ORIGINALARTICLE

Quaternary palaeoenvironmentaloscillations drove the evolution of theEurasian Carassius auratus complex(Cypriniformes, Cyprinidae)

Yun Gao1�, Shu-Yan Wang1,2�, Jing Luo3, Robert W. Murphy1,4,

Rui Du3, Shi-Fang Wu1, Chun-Ling Zhu1, Yan Li3, Andrei D. Poyarkov5,

Sang Ngoc Nguyen1,6, Peng-Tao Luan3 and Ya-Ping Zhang1,3*

1State Key Laboratory of Genetic Resources and

Evolution and Yunnan Laboratory of

Molecular Biology of Domestic Animals,

Kunming Institute of Zoology, The Chinese

Academy of Sciences, Kunming, China, 2School

of Life Sciences, University of Science and

Technology of China, Hefei, China,3Laboratory of Conservation and Utilization of

Bio-resources and Key Laboratory for Animal

Genetic Diversity and Evolution of High

Education in Yunnan Province, School of Life

Sciences, Yunnan University, Kunming, China,4Centre for Biodiversity and Conservation

Biology, Royal Ontario Museum, Toronto,

Ontario, Canada, 5A. N. Severtzov Institute of

Ecology and Evolution, Russian Academy of

Sciences, Moscow, Russia, 6Institute of Tropical

Biology, the Vietnamese Academy of Science

and Technology, Ho Chi Minh City, Vietnam

*Correspondence: Ya-Ping Zhang, State Key

Laboratory of Genetic Resources and Evolution,

Kunming Institute of Zoology, The Chinese

Academy of Sciences, Kunming 650223, China.

E-mail: zhangyp@mail.kiz.ac.cn�These authors contributed equally.

ABSTRACT

Aim We sought to reconstruct the spatio-temporal genetic diversification in

goldfish of the Carassius auratus complex, which is widely distributed in Eurasia,

to test whether vicariance events or human-mediated translocations best

explained lineage divergence and genogeographical history.

Location East Asia and the Oriental islands including Japan, the Ryukyus and

Taiwan, and Europe, including Russia and the Czech Republic.

Methods We reconstructed the matrilineal history of Eurasian goldfish using

1876 sequences from the partial mitochondrial DNA control region (426 bp) and

191 complete sequences of cytochrome b (1140 bp) from 67 localities

representing most of the range of the species. Divergence times were estimated

using a Bayesian Markov chain Monte Carlo approach based either on molecular

clock data or on the fossil record. Genetic structure and the historical

demography of populations were analysed using partial correlation tests and

analyses of molecular variance.

Results Three lineages had high levels of regional specificity. Lineages A and B

from the main islands of Japan differed greatly from lineage C, which occurred on

the mainland, Taiwan and the Ryukyus. Lineages A and B had late Pliocene

origins. Six geographically constrained sublineages within lineage C had near-

simultaneous mid-Pleistocene divergences.

Main conclusions Genetic structure in the C. auratus complex appears to have

been driven by palaeoenvironmental perturbations rather than human

translocations. The disappearance of a land bridge in the Tsushima Strait

around 3.0 Ma is responsible for the separation of Japanese and continental

lineages; the estimated divergence time is 2.75–2.32 Ma. Fujian, China and

Vietnam appear to have provided important refugia for the C. auratus complex

during glaciation. After warm, moist summer monsoons intensified during the

mid-Pleistocene, goldfish are likely to have dispersed north-eastwards to

recolonize the Ryukyus via Taiwan and northwards to recolonize mainland

China.

Keywords

Dispersal, divergence dating, East Asia, Eurasian goldfish, glacial cycling,

monsoon oscillations, mtDNA, phylogeography, Pleistocene.

Journal of Biogeography (J. Biogeogr.) (2012) 39, 2264–2278

2264 http://wileyonlinelibrary.com/journal/jbi ª 2012 Blackwell Publishing Ltddoi:10.1111/j.1365-2699.2012.02755.x

INTRODUCTION

Glacial cycling from the Pliocene and through the Quaternary is

known to have caused dramatic climatic (Bray, 1979) and

biogeographical changes (Ogasawara, 1994; Kimura, 2002) on

mainland China as well as the nearby Oriental islands. These

oscillations, which included eustatic sea-level changes and the

concomitant formation of ephemeral land bridges, are likely to

have been imprinted in rapidly evolving and maternally

inherited mitochondrial genes (Hewitt, 1996, 2000) and in

the fossil record. When investigating the genetic consequences

of such events, it is important to consider that mesophilic and

aquatic organisms are more likely than xerophilic taxa to have

been affected by environmental perturbations (Murphy &

Aguirre-Leon, 2002). Further, genogeographical (sensu Sereb-

rovsky, 1928; phylogeographical sensu Avise et al., 1987)

investigations can be complicated by human-mediated trans-

locations (Kottelat, 1997; Kalous et al., 2007; Sakai et al., 2009),

especially when evaluating economically important species.

Quaternary glaciations are known to have had far-reaching

effects in the Northern Hemisphere. For example, palaeonto-

logical and genogeographical studies indicate that European

and North American species experienced repeated episodes of

contraction and expansion of their ranges due to major

climatic oscillations (Hewitt, 2000, 2004). Similarly, the fossil

record of mainland China suggests the early Pliocene fauna,

which was adapted to warm, wet weather, retreated south-

eastwards during glacial times when the northern regions

became much cooler and drier (Li et al., 2004). At times of

glaciation, several ancient lineages of warm freshwater fishes,

such as the members of the Cyprininae, are thought to have

gradually become extinct in cooler parts of the mainland

(Chen, 1998). Populations of freshwater fishes (Chen & He,

2000), frogs (Emerson & Berrigan, 1993), salamanders (Hay-

ashi & Matsui, 1988) and non-avian reptiles (Ota, 1998) in

Taiwan and the Ryukyus share close historical relationships

with eastern China, probably reflecting the occurrence of

ephemeral land bridges that connected these areas. Further,

genogeographical studies of Chinese freshwater fishes, includ-

ing Hemibagrus guttatus (Yang & He, 2008) and Neosalanx

taihuensis (Zhao et al., 2008), suggest that the trajectories of

the major Chinese rivers have changed. Regardless, little is

known about the effect of East Asian palaeoenvironmental

oscillations on the genetic structure, possible refugia and the

contraction and expansion routes of aquatic species.

The Carassius auratus complex (Cypriniformes, Cyprinidae)

is widely distributed across Eurasia, including the Oriental

islands, and is thought to have had opportunities to occupy

new environments (Berg, 1949; Nakamura, 1969; Eschmeyer,

1998). The complex had a late Pliocene origin and Pleistocene

radiation (see below). Consequently, the species can be used to

investigate the genetic consequences of Quaternary palaeoen-

vironmental changes in East Asia. This complex exhibits

remarkable morphological and genetic diversity and some wild

lineages are endemic to particular geographical regions. In

general, Carassius auratus auratus (Linnaeus, 1758) occurs in

mainland China (Nakamura, 1969; Meng et al., 1995; Luo

et al., 1999) and Carassius auratus gibelio (Bloch, 1782; the

gibel carp) is restricted to the northern Amur River systems

and eastern Europe (Cherfas, 1981; Jiang et al., 1983; Gui,

1997, 2007). Both Carassius auratus langsdorfii Temminck &

Schlegel, 1846 and Carassius auratus cuvieri Temminck &

Schlegel, 1846 occur on the main islands of Japan (Meng et al.,

1995; Luo et al., 1999). However, morphological similarity and

human-facilitated translocations among lineages of the C. au-

ratus complex can make the identification of subspecies

difficult.

Takada et al. (2010) have examined the matrilineal genealogy

of the East Asian C. auratus complex, mostly from Japan and

the Ryukyus. They have identified two major lineages and seven

sublineages with high regional specificity. Further, five possible

human-facilitated translocation routes have been proposed.

The potential impacts of historical geography and climatic

variation on continental samples of the species have been noted

as topics requiring further study. Herein, we investigate

genogeographical patterns based on substantially increased

sample sizes and locations from mainland China and Europe.

Partial control region (CR) sequences are surveyed because of

their high evolutionary rate of mutation (Tzeng et al., 1992;

Chang et al., 1994; Meyer, 1993; Broughton et al., 2001), but we

also sequence the entire cytochrome b gene (cyt b) of a subset of

individuals in order to evaluate the matrilineal genealogy of East

Asian samples within a broader geographical sample, including

Eurasian Carassius, because this gene is more conserved than the

CR (Moritz et al., 1987; Tzeng et al., 1992; Meyer, 1993; Johns &

Avise, 1998; Broughton et al., 2001). We also evaluate human-

mediated translocations by assessing whether the present

biogeographical patterns of lineages correspond either to

long-term isolation of resident populations or to records of

anthropogenic activities involving goldfish.

