antibody (39). WAFl/Cipl was shown

to mimic the growth suppression of p53 when introduced into fourdifferent tumor cell lines (19). A recent study showed that WAFl/Ciplwas induced in wild-type /?55-containing cells by exposure to DNA-

damaging agents but not in those with mutant p53 (40). Thyroid cellsexposed to cycloheximide, an inhibitor of protein synthesis, showedincreased WAFl/Cipl and GADD45 mRNA contents, suggesting thatthose transcripts are destabilized by other labile proteins, the synthesis ofwhich is blocked by cycloheximide. The additive increase in WAFl/Ciplexpression with exposure to both ionizing radiation and cycloheximidewas observed in primary thyroid cells, but not in thyroid carcinoma cellscarrying the p53 mutant gene. This result indicates that irradiation increased the WAFl/Cipl transcript via stabilized wild-type p53.

Increased p53 binding to target genes and WAF1 expression withno changes in GADD45 mRNA level occurred on exposure to low(nonlethal) doses of radiation, and may represent a specific physiological response to irradiation in human primary thyroid cells. Ourresults suggest that WAFl/Cipl is a central transcriptional target ofp53 protein involved in induction of G, arrest after irradiation inhuman epithelial thyroid cells.

ACKNOWLEDGMENTSWe thank Y. Tsunoo for excellent secretarial assistance.

REFERENCES1. Duffy, B. J., and Fitzgerald, P. J. Thyroid cancer in childhood and adolescence, a

report on twenty-eight cases. Cancer (Phila.), 3: 1018-1032, 1950.

2. Maxon, H. R., Thomas, S. R., Saenger, E. L., Buncher, C. R., and Kereiakes, J. G.Ionizing irradiation and the induction of clinically significant disease in the humanthyroid gland. Am. J. Med., 63: 967-978, 1977.

3. Nagataki, S., Hirayu, H., I/mm. M., Inoue, S., Okajima, S.. and Shimaoka, K. Highprevalence of thyroid nodule in area of radioactive fallout. Lancet, 2: 385-386. 1989.

4. Kazakov, V. S., Demidchik, E. P., and Astakhova, L. N. Thyroid cancer afterChernobyl. Nature (Lond.), 359: 21-22, 1992.

5. Hartwell, L. H., and Weinert, T. A. Checkpoints: controls that ensure the order of cellcycle events. Science (Washington DC), 246: 629-634, 1989.

6. Fornace, A. J., Jr. Mammalian genes induced by radiation; activation of genesassociated with growth control. Annu. Rev. Genet., 26: 507-526. 1992.

7. Kuerbitz, S. J., Plunkett, B. S., Walsh, W. V., and Kastan, M. B. Wild-type p53 is acell cycle checkpoint determinant following irradiation. Proc. Nati. Acad. Sci. USA,89: 7491-7495, 1992.

8. O'Connor. P. M., Jackman, J., Jondle, D., Bhatia, K., Magrath, I., and Kohn, K. W.

Role of the p53 tumor suppresser gene in cell cycle arrest and radiosensitivity ofBurkitt's lymphoma cell lines. Cancer Res., 53: 4776-4780. 1993.

9. Zhan, Q., Carrier, F., and Fornace, A. J., Jr. Induction of cellular p53 activity byDNA-damaging agents and growth arrest. Mol. Cell. Biol., 13: 4242-4250, 1993.

10. Kastan, M. B., Onyekwere, O., Sidransky, D., Vogelstein, B., and Craig, R. W.

Participation of p53 protein in the cellular response to DNA damage. Cancer Res., 5/:6304-6311, 1991.Kastan, M. B., Zhan, 0., El-Deiry, W. S., Carrier, F., Jacks. T., Walsh, W. V.,Plunkett, B. S., Vogelstein, B., and Fornace. A. J., Jr. A mammalian cell cyclecheckpoint pathway utilizing p53 and GADD 45 is defective in ataxia-telangiectasia.Cell, 71: 587-597, 1992.

