QMBA-14249 Annual Report 2011 08-11€¦ · the phone guided search for consumers. Promotion via...

MASTER BUILDERSANNUAL REPORT 2011

Think building. Think Master Builders.

CONTENTS1 About Master Builders

2 From our President

3 Highlights 2010–2011

5 Our performance

7 Our members

8 Our people

11 Our business

13 Our community

15 Our industry voice

20 State of the state

22 State of the regions

24 Corporate governance

26 Financial statements

Queensland Master Builders Association Industrial Organisation of Employers

ABN 96 641 989 386 RTO 30097

Front Cover: 2010 Brisbane Individual Home over $2 million and State Best Kitchen – Scott Harris Constructions Pty Ltd, Livingstone Residence

2010 Housing & Construction Awards winning projects are featured throughout this report.

© 2011 Queensland Master Builders Association. No text, photo or graphic shall be reproduced, copied, published,

broadcast, rewritten for broadcast or publication, or redistributed directly or indirectly in any medium without permission. No material

or links or any portion thereof may be stored in a computer except for personal and non-commercial use.

“Master Builders strives for service excellence. To us, this means delivering timely and quality information and services in ways that meet the needs of our customers.

2010–2011 was an incredibly tough year, with our vision for representing the building and construction industry never more vital.

As we dealt with the toughest economic climate for a decade and some of the worst natural disasters ever seen in Queensland, our role of disseminating information and advice and ensuring our industry received the assistance it needed, became more important than ever.”

Derek Pingel, Master Builders President

ANNUAL REPORT 2011 MASTER BUILDERS | 1

ABOUT MASTER BUILDERS

Master Builders is the number

one source of practical and

relevant information regarding

the Queensland building and

construction industry. We keep our

members informed with regular

updates on changes to building

codes and legislation, industrial

relations and workplace health and

safety.

Master Builders membership is

the key to success in Queensland’s

construction industry. With quality

training courses developed

specifi cally for the building and

construction industry, expert advice

on technical, legal and contractual

matters, industrial relations and

human resource support, workplace

health and safety advice and a

dispute resolution service, we

help our members to operate a

professional business.

We also save our members time and

money and help them to operate a

profi table business through cross-

industry networking opportunities,

exclusive member discounts, the

Find a Master Builder service, Master r

Builders Housing & Construction

Awards program and our unique

display village concept.

We are the voice of the industry.

Master Builders is committed

to representing the interests of

Master Builders is the peak industry association representingbuilding and construction in Queensland since 1882. With around9,000 members, we are the voice of the industry. Our servicessupport members to operate professional and profi table businessesthat deliver superior quality outcomes to their customers.

Vision

To be recognised as the leader in:

• Representing the building and construction industry

in Queensland

• Providing professional advice, products and services

to our members

Mission

• To be the essential business resource to our members

• To shape the future of the building and construction

industry through eff ective infl uence on government,

industry and stakeholders

Values

• Pride and professionalism – in the way we

undertake our work and interact with our members,

the industry and relevant stakeholders

• Responsibility – to be accountable for delivering

eff ective, effi cient customer service in a timely

manner

• Integrity – in achieving our goals and meeting our

commitments to our members and customers

• Delivery – to provide products and services, on

a timely basis, that exceed the expectations of all

customers

• Excellence – in everything we do

members and the broader building

and construction industry in

Queensland. We achieve this with

comprehensive research and

assessment of industry issues, active

lobbying to all levels of government,

and strong representation on key

industry bodies.

In today’s demanding work

environment, where change is a

constant, complexity is the norm

and new issues arise daily, having

Master Builders to turn to is a distinct

advantage to our members.

2 | MASTER BUILDERS ANNUAL REPORT 2011

FROM OUR PRESIDENT

I am proud to present Master Builders Annual Report for

2010–2011, where we recognise Master Builders eff orts as

a representative body and industry leader.

Master Builders strives for service excellence. To us, this

means delivering timely and quality information and

services in ways that meet the needs of our customers.

2010–2011 was an incredibly tough year, with our vision

for representing the building and construction industry

never more vital.

As we dealt with the toughest economic climate for a

decade and some of the worst natural disasters ever seen

in Queensland, our role of disseminating information and

advice and ensuring our industry received the assistance

it needed, became more important than ever.

A united front for disaster relief

As you will be well aware, from December 2010 to

February 2011, Queensland was inundated with extreme

wet weather, cyclones and devastating fl oods, which

aff ected more than 70% of the state. In the wake of

these severe weather events, Master Builders initiated

a number of measures designed to help home and

business owners with the advice and information they

needed to get their homes and premises back to liveable

and workable states and, very importantly, to help Master

Builders members access the work needed to rebuild

their local area and economy.

In January 2011, we encouraged members to join our

Disaster Repair Register, which we supplied initially to

the Building Services Authority, insurance companies

and government agencies. Later, this list of more than

1,800 members was transformed into an online and over

the phone guided search for consumers. Promotion via

newspaper and radio advertising ensured this service

received almost 8,000 web hits.

As a service to home and small business owners, Master

Builders took to the streets of Brisbane and Ipswich

in mobile Building Advice Units, armed with rebuild

and repair information, and ran an educational media

campaign with fl ood-related information.

In February 2011, we launched the Queenslanders

rebuilding Queensland campaign, designed to encourage

the state government, insurance companies and all

Queensland communities to use local builders and

trade contractors when rebuilding after natural disasters.

Beginning with an open letter to the Queensland

Government and insurers, the campaign urged all parties

to ensure Queensland’s building industry was given the

fi rst opportunity to rebuild Queensland.

The response to the campaign from the state

government and other industry stakeholders was

extremely positive. We were pleased to receive numerous

calls from a range of members and industry partners,

thanking us for taking this stand on behalf of our

members and the wider industry.

Forging strong relationships with government and industry

On 24 February 2011, Premier Anna Bligh met with

Master Builders in Cairns to discuss the use of local

builders and trade contractors. At this event, the Premier

committed to taking a tough stance with insurance

companies on the issue, and was quoted in the media

as vowing to “play hard and tough” with companies who

don’t consider local builders and trade contractors.

In February 2011, Master Builders also welcomed the

appointment of The Honourable Simon Finn MP as the

new Minister for Government Services, Building Industry

and ICT. For some years Master Builders has lobbied for

a minister dedicated to representing the industry that is

the largest employer of full-time labour in Queensland.

Rebuilding our industry

Well before the natural disasters hit, our industry was

(and still is) suff ering at the hands of the Global Financial

Crisis (GFC). For the remainder of 2011 and into 2012,

Master Builders will embrace the theme Rebuilding

Queensland. Our operations across Queensland will

be devoted to helping members through the tough

economic times, identifying measures for kick starting

our industry and speaking on our members behalf in

order to get our industry back on its feet economically.

Derek Pingel

President, Master Builders Queensland

Our role as an industry leader was never so apparent than in early 2011, when natural disasters devastated our great state.


HIGHLIGHTS 2010–2011

• Provided information and advice during times of natural disasters that assisted members and their families to get

their businesses and lives back up and running

• Launched the Queenslanders rebuilding Queensland campaign to ensure local contractors were awarded disasterd

repair work

• Developed an online and over the phone Disaster Repair Register to help consumers fi nd properly licensed, local r

contractors and fi nd members work

• Raised our profi le by achieving more than $500,000 of media coverage

• Participated in a number of government forums to identify kick start measures for the building industry, including

the Building Boost Grant

• Answered more than 4,800 technical, legal, contractual and dispute queries

• Responded to more than 4,000 workplace relations and workplace health and safety queries, following industrial

and workplace health and safety reforms

• Developed and released a variety of new products, including ProtectionPLUS contract works and public liability

insurance policies, Master Builders First Choice business packages and a new Telstra plan for members

• Delivered subsidised training packages to industry participants across Queensland

• After many years of lobbying for a government voice, Master Builders welcomed the appointment of a dedicated

building industry minister

• Master Builders Foundation continued to provide support to the building industry and Queensland community,

with almost $400,000 worth of donations made.


OUR PERFORMANCE

Strategic plan for 2008–2012*

our members

Achieve membership growth through service excellence and a combined focus on retention and growth

Communicate regularly with and deliver tailored educational/information products and services to members

Encourage member consultation and participation

Develop and deliver contemporary and cost eff ective products and services

Build a stronger brand and profi le Develop strong brand awareness amongst members and stakeholders

Develop a strong policy process that protects and advances the interests of the industry

Foster a culture that values

staff and provides outstanding

customer service

Have well trained and experienced staff

Promote eff ective internal and external communication

Develop proactive staff policies

Optimise operational eff ectiveness Ensure an eff ective organisational management structure is in place

Put in place a secure asset base to maintain organisational viability

Continuous business process improvement

Eff ective IT business solutions

*Given the challenging economic times, Master Builders has extended the Strategic Plan to include 2012, as it was developed to refl ect the constrained times.

Once activity levels start to rise, a new Strategic Plan will be developed.


What did we achieve?

• Recruited 1,001 new members into the association, however ongoing challenging business conditions and reduced building activity saw the number of

resignations and terminations increase once again due to fi nancial hardship. As at 30 June 2011, Master Builders membership base stands at 9,243

• Delivered tailored information and advice during times of natural disasters, including fact sheets, email communication, SMS and mobile building advice units

• Streamlined email communications, including a more stringent email policy that reduced bulk emails and encouraged better segmentation of member

database and information provision according to member type, that has resulted in improved email ‘open rates’ and positive feedback from members

• Used Master Builders Customer Care Centre to better communicate a range of membership benefi ts and specialised campaigns to specifi c audience segments

• Answered more than 4,800 technical, legal, contractual and dispute queries and responded to more than 4,000 workplace relations and workplace health and

safety queries. Continued to communicate with members regularly across a range of channels, including face-to-face consultation, Master Builder magazine,

via Master Builders Customer Care Centre and electronically by email

• Delivered the new Master Builders Connect networking and mentoring program to members in the Brisbane region and regular industry updates throughout

Queensland

• Master Builders Roadshow took information and new products on the road to all major regional centres and two Brisbane locations

• Delivered a variety of information products for members, including email updates, fact sheets and publications

• New insurance products released, including ProtectionPLUS contract works and public liability policies and Master Builders First Choice business package

• Introduced revised Telstra plan for members that off ered a broader range of products and more competitive pricing structure

• Off ered subsidised training packages to industry participants across Queensland

• Increased our focus on Master Builders profi le, including a proactive media plan, resulting in 700 mentions of Master Builders in the media, valued at $528, 598

• Developed a the Queenslanders rebuilding Queensland campaign to ensure local contractors were used by the public for disaster repair workd

• Developed an online and over the phone Disaster Repair Register to help consumers fi nd properly licensed, local contractorsr

• Continued to provide relief and assistance to Queenslanders in need through the Master Builders Foundation, with almost $400,000 of donations made and

Master Builders public profi le greatly increasing as a result

• Launched the Queenslanders rebuilding Queensland campaign to strongly encourage insurance companies and the state government to ensure disaster repair d

work was completed by local contractors

• Participated in the Building Revival Forum to identify kick start measures, resulting in the announcement of the Building Boost Grant and other initiatives in the

2011–2012 State Budget

• Continued to produce the State of the State and Survey of Industry Conditions reports that provide building industry information

• Commenced development on Master Builders Policy Blueprint, to be released in late 2011, that will defi ne Master Builders policy objectives and direction

• Continued to shape policy and provide recommendation on industry-wide issues through Master Builders Construction Sector Committee and Housing Sector

Committee

• Media training for key Master Builders spokespeople ensured key spokespeople were provided with the training required to deliver a consistent message on

behalf of Master Builders

• Continued the staff customer service awards to recognise those who ‘go the extra mile’ and the Employee of the Year award, which was awarded to Trish Di

Mauro from the Membership Administration team

• Developed a number of staff working groups to address staff survey results, including a professional development and training group and uniform group

• Improved staff communication by implementing a majority of recommendations from a staff survey, including better internal communication channels, such

as video linking for regional staff and monthly staff newsletter

• Maintained stability of staffi ng levels. Some staff turnover was experienced, however most positions have been fi lled and maintained with up-skilling, etc.

• Provided fl exible working conditions for staff , including fl exible working hours and continued improvement of staff policies

• Ensured Master Builders continued to off er positive and above average working conditions by gaining feedback from staff regarding employment conditions

and staff benefi ts

• Maintained a stable Strategic Management Team and commenced succession planning for both Executive and senior staff

• Released a range of new products and services, including a new Telstra plan and additional seminars on a fee basis

• Maintained Business Communication and Insurance Services business units, despite tough economic conditions

• Reviewed Master Builders assets to ensure ongoing organisational viability

• Since undergoing a restructure and implementing new materials and processes in 2010, the Training & Licensing team achieved an extremely successful result

in the AQTF audit in May 2011

• Developed membership payment strategy that has enhanced partnerships and better utilised the services of Master Builders Customer Care Centre

• Introduced new staff group to ensure business-wide considerations are made when assessing and implementing new initiatives and projects

• Put in place a process to better utilise Master Builders Customer Care Centre as a communication and marketing pathway

• Prepared for upgrades to two essential business systems – accounting and CRM

• Currently undergoing website upgrade that will deliver more intuitive and user friendly information architecture, better navigation pathways, a more corporate

and fresh site that is easy to read and use, and more people focused and a bring some manual business processes online to create resource effi ciencies


OUR MEMBERS

The 2010–2011 fi nancial year has

been a tough one for Queensland.

Master Builders membership has

not been immune to the continued

challenges faced by Queensland’s

building and construction industry.

Diffi cult business conditions in

general, a lack of demand in both

the housing and commercial sectors,

along with record numbers of

Building Service Authority licence

cancellations, have resulted in high

numbers of member resignations

and terminations. Despite the

positive recruitment of 1,001

new members, Master Builders

experienced a net membership

decrease of 1,125 members.

Master Builders current membership

base stands at 9,243 comprising

residential and commercial builders,

trade alliance, manufacturers and

suppliers, industry consultants,

students and apprentices.