MATERIALS AND METHODS

Sampling and sequencing

Following animal-use protocols approved by the Kunming

Institute of Zoology Animal Care and Ethics Committee, we

collected 960 specimens of Carassius, primarily from mainland

China, Russia, Vietnam and Japan. The specimens were

identified morphologically to the lowest taxonomic category

possible. A total of 916 mitochondrial DNA (mtDNA) CR

sequences of Carassius with sampling localities were down-

loaded from GenBank. Altogether, we evaluated 1876

sequences of CR from mainland China (922 sequences),

Europe (Russia and the Czech Republic, 60 sequences), Taiwan

(43 sequences), Vietnam (4 sequences), the main islands of

Japan (366 sequences) and the Ryukyus (481 sequences). The

outgroup consisted of seven samples of Cyprinus carpio.

Detailed sampling localities and their corresponding voucher

specimen acronyms are listed in Table 1 and mapped in Fig. 1.

One or more specimens in our laboratory with unique CR

haplotypes were selected to estimate variation in the cyt b

Diversification of Eurasian goldfish

Journal of Biogeography 39, 2264–2278 2265ª 2012 Blackwell Publishing Ltd

Table 1 Sampling information for the 67 populations of the Carassius auratus complex in Eurasia in the present study.

Localities Code

Sample

size (n)

Haplotype

diversity (h)

Nucleotide

diversity (p) Groups

1 Puplovo, Russia RUA 13 0.7179 ± 0.0888 0.0342 ± 0.0185 Europe

2 Moscow*, Russia RUB 20 0.3684 ± 0.1351 0.0764 ± 0.0389

3 Ivanovsk, Russia RUC 13 0.3846 ± 0.1321 0.0255 ± 0.0139

4 Czech Republic� CZ 14 1.000 ± 0.0270 0.0258 ± 0.0140

5 Fangzheng, Heilongjiang FZ 40 0.7333 ± 0.0790 0.0080 ± 0.0049 Northern mainland China

6 Hulanhe, Heilongjiang HL 11 0.6182 ± 0.1643 0.0035 ± 0.0026

7 Shonghuajiang, Heilongjiang SH 20 0.8474 ± 0.0469 0.0148 ± 0.0082

8 Altay, Xinjiang AL 18 0.5000 ± 0.2652 0.0048 ± 0.0040

9 Irtysh River, Xinjiang ER 3 0.6667 ± 0.3143 0.0253 ± 0.0199

10 Habahe, Xinjiang HA 11 0.3273 ± 0.1533 0.0171 ± 0.0098

11 Tarim River, Xinjiang TL 4 0.8333 ± 0.2224 0.0127 ± 0.0092

12 Liaoyang, Liaoning LN 15 0.8095 ± 0.0782 0.0199 ± 0.0110

13 Dehong, Yunnan DH 17 0.6544 ± 0.0891 0.0058 ± 0.0037 Southern mainland China

14 Dali, Yunnan DL 48 0.8538 ± 0.0251 0.0101 ± 0.0057

15 Kunming, Yunnan KM 249 0.8006 ± 0.0184 0.0117 ± 0.0063

16 Lijiang, Yunnan LJ 31 0.8000 ± 0.0916 0.0062 ± 0.0039

17 Tengchong, Yunnan TC 11 0.5636 ± 0.1340 0.0047 ± 0.0032

18 Wenshan, Yunnan WS 4 0.8333 ± 0.2224 0.0214 ± 0.0149

19 Qinghai QH 44 0.8753 ± 0.0322 0.0200 ± 0.0105

20 Ningqiang, Shaanxi SX 7 0.8059 ± 0.1298 0.0039 ± 0.0030

21 Dongyin, Shandong SD 19 0.8304 ± 0.0490 0.0048 ± 0.0032

22 Yaan, Sichuan SC 33 0.8636 ± 0.0382 0.0385 ± 0.0196

23 Puan, Guizhou GZ 47 0.7266 ± 0.0523 0.0244 ± 0.0126

24 Guilin, Guangxi GX 25 0.9100 ± 0.0264 0.0088 ± 0.0051

25 Zongyang, Anhui ZY 34 0.9597 ± 0.0141 0.0208 ± 0.0109

26 Huaiyuan, Anhui HY 15 0.8381 ± 0.0852 0.0168 ± 0.0094

27 Hangzhou, Zhejiang HZ 13 0.9231 ± 0.0500 0.0061 ± 0.0039

28 Huzhou, Zhejiang HU 20 0.8895 ± 0.0380 0.0058 ± 0.0037

29 Wenzhou, Zhejiang WZ 11 0.7455 ± 0.0978 0.0074 ± 0.0047

30 Dongting, Hunan HN 36 0.8746 ± 0.0319 0.0254 ± 0.0131

31 Shashi, Hubei HB 32 0.9619 ± 0.0260 0.0854 ± 0.0432

32 Qihe�, Henan HE 11 0.7636 ± 0.1066 0.0124 ± 0.0073

33 Guangzhou, Guangdong GD 20 0.8857 ± 0.0686 0.0126 ± 0.0072

34 Longyan, Fujian LY 42 0.6942 ± 0.0523 0.0045 ± 0.0029

35 Zhangzhou, Fujian ZZ 31 0.7656 ± 0.0591 0.0174 ± 0.0093

36 Tra Khuc River, Vietnam VN 4 0.8333 ± 0.2224 0.0029 ± 0.0027 Vietnam

37 Taipei§, Taiwan TW 43 0.8051 ± 0.0303 0.0190 ± 0.0102 Taiwan

38 Amamioshima§, Ryukyus Am 21 0.5714 ± 0.0519 0.0071 ± 0.0045 South-central Ryukyus

39 Tokunoshima§, Ryukyus To 4

40 Iheya Island§, Ryukyus Ih 32 0.0625 ± 0.0577 0.0002 ± 0.0005

41 Izena Island§, Ryukyus Iz 59 0.5710 ± 0.0308 0.0110 ± 0.0063

42 Okinawajima§, Ryukyus Ok 242 0.8462 ± 0.0147 0.0293 ± 0.0149

43 Takashiki Island§, Ryukyus Tk 1

44 Zamami Island§, Ryukyus Za 27

45 Kume Island§, Ryukyus Ku 27 0.3333 ± 0.1105 0.0037 ± 0.0027

46 Minamidaito§, Ryukyus Mi 9

47 Ishigakijima§, Ryukyus Is 9 0.5556 ± 0.0902 0.0212 ± 0.0125

48 Tanegashima§, Ryukyus Ta 50 0.5902 ± 0.0404 0.0226 ± 0.0120 Northern Ryukyus

49 Sakasazawa§, Japan Ls 24 0.8188 ± 0.0391 0.0156 ± 0.0088 Japanese main islands

50 Fukushimagate§, Japan Lf 4 0.5000 ± 0.2652 0.0064 ± 0.0054

Y. Gao et al.

2266 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd

sequences for further biogeographical analyses (see Appen-

dix S1 in Supporting information).

Genomic DNA from freshly frozen or ethanol-fixed tissues

was extracted using the standard phenol/chloroform method.

We amplified a partial CR sequence (426 bp) and the entire cyt

b gene (1140 bp; Table 2). A 50 lL polymerase chain reaction

(PCR) amplification was performed with final concentrations

of 1· buffer containing 0.15 mm MgCl2 (Sina-American,

Beijing, China), 0.25 mm dNTPs (Amresco, Solon, OH, USA),

0.8 lm of each primer (Takara, Shanghai, China), 1 U Taq

DNA polymerase (Sina-American) and 25–50 ng total DNA.

Amplifications were performed on a Gene Amp PCR system

9700 (Applied Biosystems, Foster City, CA, USA) with the

following thermal profile: an initial 2 min denaturation at

96 �C, followed by 30 cycles at 96 �C for 1 min, 1 min

annealing (CR, 58 �C; cyt b, 50 �C), and extension at 72 �C for

1 min, followed by a final extension at 72 �C for 10 min. The

PCR products were purified on agarose gels and extracted

(Watson BioMedical Inc., Shanghai, China). Double-stranded

PCR products were directly sequenced in both directions on an

ABI 3730 with ABI PRISM BigDye Terminator Cycle Sequenc-

ing Ready Reaction Kit (Applied Biosystems) according to the

manufacturer’s instructions.

Genealogical reconstruction

We used dnastar 5.0 (DNASTAR Inc., Madison, WI, USA) to

edit and initially align the sequences. The initial CR alignments

were manually adjusted where necessary. dambe 4.1.19 (Xia &

Xie, 2001) was used to identify unique haplotypes and mega

4.0 (Kumar et al., 2008; Tamura et al., 2007) was used to

extract information on nucleotide variation.

