RAD Sequencing: A method for Population … Sequencing: A method for Population Genomics Population...

99
RAD Sequencing: A method for Population Genomics John Davey Illumina Sequencing Seminar Edinburgh 1 July 2010 Institute of Evolutionary Biology University of Edinburgh [email protected]

Transcript of RAD Sequencing: A method for Population … Sequencing: A method for Population Genomics Population...

RAD Sequencing: A method for Population Genomics

John Davey

Illumina Sequencing SeminarEdinburgh

1 July 2010

Institute of Evolutionary BiologyUniversity of Edinburgh

[email protected]

RAD Sequencing: A method for Population GenomicsPopulation Genomics

John Davey

Illumina Sequencing SeminarEdinburgh

1 July 2010

Institute of Evolutionary BiologyUniversity of Edinburgh

[email protected]

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications

John Davey

Illumina Sequencing SeminarEdinburgh

1 July 2010

Institute of Evolutionary BiologyUniversity of Edinburgh

[email protected]

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method

John Davey

Illumina Sequencing SeminarEdinburgh

1 July 2010

Institute of Evolutionary BiologyUniversity of Edinburgh

[email protected]

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

John Davey

Illumina Sequencing SeminarEdinburgh

1 July 2010

Institute of Evolutionary BiologyUniversity of Edinburgh

[email protected]

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

Illumina GAIIx Sequencing Machine

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

20 million reads per laneIllumina GAIIx Sequencing Machine

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

20 million reads per lane100 base pairs per read

Illumina GAIIx Sequencing Machine

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

20 million reads per lane100 base pairs per read

Illumina GAIIx Sequencing Machine

Population Genomics RADSeq Applications RADSeq Method Plutella Example

200 base pairs per paired end read

RAD Sequencing: A method for Population Genomics

20 million reads per lane100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

Population Genomics RADSeq Applications RADSeq Method Plutella Example

200 base pairs per paired end read

RAD Sequencing: A method for Population Genomics

20 million reads per lane

8 lanes per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

Population Genomics RADSeq Applications RADSeq Method Plutella Example

200 base pairs per paired end read

RAD Sequencing: A method for Population Genomics

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

Population Genomics RADSeq Applications RADSeq Method Plutella Example

200 base pairs per paired end read

RAD Sequencing: A method for Population Genomics

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

200 base pairs per paired end read

RAD Sequencing: A method for Population Genomics

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

200 base pairs per paired end read

RAD Sequencing: A method for Population Genomics

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

Plutella xylostella

200 base pairs per paired end read

RAD Sequencing: A method for Population Genomics

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

Plutella xylostella Salmo salar

200 base pairs per paired end read

RAD Sequencing: A method for Population Genomics

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

Plutella xylostella Salmo salar Lolium perenne

200 base pairs per paired end read

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

200 base pairs per paired end read

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

200 base pairs per paired end read

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

200 base pairs per paired end read

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

200 base pairs per paired end read

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

200 base pairs per paired end read

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

200 base pairs per paired end read

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

200 base pairs per paired end read

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

200 base pairs per paired end read

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

200 base pairs per paired end read

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

20 million reads per lane

8 lanes per run32 Gb per run

100 base pairs per read

4 Gb per lane

Illumina GAIIx Sequencing Machine

(HiSeq 2000 will be ~200Gb!)

200 base pairs per paired end read

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

Image credits: http://www2.nrm.se/en/svenska_fjarilar/p/plutella_xylostella.html, http://www.glerl.noaa.gov/pubs/photogallery/Fish/pages/1037.html, http://www.agroatlas.ru/en/content/cultural/Lolium_perenne_K/, Chris Jiggins (heliconius.org)

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

Image credits: http://www2.nrm.se/en/svenska_fjarilar/p/plutella_xylostella.html, http://www.glerl.noaa.gov/pubs/photogallery/Fish/pages/1037.html, http://www.agroatlas.ru/en/content/cultural/Lolium_perenne_K/, Chris Jiggins (heliconius.org)

Restriction-site Associated DNA Sequencing

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

1. Genotyping

Image credits: http://www2.nrm.se/en/svenska_fjarilar/p/plutella_xylostella.html, http://www.glerl.noaa.gov/pubs/photogallery/Fish/pages/1037.html, http://www.agroatlas.ru/en/content/cultural/Lolium_perenne_K/, Chris Jiggins (heliconius.org)

Restriction-site Associated DNA Sequencing

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

Plutella xylostella

1. Genotyping

Salmo salar

Image credits: http://www2.nrm.se/en/svenska_fjarilar/p/plutella_xylostella.html, http://www.glerl.noaa.gov/pubs/photogallery/Fish/pages/1037.html, http://www.agroatlas.ru/en/content/cultural/Lolium_perenne_K/, Chris Jiggins (heliconius.org)