In 2010–2011, we continued to

deliver tailored information and

advice, particularly in areas of

employment, wages, contractual

issues, how to get paid and disputes.

As new issues impacted our industry,

we also responded with information

products and events to ensure

members were up-to-date in areas

like workplace health and safety and

industrial relations.

We also constantly review and refi ne

our suite of products and services to

ensure Master Builders membership

is a relevant and important part

of any successful business in

Queensland’s building industry

and that our products and services

remain relevant for the industry. This

year we delivered a number of new

initiatives and improved our own

communication channels to help

members operate more professional

and profi table businesses.

Better targeted

information

In 2010–2011, Master Builders

undertook the massive task of

improving and streamlining our

electronic communication with

members. The result was a new

policy that provides members with

targeted information according to

their member type and reduces

the number of bulk emails and

the commencement of the

redevelopment of Master Builders

corporate website.

The redeveloped website, to be

launched in late 2011, will include

new features such as better

structure and search functionality,

making it easier for members to

fi nd information, fresh new design,

revamped Find a Master Builder

service, more information for

consumers and online functionality

for booking of events and training,

purchasing products online and

other useful features.

The response to this strategy has

been positive, with members

anecdotally providing positive

feedback and ‘open rates’ for Master

Builders emails rising well above

building and construction industry

averages.

Recognition of long serving members

To honour those members who

are long-term supporters, Master

Builders developed a long serving

member certifi cate. Presented

at the Master Builders Housing

& Construction Awards regional

presentation ceremonies, the

certifi cates honour those members

with ten or more years of

membership.

We rely on strength in numbers to represent the interests of our industry. The stronger our membership base, the louder our voice.


Membership by categoryTotal members as at 30 June 2011 = 9,243

Builders = 3,654

Trade Alliance = 3,672

Manufacturers &

Suppliers = 369

Consultants, Associates,

Supervisors & Retired = 775

Students = 34

Apprentices = 739

New members Total new members 2010–2011 = 1,001

Builders = 282

Trade Alliance = 575

Manufacturers &

Suppliers = 47

Consultants, Associates &

Supervisors = 80

Students = 9

Apprentices = 8

Membership by region Total members as at 30 June 2011 = 9,243

Brisbane/West Moreton = 4,032

Sunshine Coast = 913

Mackay & Whitsunday = 397

Downs & Western = 511

Burnett Wide Bay = 340

North Queensland = 486

Gold Coast = 1,480

Central Queensland = 528

Far North Queensland = 556

New products

We introduced a range of new

products across our business, such as

tailored insurance packages, a new

Telstra plan and subsidised training

packages.

Roadshow 2010

After the successful return of

Roadshow in 2009, Master Builders

once again travelled across

Queensland in November, taking

important industry information

and new products on the road

to all major regional centres and

two Brisbane locations and giving

members a snapshot of where the

industry is going.

The travelling band of industry

experts, Master Builders staff and

key business partners embraced the

‘Building for the future’ theme and

demonstrated to members how they

can build sustainably now and in

the future to help get more business,

save money and separate themselves

from their competition.

Keynote speaker, Mark Thomson,

President of Australian Green

Development Forum and Corporate

Sustainability Principal of the

Schiavello Group, addressed fi ve

areas of sustainable building practice

and provided an insight into why

members should think about these

issues now so they can succeed

tomorrow.

NOTE: Members and membership

refers to both members and registrants

throughout this report.


OUR PEOPLE

Executive DirectorGraham Cuthbert

Director,Construction PolicyJohn Crittall

Director, Housing PolicyPaul Bidwell

Director,Corporate ServicesFiona Ashmore

PresidentDerek Pingel

Vice PresidentMichel Mouglalis

Chairman ConstructionGlenn Rashleigh

Chairman HousingRalf Dutton

TreasurerRick Burns

Executive MemberMartin Brooke

Executive MemberKathy Seaman

Executive MemberJohn Gaskin

Strategic Management Team

The natural disasters that affected more than 70% of Queensland in early 2011 required Master Builders leaders to stand up and ensure our collective voice was heard on behalf of members. In our 129 yearhistory, never before has strong leadership been so important.

Executive

In accordance with the provisions

of Master Builders Constitution, the

management and control of the

association is vested in an eight

person Executive, elected by the

State Council every two years.

The Executive team, which meets

monthly, is solely responsible for

the operational direction of Master

Builders.

State Council

State Council is elected by members

and is responsible for Master Builders

strategic and policy direction. The

group, which meets twice per year,

is made up of 14 general councillors,

two contractor members, and nine

divisional representatives.

Strategic Management Team

The day-to-day operations of Master

Builders are overseen by the Strategic

Management Team.

Committees

Master Builders has two main

committees, the Housing Sector

Committee and the Construction

Sector Committee. These committees

are responsible for providing

recommendations on policy and

industry-wide issues, such as

proposed or recommended changes

to legislation and regulations.

These committees provide valuable

input from the coalface of the


and are supported by a number of


sub-committees, as outlined in the

organisational chart. See page 25 for

a detailed list of committee members.

Division and branch structure

In addition to the Brisbane region,

Master Builders is defi ned by eight

regional divisions, each of which

is supported by a regional offi ce.

Each division has a Committee of

Management that is comprised of a

Chairman, Vice Chairman, and up to

fi ve additional members.

Elected biennially, each committee

is responsible for identifying,

discussing and recommending

courses of action in relation to local

and industry issues.

Divisions

Branches

State Council

Executive

Environment Committee

IR Committee

Renovators Committee

Contracts Committee

H&SCommittee

IBC Committee

Executive Director

Corporate Structure

Construction Sector

Committee

HousingSector

Committee

Operational staff

Master Builders employees a team of talented, experienced and dedicated

staff , who provide exceptional services, benefi ts and products to Master

Builders members.

Note: Executive and Strategic Management team as at 30 June 2011.


OUR BUSINESS

Major highlights/issues for 2010–2011:

• A modest, but pleasing 2.2%

increase in budgeted income

• An excellent 6.5% return over the

budgeted bottom line

• Release of the new Master

Builders ProtectionPLUS contract

works and public liability policies.

These Master Builders drafted

policies deliver top of market

insurance protection to members

and are now exclusively available

to Master Builders from a choice

of two major insurers

• Finalisation of Master Builders

First Choice business package

insurance for members’ offi ces,

workshops, storage facilities, etc.

Extensive additional benefi ts

automatically form part of this

policy, in accordance with

other Master Builders branded

insurance products

• Interstate Home Warranty

activities saw the fi rst full

12 months of operations under

the various new government

controlled Home Warranty

systems. Generally, these new

government schemes are

substantially more cumbersome

to administer than those

previously in place. Commission

earnings were maintained near

to pre-existing levels, without the

need for staffi ng increases

• Master Builders exclusive

Master Trade range of products

continued to off er quality policies

and grow penetration into the

trade contractor insurance

market.

Master Builders Insurance Services

delivered on its charter to provide

a valuable and diverse range of

competitive insurance products,

to the broad requirements of the

building and construction industry.

Training & Licensing

2010–2011 was a successful year for

Master Builders Training (RTO 30097)

as they continued to re-defi ne

Master Builders role as a registered

training organisation (RTO).

Master Builders RTO exists for the

purpose of delivering nationally

recognised training within the


under the Australian Quality Training

Framework (AQTF), with a strong

focus on skilling the workforce for

the long-term future of the industry

in Queensland. Given the diffi cult

construction climate, Master Builders

Training & Licensing delivered a

sound result for the fi nancial year.

Subsidised training

During 2010–2011, considerable

funding opportunities were

accessed through Construction Skills

Queensland (CSQ), Skilling Solutions

Queensland and the federally

funded Enterprise Based Productivity

Places Program. These opportunities

enabled Master Builders to off er a

A diverse range of building and construction industry related business units have helped Master Builders put in place a secure asset base to maintain organisational viability into the future.

Master Builders Insurance, Training & Licensing and Business Communications business departments provide

members with exclusive benefi ts and help to support Master Builders core areas of service and operation, ensuring

the organisation is not solely reliant on membership subscriptions to fund business operations.

Insurance

The 2010–2011 fi nancial year

resulted in another positive

outcome for Master Builders

Insurance Services. Insurance

operations produced particularly

encouraging results, despite the

severe downturn in building activity

prevailing across both the housing

and construction sectors.

There is an obvious link between

low activity levels and the number

of projects requiring insurance

coverage. This subsequently creates

negative pressure on Master Builders

overall insurance commission

earnings. These adverse infl uences

were, however, counter balanced

by the diversifi cation of insurance

operations interstate and the

resulting broader base of available

market.


high percentage of its accredited

training under partial or full funding

to members.

This has resulted in an increase in the

number of members undertaking

unaccredited training and accredited

training and assessment at Certifi cate

III level and above. Of particular note

was the disaster recovery funding

provided by CSQ, which saw more

than 1,200 Queensland building

and construction workers undertake

funded training in order to up-skill

for fl ood recovery work.

AQTF auditing

As an RTO, Master Builders objective

and obligation is to ensure all

accredited training is compliant with

government policies and procedures,

and to ensure personnel are qualifi ed

to provide professional service to

industry.

During 2010–2011, Master Builders

worked extensively on the trainer/

assessor skill base and developed

new learning resources for the core

delivery of Certifi cate IV in Building

and Construction (Building), together

with new delivery models for face-

to-face and distance learners.

Administrative processes focussing

on demonstration of continuous

improvement cycles within the

department were also further refi ned

in preparation for an external AQTF

audit in May 2011. The excellent

outcome of this audit has clearly

established Master Builders as a

provider of highest quality training in

the industry.

Scope of off ering

The scope of Master Builders training

off ering currently includes delivery of

non-accredited workshops, through

to issuing nationally recognised

qualifi cations and Statements of

Attainment from Certifi cate I to

Advanced Diploma level. Master

Builders has a strong focus on face-

to-face delivery in Brisbane and in

the regional areas of Queensland.

In recognition of the need to service

remote workers who wish to access

training through Master Builders,

many workshops and accredited

training are provided in distance

delivery mode.

Master Builders licensing application

assistance service to Master Builders

members also continues to grow,

providing an excellent conduit from

training completion to successful

licence application for many

members.

Skills assessment or recognition of

prior learning (RPL) continues to

assist individuals who do not have

formal qualifi cations, by providing

an opportunity for qualifi cation-

aligned recognition of the valuable

skills that many construction workers

gain during years of experience

in the industry. Master Builders

trade-specifi c, qualifi ed assessors

operate throughout Queensland,

ensuring that all applicants have

access to high quality and timely RPL

opportunities.

As Master Builders RTO moves into

a new era of change in regulation

from a state-based to a federal

based monitoring model during

late 2011, the organisation is well

placed to undertake the inevitable

adjustments that will be required,

and to continue to consolidate our

fi nancial position through revenue

growth and sustainable cost control.

Business Communications

Master Builders Business

Communications department

continued to grow during the

2010–2011 fi nancial year. With

Master Builders overall goal to

regularly review and improve our

product off erings, we were pleased

to introduce a revised Telstra plan

for members, which off ers a broader

range of products and a more

competitive pricing structure.

Overcoming a number of previous

issues surrounding privacy, Master

Builders and Telstra were able to

commence promotion of all Telstra

business products and services

during the fi nancial year. This focus

on promotion ensured a growing

portfolio and increase in revenue,

and included a mix of traditional

marketing activities, such as the

quarterly catalogue, and new ‘out of

market’ off ers.

However, this success has not been

without its challenges. A complete

change of staff within the Business

Communications department

required strong organisational

leadership, while the credit risk

profi le of the plan remains a concern

and refl ects the market downturn.

In the new fi nancial year we look

forward to increasing service

standards to Master Builders Telstra

plan customers and all members.

Regular member communication

will be employed to gauge customer

needs and satisfaction, to ensure

Master Builders continues to provide

a relevant product and maintain

service standards. The introduction

of new and emerging technologies,

such as tablet devices, smartphones

and Telstra cap plans, will also allow

members to work smarter and

improve their bottom line in the

future.


OUR COMMUNITY

Master Builders has a long,

charitable history and made the

decision in 2010 to formalise these

eff orts by establishing the Master

Builders Foundation as the offi cial

fundraising and community support

arm. The Foundation, which is

funded via voluntary contributions

from Master Builders members, has

a strong focus on issues that align

with the Queensland building and

construction industry, and also

issues that aff ect Master Builders

members and their families and

communities. In the last 12 months,

the Foundation has contributed to a

number of worthy causes that have

changed lives and provided much

needed assistance.

Timely assistance

When the fl oods hit Queensland in

early 2011, impacting on so many

people and so much of the state,

the Foundation was in a position to

help – it was a case of fi nding the

right equipment and ensuring it

made it to the right people. Fifteen

self-contained water pressure units

were purchased and donated to

local councils and SES branches

across Queensland to assist with

the immediate fl ood clean up.

These units are a classic example of

equipment that provided immediate

benefi t, but will also help into the

future.

In response to the damage wreaked

by Cyclone Yasi, an important

contribution was also made to the James Cook University’s Cyclone Testing

Station (CTS). CTS now have a state-of-the-art vehicle to be used for cyclone

damage investigation and inspections.

Help for deserving families, programs and projects

During the 2010–2011 fi nancial year, the Master Builders Foundation donated

equipment like mobility chairs, hydraulic lifts and other donations that have

drastically improved the lifestyle of many Queensland families and provided

much needed assistance for a number of organisations.

A snapshot of the donations made is:

Recipient Donation Region

Tessman family Hydraulic lift for wheelchair

accessible vehicle

Sunshine Coast

Ashton family Customised mobility chair Sunshine Coast

Muller family Hydraulic lift for wheelchair

accessible vehicle

Brisbane

Dave Galvin Wheelchair accessible vehicle Brisbane

Kellin Hyde School fees for heart

transplant recipient

Gold Coast

The Australian Association

of the Sovereign Military

Hospitaller Order of Malta

Purchase of coats for ‘Coats

for the homeless’ project

Toowoomba

Kiyua Performing Arts Donation towards arts project Toowoomba

The Master Builders Foundation is our way of leaving a lasting legacy in Queensland’s community on behalf of Master Buildersmembers.