Two datasets were subjected to phylogenetic analyses:

unique CR haplotypes only (216 haplotypes) and combined

CR and cyt b (180 haplotypes). Trees were constructed using

maximum likelihood (ML), maximum parsimony (MP) and

Bayesian inference (BI). The ML and MP trees, obtained using

RAxML (Stamatakis et al., 2008) and paup* 4.0b10 (Swofford,

2002), respectively, involved a heuristic search with 100

random addition replicates. Likelihood ratio tests (Goldman,

1993a,b; Huelsenbeck & Crandall, 1997), as implemented in

Modeltest 3.7 (Posada & Crandall, 1998), were employed to

select the best-fitting models for the ML and BI analyses. The

HKY + I + G model was selected for the partitioned CR

dataset, and the TrN + I + G model for the combined dataset,

both based on the Akaike information criterion (AIC; Akaike,

1974). BI and Bayesian posterior probabilities (BPP) were

estimated using MrBayes 3.0b4 (Huelsenbeck & Ronquist,

2001; Ronquist & Huelsenbeck, 2003). BI used four simulta-

neous Metropolis-coupled Markov chain Monte Carlo

(MCMC) runs, each lasting 5,000,000 generations. The average

standard deviation of split frequencies was required to drop to

below 0.01, and the convergence diagnostic for branch length

posterior probabilities (potential scale reduction factor) to

approach 1 (Gelman & Rubin, 1992) after 1,000,000 genera-

tions. Convergence to stationarity was evaluated in tracer 1.5

Table 1 Continued

Localities Code

Sample

size (n)

Haplotype

diversity (h)

Nucleotide

diversity (p) Groups

51 Inawashiro§, Japan Li 6 0.3333 ± 0.2152 0.0053 ± 0.0042

52 Urano River§, Japan Ur 21 0.7048 ± 0.0935 0.0162 ± 0.0091

53 Kasumigaura§, Japan Lk 32 0.7379 ± 0.0511 0.0176 ± 0.0097

54 Magame River§, Japan Mr 15 0.1333 ± 0.1123 0.0051 ± 0.0036

55 Kamidokan Moat§, Japan Km 21 0.5524 ± 0.0658 0.0048 ± 0.0034

56 Nagara River§, Japan Nr 1

57 Lake Biwa§, Japan Lb 39 0.8475 ± 0.0415 0.0722 ± 0.0358

58 Kako River§, Japan Kr 6 0.6000 ± 0.2152 0.0072 ± 0.0053

59 Takatsu River§, Japan Tu 15

60 Shimato River§, Japan Sa 14 0.5824 ± 0.0919 0.0253 ± 0.0141

61 Shigenobu River§, Japan Sr 27 0.4701 ± 0.0962 0.0341 ± 0.0178

62 Iki Island§, Japan Ik 4 0.6667 ± 0.2041 0.0021 ± 0.0024

63 Takara River§, Japan Tr 18 0.4706 ± 0.0823 0.0015 ± 0.0015

64 Chikugo River§, Japan Cr 6 0.5333 ± 0.1721 0.0338 ± 0.0207

65 Sakai River–, Japan Sk 25 0.3913 ± 0.0912 0.0100 ± 0.0060

66 Shibuta River–, Japan Sb 70 0.8824 ± 0.0216 0.1260 ± 0.0611

67 Imba River–, Japan Ir 18 0.8676 ± 0.0446 0.1476 ± 0.0750

Note: Groups, sampling localities and the codes are mapped in Fig. 1, sample size (n) of the specimens together with the haplotype (h) and nucleotide

(p) diversity of the population are listed. The values of h and p equivalent to zero were not shown.

Source: *Three specimens from Takada et al. (2010).

�From Papousek et al. (2008).

�From Li & Gui (2007).

§From Takada et al. (2010).

–From Murakami et al. (2001).

Diversification of Eurasian goldfish

Journal of Biogeography 39, 2264–2278 2267ª 2012 Blackwell Publishing Ltd

(Rambaut & Drummond, 2009) using log-likelihood values.

The first 25% of the trees were discarded as burn-in and the

remaining tree samples were used to generate a consensus tree.

The BPP values were mapped onto the tree, and nodal support

for other tree building methods was assessed using nonpara-

metric bootstrapping (BS; Felsenstein, 1985) calculated in

paup* for the MP analysis (MPBS) and RAxML (Stamatakis

et al., 2008) for ML (MLBS) using 1000 pseudoreplicates each.

Estimation of divergence times

Divergence times among the main lineages of Carassius were

estimated using a Bayesian MCMC approach performed in

beast based on a strict molecular clock or fossil records

(Drummond & Rambaut, 2007; substitution model,

GTR + G + I; tree prior, constant size; 10,000,000 generations;

parameters logged every 1000; burn-in value = 1000). We used

two datasets to estimate the divergence time: unique cyt b

haplotypes only and combined CR and cyt b. The molecular

clock was assumed to be 2.0% site)1 Myr)1 (Meyer, 1993) for

the unique cyt b haplotypes. A node calibration estimated from

a fossil Carassius (Liu & Su, 1962) for the split between

Carassius carassius and the C. auratus complex was dated at

3.6–4.0 Ma. This date was also used in the analyses of the

combined data, and of cyt b alone.

Distribution patterns and hierarchical genetic

structure

To clarify the genogeographical relationships of C. auratus, we

classified the 1876 specimens sequenced for CR using the

combined tree as a backbone, and mapped the distribution of

the haplotypes for each sampling locality on Fig. 1. The

compiled data are listed in Appendix S1.

We used an analysis of molecular variance (AMOVA;

Excoffier et al., 1992; Excoffier & Lischer, 2010) and partial

correlation tests (PCTs) to identify the hierarchical genetic

structure of the C. auratus complex. Sampling localities in

mainland China were classified into eight groups as follows:

Yunnan-Guizhou plateau (e.g. Yunnan and Guizhou), the

Yellow River (e.g. Qinghai), the Pearl River (e.g. Guangxi and

Guangdong), the middle reach of the Yangtze River (e.g. Hunan

and Hubei), the lower Yangtze River (e.g. Anhui and Zhejiang),

the Minjiang River (e.g. Fujian), the Amur River (e.g. Hei-

longjiang and Liaoning) and the inland rivers in Xinjiang (e.g.

the Irtysh and Tarim rivers). AMOVA among the different

20

RUA RUB

8 10

3

241118

11

3

RUA RUC

AL

HA

ER

FZ

HL

SH 46Lk

Ur Lf

Ls

Li

Lk

40

21

5

13

2815

19

20

4

11

ER

TLQH

SCSX

HE

SD

HBHU

LN

154

6

18

Cr

Tr

Lk

Mr

Ik Tu

Sa

CZ

15

Sk

25

2144

32

15

HY

13

1

14

1134

SX

ZYTC

DL

KM

GZ

HB

HNHZ

WZ

TW

11732

13

20

9

a

Am

TaKm

LbKr

Sa

27

21

50

3647249

48

33

39

Sr Ir18

31ZZ b

1

6

Colour of lineages

Li C S bli C3Lineage C Sublineage C2Lineage C Sublineage C1Lineage BLineage A

43

27

32174

31

DH LJWS

GX

GD

20

25

4

Is

ZaTk

Ok

Iz

Mi

IhTo

591

70

Sb42

LY27

9

242 Nr

CC. carassiusLineage C Sublineage C6Lineage C Sublineage C5Lineage C Sublineage C4Lineage C Sublineage C3

Ku

VN

4

B

A

B

//

Figure 1 Geographical distribution and population structure of the Carassius auratus complex and C. carassius in Eurasia. Codes for

sampling localities are listed in Table 1. The inset shows the matrilineal genealogy (from Fig. 2) that depicts eight lineages. Each lineage or

sublineage is uniquely coloured. The number of mitochondrial DNA control region sequences is graphed for each location. Black bar ‘a’ is

the Tokara Gap and ‘b’ is the Kerama Gap.

Y. Gao et al.

2268 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd

drainage basins and populations within each Chinese drainage

basin was implemented using Arlequin 3.5 (Excoffier & Lischer,

2010). We also tested whether or not geographical structure

existed in each of the drainage basins. The drainage basin matrix

value was set to 0 for individuals from the same drainage basin,

and to 1 if in different drainage basins. Geographical distance

was estimated as the Euclidean distance obtained from the

longitude and latitude of sampling localities. Pairwise genetic

differentiation values (FST) were calculated using Arlequin

(Appendix S2). PCTs were used to assess congruence between

genealogical divergence and geographical distance within each

drainage basin (Smouse et al., 1986; Thorpe et al., 1996; Kozak

et al., 2006). PCTs between FST and geographical distance (D) in

each drainage basin were implemented by spss 15 (2006; SPSS

Inc., Chicago, IL, USA). Arlequin was also used to calculate

haplotypic (h) and nucleotide (p) diversity.