Lolium perenne

Restriction-site Associated DNA Sequencing

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

Plutella xylostella

1. Genotyping2. Linkage mapping

Salmo salar

Image credits: http://www2.nrm.se/en/svenska_fjarilar/p/plutella_xylostella.html, http://www.glerl.noaa.gov/pubs/photogallery/Fish/pages/1037.html, http://www.agroatlas.ru/en/content/cultural/Lolium_perenne_K/, Chris Jiggins (heliconius.org)

Lolium perenne

Restriction-site Associated DNA Sequencing

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

Plutella xylostella

1. Genotyping2. Linkage mapping

Salmo salar

Image credits: http://www2.nrm.se/en/svenska_fjarilar/p/plutella_xylostella.html, http://www.glerl.noaa.gov/pubs/photogallery/Fish/pages/1037.html, http://www.agroatlas.ru/en/content/cultural/Lolium_perenne_K/, Chris Jiggins (heliconius.org)

Lolium perenne

Restriction-site Associated DNA Sequencing

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

Plutella xylostella

1. Genotyping2. Linkage mapping3. Genome scaffolding

Salmo salar

Image credits: http://www2.nrm.se/en/svenska_fjarilar/p/plutella_xylostella.html, http://www.glerl.noaa.gov/pubs/photogallery/Fish/pages/1037.html, http://www.agroatlas.ru/en/content/cultural/Lolium_perenne_K/, Chris Jiggins (heliconius.org)

Lolium perenne

Restriction-site Associated DNA Sequencing

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

Plutella xylostella

1. Genotyping

4. Population genetics

2. Linkage mapping3. Genome scaffolding

Salmo salar

Image credits: http://www2.nrm.se/en/svenska_fjarilar/p/plutella_xylostella.html, http://www.glerl.noaa.gov/pubs/photogallery/Fish/pages/1037.html, http://www.agroatlas.ru/en/content/cultural/Lolium_perenne_K/, Chris Jiggins (heliconius.org)

Lolium perenne

Restriction-site Associated DNA Sequencing

RAD Sequencing: A method for Population Genomics

Hohenlohe et al, PLoS Genetics 6(2):e1000862, 2010

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

OceanicRabbit SloughResurrection Bay

FreshwaterBear Paw LakeBoot LakeMud Lake

Hohenlohe et al, PLoS Genetics 6(2):e1000862, 2010

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

OceanicRabbit SloughResurrection Bay

FreshwaterBear Paw LakeBoot LakeMud Lake

Hohenlohe et al, PLoS Genetics 6(2):e1000862, 2010

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

OceanicRabbit SloughResurrection Bay

FreshwaterBear Paw LakeBoot LakeMud Lake

FST

Hohenlohe et al, PLoS Genetics 6(2):e1000862, 2010

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

OceanicRabbit SloughResurrection Bay

FreshwaterBear Paw LakeBoot LakeMud Lake

FST

Hohenlohe et al, PLoS Genetics 6(2):e1000862, 2010

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

OceanicRabbit SloughResurrection Bay

FreshwaterBear Paw LakeBoot LakeMud Lake

LG I

FST

Hohenlohe et al, PLoS Genetics 6(2):e1000862, 2010

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

100bp 100bp

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

100bp 100bp 200-500bp200-500bp

RAD Sequencing: A method for Population Genomics

Baird et al, PLoS ONE 3(10):e3376, 2008

Population Genomics RADSeq Applications RADSeq Method Plutella Example

46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

100bp 100bp 200-500bp200-500bp

~1Kbp

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

Plutella xylostella

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

Plutella xylostella

Population Genomics RADSeq Applications RADSeq Method Plutella Example

Baxter et al, PLoS Genetics 6(1):e1000802, 2010

RAD Sequencing: A method for Population Genomics

Plutella xylostella

BC Male (father) (R/R)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

Baxter et al, PLoS Genetics 6(1):e1000802, 2010

RAD Sequencing: A method for Population Genomics

Plutella xylostella

BC Male (father) (R/R) F1 Female (mother) (R/S)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

Baxter et al, PLoS Genetics 6(1):e1000802, 2010

RAD Sequencing: A method for Population Genomics

Plutella xylostella

BC Male (father) (R/R)11 offspring treated with Spinosad (R/R)

F1 Female (mother) (R/S)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

Baxter et al, PLoS Genetics 6(1):e1000802, 2010

RAD Sequencing: A method for Population Genomics

Plutella xylostella

BC Male (father) (R/R)11 offspring treated with Spinosad (R/R) 9 offspring untreated (R/S or R/R)

F1 Female (mother) (R/S)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

Baxter et al, PLoS Genetics 6(1):e1000802, 2010

RAD Sequencing: A method for Population Genomics

Plutella xylostella

BC Male (father) (R/R)11 offspring treated with Spinosad (R/R) 9 offspring untreated (R/S or R/R)