Key partnerships for the future

In 2011 the Foundation identifi ed

partnerships with three key

organisations that will cement

the Foundation’s mission to

provide support for organisations

that align with the building and

construction industry and assist with

the construction or renovation of

accommodation for young, elderly,

sick or injured Queenslanders.

Mates in Construction is a charitable

organisation established to

highlight the mental health plight

of Queensland construction workers,

who are up to six times more likely

to die from suicide than from an

accident at work. Master Builders will

provide funding for a fi eld offi cer for

the next two years to assist in their

goal of reducing the incidences of

suicide and help improve the mental

health and wellbeing of workers

in the Queensland construction

industry.

A signifi cant contribution has

also been made to Youngcare,

who provide new and innovative

standards in residential care for

young people. The Foundation’s

contribution will assist in building a

new Youngcare facility on the Gold

Coast.

Finally, the Cerebral Palsy League

will benefi t from a Foundation

contribution towards the

refurbishment and outfi tting of their

premises in Toowoomba.

These contributions are all

circumstances where the Master

Builders Foundation can off er

assistance that really makes a

diff erence. The Foundation is proud

and delighted that the voluntary

contributions by members are used

for such worthy causes and make

such an impact on the lives of many

Queenslanders.

All members who make this voluntary contribution should be proud of the Foundation’sachievements.


OUR INDUSTRY VOICE

Master Builders is a major force within the industry and is in a strong position to infl uence decisions and lobby for or against issues that affect our members’ businesses.

Master Builders works hard to

protect and advance the interests of

members through active lobbying to

all levels of government and strong

representation on industry bodies.

With well established networks, we

are the voice of the industry and

have the ear of government and

other key decision-makers. Key issues

and campaigns we have run during

2010–2011 are outlined below.

Building Revival Forum

The issue

In response to the tough economic

conditions facing the construction

sector, the Premier convened a

Building Revival Forum in April 2011

to consider ideas and actions to kick

start building activity.

What we did

Master Builders was represented by

members and staff from across the

state and lobbied for a number of

key measures to be considered:

• Financial incentives to encourage

building construction (e.g. stamp

duty concessions and redirecting

the First Home Owners Grant to

new construction)

• Reforms to the planning system

to provide more certainty and

reduce assessment timeframes

• Moratorium on new land use,

development and environment

regulations, including removing

the need for rainwater tanks in

new houses

• Fast tracking surplus government

land for residential development

• Initiatives to increase consumer

and investor confi dence.

Outcomes

The government agreed to a number

of these proposals. A new Building

Boost Grant of $10,000 for new

houses and units and signifi cant

capital works expenditure were

announced as part of the 2011–2012

State Budget and a Major Projects

Offi ce will be established as a ‘one-

stop-shop’ to guide projects through

the planning process.

Infrastructure charges

The issue

In Queensland, infrastructure

charges vary greatly between local

governments, with the system

meaning that local councils have the

discretion on what charges to apply to

new developments. This system had

major repercussions for the housing

industry and housing aff ordability

generally. The government set up an

Infrastructure Charges Taskforce to

investigate the issue.

What we did

Master Builders put forward a strong

case to have the charges capped at a

maximum of $20,000, as our opinion

was anything beyond that is excessive

and will have major repercussions for

housing aff ordability.

Outcomes

On 12 April 2011, the Premier

announced that maximum standard

charges will be introduced for a

three year period, commencing

1 July 2011. These charges were

$28,000 for three or more bedroom

dwellings and $20,000 for one or two

bedroom dwellings.

Payment of infrastructure charges

for land subdivisions will be deferred

past the plan sealing stage to the

point where the sale of the lot is

settled, or maybe even when the

house is built. This is still being

fi nalised.

Whilst there was some

disappointment with the decision,

Master Builders is comfortable with

the government’s proposal of a lower

charge for one and two bedroom

dwellings.

Master Builders will watch the

response from local governments.

It is possible that councils with

lower charges will increase to meet

the cap. For example, Logan City

currently has an average charge of

approximately $15,000 per house,

which is very competitive compared

to Brisbane and the Gold Coast. The

Logan Mayor says she is keen to

retain that competitive advantage;

however it remains to be seen if that

will be the case.

Universal housing design guidelines

The issue

There is a signifi cant coalition

comprising the disability, anti-

discrimination and seniors lobbies,

working at national and state levels

to require a range of features to be

included in all new and extensively

modifi ed houses. These groups are


working with the building industry

through the National Dialogue on

Universal Housing Design.

What we did

Master Builders is represented on an

Advisory Group monitoring progress

in Queensland.

Outcomes

National Dialogue members

(including Master Builders Australia)

have agreed that the following

six core universal housing design

elements (the silver standard) will

be incorporated in all new homes

by 2020, with 25% of new houses

incorporating these features by 2013:

1. A safe and continuous path of

travel from the street entrance

and/or parking area to a dwelling

entrance that is level

2. At least one level entrance into

the dwelling

3. Internal doors and corridors

that facilitate comfortable and

unimpeded movement between

spaces

4. A toilet on the ground (or entry)

level that provides easy access

5. A bathroom that contains a

hobless (step-free) shower recess

6. Reinforced walls around toilets,

showers and baths to support the

safe installation of grab-rails.

It is very unlikely that we will meet

the target of 25% of new houses

incorporating the silver standard by

2013. There is no doubt that this will

be an ongoing issue, with signifi cant

pressure at a national and state level

to have the silver standard features

incorporated into the Building Code.

BSA dispute resolution process

The issue

During the process of dealing with

consumer complaints about building

work, the Building Services Authority

(BSA) has proposed to remove

the step of sending a contractor a

‘Request to Rectify’ letter prior to

issuing a ‘Direction to Rectify’. This

proposal is concerning, particularly

in cases when it is yet to be

determined if the work in question is,

in fact, defective.

Once the uncertainty surrounding

the standard of the work is resolved,

natural justice dictates that the

builder should be given the

opportunity to remedy any defects

(if the work is considered to be

defective by the BSA) prior to any

direction being issued. A Request

to Rectify provides the builder with

such an opportunity.

If the builder fails to comply with

the requirements of the Request to

Rectify, it would then be appropriate

to issue a direction. Master Builders

does accept that contractors need to

respond to their clients’ concerns in a

timely manner.

What we did

Master Builders has raised concerns

about this proposal, believing the

issuing of a Request to Rectify is critical

to ensuring that builders are aff orded

their fundamental right to natural

justice. Master Builders prepared

a submission to the BSA, which

unfortunately was not accepted.

Outcomes

From 3 May 2012, the revised policy

will see the BSA write to individual

contractors, advising them of the

home owner’s complaint and

follow up with a phone call. If they

subsequently go on site and the

work is defective, a direction will be

issued instead of a request.

Master Builders has major concerns

with the changes, particularly the

issue of subcontractor accountability.

Over many years we have argued

that the BSA must be more active in

ensuring contractor accountability

for their work. Tighting the

requirements for Directions to Rectify

should have included measures

to improve the accountability of

subcontractors. This issue is yet to

be resolved and Master Builders will

pursue it further.

Erosion and sediment control

The issue

In response to local government

pressure, the state government

introduced new controls to prevent

erosion and sediment run-off on

building sites.

What we did

As a member of the CEO’s

Committee for Natural Resource

Management in South East

Queensland, Master Builders worked

with the government to develop


OUR INDUSTRY VOICE

building and construction activity on

the environment.

What we did

Master Builders participated in the

consultation process regarding

implementation of the levy,

particularly to address potential

practical problems such as the

logistics of separating waste streams

on site, diffi culties of reusing

certain reconditioned or recycled

products and the provision of clear

information for businesses.

With natural disasters and tough

economic times impacting so heavily

on the industry, Master Builders

also recommended deferring the

introduction of the levy.

Outcomes

The Minister for Climate Change and

Sustainability has agreed to postpone

the levy until 1 December 2011.

Building Codes Queensland inspection requirements

The issue

The role of building certifi ers in

inspecting the footing stages of

single detached dwellings, garages,

carports and sheds has been an

ongoing discussion. Building Codes

Queensland (BCQ) has a policy that a

building certifi er must inspect works,

in addition to the use of surveyors

and engineers. This approach results

in doubling up of inspections,

slowing of construction timeframes

and the addition of unnecessary

costs to an already expensive

inspection regime.

What we did

With this issue having such an

impact on the industry, Master

Builders raised these concerns

directly with BCQ and strongly

lobbied for a change to inspection

requirements.

Outcomes

Commonsense prevailed, with

BCQ agreeing that builders can

engage a surveyor to certify that

works are in the correct location,

and/or an engineer to confi rm the

structural aspects are correct before

the concrete is poured for the

footings and slab. While building

certifi ers will not be required to

personally undertake the footing

stage inspections, they will still

need to sign the footing inspection

certifi cate and issue advice to the

builder that they can continue to the

next stage.

National licensing

The issue

The debate on national licensing

continued throughout 2010–2011,

with the Council of Australian

Governments, in conjunction with

all states and territories, working

towards a national licensing system.

The national approach to licensing

electricians and plumbers is

intended to commence in July 2012

with the new arrangements for the

building sector in July 2013.

What we did

Master Builders supports a broad

approach to national licensing

focused on protecting the interests

of consumers. A wide range of

builder and contractor licenses

assists with maintaining and

improve building standards and is

a prerequisite to ensuring that all

contractors are accountable for their

work. We also believe licensing is

the key to successful training and

apprenticeships.

Given the slim probability of

retaining a comprehensive licensing

acceptable erosion and sediment

controls. However, given the

state of the industry, we strongly

recommended delaying the

introduction of these measures until

the economy recovers.

Outcomes

The building industry had a win

on this issue, with the government

agreeing to defer the introduction

of mandatory urban stormwater

quality management and erosion

and sediment control requirements

for 12 months.

Waste levy

The issue

As part of the 2010–2011 State

Budget, the Queensland

Government announced the

introduction of an industry waste

levy, to reduce the impact of


system for the trades, Master Builders

has agreed on the following priority

list, which relates to trades that

impact on the structural integrity of

a building.

1. Bricklaying and blocklaying

2. Carpentry

3. Concreting

4. Drainage

5. Foundation work (piling and

anchors)

6. Gasfi tting

7. Glass, glazing and aluminium

8. Plastering drywall

9. Roof and wall cladding

10. Roof tiling

11. Sheds, carports and garages

12. Steel fi xing

13. Structural metal fabrication and

erection

14. Tiling

15. Waterproofi ng

We strongly represented the

industry to try to ensure the

BSA’s eff ectiveness as a system

for protecting consumers and

contractors was not compromised.

Outcomes

At the time of publishing, there is

no defi nitive view on the range of

builder and trade contractor license

categories that will apply nationally.

It is likely that Queensland’s three

tiered approach (low-rise, medium-

rise and open) for builders will be

adopted nationally. However, it is

likely that many of Queensland’s 59

trade contractor licenses will not be

picked up in the national scheme and

Queensland will be required to fall

into line.

Irrespective of the outcome,

Queensland will retain its Home

Warranty Insurance scheme, but the

outcome on Queensland’s existing

fi nancial tests for licensed contractors

is unknown. This issue will be a major

focus for Master Builders during

2011–2012 fi nancial year.

Rainwater tanks

The issue

In looking at ways to reduce the

construction cost of new houses,

Master Builders has pressed for the

removal of mandatory rain water

tanks in all new dwellings as part of

the Queensland Development Code

(QDC).

Master Builders recognises that rain

water tanks are vital in rural and

regional areas where there is no

reticulated supply. And, in urban

areas, tanks assist households to

reduce their demand on reticulated

supplies (particularly during dry

conditions), as well as reduce their

water bills.

However, we have concerns about

the mandatory requirement for water

tanks in urban areas, principally the

impact on housing aff ordability. The

cost of a 5,000 litre rainwater tank is

estimated to be $6,000 in southern

Queensland and $7,000 in northern

parts. Economic research supports

our position, as the cost for rainwater

tanks is higher than other sources of

public water, for example, dams and

desalination.

Removing the mandatory

requirement for rainwater tanks in

new houses is a no cost, simple way

to reduce the cost of new housing to

help stimulate building activity.

What we did

Master Builders raised this issue at

the Building Revival Forum and has

asked the Deputy Premier to take

action and amend the QDC. No

outcome is known at this stage.

Building and Construction Industry Payments Agency

The issue

Master Builders has long called

for the Building & Construction

Industry Payments Agency (BCIPA)

to be extended in the housing

sector, enabling contractors and

subcontractors to access a quick,

informal and eff ective process

for resolving payment disputes

with owners. To date the state

government has rejected our call.

What we did

Given the grim state of the housing

industry, in our March 2011 quarter

Survey of Industry Conditions we

asked members about the extent of

non-payment in the current market.

The fi ndings were overwhelming and

it is clear this issue is having a serious

impact on many businesses.

We used these fi ndings to put

pressure on the building industry

Minister to move quickly to

introduce a fairer and timelier

process for resolving payment

disputes.

Outcome

The BSA has agreed to work with

Master Builders to develop a model

that suits the requirements of both

consumers and builders.

New health and safety laws

The issue

The 2010–2011 fi nancial year saw

rapid progress in the development

of nationally harmonised health

and safety laws. The Work Health

and Safety Bill 2011 was passed in

Queensland Parliament in May 2011,

and along with new regulations


and around 41 new codes of

practice aff ecting the building and

construction industry, is scheduled

to commence on 1 January 2012.

The harmonised laws represent the

most signifi cant change in health

and safety legislation in more than

20 years. The new laws have also

ushered in a shift towards a closer

integration of industrial relations and

health and safety.

What we did

Master Builders Workplace Relations

and Health and Safety teams

worked closely to ensure that the

information and advice provided to

members is not only accurate but

also consistent with both sets of laws.