RESULTS

Sequence variation

Hyper-variable CR sequences consisted of 426 nucleotide

positions of which 130 were variable (106 potentially parsi-

mony informative). The downloaded data included 916

individuals having 323 nucleotide positions, which were

aligned against our longer fragment. A total of 216 haplotypes

were found in the 1876 samples of Carassius from 67 Eurasian

localities including the Oriental islands and the seven outgroup

sequences (Appendix S1).

The 1140 bp of cyt b had 303 variable sites (232 potentially

parsimony informative), and 110 unique haplotypes were

identified from our 197 specimens (Appendix S1) plus the

downloaded sequences (including the outgroup taxa). The

combined CR and cyt b dataset contained 1566 bp, with 423

variable sites (371 potentially parsimony informative).

Because some of the CR haplotypes in GenBank were not

associated with cyt b sequences, the combined data

distinguished 180 unique haplotypes including six from the

outgroup.

Matrilineal genealogy

BI, MP and ML analyses based on partitioned CR sequences

yielded essentially the same genealogy; variation was restricted

to poorly supported nodes. Although most terminal lineages

were well supported by all methods of analysis, the relation-

ships between sublineages were still unresolved. The matrilin-

eal genealogy based on unique CR haplotypes is presented in

Appendix S3.

Analyses of the combined data yielded essentially the same

topology as the supermatrix tree of Takada et al. (2010), except

for the position of C. carassius and the two new sublineages

(Fig. 2). In their tree, C. carassius appeared to have diverged

after C. a. cuvieri, although without support, presumably

because of the missing CR, ND4 and ND5 data. In our tree,

the two haplotypes of C. carassius from Russia clustered

together (MLBS = 100%, MPBS = 100%, BPP = 100%) and

then formed the sister group of the C. auratus complex,

including C. a. cuvieri, with robust support (MLBS = 100%,

MPBS = 100%, BPP = 100%).

The relationships between (sub)lineages within the C. auratus

complex were more clearly resolved in the analyses of combined

data than when using partitioned CR sequences alone. Within the

C. auratus complex, three major lineages with high support were

identified. First, lineage A included individuals of C. a. cuvieri

from the main islands of Japan (MLBS = 100%, MPBS = 100%,

BPP = 100%). Second, lineage B (superclade A of Takada et al.,

2010) included individuals of C. a. langsdorfii from the main

islands of Japan and the northern Ryukyus (MLBS = 94%,

MPBS = 98%, BPP = 100%). It differed from the CR tree

(Appendix S3), in which lineage B fell within the sublineages of

lineage C, albeit without support. Considering the absence of

support, the two trees were considered to be compatible. Finally,

lineage C (superclade B of Takada et al., 2010) contained the

Table 2 Primer sequences used to amplify by PCR and sequence mitochondrial DNA genes of the genus Carassius.

Target Primer Sequence (5¢ fi 3¢) References

For PCR

cyt b PF15239 TTTAACCGAGACCAATGACT’ This study

PR16473 ACAAGACCGATGCTTTTAT This study

CR DL16526 TCACCCCTGGCTACCAAAGCCAG Luo et al. (2004)

DH478 TGCATATAAAAGAAYGCTCGGCATG Luo et al. (2004)

For sequencing

cyt b PF15239 TTTAACCGAGACCAATGACT This study

PR16473 ACAAGACCGATGCTTTTAT This study

SR16077 ATTRGCTGGRGTGAAGTTTT This study

SF15624 CAAAGAAACCTGAAACAT This study

SR15649 CTACYCCAATGTTTCAGGTT This study

SF15950 TTTCTTTCCACCCATACT This study

CR DL16543 CTCCCAAAGCCAGAATTCTAAAC This study

DH478 TGCATATAAAAGAAYGCTCGGCATG Luo et al. (2004)

PCR, polymerase chain reaction; CR, control region; cyt b, cytochrome b gene.

Diversification of Eurasian goldfish

Journal of Biogeography 39, 2264–2278 2269ª 2012 Blackwell Publishing Ltd

h60B79

Figure 2 Matrilineal genealogy of the Carassius auratus complex and C. carassius in East Asia generated from 1566 bp of combined

mitochondrial DNA, cytochrome b and partial control region sequences generated by Bayesian inference (BI) using unique haplotypes only;

the scale bar indicates substitutions per site. Numbers above the branches represent branch support (> 50%) for maximum parsimony and

maximum likelihood estimations (bootstrap) and Bayesian posterior probabilities, respectively. Numbers below branches denote estimated

divergence dates listed in Table 3; nodes with fossil records are marked with an asterisk.

Y. Gao et al.

2270 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd

Eurasian group including specimens from mainland China,

Taiwan, Russia, the Czech Republic, Vietnam and the south-

central Ryukyus (MLBS = 87%, MPBS = 81%, BPP = 100%).

Six geographically constrained sublineages were identified

within lineage C (Fig. 2) of which two (C1 and C5) were newly

discovered. Sublineage C1, which was the sister group to the

Figure 2 Continued

Diversification of Eurasian goldfish

Journal of Biogeography 39, 2264–2278 2271ª 2012 Blackwell Publishing Ltd

rest of C, only included individuals from Vietnam and Fujian,

China (MLBS = 83%, BPP = 80%). This sublineage was not

resolved by Takada et al. (2010). Sublineage C2 (clade V of

Takada et al., 2010; MLBS = 95%, MPBS = 62%,

BPP = 100%) included the gibel carp mainly from northern

mainland China and Europe. Sublineages C3 (clade VI of

Takada et al., 2010; MLBS = 97%, MPBS = 99%,

BPP = 100%) and C4 (clade IV of Takada et al., 2010;

MLBS = 70%, MPBS = 97%, BPP = 100%) contained haplo-

types generally from the south-central Ryukyus, Japan, Taiwan

and Anhui and Fujian, China. Within sublineage C4, the

haplotypes from mainland China (h41B34 and h94B34;

Fujian) rooted more basally than those from the Ryukyus.

Haplotypes in sublineage C4 were only found south of the

Tokara Gap. Sublineage C5 (MLBS = 100%, MPBS = 99%,

BPP = 100%), which was also not resolved by Takada et al.

(2010), only included individuals from localities close to the

Yangtze River. Sublineage C6 (Clade VII of Takada et al.,

2010) included about 40% of all sampled individuals, most of

which were from southern mainland China. This sublineage

received low support in the ML and MP analyses, but high

support in the BI treatment (BPP = 98%).

Estimated times of divergence

In the two beast analyses based on cyt b only, lineage A

(C. a. cuvieri) clustered with lineage B (C. a. langsdorfii)

first, and the sublineages C3 and C4 exchanged relative

positions. The substitution rate of cyt b was independently

estimated to be 2.09% site)1 Myr)1 based on a nodal

calibration (C. carassius–C. auratus complex) dated at

around 3.6–4.0 Ma (Liu & Su, 1962) using cyt b only. The

divergence time between C. carassius and the C. auratus

complex was estimated to be 4.76 Ma [95% confidence

interval (CI): 3.51–5.96] based on cyt b only using the

assumed molecular clock (2.0% site)1 Myr)1, Meyer, 1993)

corresponding well to the fossil-calibrated estimate. The

beast and BI analyses of combined cyt b and CR sequences

resulted in similar topologies.

Estimated divergence times calculated in all analyses were

similar to each other (Table 3). The separation of Cyprinus and

Carassius occurred about 11.11–9.14 Ma. The two species of

Carassius split around 4.76–3.45 Ma, which matched the fossil

calibration. Lineage A (C. a. cuvieri) split around 2.75–

2.32 Ma and lineages B (C. a. langsdorfii) and C separated

around 2.35–1.80 Ma.

Within lineage C, goldfish from Fujian, China and Vietnam

(sublineage C1) were estimated to have separated first around

0.79–0.69 Ma, followed shortly thereafter by the near simul-

taneous divergences of sublineages C2–C6 at about

0.68–0.59 Ma. Most recently, lineages from Taiwan and the

south-central Ryukyus in sublineage C3 separated around

0.21–0.17 Ma, and within sublineage C4, lineages from the south-

central Ryukyus were isolated around 0.12–0.11 Ma (Table 3).

Table 3 Estimated divergence time for

the Carassius auratus complex from

C. carassius calculated by three approaches.

Node no.