F1 Female (mother) (R/S)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

1 lane of RAD Sequencing:10 million paired end reads

Baxter et al, PLoS Genetics 6(1):e1000802, 2010

RAD Sequencing: A method for Population Genomics

Plutella xylostella

BC Male (father) (R/R)11 offspring treated with Spinosad (R/R) 9 offspring untreated (R/S or R/R)

F1 Female (mother) (R/S)

Aims1. Identify 31 linkage groups including chromosome with resistance mutation

Population Genomics RADSeq Applications RADSeq Method Plutella Example

1 lane of RAD Sequencing:10 million paired end reads

Baxter et al, PLoS Genetics 6(1):e1000802, 2010

RAD Sequencing: A method for Population Genomics

Plutella xylostella

BC Male (father) (R/R)11 offspring treated with Spinosad (R/R) 9 offspring untreated (R/S or R/R)

F1 Female (mother) (R/S)

Aims1. Identify 31 linkage groups including chromosome with resistance mutation

2. Build linkage map based on paternal inheritance

Population Genomics RADSeq Applications RADSeq Method Plutella Example

1 lane of RAD Sequencing:10 million paired end reads

Baxter et al, PLoS Genetics 6(1):e1000802, 2010

RAD Sequencing: A method for Population Genomics

Plutella xylostella

BC Male (father) (R/R)11 offspring treated with Spinosad (R/R) 9 offspring untreated (R/S or R/R)

F1 Female (mother) (R/S)

Aims1. Identify 31 linkage groups including chromosome with resistance mutation

2. Build linkage map based on paternal inheritance3. Compare RAD loci to Bombyx mori silkworm genome

Population Genomics RADSeq Applications RADSeq Method Plutella Example

1 lane of RAD Sequencing:10 million paired end reads

Baxter et al, PLoS Genetics 6(1):e1000802, 2010

RAD Sequencing: A method for Population Genomics

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

M F C1 C2 C3 C4 C5 C6 C7 C8 C9 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 Alleles

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

M F C1 C2 C3 C4 C5 C6 C7 C8 C9 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 Alleles

- ● * * * * * * * * * - - - - - - - - - - - 168

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

M F C1 C2 C3 C4 C5 C6 C7 C8 C9 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 Alleles

- ● ● - - - - - ● ● - - - - - - - - - - - -- ● * * * * * * * * * - - - - - - - - - - - 168

99

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

M F C1 C2 C3 C4 C5 C6 C7 C8 C9 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 Alleles

- ● ● - - - - - ● ● - - - - - - - - - - - -- ● * * * * * * * * * - - - - - - - - - - - 168

99

- ● - ● ● ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ●

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

75

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

M F C1 C2 C3 C4 C5 C6 C7 C8 C9 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 Alleles

- ● ● - - - - - ● ● - - - - - - - - - - - -- ● * * * * * * * * * - - - - - - - - - - - 168

99

- ● - ● ● ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ●

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

75

0 48 49 0 0 0 0 0 34 65 0 0 0 0 0 0 0 0 0 0 0 0CTACACGCTGAAAGACCCATATTCGATGCACGACACGGAC

M F C1 C2 C3 C4 C6 C7 C8 C9 C10 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

M F C1 C2 C3 C4 C5 C6 C7 C8 C9 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 Alleles

- ● ● - - - - - ● ● - - - - - - - - - - - -- ● * * * * * * * * * - - - - - - - - - - - 168

99

- ● - ● ● ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ●

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

75

0 48 49 0 0 0 0 0 34 65 0 0 0 0 0 0 0 0 0 0 0 0CTACACGCTGAAAGACCCATATTCGATGCACGACACGGAC

M F C1 C2 C3 C4 C6 C7 C8 C9 C10 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11

0 71 0 53 76 56 53 84 0 0 45 20 40 53 79 59 67 59 47 66 71 32CTACACGCTGAAAGACCCATGTTCGATGCACGACACGGAC

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

M F C1 C2 C3 C4 C5 C6 C7 C8 C9 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 Alleles

- ● ● - - - - - ● ● - - - - - - - - - - - -- ● * * * * * * * * * - - - - - - - - - - - 168

99

- ● - ● ● ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ●

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

75

0 48 49 0 0 0 0 0 34 65 0 0 0 0 0 0 0 0 0 0 0 0CTACACGCTGAAAGACCCATATTCGATGCACGACACGGAC

M F C1 C2 C3 C4 C6 C7 C8 C9 C10 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11

0 71 0 53 76 56 53 84 0 0 45 20 40 53 79 59 67 59 47 66 71 32CTACACGCTGAAAGACCCATGTTCGATGCACGACACGGAC

30 0 51 26 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41

CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

M F C1 C2 C3 C4 C5 C6 C7 C8 C9 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 Alleles

- ● ● - - - - - ● ● - - - - - - - - - - - -- ● * * * * * * * * * - - - - - - - - - - - 168