Although the new laws will still

impact heavily on all sectors of the

building and construction industry,

Master Builders has been extremely

proactive in lobbying government

at both state and federal levels to

secure a more practical ‘common

sense’ regulatory approach towards

health and safety for builders and

subcontractors.

Senior staff from Master Builders

represented members and

the industry on the Workplace

Health and Safety Board and the

Construction Industry Sector

Standing Committee which are

respectively, the peak industry and

construction industry consultative

bodies to the Queensland

Government on health and safety

matters.

The Health and Safety team ran

information sessions throughout

various stages of the legislative

drafting process and will embark

on a more structured and intensive

training and education program for

members in 2011–2012.

ABCC sham contracting inquiry

The issue

During 2010–2011, Master Builders

has defended the rights of its

members to enter into subcontract

arrangements with, or as, ABN

contractors. More so now than

in recent years, the building

and construction industry is

under scrutiny by government

agencies, unions and others for its

subcontracting arrangements.

In late 2010, the ABCC (Australian

Building and Construction

Commission) commenced a

national inquiry into the nature and

prevalence of sham contracting

and of labour hire in the building

and construction industry. The ABCC

called for submissions from industry,

unions and other interested parties,

from early 2011.

What we did

Master Builders prepared a

submission, which cautions the

ABCC to intervene in the contracting

relationship only where there was

sound evidence of sham. It argues

that the inquiry should confi ne itself

to matters of fact, evidence and

a defi nition of sham contracting

that was clear and consistent with

existing laws. In particular, Master

Builders believes the Independent

Contractors Act 2006 (common law

test) and Fair Work Act 2009, (laws

against misrepresentation) protect

genuine options for persons who

elect to provide their services

through legitimate contracting

arrangements, including ABN

contractors’ services.

The factors that determine whether

a person is a contractor or an

employee is complicated and the

various tests of common law, payroll

tax, superannuation and work

cover must each be considered.

Unfortunately, the anti-independent

contracting lobby point to this

complexity as a reason why greater

restrictions should be placed on ABN

OUR INDUSTRY VOICE


registration.

To this end, Master Builders

submission to the ABCC inquiry

proposes a new approach for

statutory recognition and protection

of independent contractors, which

does not diminish common law

rights for such arrangements to

exist and not be subjected to

inappropriate and incompatible

regulation. This may enable

independent contractors to register

with a dedicated government

agency to gain registration for

a particular contract period or

engagement. To obtain registration,

the contractor would be required

to hold a Personal Services

Determination issued by the ATO,

and a certifi cate provided by an

independent legal or professional

audit, certifying that the particular

contracting arrangement satisfi ed

the common law test.

The ABCC report on its inquiry is

expected in August 2011.

Enterprise bargaining

The issue

Some Master Builders members

commenced a new cycle of

enterprise bargaining in early 2011.

While industrial laws on enterprise

bargaining were changed nearly two

years ago, these members have had

three or four year term agreements,

which have excluded any new claims

until 2011.

In 2010–2011, union claims were

especially unrealistic, with excessive

wage claims and absence of

productivity off sets, which are

completely at odds with the adverse

industry conditions. In particular,

the union agreement requires

all subcontracting entities to the

employer party to also be bound by

the agreement. The wording of this

‘subcontracting’ or ‘jump up’ clause is

signifi cant. If the provision is applied

in a manner which does not pertain

to the employment relationship, it

is likely to be unenforceable and

possibly unlawful.

What we did

Master Builders prepared a

comprehensive opinion and

submission on the nature of the

union claim. Submissions have been

made to the federal government,

Fair Work Australia and the ABCC to

seek solutions to protect the industry

from this extreme claim by the

unions.

The ABCC responded to Master

Builders concerns and in April 2011

issued an update which cautioned

the clause may lead to coercion or

discrimination between contracting

parties. The ABCC has advised that it

will be assessing the subcontractors’

/jump up clause and other notable

union claims for compliance with

government procurement guidelines.

There may also be exposure under

the Competition and Consumer Act

2010, for example, if a contractor was

required to have an agreement with

a particular union.

Master Builders has renewed its

enterprise bargaining information

services and dispute resolution

documents, to counter the

resurgence of extreme industrial

activity surrounding enterprise

bargaining, along with services such

as member briefi ngs, background

planning, representation before Fair

Work Australia and negotiations with

unions.


It was another tough year for Queensland’s building sector. Activity in the

residential sector remained weak, with interest rates, fi nancing problems and

low aff ordability combining to constrain building activity. The wet and wild

weather over spring and summer also took a heavy toll on the sector in many

regions of the state. Building approvals and fi nance commitments were at

some of the lowest levels in the last decade with consumers and businesses

alike either unwilling to buy or unable to secure fi nancing to buy a new

property.

New residential building approvals – Queensland

It was a similar story for the commercial sector with activity levels driven

largely by public sector funded programs, such as the Building the Education

Revolution. Private sector funded commercial work remained very weak

as businesses continued to struggle with fi nancing issues and lacklustre

demand in many key areas of the economy including retail, tourism and

hospitality.

The public sector has basically kept the industry afl oat with massive increases

in its expenditure.

Unfortunately, this expenditure is winding down and it would appear

that the private sector will not be in a position to make up the decline in

public sector funding. The lack of readily available fi nance, continuing soft

business confi dence and higher interest rates were largely responsible for the

weakness in private sector activity with developers unable to obtain fi nance

at the one end and potential investors waiting on the sidelines for signs of a

genuine economic recovery at the other end.

Higher interest rates added to fi nancing costs and impacted on the level

of demand, resulting in lower building activity in key areas such as retail,

industrial/warehouse, new offi ces and high-rise apartments.

STATE OF THE STATE


Value of non-residential building approvals – Queensland

The poor economic climate and activity levels fl owed through to business

performance with turnover and profi tability staying at less than satisfactory levels

for all of 2010–2011. After a number of years of challenging trading conditions,

many businesses in the industry were clearly under substantial pressure.

This is highlighted by employment levels, with many businesses reporting a

reduction in staffi ng levels over the course of the 2010–2011 fi nancial year.

The work pipeline also remained weak with many businesses reporting less

than three months work and operations well below their optimal capacity.

Business performance benchmarks

factors. Many consumers and businesses remained unconvinced of the

Australian economy’s supposed strength and were consequently unwilling

to spend money unnecessarily. This situation is unlikely to change in the

short term with the domestic economy remaining decidedly ‘two speed’ and

Europe teetering on the edge of a sovereign debt abyss.

The spectre of higher rates continued to unsettle some consumers and investors

and deterred them from entering the housing market. Despite the uncertain

global environment, consumers remained fearful of increases to interest rates in

response to infl ationary pressures associated with the mining boom, that would

place further pressure on already strained household fi nances.

Financing and valuation issues

also remained critical constraints

on building activity, with the

availability and cost of fi nance

continuing to create diffi culties for

some purchasers and developers.

Higher deposit requirements, new

responsible lending laws and

seemingly more conservative

valuations made it diffi cult for

potential buyers to secure fi nance.

On the positive side, the fl ood and

cyclone recovery provided work for

some industry participants, even if

the process is taking a little longer

than expected. In 2011–2012, the

Queensland Government’s Building

Boost Grant should also provide an

additional incentive for people to

build or buy a new home.

While the repair work and the

Building Boost Grant will provide

welcome stimulus, they will not be

enough to pull the industry out of

its current state. Any substantial

improvement will require a sustained

recovery in consumer and business

confi dence and non-mining

economic activity, as well as an

improvement in housing aff ordability.

This is likely to be a slow process

and, consequently, activity levels

in the residential and commercial

sectors are expected to remain

weak during the early part of

2011–2012. Residential activity is

expected to improve during 2012,

but commercial activity is likely to

remain soft until businesses are

relatively certain that the non-

mining sectors of the economy are

rebuilding momentum.


Across Queensland, regional areas

have faced a tough year with higher

interest rates, falling dwelling

prices, a high Australian dollar

and wet weather taking their toll

on residential building activity in

most regions. On the commercial

front, the tail end of the Australian

Government’s stimulus measures

and state government projects

generated most of the activity, with

private sector investment continuing

to be in short supply.

In some areas, one of the few

upsides of the subdued demand was

that it helped to moderate growth

in construction costs. Material and

labour costs remained fairly stable

over the year as the lack of demand

eased the pressure on wages and

materials costs.

Despite very tough conditions, in

most areas, local businesses retained

a positive outlook. Many were of the

view that construction activity would

gradually increase during 2011–2012,

particularly in the residential sector,

while others are hopeful that the

Queensland Government’s Building

Boost Grant will stimulate demand.

Stability on the interest rate front

would also be welcome to help

stabilise fragile consumer and

business confi dence.

STATE OF THE REGIONS

Gold Coast

• New house approvals were

considerably softer than in 2009-

2010 with an ongoing weakness

in the high density dwelling

segment of the market.

• Local businesses reported that

the availability of fi nance was the

most critical constraint on their

growth over the last 12 months,

followed by tighter lending

criteria and higher than average

mortgage rates.

• Other key constraints on

business growth included

infrastructure charges, the

planning approval process and

the level of demand.

Sunshine Coast

• Subdued economic conditions,

fi nancing issues and sluggish

demand took their toll on

construction activity in the

region with new residential

building approvals falling sharply

during 2010–2011.

• In the commercial building sector,

lacklustre demand, fi nancing

constraints and diffi culties

securing planning approvals

stifl ed any rebound in activity.

• The level of demand and the

availability of fi nance were the

Region New house approvals

2009–10 2010–11 % change

Brisbane & West Moreton 9,065 6,782 -25.2

Gold Coast 2,534 1,536 -39.4

Sunshine Coast 2,577 1,673 -35.1

Downs & Western 1,750 1,227 -29.9

Burnett Wide Bay 1,179 1841 56.1

Central Queensland 9,03 963 6.6

Mackay & Whitsunday 1,154 899 -22.1

North Queensland 1,471 1,097 -25.4

Far North Queensland 1,170 718 -38.6

Source: Australian Bureau of Statistics


two most critical constraints

on business growth and for the

second year in a row, the planning

approval process was identifi ed as

another signifi cant constraint.

Downs & Western

• After rebounding strongly in

2009–2010, new residential

dwelling approvals fell sharply in

response to higher interest rates,

tougher lending criteria and

sluggish demand.

• The most critical constraint on

business growth was fi nance

availability and cost and as in

2009–2010, infrastructure charges

and the planning process were

also important barriers to growth.

• Given the subdued condition of

the Queensland economy and

the level of interest rates, it was

also not surprising that the level

of demand was another key

constraint on building activity in

the region.

Burnett Wide Bay

• Building approvals have been

volatile during 2010–2011, with

wet weather, higher interest rates

and fi nancing issues continuing

to take their toll on construction

activity.

• While Burnett Wide Bay was one

of the few regions in the state

to record an increase in new

residential building approvals

over the last 12 months,

anecdotal evidence does suggest

that initial approvals may not

have translated into building

activity.

• The most critical constraint on

business growth in the region

was fi nance availability and cost,

with the level of demand, the

planning approval process and

infrastructure charges identifi ed

as other signifi cant issues for

businesses in the region.

Central Queensland

• Residential building approvals

held up reasonably well.

• Private sector funded commercial

building activity remained weak

throughout the year, driven

largely by problems with access

to fi nance and soft demand for

commercial property.

• The availability and cost of

fi nance was the key constraint

on business growth, with

other important constraints

identifi ed as the weather,

infrastructure charges and the

level of demand.

Mackay & Whitsunday

• While new residential building

approvals recovered from their

lows of early 2011 the level of

approvals remained well below

pre-GFC levels.

• The commercial sector struggled

with the tough trading

environment with fi nancing and

soft demand from investors and

businesses contributing to the

weak conditions. Unfortunately

this situation is not expected to

rapidly improve over the course

of 2011–2012.

• The most critical constraint

on business growth was the

availability and cost of fi nance,

with local businesses also

identifying the level of demand,

the wet weather and the

planning approval process as

other key constraints.

North Queensland

• While new residential building

approvals recovered over the

latter part of 2010–2011, the

region still recorded negative

growth in building approvals.

• Availability of fi nance and soft

demand remained key issues and

it is likely that these issues will

continue to infl uence the level of

activity in 2011–2012.

• Unlike many other regions,

fi nance availability was not

the number one constraint on

business growth in 2010–2011.

Instead, local businesses

identifi ed the level of demand

as their most critical constraint

during the year. The other three

key constraints identifi ed were

interest rates, fi nance availability

and the weather.

Far North Queensland

• New house approvals were

considerably softer throughout

much of the year, with the

region recording negative

growth in building approvals and

conditions in the commercial

sector remained poor.

• The availability of fi nance was

the most critical constraint on

growth, and in particular, tighter

lending criteria and higher than

average mortgage rates weighed

heavily on the local industry.

• Other key constraints included

the weather, the level of demand,

interest rates and infrastructure

charges.


CORPORATE GOVERNANCE

Executive meetings

Master Builders is governed by an

elected Executive team, which is

chartered with the responsibility of

conducting the business of Master

Builders within the policies and

budget of the organisation (see page

8 for more details). During the year,

Master Builders held 11 executive

meetings (see Executive attendance

register below).

Strategic planning

The fi ve year strategic plan is

developed and approved by the

State Council. State Council is

responsible for setting the strategic

and policy direction of Master

Builders, as well as tracking the

association’s performance.

The strategic plan is reviewed on an

annual basis.

Given the challenging economic

times, Master Builders has made the

decision to extend the Strategic Plan

to include 2012, as it was developed

to refl ect the constrained times.

Once activity levels start to rise, a

new Strategic Plan will be developed

that is suitable for a more positive

economic climate. See page 4 for

more details on our performance

against the Master Builders

Strategic Plan.