Fagin, J. A., Matsuo, K., Karmakar, A., Chen, D. L., Tang, S. H., and Koeffler, H. P.High prevalence of mutations of the p53 gene in poorly differentiated human thyroidcarcinomas. J. Clin. Invest., 91: 179-184, 1993.Shimaoka, K., Getaz, E. P., and Rao, U. Anaplastic carcinoma of thyroid: radiation-associated. NY State J. Med., 79: 874-877. 1979.Bargonetti, J., Friedman, P. N., Kern, S. E., Vogelstein, B., and Prives, C. Wild-type

but not mutant p53 immunopurified proteins bind to sequences adjacent to the SV 40origin of replication. Cell, 65: 1083-1091, 1991.

Agoff, S. N., Hou, J., Linzer, D. I., and Wu, B. Regulation of the human hsp70promoter by p53. Science (Washington DC), 259: 84-87, 1993.Wu, X., Bayle, J. H., Olson, D., and Levine, A. J. The p53-mdm-2 autoregulatoryfeedback loop. Genes Dev., 7: 1126-1132, 1993.

Kern, S. E., Pietenpol, J. A., Thiagalingam, S.. Seymour, A., Kinzler, K. W., andVogelstein, B. Oncogenic forms of p53 inhibit /ï53-regulated gene expression. Science (Washington DC), 256: 827-830, 1992.Fornace, A. J., Jr., Neben, D. W., Hollander, M. C., Luethy, J. D.. Papathanasiou, M.,Fargnoli, J., and Holbrook. N. J. Mammalian genes coordinately regulated by growtharrest signals and DNA-damaging agents. Mol. Cell. Biol., 9: 4196-4203, 1989.El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M.,

Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B. WAF 1, a potentialmediator of p53 tumor suppression. Cell, 75: 817-825, 1993.Fornace, A. J., Jr., Alamo, I., Jr., and Hollander, M. C. DNA damage-inducibletranscripts in mammalial cells. Proc. Nati. Acad. Sci. USA, 85: 8800-8804, 1988.

Papathanasiou, M. A., Kerr, N. C., Robbins, J. H., McBride, O. W., Alamo, I., Jr.,Barrett, S. F., Hickson, I. D., and Fornace, A. J., Jr. Induction by ionizing radiationof the gadd 45 gene in cultured human cells: lack of mediation by protein kinase C.Mol. Cell. Biol., //: 1009-1016, 1991.Zhan, Q., Bae, I., Kastan, M. B., and Fornace, A. J., Jr. The p53-dependent -y-rayresponse of GADD45. Cancer Res., 54: 2755-2760, 1994.

Harper, J. W., Adami, G. R., Wei, N., Keyomarsi, K., and Elledge, S. J. The p21Cdk-interacting protein Cip 1 is a potent inhibitor of G, cyclin-dependent kinase.Cell, 75: 805-816, 1993.