99

- ● - ● ● ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ●

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

75

0 48 49 0 0 0 0 0 34 65 0 0 0 0 0 0 0 0 0 0 0 0CTACACGCTGAAAGACCCATATTCGATGCACGACACGGAC

M F C1 C2 C3 C4 C6 C7 C8 C9 C10 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11

0 71 0 53 76 56 53 84 0 0 45 20 40 53 79 59 67 59 47 66 71 32CTACACGCTGAAAGACCCATGTTCGATGCACGACACGGAC

13 0 0 0 46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC

30 0 51 26 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41

CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

Population Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population Genomics

M F C1 C2 C3 C4 C5 C6 C7 C8 C9 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 Alleles

- ● ● - - - - - ● ● - - - - - - - - - - - -- ● * * * * * * * * * - - - - - - - - - - - 168

99

- ● - ● ● ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ●

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

75

0 48 49 0 0 0 0 0 34 65 0 0 0 0 0 0 0 0 0 0 0 0CTACACGCTGAAAGACCCATATTCGATGCACGACACGGAC

M F C1 C2 C3 C4 C6 C7 C8 C9 C10 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11

0 71 0 53 76 56 53 84 0 0 45 20 40 53 79 59 67 59 47 66 71 32CTACACGCTGAAAGACCCATGTTCGATGCACGACACGGAC

13 0 0 0 46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC

30 0 51 26 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41

CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

Population Genomics RADSeq Applications RADSeq Method Plutella Example

01 100000110 00000000000 99

RAD Sequencing: A method for Population Genomics

M F C1 C2 C3 C4 C5 C6 C7 C8 C9 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 Alleles

- ● ● - - - - - ● ● - - - - - - - - - - - -- ● * * * * * * * * * - - - - - - - - - - - 168

99

- ● - ● ● ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ●

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

75

0 48 49 0 0 0 0 0 34 65 0 0 0 0 0 0 0 0 0 0 0 0CTACACGCTGAAAGACCCATATTCGATGCACGACACGGAC

M F C1 C2 C3 C4 C6 C7 C8 C9 C10 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11

0 71 0 53 76 56 53 84 0 0 45 20 40 53 79 59 67 59 47 66 71 32CTACACGCTGAAAGACCCATGTTCGATGCACGACACGGAC

13 0 0 0 46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC

30 0 51 26 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41

CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

Population Genomics RADSeq Applications RADSeq Method Plutella Example

01 100000110 00000000000 99 01 011111001 11111111111 75

RAD Sequencing: A method for Population Genomics

M F C1 C2 C3 C4 C5 C6 C7 C8 C9 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 Alleles

- ● ● - - - - - ● ● - - - - - - - - - - - -- ● * * * * * * * * * - - - - - - - - - - - 168

99

- ● - ● ● ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ●

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

75

0 48 49 0 0 0 0 0 34 65 0 0 0 0 0 0 0 0 0 0 0 0CTACACGCTGAAAGACCCATATTCGATGCACGACACGGAC

M F C1 C2 C3 C4 C6 C7 C8 C9 C10 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11

0 71 0 53 76 56 53 84 0 0 45 20 40 53 79 59 67 59 47 66 71 32CTACACGCTGAAAGACCCATGTTCGATGCACGACACGGAC

13 0 0 0 46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC

30 0 51 26 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41

CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

Population Genomics RADSeq Applications RADSeq Method Plutella Example

01 100000110 00000000000 99 01 011111001 11111111111 75

10 110010000 11100010101 18

RAD Sequencing: A method for Population Genomics

M F C1 C2 C3 C4 C5 C6 C7 C8 C9 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11 Alleles

- ● ● - - - - - ● ● - - - - - - - - - - - -- ● * * * * * * * * * - - - - - - - - - - - 168

99

- ● - ● ● ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ●

M = Male (R/R) F = Female (R/S) E = Experiment (R/R) C = Control (R/R or R/S)

75

0 48 49 0 0 0 0 0 34 65 0 0 0 0 0 0 0 0 0 0 0 0CTACACGCTGAAAGACCCATATTCGATGCACGACACGGAC

M F C1 C2 C3 C4 C6 C7 C8 C9 C10 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11