Estimated divergence time

based on combined CR

and cyt b dataset (Ma)

Estimated divergence time based on cyt b only

(Ma)

Based on fossil

calibration for the

C. carassius–C. auratus

complex (3.6–4.0 Ma)

Based on fossil

calibration for the

C. carassius–C. auratus

complex (3.6–4.0 Ma)

Based on molecular

clock of cyt b (2.0%

site)1 Myr)1)

1 9.14 (5.76–12.96) 9.34 (6.80–12.50) 11.11 (7.60–15.70)

2* 3.45 (2.38–4.40) 4.33 (3.27–5.45) 4.76 (3.51–5.96)

3 2.32 (1.43–3.13) 2.64 (2.10–3.25) 2.75 (2.12–3.36)

4 1.80 (1.21–2.54) 2.26 (1.72–2.82) 2.35 (1.84–3.00)

5 0.02 (0.00–0.04) 0.03 (0.00–0.07) 0.03 (0.00–0.07)

6 0.78 (0.46–1.08) 1.02 (0.73–1.33) 1.03 (0.75–1.36)

7 0.69 (0.42–0.98) 0.77 (0.58–0.97) 0.79 (0.60–0.99)

8 0.59 (0.34–0.81) 0.68 (0.53–0.87) 0.64 (0.47–0.79)

9 0.53 (0.31–0.77) 0.53 (0.34–0.73) 0.53 (0.35–0.73)

10 0.30 (0.17–0.46) 0.18 (0.08–0.29) 0.18 (0.09–0.29)

11 0.21 (0.11–0.32) 0.17 (0.07–0.28) 0.17 (0.08–0.28)

12 0.23 (0.12–0.35) 0.25 (0.12–0.38) 0.26 (0.13–0.38)

13 0.15 (0.08–0.22) 0.15 (0.08–0.22) 0.15 (0.08–0.23)

14 0.23 (0.13–0.34) 0.18 (0.12–0.26) 0.19 (0.03–0.12)

15 0.12 (0.06–0.18) 0.11 (0.05–0.17) 0.11 (0.12–0.27)

CR, control region; cyt b, cytochrome b gene.

Node numbers listed in the first row correspond to those given below the branches in Fig. 2. The

node with fossil record was marked with asterisk. The confidence intervals follow the estimated

dates (in parentheses).

Y. Gao et al.

2272 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd

Distributional pattern and hierarchical genetic

structure

Within sublineage C1, no haplotypes were shared between

Fujian, China and Vietnam. Populations in sublineage C2 from

the Amur River and the Czech Republic had many unique

haplotypes and exhibited greater polymorphism than did those

from southern China and Russia. Furthermore, all four

haplotypes of sublineage C2 found in southern China were

shared with northern China. Haplotype GH1 was widespread

across mainland China and Europe. Sublineages C3 and C4,

which were widespread in mainland China (Fig. 2), were also

distributed south of the Tokara Gap only (Fig. 1). Mainland

China and the Ryukyus did not share haplotypes (Fig. 2,

Appendix S1), even when all the sequences were cut to the

same length of 323 bp. Within sublineages C5 and C6, the

genetic diversity from southern mainland China was much

higher than that from northern mainland China and Europe.

Haplotypes h55 and h56 were widespread across mainland

China (Appendix S1).

The AMOVA analysis, which focused on the mainland,

detected significant genetic divergence among the six drainage

basins (FCT = 0.415, P < 0.01). A smaller but significant

amount of genetic divergence (FSC = 0.183, P < 0.01) was

found among populations within each drainage basin. A

significant positive correlation occurred between genetic

divergence and geographical distance in each of the drainage

basins in mainland China (r = 0.237, P < 0.001). These

results indicated a significant, and probably old, genealogical

divergence within and among mainland Chinese drainage

basins.

DISCUSSION

Natural versus human-facilitated dispersal

of Carassius

Our genealogical and population genetic analyses strongly

suggest that the haplotypic patterns mostly reflect natural

occurrences, as originally reported by Takada et al. (2010).

Artificial introductions are evident only at a low frequency

among the different lineages. Only 27 of 366 samples of

sublineage C6 (C. a. auratus) from the main islands of Japan

are identified as being recent translocations; each of these 27

individuals has one of three common mainland haplotypes.

Given the history of goldfish domestication (Wang, 1985), the

Japanese occurrence of sublineage C6 is not unexpected. In

addition, the sporadic distribution of haplotypes GH1 and

GH2 (sublineage C2; gibel carp) in southern China (77/800

individuals) might reflect escapes from hatcheries. This taxon

– and in particular these two haplotypes – naturally occurs in

the Amur River and eastern Europe and it is widely cultured

in mainland Chinese hatcheries (Zhou et al., 2000; Zhou &

Gui, 2002; Li & Gui, 2007). Similarly, C. a. langsdorfii (lineage

B), originally from the main islands of Japan (Luo et al.,

1999), occurs sporadically in the south-central Ryukyus (42/

431 individuals). Among the 42 individuals, 31 have four of

the six haplotypes shared with the main islands of Japan. This

pattern may reflect human-facilitated translocations from the

main islands of Japan to the south-central Ryukyus, noted in

the historical record (Senou, 1985; Takada & Tachihara,

2009).

Although sporadic human-facilitated translocations are

evident, they do not play a major role in the present

distributions of the lineages. All specimens of C. carassius are

from Russia and the Czech Republic (Fig. 1, Appendix S1) and

this corresponds with their native distribution from the Irtysh

River in China to Europe and the British Isles (Wheeler, 1977,

2000; Meng et al., 1995; Luo et al., 1999). Over 90% of the

samples from the main islands of Japan belong to either lineage

A (C. a. cuvieri) or lineage B (C. a. langsdorfii; Fig. 1, Appen-

dix S1). All mainland Chinese samples are identified as

belonging to lineage C (Fig. 1). Within sublineages C3 and

C4, although the populations from the Ryukyus and mainland

China have a close genealogical relationship, the localities do

not share any haplotypes. If the population from the south-

central Ryukyus is the result of translocation, then its

haplotypes should be shared with eastern China. Recently, a

Pleistocene fossil Diplothrix was recorded from the deposits of

Renzidong Cave in Anhui, and its age pre-dates the first

appearance of this species in the Ryukyus (Wang & Jin, 2009;

Wang et al., 2010). Given that Diplothrix and the C. auratus

complex have nearly identical distributions, we infer that the

close relationship between the C. auratus complex from

eastern mainland China and the south-central Ryukyus is the

result of a natural Pleistocene dispersal and not human-

mediated translocations.

Vicariance event in the C. auratus complex between

mainland China and Japan

Today’s freshwater ichthyofaunas from the Japanese islands

and China differ dramatically, while those of the Pliocene and

Miocene appear to have resembled each other. Our intensive

study of samples from the rich East Asian C. auratus complex

indicates that the evolutionary history of the complex is likely

to be a result of Quaternary palaeogeographical events. Fossils

indicate that in the late Pliocene, C. auratus was distributed

across the continent and the main islands of Japan (Liu & Su,

1962; Zhang & Chen, 2000). The main islands of Japan and

mainland China are known to have formed a contiguous land

mass in the late Pliocene (Kimura, 1996a,b). Their isolation is

likely to have occurred in the last 3.0 Myr due to the

disappearance of a land bridge in the Tsushima Strait

(Ogasawara, 1994; Kimura, 2002). Stratigraphic data corrob-

orate the genetic evidence that Japanese lineages A and B

separated from lineage C around 2.75–1.80 Ma (Fig. 2,

Table 3). This vicariance event appears to be responsible for

the independent evolution of the insular and continental

lineages (Fig. 3). Our evolutionary reconstruction is consistent

with ichthyofaunal studies of both extant (Chen, 1998) and

fossil (Zhang & Chen, 2000) species.

Diversification of Eurasian goldfish

Journal of Biogeography 39, 2264–2278 2273ª 2012 Blackwell Publishing Ltd

Historical demography of the C. auratus complex

in mainland China

Isolation by distance (IBD) between different drainage basins best

explains genetic divergence in the Chinese C. auratus complex

(UCT = 0.415, P < 0.01). However, IBD also explains a signifi-

cant amount of variation (r = 0.237, P < 0.001) within drainages.

Patterns of divergence suggest natural historical events.

Genealogical analyses both of the CR sequences (Group 2,

Appendix S3) and of the concatenated data (sublineage C2,

Fig. 2) cluster the haplotypes of gibel carp with strong support.

Sublineage C2 from the Amur River system is far more

polymorphic than sublineages from southern China. This

discovery corresponds to previous suggestions that the gibel

carp has a northern origin (Cherfas, 1981; Jiang et al., 1983;

Luo et al., 1999; Gui, 2007). Populations of C. a. auratus from

southern mainland China (sublineages C5, C6), especially

those downstream in the Yangtze River, have the highest levels

of genetic diversity. This may be the result of repeated episodes

of range contraction and expansion during glacial cycling.

Mainland Chinese rivers, except for the Amur and inland

rivers in Xinjiang, are known to have flowed north-eastwards

and repeatedly anastomosed with one another during post-

glacial and Holocene times because of erosion (Yap, 2002);

stream capture and the mixing of independently evolved

lineages of goldfish is likely to have been common and the

genetic signal of these events persists today.