Complaints

Master Builders is committed to

resolving customer complaints

quickly and fairly, and we empower

our people to resolve issues as

Executive attendance register

Name PositionMeetings

attended

Meetings

eligible to

attend

Derek Pingel President 11 11

Michel Mouglalis Vice President 8 11

Glenn Rashleigh Chairman Construction 9 11

Ralf Dutton Chairman Housing 11 11

Rick Burns Treasurer 9 11

John Gaskin Executive Member 11 11

Martin Brooke Executive Member 11 11

Kathy Seaman Executive Member 10 11

Master Builders corporate governance systems guide the way wemanage our business, minimise risk and ensure integrity. Oursystems are based on a commitment to fairness, accountability and transparency.

they arise. All complaints and

grievances are recorded in the

complaints register and reported

to the Executive Director on a

quarterly basis. Complaints can

be submitted in writing to: Master

Builders Association of Queensland,

417 Wickham Terrace, Brisbane

Queensland 4000.

Privacy Policy

The privacy and confi dentiality of

the personal information of our

members, stakeholders and other

parties is of the highest importance.

Master Builders is committed

to protecting privacy through

responsible collection, use, storage

and disclosure of personal and

sensitive information. We seek

to eff ectively comply at all times

with the provisions of the Privacy

Amendment (Private Sector) Act 2000.

Master Builders Queensland has

adopted the National Privacy

Principles published by the Privacy

Commissioner and operates in

accordance with those principles.

A copy of Master Builders privacy

policy can be found on our website

at www.masterbuilders.asn.au.

ANNUAL REPORT 2011 |

Code of conduct

As an industry leader, Master Builders encourages

members to abide by high ethical standards. Members

are responsible for conducting their business in a

professional, fair and honest manner and abide by the

Master Builders Code of Conduct.

• To apply fair treatment, courtesy, reasonable and

honest conduct in the effi cient operation of our

business

• To service and promote the interests of the building

and construction industry

• To support research designed to advance the

professional image of the industry through

innovation, the application of new techniques,

methods and products

• To participate in the furthering of favourable relations

with all public authorities concerned with the

administration of building and construction

• To build strong relationships with manufacturers and

suppliers of goods and services and related industry

associations

• To support training and development initiatives that

strive to maintain a high standard of workmanship

• To encourage professional development for all

stakeholders that constantly seeks to lift the standards

and improve practical and administrative skills in the

industry

• To participate in a meeting with the Disciplinary

Committee appointed by the Executive and accept

the outcomes and be bound by any resolution

determined by the Disciplinary Committee

• To encourage the friendly exchange of technical

information and practical knowledge between

members

• To conduct all business activities in a professional and

ethical manner

• To observe strict compliance and promotion of the

Master Builders Australia National Code of Practice.

AAAAAAAAAAANANANANANANAAAAAAAAAAAAAAAAAAANANNANANNNNNNANANANANNAAAAAAAAANNNNNANNNNANNANNNNAAAAAAAANNNANNANNNNNNNNAAAAANNNNNNNNNNNNNAAAAAAANNNNNNNNNNNANNAAAAAAANNNNNNNNNNNANAAAAAAAAANNNNNNNNNNANANNNAAAAAAAANAANAAANNNNNNNNNNNNAAAAAAAAAAANANAANANNNNNNNNANAAAAAAAAANANNNNNNNNNNNANAAAAAAAANANANAANANNNNNNNNNNAANAAAAANANNNNNNNNNNNNNANAAAAAANNNNNNNAAAAAANNNNNNAAAANNNNNNNNAAAANNNNNNNNNAAAANNNNNANANNNNNANAAAANNNNANNNAAAAANNNNNAAAANANNAAAANANNNAAAANNANAAAAAANNAAAAAANNAAAANNNUNUNUNUNUNUNNNNUUUUNUUNUNUNUNNUNUNUNUNNNUUNUUNUUUUUUNUNNNUNNNUUNUNUUNUUUNUNUNUNUNUNNNNNNNNNUUUUNUNUUUNNNNNNNNNUNUNUUNUUUUNNNNNNUNUNUUNUUNUNNNNNUNUUNUUUNNNNNNNUNUNUNUNUUNUNUUNUNNNNNNNNUNUNUNUNUUNNNNNNNUUNUNUUUNNNNNUNUNUUNNUNNNNUNUUNUNUNNNNNUNUNUNNNNUNNNUNUNNNUNNNNUUNNNNNNUNNNNNNNNUNNUNNNNNNUUNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNUNNNNNNNUNNNNNNNNNNNNNN ALALALALAAALALALALALLALALALLALALAAALLLLLLALALAALALLLALALALALAAALALALLALLLALALAAALLALLLALALAALAAALAALALLAAAALAAALALAALALALLALAAALAALAAAAAAALALALALLALLAALALALALAAALALLALALLLAAAALAAALLLLLLLLAAAAALLLLALAAAAAALAALAALLLLLLLAAAALAALALAAAAALLLLLLLAAAAALAALAAAAALLLLLLAAAALAALALAAAAAAAAALLLLLLAAAALAAALALAAAAAALLLLLLLLAALAAAAAAALALAAAAALLLLAAAAALAALAALLLLLALALAAAAALLLLLLAAAAAALLLLLAALAAAAAALALLLAAALALAAALLLAALAALLLALAAALLLLAALLLLLLLLAALLLLLLLL RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRREPEPEPEPEPEPEPPPPEPPPPEPEPPPPPPPEPPPPPPEPPPEPEPPPPPPPPPPPPPEPPPPEPPPEPPEPEEEEPEEEPEEEPEEEEEEEEEEEPEEEEEEEPEPPEEEEEEEEEEEEPEPPPPPEEEEEEEEPEEPPPPPPEEEEEPPPPPPEEPPPPPPPOROROROOOOOOOORORORORORORRRRRRRROROROROOOOOOOOOORORORROOOOORORRRRROROROOOOORRROOOORROOOOORROOORROOORROORRROORRROORRRROOOORRRRRROOORRRRORRRORORRRORROROROROOORRRRRRRRRRRRORRRORORRRRRRRRRRROORRROOROORROOOOOOORRROOOOOO TT TTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTT TTTTTTTTTTTTTT TTTTTTT TTTTTTTTTTTTT TTTTTTTTT TTTTTTTTTTTTTTTT TTTT 2202020202020222020000020000000022222000200000002222022000000002222200000002220200000002000000222200000202200002022202222220200220220002222222020000222222222200222222202202020222002002000222000002022000000022000020000022222020000002222220000222222022222000220002001111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111 MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMASAAAAAASASASASASASASASASASASASSSSSSSSSSSASASASASAAAASASASASASASASASSSSSSSSSSSSSASAAAAAASASASAASSSSSSSSSSSSSASASASASAAAAAASSSSSSSSSASAAAAAASSSSSSSSSSSASAAAASASASAASASSSSSSSSSAAAASSASASSSSSSSAAAASAAASSSSSASSAAAASSSSSSSASAAAAAAAAASSASSSSAAASASSASSAAAAAAAAASSSASAAAAAAAASAASSAAASAAASAAAAAAASSSASASSASAAASAASSSASSSSASAASAAAASSAASAAAAAAAAAAASAAASSSASAASSSSAAAAAAASAAAASSSAAAAAAASAAAAASAAASSSTETETETETETETTTETTTETETETEETETETETETETETTTTTTETTTTTTETTTETEEETETETEETETETETETTTTTTTTTTEEEEEEETETETETETTETTETTEETEETETETETETETETTTTTETTETETETETETEEEEETTTTTTEEETETETTTTTTTTETEETEEETEEEEEEETTETETEEEEEEEEETTTTTTTETEEEEETTTTTETEETTTTTETETTTETEEETTTTTTETETETEEEETTTETTTETTTTTTTETEETEETETTEETEEETTTEEEEEEETETTEEETETEEETETTEETEETEEETETTETTEEETTEET RRRRRRRRRRR RRR RRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR RRRRRRRRRRRRRRRRRRRRRR BUBUBBBBBUBBBBBBBUBBUUBUUBUUBUBUUBUUUUBUBUBUBBBUBBBBBUUBUUUBUUBUBUBBUBBBBBBBUBUBUBUBUUBUBUBBBBBBUBBBBBBBUUUUBUUUBUBUBBUBBBBUBUBBUUUUBUUUBUUBUUBUBUBBBBUBUBBUBBUUUUUUBUBUUUBUBUBUBUBBUBBUBBUUUUUUBUUBUBBBBBBBBUBUUBUUBUUUUUUUUBUBUBBBBUUBUUUUUBUUUUUBBBBUUBUBUUUUUUBBBBBUBUUUUUUUUUBBBBBUUUUUUUUBUBBBBUUUUUUBUUBUBBBBBBBUUUUUUUBBBUBBBBUUUUUUUUUUBUBBUBBBBBUUUUUUUUUUBUBBUBBBBUUUUUUUBUBBBUUUBUBUUUBUBBUBUBBUUBBBUUUUBBUBUBBBBUBUBUBUBUUBUUUUUUUUUUUUUUUILILLLILILILILLLILILLLLILIILILLLLLIILIILLLILILLLLILILLILLLILILILLILILLILILLLLIIILLLLILLLLILILLLLLLLLLLLILLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLILLLLILLLLLILILLLLLLLLILLLIIILIILLLLLLLILLLLLDEDEDEDEDEDDDEDEDEDEDEDDDDDDDDDDEEEDEDEDDDEDEDDDDDDDDDDEEEEDEEEEEEEEEDDEDDDDDDDDDEEEEEDEEEEEEEEDEDEDEDDEDEDDDEDEDEEEEEDEDEEEEEEDEDDDEDDDDEDDDEDEEDEEDEDEEEDDDEDDDDDEEDEDEDEDEEEEDEDDDDDEDDEEEDEEDEDEEDDDEDDDDDDDDEDEEDEEEDEEEEDDDDDDDDDEDDDEEEEDDDDDDEDDEEDEEEEDDDDDDDEDEDDDDDDDDDEDEDEEEEDDDEDDDDDEDDEDEDDEDEEDDDDEDEDDDDEDEEEEEEEEEEDDEDDDEDDDDDDEEEDEEEEEEDDDDDDEEEEEEEEEEEEEDEDDDDEEEEEEEEDDDDEDDDDEEDEEEEEEEEDDDDDDDDEDEEEEDDDDEEEEDEDDDDDDEDEEEEEDDDDDDDDDEEEEDDDDDDDDDDDDDDDDEDDDDEEEDDDDDDDDEEERRRRRRRRRRSRRRSRSRSRSSSSRSSRSSRSSSSRSRRRRRRRRRRRRRSSSRSRSRSSRSRSSSSSSRRRRRRSRSRRSRSSSRSRSSSSRSRRRRRRRRRSRRRSRSSRSSSSSSSSSSSRRRRRRRRRRSSSSSSSSSRRRRRSSSSRSSRSSSSSRRRSRSRSSRSSSSSSRRSRSRSSSRSSSSSSSSRRSSSRSSSSSSRRRSSSSSSRRSSSSSRSRRRRSSSSSSSSSSSSSSSSRRRRRSSSSSSSSSSRRRRRRRRSSSSSSRRRSRRSSSSRRRSSSSSRRRRRSSSSSSSSRRRRRRRRSSSSSSSRRRRRRRRRSSSSSSSSSSRRRRRRRRRRSSSSRRRRRRRRSSSSSRRRRRRRRSRSSRSRRRRRRRRSSSSSSRSRRSRRRRRRRRSSSSSRRRRSRRRRRRSSRSRRSSSS ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 2522222255255255255525522222222222222225255552525555222222222222255552222222225525252525222222222255525555252222222222222555252525255222222222225552222222555252522222222255525222222225255555252222222255555525255552222255555552525222222225222552555555252222525222225525252555525522222255525525555555252255255522525555555552222552555252555555552522255525252522222222222222555222255222522555

EXEEXECUTIVE

PRESIDDENTENT:: DerD ek Pingel

VICE PRESIDENT:T MicMichel Mouglalis

CHAIRMAN CONSTRUCTTIONION: GleGlenn RasR hhleigh

CHAIRMAN HOUSING: Ralf Dutton

TREASURER: Rick Burns

EXEXECUTUTIVE MEMBERS:

MarMa tin Brookke,e Johhn Gn Gaskaskiin andd KaKathythy SeSeamaam n

EXECUTIVE DIRDIRI ECTECTECTCTTOR:OR:OR:OR:OR: GGraGraGraGrahamhamhamham CuCuCuCuuthbthbthbthbthberterterterte

COUCOUCOUCOUNCINCINCINCILLOLLOLLOLLORSRSRSRS

GenGenGenGeneraeraeraeral:l:l:l: JoJoJoJohn hn hn hn KirKirKirKirkwokwokwokwood,od,od,od, LaLaLaLawriwriwriwrir e De De De Dorèorèorèorè,, , ,

PauPauaul Bl BBoddoddddoddiingingingn tontontonoonton GG, G, G, Garrarrarrarra y Ry Ry Ry Ryy ossossossosssow,ow,ow,ow,ow, ErErErErE rolrolrolrolo EdEdEdEdwarwarwarwarwards,ds,ds,dsdsds,

TomT m BBrBB ownwnownno nnn L, Lewiewis Ss Saraarrrar gosgg si,i NiNickck HerHerronron,

Don Closeeee, CChriis Es Evanvannnnss

Farrrrr Northhhh QuQuQuQueene slaaannnd:ndndnd: GaGary r RiRiccchehhees

GolGGold Cd Cd Cd Cdd CCoasoasoassoassoasst:t:t:t:t: ShShShaneaanea SuSuuuummmmemmem rsr

SunSu shihish neee CCCoaCo st:tt: RiRiccckkk BBurBB ru nsn

GymGympiepiepiepi :: TrTTTrrrevoevovor Nr Nr obbbbbbbs (s s ObsObservver)er)er)er)r)er)e

DoDDowDowDoDo ns ns & WWW& WWestestesternernern::: LeLLeeLeLeaannnneeee Ge Ge illillamamm

BurBurBurBurrrrrnetnnetn t WWWWt WWidedeid BaBaaay: y: y: y:y: y DesDDeeDesDDD BoBooooBoowweswesw