0 71 0 53 76 56 53 84 0 0 45 20 40 53 79 59 67 59 47 66 71 32CTACACGCTGAAAGACCCATGTTCGATGCACGACACGGAC

13 0 0 0 46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC

30 0 51 26 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41

CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

Population Genomics RADSeq Applications RADSeq Method Plutella Example

01 100000110 00000000000 99 01 011111001 11111111111 75

10 110010000 11100010101 18 10 001101111 00011101010 15

0101111100111111111111 75 0110000011000000000000 990111111010100010010000 49 0100000101011101101111 900100100000111100010100 25 0111011111000011101011 800111100011011100111000 48 0100011100100011000111 790110010110101111110010 64 0101101001010000001101 700101000101010101010111 48 0110111010101010101000 670110110001111001011001 65 0101001110000110100110 660110011101110011110001 23 0101100010001100001110 660111001010110101111101 45 0100110101001010000010 620110100011100111000000 17 0101011100011000111111 570100101111000000111111 35 0111010000111111000000 540101010001101000110011 39 0110101110010111001100 480101000000111010010010 17 0110111111000101101101 470101100010100010111001 29 0110011101011101000110 470110110001011001110001 35 0101001110100110001110 450101001111100001100110 41 0110110000011110011001 430110001111011100101010 37 0101110000100011010101 430110001010010011101001 35 0101110101101100010110 420100111111001001010100 35 0111000000110110101011 390101110010011110111010 32 0110001101100001000101 390110011000001101000001 32 0101100111110010111110 370111101110111000110110 26 0100010001000111001001 370111100011100000011110 22 0100011100011111100001 360111101100010011010000 33 0100010011101100101111 350100000111111010111010 29 0111111000000101000101 330101110010101100010000 29 0110001101010011101111 330100001101010100111000 25 0111110010101011000111 320100111000011000011001 17 0111000111100111100110 320101101010011000010101 18 0110010101100111101010 190110101110111101000100 14 0101010001000010111011 190100101011001001010111 16 0111010100110110101000 17

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

0101111100111111111111 75 0110000011000000000000 990111111010100010010000 49 0100000101011101101111 900100100000111100010100 25 0111011111000011101011 800111100011011100111000 48 0100011100100011000111 790110010110101111110010 64 0101101001010000001101 700101000101010101010111 48 0110111010101010101000 670110110001111001011001 65 0101001110000110100110 660110011101110011110001 23 0101100010001100001110 660111001010110101111101 45 0100110101001010000010 620110100011100111000000 17 0101011100011000111111 570100101111000000111111 35 0111010000111111000000 540101010001101000110011 39 0110101110010111001100 480101000000111010010010 17 0110111111000101101101 470101100010100010111001 29 0110011101011101000110 470110110001011001110001 35 0101001110100110001110 450101001111100001100110 41 0110110000011110011001 430110001111011100101010 37 0101110000100011010101 430110001010010011101001 35 0101110101101100010110 420100111111001001010100 35 0111000000110110101011 390101110010011110111010 32 0110001101100001000101 390110011000001101000001 32 0101100111110010111110 370111101110111000110110 26 0100010001000111001001 370111100011100000011110 22 0100011100011111100001 360111101100010011010000 33 0100010011101100101111 350100000111111010111010 29 0111111000000101000101 330101110010101100010000 29 0110001101010011101111 330100001101010100111000 25 0111110010101011000111 320100111000011000011001 17 0111000111100111100110 320101101010011000010101 18 0110010101100111101010 190110101110111101000100 14 0101010001000010111011 190100101011001001010111 16 0111010100110110101000 17

mffmfmmmfffmmfffmmmmmm

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

0101111100111111111111 75 0110000011000000000000 990111111010100010010000 49 0100000101011101101111 900100100000111100010100 25 0111011111000011101011 800111100011011100111000 48 0100011100100011000111 790110010110101111110010 64 0101101001010000001101 700101000101010101010111 48 0110111010101010101000 670110110001111001011001 65 0101001110000110100110 660110011101110011110001 23 0101100010001100001110 660111001010110101111101 45 0100110101001010000010 620110100011100111000000 17 0101011100011000111111 570100101111000000111111 35 0111010000111111000000 540101010001101000110011 39 0110101110010111001100 480101000000111010010010 17 0110111111000101101101 470101100010100010111001 29 0110011101011101000110 470110110001011001110001 35 0101001110100110001110 450101001111100001100110 41 0110110000011110011001 430110001111011100101010 37 0101110000100011010101 430110001010010011101001 35 0101110101101100010110 420100111111001001010100 35 0111000000110110101011 390101110010011110111010 32 0110001101100001000101 390110011000001101000001 32 0101100111110010111110 370111101110111000110110 26 0100010001000111001001 370111100011100000011110 22 0100011100011111100001 360111101100010011010000 33 0100010011101100101111 350100000111111010111010 29 0111111000000101000101 330101110010101100010000 29 0110001101010011101111 330100001101010100111000 25 0111110010101011000111 320100111000011000011001 17 0111000111100111100110 320101101010011000010101 18 0110010101100111101010 190110101110111101000100 14 0101010001000010111011 190100101011001001010111 16 0111010100110110101000 17