Refugia and dispersal routes of the C. auratus

complex in East Asia

Pleistocene glacial cycling had a major impact on monsoon

oscillations as well as subaerial landmasses and, consequently,

the East Asian biota. East Asian winter monsoons have

intensified, and the summer monsoons have weakened, since

about 2.6 Ma (An et al., 2001, 2006; Shi, 2002). As a result,

north-western regions were cold and dry, and south-eastern

mainland China was warm and humid (Chen, 1998; An et al.,

2006). Our analyses revealed that sublineages C1–C6 diverged

after 0.79–0.69 Ma. Sublineage C1 occurred only in warm and

moist tropical or subtropical areas (Vietnam and Fujian,

China; Fig. 1; Shi, 2002). Vietnam and Fujian, China, may

have provided important refugia for East Asian freshwater

fishes during glaciations. Strengthening cold and dry winter

monsoons forced the southward retreat of East Asian fresh-

water fishes. Whereas Chen (1998) proposed that the retreat

stopped at the Yangtze River, our analyses suggested they went

far south of this river. During interglacial times since 1.0–

0.78 Ma, the warm, wet East Asian summer monsoons

intensified (An et al., 2006; Ye et al., 2007). Lineages of the

C. auratus complex may have dispersed north-eastwards to

recolonize the Ryukyus via Taiwan, and northwards to

recolonize mainland China.

The genogeography of the C. auratus complex provides

evidence of ephemeral land bridges. During glaciations, the

2.75-1.80 Ma

4.76-3.45 Ma

C. carassiusChinese lineage Japanese

0.79-0.69 Ma lineage

A &B

C

C1C2-C6

12

FujianTokara Gap

C3 & C4

Vietnam

Figure 3 Scenario for the evolutionary history of the Carassius auratus complex and C. carassius in East Asia. A vicariance event for the

C. auratus complex between mainland China (lineage C) and Japan (lineages A and B) occurred after 3.0 Ma. Lineage C of the C. auratus

complex radiated across mainland China and dispersed north-eastwards to the Ryukyus as far as the Tokara Gap via a land bridge between

Taiwan and the mainland when East Asian summer monsoons were enhanced after 1.0–0.78 Ma. Two fossil records for the genus Carassius

are also mapped with numbers as follows: 1, Yushe, Shanxi (Liu & Su, 1962); 2, Lake Biwa (Kodera, 1985).

Y. Gao et al.

2274 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd

shoreline of mainland China appears to have expanded about

600 km eastwards when the sea level was 120–140 m lower

than today (Li et al., 2004). Pleistocene sea-level changes and

tectonic activities are responsible for the formation and

destruction of land bridges between the southern Ryukyus

and mainland China (Kizaki & Oshiro, 1977, 1980; Ujiie,

1990). However, it remains unclear whether the land bridges

extended to the Kerama (Ota, 1998) and Tokara gaps (Kimura,

1996a; b; Kizaki & Oshiro, 1977, 1980) or to the main islands

of Japan (Ujiie, 1990; Ujiie et al., 1991). Lineages from the

south-central Ryukyus and Taiwan closely cluster with those

from eastern China; these insular lineages only occur south of

the Tokara Gap (Fig. 1). Sublineages C3 and C4 are distributed

in mainland China (Fig. 2). In contrast, lineages from the main

islands of Japan occur only north of the Tokara Gap (Fig. 1).

Thus, terrestrial and freshwater connections between the

Ryukyus and eastern mainland China do not appear to have

passed the Tokara Gap. The same biogeographical pattern also

occurs in most amphibians and non-avian reptiles (Ota, 1998;

Otsuka & Takahashi, 2000) and the murine Diplothrix (Wang

& Jin, 2009; Wang et al., 2010) from the Ryukyu Archipelago.

The estimated dispersal times of 0.26–0.11 Ma (Fig. 2;

Table 3) are coincident with land-bridge connections that

existed 0.2–0.02 Ma (Kimura, 1996a, b). Thus, it is likely that

the C. auratus complex dispersed from mainland China via

Taiwan to the Ryukyus. The increased diversity of haplotypes

may reflect mutations accumulated through repeated intergla-

cial isolation events when sea levels were high (Fig. 3).

CONCLUSIONS

Our study supports the proposition that the genealogical

history of the C. auratus complex in Eurasia is mainly a result

of Quaternary palaeogeographical and palaeoclimatic pertur-

bations rather than recent human-mediated translocations.

Three distinct, mostly geographically constrained, matrilineag-

es document a vicariance event around 3.0 Ma – the disap-

pearance of a land bridge in the Tsushima Strait – for

populations on Japan and the continent (estimated divergence

time around 2.75–2.32 Ma). The newly detected older sublin-

eage C1 from Fujian, China and Vietnam appears to identify

important refugia for the C. auratus complex during glaciation.

Warm, moist summer monsoons were enhanced during the

mid-Pleistocene and in response it is likely that goldfish

dispersed north-eastwards from refugia to occupy the Ryukyus

via Taiwan, but stopping at the Tokara Gap. A second lineage

seems to have recolonized mainland China during interglacial

times. Additional molecular markers and more extensive

sampling, especially from Siberia and the Far East, may identify

lineages involved in the early evolution of Eurasian Carassius.

ACKNOWLEDGEMENTS

We gratefully acknowledge Yong-yi Shen, Qing-peng Kong,

Zhe-kun Zhou, David M. Irwin, and Mi-man Zhang for

valuable comments. We thank Yong-gang Yao, Kai Zhao,

Tian-xiang Gao, Shao-jun Liu, Xin-hua Chen, Sheng-guo

Fang, Yun-fa Ge, Xin-wen Bo, Zi-ming Chen, Nikolai A.

Poyarkov, Ekaterina D. Vasil’eva, Mu-yeong Lee and many

other individuals for collecting samples important to this

study. Amy Lathrop assisted with preparation of the figures.

This work was supported by grants from the State Key Basic

Research and Development Plan (2007CB411600), the Bureau

of Science and Technology of Yunnan Province, the National

Natural Science Foundation of China (30600065 and

30870291) and the ‘Western Light programme’ of the Chinese

Academy of Sciences to Y.G. J.L. was funded by the State Key

Laboratory of Genetic Resources and Evolution and R.W.M.

was supported by a Visiting Professorship for Senior Interna-

tional Scientists from the Chinese Academy of Sciences.

REFERENCES

Akaike, H. (1974) A new look at statistical model identification.

IEEE Transactions on Automatic Control, AC-19, 716–723.

An, Z.S., Kutzbach, J.E., Prell, W.L. & Porter, S.C. (2001)

Evolution of Asian monsoons and phased uplift of the

Himalaya–Tibetan Plateau since Late Miocene times. Nat-

ure, 411, 62–66.

An, Z.S., Zhang, P.Z., Wang, E.C., Wang, S.M., Qiang, X.K., Li,

L., Song, Y.G., Chang, H., Liu, X.D., Zhou, W.J., Liu, W.G.,

Cao, J.J., Li, X.Q., Shen, J., Liu, Y. & Ai, L. (2006) Changes

of the monsoon-arid environment in China and growth of

the Tibetan Plateau since the Miocene. Quaternary Sciences,

26, 678–693 (in Chinese).

Avise, J.C., Arnold, J., Ball, R.M., Bermingham, E., Lamb, T.,

Neigel, J.E., Reeb, C.A. & Saunders, N.C. (1987) Intraspe-

cific phylogeography: the mitochondrial DNA bridge be-

tween population genetics and systematics. Annual Review of

Ecology and Systematics, 18, 489–522.

Berg, L.S. (1949) Freshwater fishes of the USSR and adjacent

countries, Part II. Academy of Sciences of the USSR, Moscow

and Leningrad (in Russian).

Bray, J.R. (1979) Neogene explosive volcanicity, temperature

and glaciations. Nature, 282, 603–605.

Broughton, R.E., Milam, J.E. & Roe, B.A. (2001) The complete

sequence of the zebrafish (Danio rerio) mitochondrial gen-

ome and evolutionary patterns in vertebrate mitochondrial

DNA. Genome Research, 11, 1958–1967.

Chang, Y.S., Huang, F.L. & Lo, T.B. (1994) The complete

nucleotide sequence and gene organization of carp (Cypri-

nus carpio) mitochondrial genome. Journal of Molecular

Evolution, 38, 138–155.

Chen, Y.Y. (ed.) (1998) Fauna Sinica, Osteichthyes, Cyprini-

formes II. Science Press, Beijing (in Chinese).

Chen, Y.Y. & He, S.P. (2000) Freshwater fishes distribution in

Taiwan and continent of China and its biogeographical

significance. Progress in Natural Science, 11, 411–416 (in

Chinese).