CenCenCenCennnntratraaatraattt l QQl Ql Ql Ql Queeuee lnslnslnslandanandanda ::: BBrrrBrrettett LoLouttuttttiiittiittit

NorNorNorNorthth th th QQueQueQueensensen lanla d: : MaMaararaMaa tintin BrBrookoookokoko ee

MacMacMacMackaykakaykayy:: GeGeeGeoff off off o BaBaBagggulggululeyeyyyy

InsInsInsIn tittittitti utuuteute ofofofofo BuBuuildildingngnginggngg CoCoCCoCoCoConsunsunsunsultatltaltantsntsntsntsnts::::: MiMiMike ke ke DececDeDecmanmann

DIVDIVDIVVDIVISIISIIISIONAONAONONAL CL CCHAIHAIHAIRMRMMERMEMMEENNNNN

GolGolGolG d Cd Cd Cd Coasoasoaoa t: M.M MoMoMooMoMooMoMoMM uuugluuuuuuu alililiiiisssssss

SunSunSunshishishishhinenene ne CoaCoaast:st:s DD.. Robinsooononoon

DowDowDowwnsns ns ns ns & W& W& Westestesternerner : R.R.R.R.RR WeWeW ymoymoutututhuthututu

BurBurBurrnetnetnett Wt Wt Wt Wideideide BaBaBay:y: y: P.P SomSomSSomS mermerfi efieldlddddddd

Centratr l Qld: B. Louttit

MacMackaykay: G. BeB ll

North QQueensslanland: D. ReReevevess

FarFar NoNorth Queensland: K.K GrGrossossmanm

BRARANCH CHAIRMEN

Beaudeudesersert: GG. RaiRaine

Bundaberg: A. Murchrchie

Gympie: R. Salmon

Hervey Bay: R. Gatt

MarMarMaMarMa yboyboy rourough:gh: PP. SoSommemmerfefeldld

GlaGlaGlaGlaGladstdstdstdstdstoneoneoneoneeone:::::: CC.CCC ChC ristensenenenenen

CenCenenCenCentratratratratral Hl Hl Hl Hl Hl Highighighighighighlanlanlanlanlanlands:ds:dsds:ds: JJJJ.J GrGGrGrGrGrillillillllillllmeimeimeimeimeimeiererererererr

YepYepYepYepYepYeppoopoopoopoopoopoon:n:n:n:nn:n:n TBTBTBTBTBT AAAAAAAA

WhiWhiWhiWWWhitsuttsutttsuts ndandandanday:y:y TBTBTBAAA

TulTullly-Misissiosioosiosioioion Bn Bn Bn BBeaceaccaceach:h:h:h:h: CC.CCCC.CCCCC WaWaWaWaWatttttttttttttttt

IInnInnInnInnnnisfsfisfsfisffailailailailailai ::::: TBATBATBATBAT

TabTabTabTablelleleelelandandandands:s D. PPPPoPogggiolii

DIVDIVISIISISSIS ONSO

InsInssInsInstittittt uteuteuteeute of BuBuiildinng CoCoCoCoCCoCoCC nsunsnsultatataantsntsnts::

M.M. MM. DecDecDDecDecDecmanmamanmanamanm (C(C(C((C( haaiaa rmaman),), E.E.EE.E. PiPiP ckeckekeekerinrinrinrinrinr g, ggggg T. T. T. BetBetBetBettttteridgge,

CC. .C. FriFF tz,z,tzz G.G. BaBarloloor www,ww W. W. MMMouuoouM ultoltoltoton Hn Hn Hnn . C. CCCCChhrihhhh stst t

ConConnConoo venenor:or:oo TTT. MiiMM tchhelle

COMCOMCOMOCOMCOMMITMITMITMITTMITTEETEETEEEEEESSSSS

Indndn uststriarial Rl RRelaelael tioions: C.C Beeeech,ch, B.B RyRyR an,an, J. RuRuRuuuss,ss,ssss,ss,ss,ss

PPP. P. RyaRRyaRy n, n, n PP.PPP. P CorCoCCorCorCorCororcorcorcorcorcorcocoro anananananan,an,an, MMMMM.M.MMM WWWWyWyWyWyW attattatt, M, MM P. PPlumluml mermer,

D.D. D. D. D. VinVinVinnVinVincecencencecencene zizizinziniz o, o, D. D. D. DovDovDove, e, e, e, C. C. CC TomTomlinlinsonson

ConConvenvenor:or M.MM.M BeBeBelfi lfi lfilfi eldeldeldeld

Contracts: N..NN HerHerHerHe ronronronron (C(C(C(Chaihhaih rman), P. Boddidd ngtngn on,onon,

R. R FarFFara doudodoulys, RRRR. H. H. HHallallallal , N, N, N. H. HH. Harraaa is,is,, C. Nash, M. M.M. RosR zkakazkak ,,

J. TayTayTaylor, A, A. SSSnednednedddondondondon, CCCC. WWW. Wooloolo nounough,gh,gh,gh M.M.M KiKiKilpalpalpatritritrit ck ck ck k

ConConConoC venvevee or: J. Pououultntltnltneyeyy

Construction: G. Rashleigh (h (Chairman), S. Coole,

S. Hawkins, N. Herron, C. Evaans, J. Kirkwood,od,

A. Moore, P. Veale, E. Edwardds, G. Muir, DD. GGrehrehan,,

G. G Henderson, J. Palmer Convennor:or: J. J CriCr ttaall

Housing: R. Dutton (Chairman), R. BBurnu s,

A. DaDawson, D. Dawson, L. Doré, D. Haaighig , B. Hilder,

L.L. Mizikoikovskvsky, y, PP. NewNewcomb, H. Van RiRieel, D. Werner,

A. A WilWillialiams ms Convenor: PP. BidBidwelwelll

HeaHealthlth && Safety: A.A. CamCampbell (chairmanmanananan)),),),),), PP.P.PP.P. AdaAdaAdaAdaAdaAdams,msms,ms,ms,msm

M. Houston, D.D. ShaShaharryrryrryrryrryyy,,,,, MM.M.M.M.M. PolPolPolPolPoloPolPo itoitoitoitoitoitoitot ,,,,,, B.B.B.B.BBBB. LewLewLewLewLewLewLewe is,is,is,is,is,is, T.TT.TT.T LloLloLloLloLloLloLloyd,yd,yd,yd,ydyd,yd,

JJ.JJ.J McPMcPMcPMcPMcPcPMcPMcPherherherherherherheh sonsonsonsonsonsonsonn,,,,,,,, S.S.S.S.S.S. MoeMoeMoeMoeMoeMoeMoeMoeheaheaheaheaheaahead,d,d,d,d,d, R.R.R.R.R.R ThiThiThiThiThiThiessessessessessess,,,,, J.J.J.J.JJ. TaiTaiTaiTaiTaTaiTaiit,t,t,t,tt,t R.R.R.RRR WilWWiWilWWilWillsolsolsolsolsososonnn n nn

ConConConConConCononvenvenvenvenvenvenor:or:or:or:or:or:o S.S.SS.S.S.KinKinKinKinKinKingggggg

EnvEEEEEnviroronmenment:nt: GG. RoRRobinbinsonsoson (c(chaihairmarmarman)n)n),

P. PPPPPP. P AndAndndAndAnderserserson,onon, SS.SSS.SS DaDaDaD wwwooowww d, S.. KKorK ecki, , TT.TT Lloyd,d,

BB. BB.B.. LodLodge,ge,ge,,g , T.T. PPlPPlP antant, T, T. C. Cartaa tter,er,er,er,eer,

BB. B. WatWWWWatatkinkininnsss.. CCoonoonvenvenooooor:r:r S.SS. WhWWhWhite

RRReReReeenovovatorororrs: ::s:: ss: A. Dawawwwwwwsonsonsson (CCChaihaih rmarman),n),, M.M. CaCatchtccchhtchpolpole,e,

PPP. P. P. GobGobbbiee, M, M, MM.. Q.. . uirkk,, MMMMM. M PatPatPaatersererson,on I.I. JeJeensensen, , AAAAA. A. AAA GolGolléé,

MMMM. DorDooré,, , S. S. CCeeeedeCee ergrreeeeennnr . ConConononvenvvenvee oror:or PPPPPP. BreBreBreBB ezeezeeeeze

MasMMaMMMasMastertertt BuBuBuuBuildildildddildders Foooooundundundundundattatiatiatit on:on:

MM. MMM. MouMouMouMouM glaglaglaglaglalilislisislislis (CC(C((C(C(Chaihahaihaihaiahairmarmarmarmarmarmrmarmrm n))n)n)n),)n),n)n),) D.DDD.D PiPiPiiPPiPiingeengengegengngengengeg llll, l,,,,

KKKKK. K. SSSeaSeaSSeamanmanmanmanman, P, PP, PPP. H. HHH. Hoiboiboiboiboiboibergergergergergerg PPP, PP, P, P, PP, P PPPP. P. . P. P. P. Purcurcurcurcurcurcurccellellellellellellelellellelle ,,,, ,

Q. Q. GooGoodwidwin (n (ComCompanpanny Sy Sy Sececrecretatetaary)ry)ry)))

Committees as at 30 June 2011


FINANCIAL STATEMENTS

STATEMENT OF COMPREHENSIVE INCOME Year ended 30 June 2011

Notes 2011

$

2010

$

Revenue from continuing operations 2(i) 16,744,230 17,457,449

Other income 2(ii) 713,856 556,109

Employee expenses (9,320,306) (9,166,545)

Depreciation and amortisation expense (779,040) (635,427)

Printing stationery & postage expenses (583,226) (616,531)

Occupancy expenses (484,708) (441,026)

Other expenses 3(i) (4,992,900) (6,273,576)

Surplus before income tax expense 1,297,906 880,453

Income tax expense – –

Surplus for the year 1,297,906 880,453

Other comprehensive income

Net gain/(loss) on revaluation of investment portfolio 4,499 335,817

Total comprehensive income for the year 1,302,405 1,216,270

The accompanying notes form an integral part of these fi nancial statements.


STATEMENT OF FINANCIAL POSITION As at 30 June 2011

Notes 2011

$

2010

$

Current Assets

Cash and cash equivalents 4 7,351,147 5,049,974

Inventories 175,225 222,448

Trade and other receivables 5 1,483,847 1,287,537

Other current assets 6 116,658 98,081

9,126,877 6,658,040

Non-Current Assets

Investment portfolio (Available-for-sale fi nancial assets) 3,792,327 4,637,259

Property, plant & equipment 7 23,751,275 23,159,226

27,543,602 27,796,485

Total Assets 36,670,479 34,454,525

Current Liabilities

Trade and other payables 8 6,387,438 5,588,311

Short-term provisions 9 (i) 38,182 38,482

6,425,620 5,626,793

Non-Current Liabilities

Long-term provisions 9 (ii) 518,666 403,944

518,666 403,944

Total Liabilities 6,944,286 6,030,737

Net Assets 29,726,193 28,423,788

Equity

Reserves 10,350,897 10,346,398

Retained profi ts 19,375,296 18,077,390

Total Equity 29,726,193 28,423,788



STATEMENT OF CHANGES IN EQUITY Year ended 30 June 2011

RETAINED

PROFITS

$

ASSET

REVALUATIONLand and buildings

$

ASSET

REVALUATIONInvestments

$

TOTAL

$

Balance at 1 July 2009 17,196,937 10,102,716 (986,706) 26,312,947

Net surplus for the year 880,453 – – 880,453

Impairment loss of available-for-sale fi nancial

assets recognised in profi t and loss – – 894,571 894,571

Other comprehensive income – – 335,817 335,817

Balance at 30 June 2010 18,077,390 10,102,716 243,682 28,423,788

Net surplus for the year 1,297,906 – – 1,297,906

Other comprehensive income – – 4,499 4,499

Balance at 30 June 2011 19,375,296 10,102,716 248,181 29,726,193


STATEMENT OF CASH FLOWS Year ended 30 June 2011

Notes 2011

$

2010

$

Cash fl ows from operating activities inclusive of GST

User charges 19,451,773 20,319,707

Interest and dividends received 490,913 448,201

Payments to suppliers and employees (17,096,501) (18,024,190)

Net cash infl ow (outfl ow) from operating activities 15 2,846,185 2,743,718

Cash fl ows from investing activities

Proceeds from disposal of assets 198,772 99,519

Proceeds from sale of listed investments 2,646,491 881,625

Payments for property, plant & equipment (1,733,754) (370,420)

Payments for purchase of listed investments (1,656,521) (1,415,476)

Net cash infl ow (outfl ow) from investing activities (545,012) (804,752)

Net increase/(decrease) in cash held 2,301,173 1,938,966

Cash and deposits at beginning of fi nancial period 5,049,974 3,111,008

Cash and deposits at end of fi nancial period 4 7,351,147 5,049,974


FINANCIAL STATEMENTS


Note 1: Summary of Signifi cant Accounting Policies

The fi nancial report is a special purpose

fi nancial statement that has been

prepared for distribution to the Members

to fulfi l the Executive Committee’s

fi nancial reporting requirement

under the Association’s constitution.

The report has been prepared in

accordance with the requirements of

the Industrial Relations Act 1999 (Qld)

and the recognition and measurement

requirements of the Australian

Equivalents to the International Financial

Reporting Standards (AIFRS), and the

disclosure requirements of the following

Australian Accounting Standards:

• AASB 101 Presentation of Financial

Statements;

• AASB 107 Cash Flow Statements

• AASB 108 Accounting Policies,

Changes in Accounting Estimates

and Errors;

• AASB 110 Events after the Balance

Sheet Date;

• AASB 1031 Materiality; and

• AASB 1048 Interpretation and

Application of Standards.

No other Accounting Standards,

Accounting Interpretations or other

authoritative pronouncements of

the Australian Accounting Standards

Board have been applied. The fi nancial

report covers QUEENSLAND MASTER

BUILDERS ASSOCIATION INDUSTRIAL

ORGANISATION OF EMPLOYERS as an

individual entity. QUEENSLAND MASTER

BUILDERS’ ASSOCIATION INDUSTRIAL

ORGANISATION OF EMPLOYERS is an

Association incorporated in Queensland

under the Industrial Relations Act 1999

(Qld).