mffmfmmmfffmmfffmmmmmm

0110100011100111000000 17 0101011100011000111111 57

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

0101111100111111111111 75 0110000011000000000000 990111111010100010010000 49 0100000101011101101111 900100100000111100010100 25 0111011111000011101011 800111100011011100111000 48 0100011100100011000111 790110010110101111110010 64 0101101001010000001101 700101000101010101010111 48 0110111010101010101000 670110110001111001011001 65 0101001110000110100110 660110011101110011110001 23 0101100010001100001110 660111001010110101111101 45 0100110101001010000010 620110100011100111000000 17 0101011100011000111111 570100101111000000111111 35 0111010000111111000000 540101010001101000110011 39 0110101110010111001100 480101000000111010010010 17 0110111111000101101101 470101100010100010111001 29 0110011101011101000110 470110110001011001110001 35 0101001110100110001110 450101001111100001100110 41 0110110000011110011001 430110001111011100101010 37 0101110000100011010101 430110001010010011101001 35 0101110101101100010110 420100111111001001010100 35 0111000000110110101011 390101110010011110111010 32 0110001101100001000101 390110011000001101000001 32 0101100111110010111110 370111101110111000110110 26 0100010001000111001001 370111100011100000011110 22 0100011100011111100001 360111101100010011010000 33 0100010011101100101111 350100000111111010111010 29 0111111000000101000101 330101110010101100010000 29 0110001101010011101111 330100001101010100111000 25 0111110010101011000111 320100111000011000011001 17 0111000111100111100110 320101101010011000010101 18 0110010101100111101010 190110101110111101000100 14 0101010001000010111011 190100101011001001010111 16 0111010100110110101000 17

mffmfmmmfffmmfffmmmmmm

0110100011100111000000 17 0101011100011000111111 57

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

LG AFLPsMother-linked

RAD allelesFather-linked RAD alleles

Segregation Patterns

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

Z/W

TOTAL

10 174 155 45

9 139 162 47

9 134 125 27

8 131 102 35

7 127 106 34

7 115 91 27

7 107 56 25

7 105 61 23

6 89 78 23

5 89 106 33

5 87 109 44

5 84 14 7

5 80 60 21

5 80 101 25

4 77 95 21

4 76 94 38

4 74 57 18

3 71 54 16

3 69 17 8

3 68 50 18

3 64 47 17

3 63 86 27

3 62 18 6

3 62 66 18

2 58 34 9

2 57 62 22

2 49 61 16

2 37 28 12

2 33 60 20

0 33 17 9

8 74 73 31

146 2,568 2,245 722

0101111100111111111111 75 0110000011000000000000 990111111010100010010000 49 0100000101011101101111 900100100000111100010100 25 0111011111000011101011 800111100011011100111000 48 0100011100100011000111 790110010110101111110010 64 0101101001010000001101 700101000101010101010111 48 0110111010101010101000 670110110001111001011001 65 0101001110000110100110 660110011101110011110001 23 0101100010001100001110 660111001010110101111101 45 0100110101001010000010 620110100011100111000000 17 0101011100011000111111 570100101111000000111111 35 0111010000111111000000 540101010001101000110011 39 0110101110010111001100 480101000000111010010010 17 0110111111000101101101 470101100010100010111001 29 0110011101011101000110 470110110001011001110001 35 0101001110100110001110 450101001111100001100110 41 0110110000011110011001 430110001111011100101010 37 0101110000100011010101 430110001010010011101001 35 0101110101101100010110 420100111111001001010100 35 0111000000110110101011 390101110010011110111010 32 0110001101100001000101 390110011000001101000001 32 0101100111110010111110 370111101110111000110110 26 0100010001000111001001 370111100011100000011110 22 0100011100011111100001 360111101100010011010000 33 0100010011101100101111 350100000111111010111010 29 0111111000000101000101 330101110010101100010000 29 0110001101010011101111 330100001101010100111000 25 0111110010101011000111 320100111000011000011001 17 0111000111100111100110 320101101010011000010101 18 0110010101100111101010 190110101110111101000100 14 0101010001000010111011 190100101011001001010111 16 0111010100110110101000 17