Cherfas, N.B. (1981) Gynogenesis in fishes. Genetic bases of fish

selection (ed. by V.S. Kirichnikov), pp. 255–273. Springer,

Berlin.

Diversification of Eurasian goldfish

Journal of Biogeography 39, 2264–2278 2275ª 2012 Blackwell Publishing Ltd

Drummond, A.J. & Rambaut, A.J. (2007) BEAST: Bayes evo-

lutionary analysis by sampling trees. BMC Evolutionary

Biology, 7, 214.

Emerson, S.B. & Berrigan, D. (1993) Systematics of South-

east Asian ranids: multiple origins of voicelessness in the

subgenus Limnonectes (Fitzinger). Herpetologica, 49, 22–

31.

Eschmeyer, W.N. (1998) Catalog of fishes. Special Publication

No. 1. Center for Biodiversity Research and Information,

California Academy of Sciences, San Francisco.

Excoffier, L. & Lischer, H.E.L. (2010) Arlequin suite v.3.5: a

new series of programs to perform population genetics

analyses under Linux and Windows. Molecular Ecology

Resources, 10, 564–567.

Excoffier, L., Smouse, P.E. & Quattro, J.M. (1992) Analysis of

molecular variance inferred from metric distances among

DNA haplotypes: application to human mitochondrial DNA

restriction data. Genetics, 131, 479–491.

Felsenstein, J. (1985) Confidence limits on phylogenies: an

approach using the bootstrap. Evolution, 39, 783–791.

Gelman, A. & Rubin, D.B. (1992) Inference from iterative

simulation using multiple sequences. Statistical Science, 7,

457–511.

Goldman, N. (1993a) Statistical tests of models of DNA sub-

stitution. Journal of Molecular Evolution, 36, 182–198.

Goldman, N. (1993b) Simple diagnostic statistical tests of

models of DNA substitution. Journal of Molecular Evolution,

37, 650–661.

Gui, J.F. (1997) Retrospects and prospects of studies on the

mechanism of natural gynogenesis in silver crucian carp

(Carassius auratus gibelio). Bulletin of the National Natural

Science Foundation of China, 1, 11–16 (in Chinese).

Gui, J.F. (2007) Genetic basis and artificial control of sexuality

and reproduction in fish. Science Press, Beijing (in Chinese).

Hayashi, T. & Matsui, M. (1988) Biochemical differentiation in

Japanese newts, genus Cynops (Salamandridae). Zoological

Science, 5, 1121–1136.

Hewitt, G.M. (1996) Some genetic consequences of ice ages,

and their role in divergence and speciation. Biological Jour-

nal of the Linnean Society, 58, 247–276.

Hewitt, G.M. (2000) The genetic legacy of the Quaternary ice

ages. Nature, 405, 907–913.

Hewitt, G.M. (2004) The structure of biodiversity – insights

from molecular phylogeography. Frontiers in Zoology, 1, 4.

Huelsenbeck, J.P. & Crandall, K.A. (1997) Phylogeny estima-

tion and hypothesis testing using maximum likelihood.

Annual Review of Ecology and Systematics, 28, 437–466.

Huelsenbeck, J.P. & Ronquist, F. (2001) MRBAYES: Bayesian

inference of phylogenetic trees. Bioinformatics, 17, 754–755.

Jiang, Y.G., Liang, S.C., Chen, B.D., Yu, H., Shan, S.X., Yang,

D.L., Lin, S.E. & Shen, G.Q. (1983) Biological effect of

heterologous sperm on gynogenetic offspring in Carassius

auratus gibelio. Acta Hydrobiologica Sinica, 8, 1–13 (in

Chinese with English abstract).

Johns, G.C. & Avise, J.C. (1998) A comparative summary of

genetic distances in the vertebrates from the mitochondrial

cytochrome b gene. Molecular Biology and Evolution, 15,

1481–1490.

Kalous, L., Slechtova, V., Jr, Bohlen, J., Petrtyl, M. &

Svatora, M. (2007) First European record of Carassius

langsdorfii from the Elbe Basin. Journal of Fish Biology, 70,

132–138.

Kimura, M. (1996a) Quaternary paleogeography of the Ryukyu

Arc. Journal of Geography, 105, 259–285 (in Japanese with

English abstract).

Kimura, M. (1996b) Palaeogeography of the Ryukyu Arc.

Chikyu Monthly, 18, 488–494 (in Japanese).

Kimura, M. (ed.) (2002) The formation of the Ryukyu Arc and

migration of biota to the arc. Okinawa Times, Naha (in

Japanese).

Kizaki, K. & Oshiro, I. (1977) Paleogeography of the Ryukyu

Islands. Marine Science Monthly, 9, 542–549.

Kizaki, K. & Oshiro, I. (1980) The origin of the Ryukyu Is-

lands. Natural history of the Ryukyus (ed. by K. Kizaki), pp.

8–37. Tsukiji-shokan, Tokyo (in Japanese).

Kodera, H. (1985) Paleontological evidence for appearance of a

species, gengoro-buna (Carassius cuvieri Temminck &

Schlegel). A comparative study of the dental tissues between

living and fossil species. Earth Science, 39, 272–281 (in

Japanese).

Kottelat, M. (1997) European freshwater fishes. Biologia, 52, 1–

271.

Kozak, K.H., Blaine, R.A. & Larson, A. (2006) Gene lineages

and eastern North American palaeodrainage basins:

phylogeography and speciation in salamanders of the

Eurycea bislineata species complex. Molecular Ecology, 15,

191–207.

Kumar, S., Nei, M., Dudley, J. & Tamura, K. (2008) MEGA: a

biologist-centric software for evolutionary analysis of DNA

and protein sequences. Briefings in Bioinformatics, 9, 299–

306.

Li, F.-B. & Gui, J.-F. (2007) Clonal diversity and genealogical

relationships of gibel carp in four hatcheries. Animal

Genetics, 39, 28–33.

Li, J.J., Shu, Q., Zhou, S.Z., Zhao, Z.J. & Zhang, J.M. (2004)

Review and prospects of Quaternary glaciation research in

China. Journal of Glaciology and Geocryology, 26, 235–243.

(in Chinese with English abstract).

Liu, H.-T. & Su, T.-T. (1962) Pliocene fishes from Yushe Basin,

Shansi. Vertebrata PalAsiatica, 6, 1–125 (in Chinese with

English abstract).

Luo, J., Zhang, Y.-P., Zhu, C.-L., Xiao, W.-H. & Huang, S.-Y.

(1999) Genetic diversity in crucian carp (Carassius auratus).

Biochemical Genetics, 37, 267–279.

Luo, J., Yang, D., Suzuki, H., Wang, Y., Chen, W.-J., Campbell,

K.L. & Zhang, Y.-P. (2004) Molecular phylogeny and bio-

geography of Oriental voles: genus Eothenomys (Muridae,

Mammalia). Molecular Phylogenetics and Evolution, 33, 349–

362.

Meng, Q.W., Su, J.X. & Miao, X.Z. (1995) Fish taxonomy.

China Agriculture Press, Beijing (in Chinese with English

abstract).

Y. Gao et al.

2276 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd

Meyer, A. (1993) Evolution of mitochondrial DNA in fishes.

Molecular biology frontiers, biochemistry and molecular biol-

ogy of fishes, Vol. 2 (ed. by P.W. Hochachka and T.P.

Mommsen), pp. 1–38. Elsevier, The Hague.

Moritz, C., Dowling, T.E. & Brown, W.M. (1987) Evolution of

animal mitochondrial DNA: relevance for population biol-

ogy and systematics. Annual Review of Ecology and System-

atics, 18, 269–292.

Murakami, M., Matsuba, C. & Fujitani, H. (2001) The

maternal origins of the triploid ginbuna (Carassius auratus

langsdorfii): phylogenetic relationships within the C. auratus

taxa by partial mitochondrial D-loop sequencing. Genes and

Genetic Systems, 76, 25–32.

Murphy, R.W. & Aguirre-Leon, G. (2002) The non-avian

reptiles: origins and evolution. A new island biogeography of

the Sea of Cortes (ed. by T.J. Case, M.L. Cody and E. Ez-

curra), pp. 181–220. Oxford University Press, New York.

Nakamura, M. (1969) Cyprinid fishes of Japan. Research

Institute for Natural Resources, Tokyo (in Japanese).

Ogasawara, K. (1994) Neogene paleogeography and marine

climate of the Japanese Islands based on shallow-marine

molluscs. Palaeogeography, Palaeoclimatology, Palaeoecology,

108, 335–351.

Ota, H. (1998) Geographic patterns of endemism and specia-

tion in amphibians and reptiles of the Ryukyu Archipelago,

Japan, with special reference to their paleogeographical

implications. Researches on Population Ecology, 40, 189–204.