The fi nancial statements have been

prepared on an accruals basis and are

based on historical costs modifi ed,

where applicable, by the revaluation of

selected non-current assets and fi nancial

assets for which the fair value basis

of accounting has been applied. The

fi nancial statements are presented in

Australian dollars, which is QUEENSLAND

MASTER BUILDERS’ ASSOCIATION

INDUSTRIAL ORGANISATION OF

EMPLOYERS functional and presentation

currency.

The following is a summary of the

material accounting policies adopted

in the preparation of the fi nancial

statement. The accounting policies

have been consistently applied, unless

otherwise stated.

Income Tax

The activities of the Association are

exempt from income tax pursuant to sec

50.15 of the Income Tax Assessment Act

1997.

Inventories

Inventories are measured at the lower of

cost and net realisable value. Costs are

assigned on a fi rst-in fi rst-out basis.

Revenue

Revenue of the Association includes

membership subscriptions, commissions

from insurance premiums & third party

telecommunications services, course fees

for the provision of training courses and

proceeds from the sale of documents,

signs & advertising.

Subscription revenue is recognised

progressively over the subscription

period. Course revenue is recognised

at the time of raising the invoice

which is within thirty days of course

commencement. Other income is

recognised when the service is

provided.

Available-for-Sale Financial

Assets

Available-for-sale fi nancial assets

comprising managed funds operated by

professional fund managers are classifi ed

as non-derivatives that are not classifi ed

in any of the other investment categories.

Purchases and sales of available-for-

sale fi nancial assets are recognised on

trade-date – the date on which the

Association commits to purchase or sell

the asset. The asset is initially recognised

at fair value and subsequently carried

at fair value. Unrealised gains and losses

arising from changes in the fair value

are recognised in equity in the asset

revaluation reserve. When securities are

sold or impaired, the accumulated fair

value adjustments are included in the

statement of comprehensive income as

realised gains and losses.

Fair Value Estimation

The fair values of available-for-sale

fi nancial assets are based on unit prices

at the time of valuation provided by the

professional fund managers.

Impairment

At the end of each reporting period,

the Association assesses whether there

is objective evidence that a fi nancial

instrument has been impaired. In the

case of available-for-sale fi nancial

instruments, a prolonged decline in the

value of the instrument is considered to

determine whether an impairment has

arisen. Impairment losses are recognised

in the statement of comprehensive

income.

Held-to-Maturity

Held-to-maturity investments are non-

derivative fi nancial assets that have fi xed

maturities and fi xed or determinable

payments, and it is the entity’s intention

to hold these investments to maturity.

They are subsequently measured at

amortised cost.

Held-to-maturity investments are

included in non-current assets, except

for those which are expected to mature

within 12 months after the end of the

reporting period.

Property, Plant and Equipment

Each class of property, plant and

equipment is carried at cost or fair value

as indicated, less, where applicable,

any accumulated depreciation and

impairment of losses.

Freehold land and buildings are shown

at fair value based on periodic, but at

least four yearly valuations by external

independent valuers, less subsequent

depreciation for buildings. Increases

in the carrying amounts arising on

revaluation of land and buildings are

credited to the asset revaluation reserve

in equity. Decreases that off set previous

increases of the same asset are charged

against reserves directly in equity; all

other decreases are charged to the

statement of comprehensive income.

Any accumulated depreciation at the

date of revaluation is eliminated against

the gross carrying amount of the asset

and the net amount is restated to the

re-valued amount of the asset.

NOTES TO THE FINANCIAL STATEMENTS Year ended 30 June 2011


All other property, plant and equipment

are measured on cost basis.

Property, plant and equipment, other

than freehold land, are depreciated over

their expected useful lives. Acquisitions

prior to 1 July 2007 were depreciated

using the diminishing value method.

Assets purchased post 1 July 2007 are

depreciated using the straight line

method. Where an asset’s life is not

expected to greatly exceed twelve

months, or expenditure is of a minor

capital nature, less than $1,000, it is

written off and not capitalised. Gains

and losses on disposals are determined

by comparing proceeds with the

carrying amount. These gains or losses

are included in the statement of

comprehensive income. When revalued

assets are sold, amounts included in the

revaluation reserve relating to that asset

are transferred to retained earnings.

Other Operations

The Association administers a bank

account on behalf of QMBA Insurance

Agency that is not included in the

fi nancial statements for the year: The

account was established to hold

insurance premiums received, pending

disbursement to insurers in accordance

with agreements with insurers. The

balance at 30 June 2011 was $678,222

(2010: $765,159)

The Association administers various

building display villages. As at 30 June

2011, net funds of $637,349 (2010:

$539,130) were held on behalf of display

village builders, pending expenditure on

promotion and administration costs. This

is recognised as a current liability.

There are two items on the Statement

of Financial Position that are included

in both “Cash at Bank - Restricted” and

“Other Payables and Accruals”. These

items are:

a) an amount of $1,398,824 (2010:

$853,534) representing funds

administered by the Association

on behalf of parties involved in

arbitration, and

b) an amount of $90,000 (2010: nil)

representing holding deposits made

by Display Village builders against

failures to complete contracts.

Employee Benefi ts

Provision is made for the Association’s

liability for employee benefi ts arising

from services rendered by employees to

balance date. Employee benefi ts that are

expected to be settled within one year

have been measured at the amounts

expected to be paid when the liability is

settled, plus related on-costs. Employee

benefi ts payable later than one year have

been measured at the present value of

the estimated future cash outfl ows to be

made for those benefi ts.

Long service leave is accrued in respect

of all employees with more than 6 years’

service.

Provisions

Provisions are recognised when the

Association has a legal or constructive

obligation, as a result of past events, for

which it is probable that an outfl ow of

economic benefi ts will result and that

outfl ow can be reliably measured.

Cash and Cash Equivalents

Cash and cash equivalents include

cash on hand, deposits held at call with

banks, other short-term highly liquid

investments with original maturities of

three months or less. The Association

does not have a bank overdraft.

Critical Accounting Estimates and

Judgements

Other than accruals and provisions there

are no critical accounting estimates.

Adoption of New and Revised

Accounting Standards

During the current year the Association

has not needed to adopt any new or

revised Australian Accounting Standards

and Interpretations applicable to its

operations which became mandatory.

New Accounting Standards for

Application in Future Periods

The AASB has issued new and amended

accounting standards and interpretations

that have mandatory application

dates for future reporting periods. The

Association has decided against early

adoption of these standards. These

amendments are not expected to

signifi cantly impact on the Association.

Reserves

The asset revaluation reserve records

revaluations of Land and Buildings and

unrealised gains and losses on available-

for-sale investments.

Capital Management

Management controls the capital of the

company in order to maintain a good

debt to equity ratio and to ensure that

the company can fund its operations

and continue as a going concern. There

are no externally imposed capital

requirements.

Comparative Figures

Where necessary, comparative fi gures

have been adjusted to conform to

changes in presentation in the current

year.


2011

$

2010

$

2. REVENUE

i) Revenue from continuing operations

Membership subscriptions 5,700,689 5,615,912

Course & training income 2,282,873 2,763,782

Commissions income 6,192,585 6,308,360

Awards night income 680,775 667,995

Publications income 225,795 223,655

Display village income 69,928 118,722

Document sales income 736,539 746,500

Other income 855,046 1,012,523

16,744,230 17,457,449

ii) Other Income

Interest and dividends received 500,646 416,495

Profi t/(loss) on sale of assets 32,390 (78,250)

Rent received 180,820 217,864

713,856 556,109

3. SURPLUS INCLUDES THE FOLLOWING NET GAINS AND EXPENSES

i) Other Expenses

National levy and affi liation costs 479,244 435,000

Consultancy costs 381,932 448,951

Travel & accommodation 345,499 294,290

Telecommunications 460,071 451,900

Other expenses of operating activities 971,499 862,954

Training assessment expenses 933,366 1,515,186

Sponsorship & events expenses 1,122,609 1,040,293

Documents costs 242,935 282,250

Realised losses available-for-sale fi nancial assets – 48,181

Impairment of assets 55,745 894,571

4,992,900 6,273,576

ii) Net (gains)/losses

Net gain/(loss) recognised in the Statement of Comprehensive

Income on the:

Disposal of available-for-sale fi nancial assets 140,539 (48,181)

Disposal of plant & equipment (108,149) (78,250)

32,390 (126,431)

NOTES TO THE FINANCIAL STATEMENTS Year ended 30 June 2011


2011

$

2010

$

4. CASH AND CASH EQUIVALENTS

Cash on hand 6,150 6,000

Cash at bank 2,125,102 1,970,094

Cash at bank – call deposit 1,713,133 530,696

Cash at bank – term deposits 2,017,938 1,689,650

5,862,323 4,196,440

Cash at bank – restricted 1,488,824 853,534

Total cash and cash equivalents 7,351,147 5,049,974

5. TRADE & OTHER RECEIVABLES

Trade debtors 1,541,840 1,356,403

Less provision for doubtful debts (142,175) (133,928)

Other debtors 84,182 65,062

1,483,847 1,287,537

6. OTHER CURRENT ASSETS

Tenancy security deposits 5,738 11,288

Prepayments 110,920 86,793

116,658 98,081

7. NON-CURRENT ASSETS – PROPERTY, PLANT & EQUIPMENT

Land – at valuation

Freehold land at independent 2008 valuation 11,245,000 11,245,000

Buildings – at valuation

Buildings at independent 2008 valuation 7,775,000 7,775,000

Provision for depreciation (336,486) (224,324)

7,438,514 7,550,676

Land & buildings – at cost

Land & buildings at cost 3,812,202 2,658,712

Provision for depreciation (108,732) (67,403)

3,703,470 2,591,309

Building improvements – at cost

Building improvements 50,311 48,223

Total land & buildings 22,437,295 21,435,208

Plant & equipment at cost

Plant & equipment 3,432,637 3,726,952

Provision for depreciation (2,118,657) (2,002,934)

Total plant & equipment 1,313,980 1,724,018

Total written down value 23,751,275 23,159,226

The revaluation of all freehold land and buildings, except Townsville building, is on the assessment of the market

value of freehold land and buildings based on the independent revaluation in June 2008 by Herron Todd White. The

Townsville property was valued in April 2008 by Andrew Acton of Harcourts.


7. NON-CURRENT ASSETS – PROPERTY, PLANT & EQUIPMENT

CONTINUED $

2010

$

Land & buildings

at valuation

$

Land & buildings

at cost

$

Plant & equipment

at cost

$

Net Book Value as at 1 July 2009 18,907,837 2,671,619 2,022,547

Assets acquired during the year – 3,363 367,056

Assets disposed during the year – - (177,769)

Amortisation/Depreciation charged

during the year(112,161) (35,450) (487,816)

Net Book Value as at 30 June 2010 18,795,676 2,639,532 1,724,018

Net Book Value as at 1 July 2010 18,795,676 2,639,532 1,724,018

Assets acquired during the year – 1,211,322 522,432

Assets disposed during the year – – (306,921)

Impairment of Asset – (55,744) –

Amortisation/Depreciation charged

during the year(112,162) (41,329) (625,549)

Net Book Value as at 30 June 2011 18,683,514 3,753,781 1,313,980

8. TRADE AND OTHER PAYABLES

Trade payables 519,619 586,084

GST payable 206,689 225,267

Advance billings 2,138,370 1,894,742

Other payables and accruals 1,971,221 1,471,661

Display Village creditors 637,349 539,129

Short-term employee benefi ts 640,751 612,192

Income in advance 273,439 259,237

6,387,438 5,588,311

Trade creditors are generally settled within 30 days. The Executive Committee members consider that the carrying

amounts of trade and other accounts payable approximate their net fair values.

9. PROVISIONS

i) Short-term provisions

Qld Construction Industry Forum 38,182 38,482

ii) Long-term provisions

Employee benefi ts and related on-costs liabilities 518,666 403,944

10. CONTINGENT LIABILITIES

There were no contingent liabilities as at 30 June 2011 (2010: nil).

11. COMMITMENTS FOR EXPENDITURE

i) Capital commitments

Not later than one year 148,000 1,150,000

ii) Operating leases

Commitments for minimum lease payments in relation to non-

cancellable operating leases are payable as follows:

Not later than one year 121,116 165,106

Later than one year but not later than fi ve years 126,947 110,876

248,063 275,982


12. EVENTS AFTER THE BALANCE SHEET DATE

Since the end of the fi nancial year the Association has sold a property at Harvey Street, North Mackay.

13. REMUNERATION AND RETIREMENT BENEFITS

Executive Committee member fees

No Executive Committee member is entitled to any compensation for their services during the fi nancial year.

The names of Councillors who have held offi ce during the fi nancial year:

D Pingel (President); M Mouglalis (Vice President); R Burns (Treasurer); R Dutton (Chairman Housing Sector Committee);

G Rashleigh (Chairman Construction Sector Committee); J Gaskin; K Seaman; M Brooke; L Dore’; E Edwards; T Brown;

L Saragossi; D Bowes; G Rossow; L Gillam; N Herron; S Summers; G Riches; J Kirkwood; D Close; T Nobbs; P Boddington;

P Ward; B Louittit; G Baguley; M Decman.