Kawabe. Y., Eguchi, K., Shimomura, C., Mine. M., Otsubo, T.. Ueki, Y., Tezuka, H.,Nakao, H., Kawakami, A., Migita, K., Yamashita, S., Matsunaga, M., Ishikawa, N.,Ho, K., and Nagataki, S. Interleukin-1 production and action in thyroid tissue. J. Clin.Endocrinol. Metab., 68: 1174-1183, 1989.Estour, B., VanHerle, A. J., Juillard, G. J., Totanes, T. L., Sparkes, R. S., Giuliano,A. E., and Klandorf, H. Characterization of a human follicular thyroid carcinoma cellline (UCLA RO 82 W-l). Virchows Arch. B. 57: 167-174, 1989.Krishan. A. Rapid flow cytofluorometric analysis of mammalian cell cycle bypropidium iodide staining. J. Cell Biol., 66: 188-193. 1975.Namba, H., Yamashita, S., Usa, T., Kimura. H-, Yokoyama. N., Izumi, M.. andNagataki, S. Overexpression of the intact thyrotropin receptor in a human thyroidcarcinoma cell line. Endocrinology, 132: 839-845. 1993.Price, B. D., and Calderwood, S. K. Increased sequence-specific p53- DNA bindingactivity after DNA damage is attenuated by phorbol esters. Oncogene, 8: 3055-3062,1993.Funk, W. D., Pak, D. T., Karas, R. H., Wright. W. E,. and Shay, J. W. A transcrip-tionally active DNA-binding site for human p53 protein complexes. Mol. Cell. Biol..12: 2866-2871, 1992.El-Deiry, W. S., Kern, S. E., Pietenpol, A., Kinzler, K. W., and Vogelstein, B.Definition of a consensus binding site for p53. Nature Genet., /: 45-49, 1992.Yewdell, J. W., Gannon, J. V., and Lane, D. P. Monoclonal antibody analysis of p53expression in normal and transformed cells. J. Virol., 59: 444-452. 1986.Wassermann, K.. Markovits, J., Jaxel, C., Capranico, G., Kohn, K. W., and Pommier,Y. Effects of morpholinyl doxorubicins, doxorubicin, and actinomycin D on mammalian topoisomerases I and II. Mol. Pharmacol., 38: 38-45, 1990.Kuerbitz, S. J., Plunkett, B. S., Walsh. W. V., and Kastan, M. B. Wild-type p53 is acell cycle checkpoint determinant following irradiation. Proc. Nati. Acad. Sci. USA.Ä9:7491-7495, 1992.

Strasser, A., Harris, A. W., Jacks, T., and Cory, S. DNA damage can induce apoptosisin proliferating lymphoid cells via p53-independent mechanisms inhibitable by Bcl-2.Cell, 79. 329-339, 1994.

Park, D. J., Nakamura, H., Chumakov, A. M., Said, J. W., Miller, C. W.. Chen. D. L.,and Koeffler, H. P. Transactivationnal and DNA binding abilities of endogenous p53in p53 mutant cell lines. Oncogene, 9: 1899-1906, 1994.

Xiong, Y., Hannon, G. J., Zhang, H., Casso, D., Kobayashi, R., and Beach, D. p21 isa universal inhibitor of cyclin kinases. Nature (Lond.), 366: 701-704, 1993.

Draetta, G. Cell cycle control in eukaryotes: molecular mechanisms of cdc2 activation. Trends Biochem. Sci., 15: 378-383, 1990.Xiong, Y., Zhang, H., and Beach, D. Subunit rearrangement of the cyclin-dependentkinases is associated with cellular transformation. Genes Dev., 7: 1572-1583, 1993.Dulie, V., Kaufmann, W. K., Wilson, S. J., Tlsty, T. D., Lees, E., Harper. J. W.. Elledge,S. J., and Rééd.S. I. p53-Dependent inhibition of cyclin-dependent kinase activities inhuman fibroblasts during radiation-induced G, arrest. Cell, 76: 1013-1023, 1994.El-Deiry, W. S., Harper, J. W., O'Connor, P. M., Velculescu, V. E., Canman, C. E..

Jackman. J.. Pietenpol. J. A.. Burrell, M., Hill, D. E., Wang, Y., Wiman, K. G.,Mercer, W. E.. Kastan. M. B., Kohn, K. W.. Elledge, S. J., Kinzler, K. W.. andVogelstein, B. WAFI/CIP1 is induced in p5.i-mediated G, arrest and apoptosis.Cancer Res., 54: 1169-1174, 1994.

2080

on June 6, 2018. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

1995;55:2075-2080. Cancer Res   Hiroyuki Namba, Takesi Hara, Tomoo Tukazaki, et al.   p53-WAF1/Cip1 Pathway in Human Thyroid Cells

Arrest Is Selectively Mediated by the1Radiation-induced G

  Updated version

  http://cancerres.aacrjournals.org/content/55/10/2075

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/55/10/2075To request permission to re-use all or part of this article, use this link

on June 6, 2018. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from