mffmfmmmfffmmfffmmmmmm

0110100011100111000000 17 0101011100011000111111 57

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

LG AFLPsMother-linked

RAD allelesFather-linked RAD alleles

Segregation Patterns

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

Z/W

TOTAL

10 174 155 45

9 139 162 47

9 134 125 27

8 131 102 35

7 127 106 34

7 115 91 27

7 107 56 25

7 105 61 23

6 89 78 23

5 89 106 33

5 87 109 44

5 84 14 7

5 80 60 21

5 80 101 25

4 77 95 21

4 76 94 38

4 74 57 18

3 71 54 16

3 69 17 8

3 68 50 18

3 64 47 17

3 63 86 27

3 62 18 6

3 62 66 18

2 58 34 9

2 57 62 22

2 49 61 16

2 37 28 12

2 33 60 20

0 33 17 9

8 74 73 31

146 2,568 2,245 722

0101111100111111111111 75 0110000011000000000000 990111111010100010010000 49 0100000101011101101111 900100100000111100010100 25 0111011111000011101011 800111100011011100111000 48 0100011100100011000111 790110010110101111110010 64 0101101001010000001101 700101000101010101010111 48 0110111010101010101000 670110110001111001011001 65 0101001110000110100110 660110011101110011110001 23 0101100010001100001110 660111001010110101111101 45 0100110101001010000010 620110100011100111000000 17 0101011100011000111111 570100101111000000111111 35 0111010000111111000000 540101010001101000110011 39 0110101110010111001100 480101000000111010010010 17 0110111111000101101101 470101100010100010111001 29 0110011101011101000110 470110110001011001110001 35 0101001110100110001110 450101001111100001100110 41 0110110000011110011001 430110001111011100101010 37 0101110000100011010101 430110001010010011101001 35 0101110101101100010110 420100111111001001010100 35 0111000000110110101011 390101110010011110111010 32 0110001101100001000101 390110011000001101000001 32 0101100111110010111110 370111101110111000110110 26 0100010001000111001001 370111100011100000011110 22 0100011100011111100001 360111101100010011010000 33 0100010011101100101111 350100000111111010111010 29 0111111000000101000101 330101110010101100010000 29 0110001101010011101111 330100001101010100111000 25 0111110010101011000111 320100111000011000011001 17 0111000111100111100110 320101101010011000010101 18 0110010101100111101010 190110101110111101000100 14 0101010001000010111011 190100101011001001010111 16 0111010100110110101000 17

mffmfmmmfffmmfffmmmmmm

0110100011100111000000 17 0101011100011000111111 57

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

LG AFLPsMother-linked

RAD allelesFather-linked RAD alleles

Segregation Patterns

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

Z/W

TOTAL

10 174 155 45

9 139 162 47

9 134 125 27

8 131 102 35

7 127 106 34

7 115 91 27

7 107 56 25

7 105 61 23

6 89 78 23

5 89 106 33

5 87 109 44

5 84 14 7

5 80 60 21

5 80 101 25

4 77 95 21

4 76 94 38

4 74 57 18

3 71 54 16

3 69 17 8

3 68 50 18

3 64 47 17

3 63 86 27

3 62 18 6

3 62 66 18

2 58 34 9

2 57 62 22

2 49 61 16

2 37 28 12

2 33 60 20

0 33 17 9

8 74 73 31

146 2,568 2,245 722

0101111100111111111111 75 0110000011000000000000 990111111010100010010000 49 0100000101011101101111 900100100000111100010100 25 0111011111000011101011 800111100011011100111000 48 0100011100100011000111 790110010110101111110010 64 0101101001010000001101 700101000101010101010111 48 0110111010101010101000 670110110001111001011001 65 0101001110000110100110 660110011101110011110001 23 0101100010001100001110 660111001010110101111101 45 0100110101001010000010 620110100011100111000000 17 0101011100011000111111 570100101111000000111111 35 0111010000111111000000 540101010001101000110011 39 0110101110010111001100 480101000000111010010010 17 0110111111000101101101 470101100010100010111001 29 0110011101011101000110 470110110001011001110001 35 0101001110100110001110 450101001111100001100110 41 0110110000011110011001 430110001111011100101010 37 0101110000100011010101 430110001010010011101001 35 0101110101101100010110 420100111111001001010100 35 0111000000110110101011 390101110010011110111010 32 0110001101100001000101 390110011000001101000001 32 0101100111110010111110 370111101110111000110110 26 0100010001000111001001 370111100011100000011110 22 0100011100011111100001 360111101100010011010000 33 0100010011101100101111 350100000111111010111010 29 0111111000000101000101 330101110010101100010000 29 0110001101010011101111 330100001101010100111000 25 0111110010101011000111 320100111000011000011001 17 0111000111100111100110 320101101010011000010101 18 0110010101100111101010 190110101110111101000100 14 0101010001000010111011 190100101011001001010111 16 0111010100110110101000 17

mffmfmmmfffmmfffmmmmmm

0110100011100111000000 17 0101011100011000111111 57

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

LG AFLPsMother-linked

RAD allelesFather-linked RAD alleles

Segregation Patterns

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

Z/W

TOTAL

10 174 155 45

9 139 162 47

9 134 125 27

8 131 102 35

7 127 106 34

7 115 91 27

7 107 56 25

7 105 61 23

6 89 78 23

5 89 106 33

5 87 109 44

5 84 14 7

5 80 60 21

5 80 101 25

4 77 95 21

4 76 94 38

4 74 57 18

3 71 54 16

3 69 17 8

3 68 50 18

3 64 47 17

3 63 86 27

3 62 18 6

3 62 66 18

2 58 34 9

2 57 62 22

2 49 61 16

2 37 28 12

2 33 60 20

0 33 17 9

8 74 73 31

146 2,568 2,245 722

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

BLASTX RAD paired end sequencesagainst the Bombyx genome(Expect<1e-20)