Otsuka, H. & Takahashi, A. (2000) Pleistocene vertebrate

faunas in the Ryukyu Islands: their migration and extinc-

tion. Tropics, 10, 25–40.

Papousek, I., Vetesnık, L., Halacka, K., Luskova, V., Humpl,

M. & Mendelv, J. (2008) Identification of natural hybrids of

gibel carp Carassius auratus gibelio (Bloch) and crucian carp

Carassius carassius (L.) from lower Dyje River floodplain

(Czech Republic). Journal of Fish Biology, 72, 1230–1235.

Posada, D. & Crandall, K.A. (1998) MODELTEST: testing the

model of DNA substitution. Bioinformatics, 14, 817–818.

Rambaut, A. & Drummond, A.J. (2009) Tracer v1.5. Available

at: http://beast.bio.ed.ac.uk/Tracer (accessed 30 November

2009).

Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian

phylogenetic inference under mixed models. Bioinformatics,

19, 1572–1574.

Sakai, H., Iguchi, K., Yamazaki, Y., Sideleva, V.G. & Goto, A.

(2009) Morphological and mtDNA sequence studies on

three crucian carps (Carassius: Cyprinidae) including a new

stock from the Ob River system, Kazakhstan. Journal of Fish

Biology, 74, 1756–1773.

Senou, H. (1985) The inland water fishes of Ryukyu Islands are

endangered. Freshwater Fish, 11, 73–78.

Serebrovsky, A.S. (1928) Genogeography and the genofund of

farm animals. Nauchnoye slovo, 1928, 3–23 (in Russian).

Shi, Y.F. (2002) A suggestion to improve the chronology of

Quaternary glaciations in China. Journal of Glaciology and

Geocryology, 24, 687–692.

Smouse, P.E., Long, J.C. & Sokal, R.R. (1986) Multiple

regression and correlation extensions of the Mantel tests of

matrix correspondence. Systematic Zoology, 35, 627–632.

Stamatakis, A., Hoover, P. & Rougemont, J. (2008) A rapid

bootstrap algorithm for the RAxML web servers. Systematic

Biology, 75, 758–771.

Swofford, D.L. (2002) PAUP*. Phylogenetic analysis using

parsimony (*and other methods). Version 4. Sinauer Associ-

ates, Sunderland, MA.

Takada, M. & Tachihara, K. (2009) Comparisons of age,

growth, and maturity between male and female, and diploid

and triploid individuals in Carassius auratus from Okinawa-

jima Island, Japan. Aquatic Conservation: Marine and

Freshwater Ecosystems, 19, 806–814.

Takada, M., Tachihara, K., Kon, T., Yamamoto, G., Kei’ichiro,

I., Miya, M. & Nishuda, M. (2010) Biogeography and evo-

lution of the Carassius auratus-complex in East Asia. BMC

Evolutionary Biology, 10, 1–18.

Tamura, K., Dudley, J., Nei, M. & Kumar, S. (2007) MEGA4:

Molecular Evolutionary Genetics Analysis (MEGA) software

version 4.0. Molecular Biology and Evolution, 24, 1596–1599.

Thorpe, R.S., Black, H. & Malhotra, A. (1996) Matrix corre-

spondence tests on the DNA phylogeny of the Tenerife

lacertid elucidate both historical causes and morphological

adaptation. Systematic Biology, 45, 335–343.

Tzeng, C.-S., Hui, C.-F., Shen, S.-C. & Huang, P.C. (1992) The

complete nucleotide sequence of the Crossostoma lacustre

mitochondrial genome: conservation and variations among

vertebrates. Nucleic Acids Research, 20, 4853–4858.

Ujiie, H. (1990) Geological history of the Ryukyu Island Arc.

Nature of Okinawa: geomorphology and geology (ed. by H.

Ujiie), pp. 251–255. Hirugisha, Naha (in Japanese).

Ujiie, H., Tanaka, Y. & Ono, T. (1991) Late Quaternary

paleoceanographic record from the middle Ryukyu Trench

slope, northwest Pacific. Marine Micropaleontology, 18, 115–

128.

Wang, C.Y. (1985) The origin of the goldfish. Bulletin of

Biology, 12, 11–12 (in Chinese).

Wang, Y. & Jin, C.Z. (2009) Fossil Diplothrix (Diplothrix sp.

nov., Muridae) from Renzidong Cave, Fanchang, Anhui,

China. Proceedings of Eleventh Annual Meeting of Chinese

Society of Vertebrate Paleontology (ed. by W. Dong), pp. 65–

71. China Ocean Press, Beijing (in Chinese).

Wang, Y., Jin, C.-Z. & Wei, G.-B. (2010) First discovery of

fossil Diplothrix (Muridae, Rodentia) outside the Ryukyu

Islands, Japan. Geology, 55, 411–417.

Wheeler, A. (1977) The origin and distribution of the fresh-

water fishes of the British Isles. Journal of Biogeography, 4, 1–

24.

Wheeler, A. (2000) Status of the crucian carp, Carassius car-

assius (L.) in the U.K. Fisheries Management and Ecology, 7,

315–322.

Xia, X. & Xie, Z. (2001) DAMBE: software package for data

analysis in molecular biology and evolution. Journal of

Heredity, 92, 371–373.

Diversification of Eurasian goldfish

Journal of Biogeography 39, 2264–2278 2277ª 2012 Blackwell Publishing Ltd

Yang, L. & He, S.-P. (2008) Phylogeography of the freshwater

catfish Hemibagrus guttatus (Siluriformes, Bagridae):

implications for South China biogeography and influence of

sea-level changes. Molecular Phylogenetics and Evolution, 49,

393–398.

Yap, S.Y. (2002) On the distributional patterns of Southeast–

East Asian freshwater fish and their history. Journal of Bio-

geography, 29, 1187–1199.

Ye, F., Liu, Z.-F., Tuo, S.-T. & Jian, Z.-M. (2007) Grain size

record of terrigenous clast during Mid-Pleistocene Transi-

tion (0.78–1.0 Ma) in the northern South China Sea. Marine

Geology and Quaternary Geology, 27, 77–83.

Zhang [= Chang], M.M. & Chen, Y.Y. (2000) Late Mesozoic

and Tertiary ichthyofaunas from China and some

puzzling patterns of distribution. Vertebrata PalAsiatica, 38,

161–175.

Zhao, L., Zhang, J., Liu, Z.-J., Funk, S.M., Wei, F.-W., Xu, M.

& Li, M. (2008) Complex population genetic and demo-

graphic history of the salangid, Neosalanx taihuensis, based

on cytochrome b sequences. BMC Evolutionary Biology, 8,

201.

Zhou, L. & Gui, J.F. (2002) Karyotypic diversity in polyploid

gibel carp, Carassius auratus gibelio Bloch. Genetica, 115,

223–232.

Zhou, L., Wang, Y. & Gui, J.F. (2000) Analysis of genetic

heterogeneity among five gynogenetic clones of silver cru-

cian carp, Carassius auratus gibelio Bloch, based on detection

of RAPD molecular markers. Cytogenetics and Cell Genetics,

88, 133–139.

SUPPORTING INFORMATION

Additional Supporting Information may be found in the

online version of this article:

Appendix S1 Distribution of control region (CR) haplotypes

from the genus Carassius grouped according to their evolu-

tionary history (Fig. 2), GenBank accession numbers of CR

and cyt b, and the sampling localities of the specimens with cyt

b sequences.

Appendix S2 Pairwise FST values and geographical distances

(D) for the Carassius auratus complex.

Appendix S3 Matrilineal genealogy of Carassius generated

from 323 to 426 bp of mitochondrial DNA control region

sequences inferred using MrBayes.

As a service to our authors and readers, this journal provides

supporting information supplied by the authors. Such mate-

rials are peer-reviewed and may be re-organized for online

delivery, but are not copy-edited or typeset. Technical support

issues arising from supporting information (other than

missing files) should be addressed to the authors.

BIOSKETCHES

Yun Gao, an Associate Professor, is interested in the

biogeography of widely distributed East Asian freshwater

fishes and other vertebrates. All members of our research team

are keenly interested in understanding the drivers of biogeo-

graphical patterns, for example, rapid rates of evolution under

natural or artificial selection.

Author contributions: Y.G. and Y.-P.Z. developed the ideas

and obtained funding support; S.-Y.W., Y.G., J.L. and R.W.M.

analysed the data and Y.G., S.-Y.W. and R.W.M. led the

writing; S.-Y.W., R.D., S.-F.W., C.-L.Z., Y.L., P.-T.L., A.D.P.

and S.N.N. collected data or samples.

Editor: Brett Riddle

Y. Gao et al.

2278 Journal of Biogeography 39, 2264–2278ª 2012 Blackwell Publishing Ltd