Bm DBM Total Hits1 22 242 1 13 16 94 30 205 31 236 17 147 7 58 12 38 23 149 6 410 28 1511 5 511 13 1712 15 813 20 813 21 1414 2 715 29 2216 3 216 27 1717 25 1119 11 920 14 721 24 1622 10 923 9 923 20 1325 26 1726 19 227 18 628 4? x

1/11/15/6/8 8 x

Bombyx mori (Bm)28 chromosomes

Plutella xylostella (DBM) 31 chromosomes

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

BLASTX RAD paired end sequencesagainst the Bombyx genome(Expect<1e-20)

Bm DBM Total Hits1 22 242 1 13 16 94 30 205 31 236 17 147 7 58 12 38 23 149 6 410 28 1511 5 511 13 1712 15 813 20 813 21 1414 2 715 29 2216 3 216 27 1717 25 1119 11 920 14 721 24 1622 10 923 9 923 20 1325 26 1726 19 227 18 628 4? x

1/11/15/6/8 8 x

Bombyx mori (Bm)28 chromosomes

Plutella xylostella (DBM) 31 chromosomes

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

0 48 49 0 0 0 0 0 34 65 0 0 0 0 0 0 0 0 0 0 0 0

CTACACGCTGAAAGACCCATATTCGATGCACGACACGGAC M F C1 C2 C3 C4 C6 C7 C8 C9 C10 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11

0 71 0 53 76 56 53 84 0 0 45 20 40 53 79 59 67 59 47 66 71 32CTACACGCTGAAAGACCCATGTTCGATGCACGACACGGAC

13 0 0 0 46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC

30 0 51 26 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

0 48 49 0 0 0 0 0 34 65 0 0 0 0 0 0 0 0 0 0 0 0

CTACACGCTGAAAGACCCATATTCGATGCACGACACGGAC M F C1 C2 C3 C4 C6 C7 C8 C9 C10 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11

0 71 0 53 76 56 53 84 0 0 45 20 40 53 79 59 67 59 47 66 71 32CTACACGCTGAAAGACCCATGTTCGATGCACGACACGGAC

13 0 0 0 46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC

30 0 51 26 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

LG I

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

0 48 49 0 0 0 0 0 34 65 0 0 0 0 0 0 0 0 0 0 0 0

CTACACGCTGAAAGACCCATATTCGATGCACGACACGGAC M F C1 C2 C3 C4 C6 C7 C8 C9 C10 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11

0 71 0 53 76 56 53 84 0 0 45 20 40 53 79 59 67 59 47 66 71 32CTACACGCTGAAAGACCCATGTTCGATGCACGACACGGAC

13 0 0 0 46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC

30 0 51 26 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

LG I

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

0 48 49 0 0 0 0 0 34 65 0 0 0 0 0 0 0 0 0 0 0 0

CTACACGCTGAAAGACCCATATTCGATGCACGACACGGAC M F C1 C2 C3 C4 C6 C7 C8 C9 C10 E1 E2 E3 E4 E5 E6 E7 E8 E9 E10 E11

0 71 0 53 76 56 53 84 0 0 45 20 40 53 79 59 67 59 47 66 71 32CTACACGCTGAAAGACCCATGTTCGATGCACGACACGGAC

13 0 0 0 46 40 0 83 43 34 29 0 0 0 44 50 48 0 42 0 85 0CTACACGCTGAAAGACCCATTTTCGAATCACGACACGGAC

30 0 51 26 0 0 57 0 0 0 0 13 31 50 0 0 0 67 0 41 0 41CTACACGCTGAAAGACCCATTTTCGATGCACGACACGGAC

LG I

2nd UK RADSequencing Meeting

Tuesday 31st AugustNational e-Science Centre

Edinburgh

www.nesc.ed.ac.uk/esi/events/1090

https://www.wiki.ed.ac.uk/display/RADSequencing

(Google “RAD Sequencing”)

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

2nd UK RADSequencing Meeting

Tuesday 31st AugustNational e-Science Centre

Edinburgh

www.nesc.ed.ac.uk/esi/events/1090

https://www.wiki.ed.ac.uk/display/RADSequencing

(Google “RAD Sequencing”)

Mark BlaxterMarian Thomson

Urmi TrivediKarim Gharbi

RAD Sequencing: A method for Population GenomicsPopulation Genomics RADSeq Applications RADSeq Method Plutella Example

2nd UK RADSequencing Meeting

Tuesday 31st AugustNational e-Science Centre

Edinburgh

www.nesc.ed.ac.uk/esi/events/1090

https://www.wiki.ed.ac.uk/display/RADSequencing

(Google “RAD Sequencing”)

Simon BaxterEric Johnson

Paul Etter