14. REMUNERATION OF AUDITORS

During the year the following fees were paid or payable for services provided by the auditor

Audit and review of fi nancial reports – Bentleys 24,972 28,000

Audit and review of Financial Services Licence – Bentleys 3,000 2,750

27,972 30,750

15. RECONCILIATION OF SURPLUS TO NET CASH FLOW FROM OPERATING ACTIVITIES

Net surplus/(loss) for the year 1,297,906 880,453

Depreciation and amortisation 779,040 635,427

(Gain)/loss on disposal of non-current assets 23,354 1,021,002

(Increase)/decrease in trade and other debtors (214,888) 85,179

Increase/(decrease) in provisions 142,982 106,874

(Increase)/decrease in inventories 47,223 17,265

Increase/(decrease) in trade and other creditors 770,568 (2,482)

Net cash infl ows from operating activities 2,846,185 2,743,718


Statement by Treasurer

In relation to the attached accounts of the Association, I hereby

certify that the Association had 7,326 (2010: 7,839) members

and 1,917 (2010: 2,529) registrants all of whom are fi nancial as at

30 June 2011 and that in my opinion:

1. the accounts prepared in accordance with section 555 of the

Industrial Relations Act 1999 (Qld) show a true and fair view of 9

transactions for the fi nancial year and the fi nancial position of

the Association as at the end of the fi nancial year;

2. a record has been kept of all moneys paid by, or collected

from, members of the Association and all moneys so paid

or collected have been credited to the bank account or

accounts to which those moneys are to be credited, in

accordance with the rules of the Association;

3. before any expenditure was incurred by the Association,

approval of the incurring of the expenditure was obtained in

accordance with the rules of the Association;

4. no payment was made out of a fund referred to in Schedule 5

of the Industrial Relations Regulations 2000 Qld (section 45).

No such fund was operated;

5. no loans or other fi nancial benefi ts were granted to persons

holding offi ce in the Association;

6. the register of members of the Association was maintained in

accordance with the Industrial Relations Act 1999 (Qld).9

Martin Brooke, Treasurer 9 September 2010

Certifi cate in Relation to Documents

I hereby certify that the foregoing documents, being accounts

and notes thereto, and statements and reports in relation to

the fi nancial year ended 30 June 2011, are copies of the

documents presented to the Annual General Meeting of the

Association for 2011.

Derek Pingel, President 9 September 2010

Certifi cate in Relation to Documents

Attention of the members is drawn to the following provisions

of Part 12 Division 2 Section 556 of the Industrial Relations Act

1999 (Qld) in relation to “prescribed information” – as listed in

Division 2.

1. A member of an organisation may apply to the organisation

for information that it must, under a regulation, give its

members.

2. An application may be made by the registrar for a member.

3. The organisation must give the member or, if the registrar

applied for the member, the registrar, the information

applied for in the way prescribed under a regulation.

4. If the information is given to the registrar, the registrar must

give the information to the member for whom the registrar

made the application.

Statement by Executive Committee of Management

The Executive Committee of the QUEENSLAND MASTER

BUILDERS ASSOCIATION INDUSTRIAL ORGANISATION OF

EMPLOYERS has determined that the Association is not

a reporting entity and that this special purpose fi nancial

statement should be prepared in accordance with the

accounting policies described in Note 1 to the fi nancial

statements. They are also of the opinion that the fi nancial

statements:

1. give a true and fair view of the fi nancial position of

QUEENSLAND MASTER BUILDERS ASSOCIATION INDUSTRIAL

ORGANISATION OF EMPLOYERS as at 30 June 2011 and of its

performance, as represented by the results of its operations

and its cash fl ows for the fi nancial year ended on that date;

2. at the date of this statement, there are reasonable grounds

to believe that the Association will be able to pay its debts

as and when they become due and payable;

3. the meetings of the Executive during the year were held in

accordance with the constitution of the Association;

4. during the fi nancial year, there have been no instances

where records of the Association or other documents,

or copies of records or documents, or copies of the

constitution of the Association, have not been furnished

or made available to members in accordance with the

Industrial Relations Act 1999 (Qld), or the constitution of the

Association;

5. the Association has complied with section 566 of the

Industrial Relations Act 1999 (Qld) in relation to the provision

of copies of the accounts and statements to members, and

to the presentation of the accounts and statements to a

general meeting of members as required by section 565 of

the Act;

6. the accounts and statements for the fi nancial year have

been prepared in accordance with Section 555 of the Act

and with applicable Australian Accounting Standards as

detailed in Note 1: Summary of Signifi cant Accounting

Policies.

This statement is made in accordance with a resolution of the

Executive Committee and is signed for and on behalf of the

Executive Committee by:

Derek Pingel, President 9 September 2011

Martin Brooke, Treasurer 9 September 2011


Report on the Financial Report

We have audited the accompanying fi nancial report of

Queensland Master Builders’ Association Industrial Organisation

of Employers, being a special purpose fi nancial report, which

comprises the statement of fi nancial position as 30 June 2011,

the statement of comprehensive income, statement of changes

in equity and statement of cash fl ows for the year then ended,

notes comprising a summary of signifi cant accounting policies

and other explanatory information and the statements by the

Executive Committee.

Executive Committees’ Responsibility for the

Financial Report

The Executive Committee are responsible for the preparation

and fair presentation of the fi nancial report in accordance

with Australian Accounting Standards and have determined

that the accounting policies described in Note 1 to the

fi nancial statements which form part of the fi nancial report

are appropriate to meet the fi nancial reporting requirements

and are appropriate to meet the needs of the members. The

Executive Committee are also responsible for such internal

control as the Executive Committee determines is necessary to

enable the preparation of the fi nancial report that is free from

material misstatement, whether due to fraud or error.

Auditor’s Responsibility

Our responsibility is to express an opinion on the fi nancial

report based on our audit. We conducted our audit in

accordance with Australian Auditing Standards. Those standards

require that we comply with relevant ethical requirements

relating to audit engagements and plan and perform the audit

to obtain reasonable assurance about whether the fi nancial

report is free from material misstatement.

An audit involves performing procedures to obtain audit

evidence about the amounts and disclosures in the fi nancial

report. The procedures selected depend on the auditor’s

judgement, including the assessment of the risks of material

misstatement of the fi nancial report, whether due to fraud or

error. In making those risk assessments, the auditor considers

internal control relevant to the entity’s preparation of the

fi nancial report that gives a true and fair view in order to design

audit procedures that are appropriate in the circumstances,

but not for the purpose of expressing an opinion on the

eff ectiveness of the entity’s internal control. An audit also

includes evaluating the appropriateness of accounting policies

used and the reasonableness of accounting estimates made by

management, as well as evaluating the overall presentation of

the fi nancial report.

We believe that the audit evidence we have obtained is

suffi cient and appropriate to provide a basis for our audit

opinion.

Independence

In conducting our audit, we have complied with the

independence requirements of the Australian professional

ethical pronouncements.

Opinion

In our opinion the fi nancial report presents fairly, in all material

respects, the fi nancial position of Master Builders Queensland as

at 30 June 2011 and its performance for the year then ended in

accordance with Australian Accounting Standards to the extent

described in note 1.

Basis of Accounting

Without modifying our opinion, we draw attention to note 1 to

the fi nancial report, which describes the basis of accounting.

The fi nancial report has been prepared for the purpose

of fulfi lling the Executive Committees’ fi nancial reporting

responsibilities under the Industrial Relations Act 1999 (Qld). As

a result, the fi nancial report may not be suitable for another

purpose.

Bentleys Brisbane (Audit) Pty Ltd

Chartered Accountants

P M Power

Director

Dated this ninth day of September 2011Brisbane

Independent Auditor’s Report to the Members

FINANCIAL STATEMENT

2010 HOUSE OF THE YEAR

Braeden Constructions Pty Ltd

PePerched high on Cooroy Mountain on the Sunshine Coast, the House e e ofofoffffff tttttttttthhehehehehehehehehe YYYYYYYYYYeaeaeaeaeaeaeaeaearrrrrrrr wwwwwwwinininniinnnenenenener r rr r rr r bybybybybybybyybybyby rrrrrr

BrBraededen CoConsnstrtrucu titionns isis an amamamamammammamazazazaazazazzaaaza inininininininiiningggggggg papapapapapapappapa ivivivivivivvivivililililillilililionononononononononoon-sstytylele hhomomee ththatatt rrepepepepepepepepeepeeepeppprererererereererrrereeseseseseseseseseseeeennntntntntntntntntntnn ssssssss opopopopopopopululululululululeneneneenenenenenttttttt ttt lililililillliilil viviviviviviviv ngngng aaattt ititittss

beststststststststtttt..... WWiWiWiWiWiWiWiWiWWWWithththththththhhthth sssssssssswewewewewwwweweweewweweepepepepepepepepepininininininininnggggggggg cucucucucucucuc rvrvrvrvrvrvedededededededdddddded llllllllininninininininesesesesesese aaaaaaaaandnddndndndndnd aaaaaaa bbbbbbbbbbbririiriiririririlllllllllllllllliaiaiaiiaiaiantntntntntntntntttnt cccccccccccccceeenenee trtralal ffffffffffocoocococococococococoococcaaalalalalallalalaa ppppppppooioioiiintntntntntntn fffffffffeaeaeaeaeaeaaaaatututututtuttut riringngng aaaaaaa rrrraaiaiaia sseseeeddddd gogoggggoururmemeett

kitchen ovovovovovovovooovovovvovovvvvvererereereeereererrlololololololoolookookkinninggg a a susunknkkknkknkkenenene llllllououououngngngngngnggee,ee,e,,, eeeextxtttxttxtxx enenenenenene sisssisisivevevevevvvvvvvvev sssssssititititittingnnngng a dddddddnd dddddddddddddinninninnnninnnggggggggg arararaarrrreaeaeaaeaaeaasss anddd aanananann unbbbbbeeelllliievablblblbblbbb e ee ee e e e e

outdoorrrrr tettteteeeeeett rrrrrrraca e ee aaaaaaraa eaeeaaaeaaaaaaaaa, ththisisisisississsiiss hhhhhhhhhhhhhommmommmmmmmmmeeeeeeeeeee isisisisssisisisissssssiiii ooooooonnnenennnen -o-of-f aa-a-aa-a kkkikikkinndndndd. . FFrFrFrFrFrFrFrooomomomomo ttthehhehheheehh iiiiimmmmmmmmmaacacacacacacacacacacacaccaa ulululululuulululuuluuuu atatatatatatatatatatateeee eeeeeeeeee sststacacacaccacacacckkeekeekekekekekeddddddddddd ststttttstststtstoononononononoonnno eeeeeeeeeeee wawawawawwawaaawawawwww llllllllllllss,s,s,s,sss

exexexexexexexxxtetttettttetetetensnsnsnsnsnsnsnsnsnsiviiviviviveeeeeeeeee wawawawwawawaawawawaawaawawaw tetetetetetetetetet rrrr r rr rrr feffffefeffffefefefefeffefefeff aataatatatattatatatatattatatururururururruruuresesessessseseesesessessesss aaaannnnnndndnnnnnnnnn impmpmpmpmpmpmpmpmpmpmmpmpmpmmmmmprererereerreeererresssssssssssssssss ivivvve poportrtrtrtrttrtttteeee-e-eee cocccc chchhhc èrèrèrrrre,ee,e,eeee tttthihihihihihihihis s ss hohohohohohohohohohohooomemememmemememememememm sssssssssetetetetettteteeee sssssssssss anaaaaanannnannaan aaaaaaaaamamamamamamammamm ziziziziziziziziziizzz ngngngnngngngngngngngngng sssssssssstatatatatataaat ndndnndndndnndndndnndn arrrrrarararrrrddddddddddd ofofofofofofffoffofffff

cococococconsnnsnnsnstrtrtrtrrrtrrrrrucucucucucucuccucucccucttittititititionononnononnonoonononnnn aaaaaaaaaandndndndndnndnddndnddnd iiiiiiiiissssssss sss aaaaaaa tteteteteteteteteteeeeeeestststttstttststtstaaamamamammmmmameneneneneneneneeneeeenennnt t t tttt ttttt t totototototototooto tttttttttttthehhehehehehehhe hhhararaarddddd wowwowwowoworkrkrkrkrkrk aaaaaandndndndndnddndndddddddnddddndddndddnddd dddddddddddddededededededededededededeediciciciciciciciciciciciccicatatatatatattaatatttaaatattttioioioiooioioonnnnnnnnnnnnnnnn ofofofofofofofoofoffof BBBBBBBBBBBBBrararararaararararrarar ededeeddddddededdededeeddededenenenenenenenenneenenenenen CCCCCCCCCCCCCCConononononononononnooonstststststststsstrurururururuructctcctctctioiiiiioioioonsnsnsnsns...

2010 PROJECT OF THE YEAR

Bovis Lend Lease – Robina Town Centre Northern Malls Redevelopment

The Robina TTown Centre Northern Malls Redevelopment has seen a revitalisation of the Robbbbbbininnni aa ToToToToToTown

CeCeCeCeCeCeCCeCeCCeeCeCeCentntntntntntntntntnntnntntnn rerererereree bbbacack k tototo one of the Gold Coasttttt’sssssss mmmmmmososossososossstttt ttt t t t sosososososososouguuuuu ht after retail areas. With high qualityy bbououtititiquququeeeee

shhshshshhshhshshhopopopopopopoooppipipipp ngngngnggggnnn aaaaaaattt t yoyoyoyoururururu ddddddddddddooooooooooooooo rsrsrsrsrrsrstetetetttetetetttepppppppppppppppppp anananaanaa dddd dididididiiiiiiiiiirerrererrerererrereerr ctctctctctctctttctcttctctctctcctioioioioioioioioioiooionananananananananananananananaaanannan lllll lll lll ll asasasasasasasasasasasssssaasasasaaa siiiisisiststttststtststsstststsstststtedededeeededeeee car pppppppararkikingngggg, BoBoviviss LeLeendndndnd LLLLLLLeaeaeeaaeaseseseseseese oooooooovevveveveverrrcrcrcrccrcrccamamamammmamaammamammeeeeeee ee e mamamammamaamaamamamamamamannynynynynynynynynynynynynnynynynynyyyyyyyyy

chcchchhhchchchcchchcchchchhhaaallallallaalaaallaaaalleleleleleleleleengngnggngnggnggggesesesesessesesesesessese ttttoooo oo coccoccococococoooooooooooompmpmpmpppppmppmppleleleeleeleeleeleeeeeteteteetetetetetetetet tthihhhh s iimimmmmprprprprpppp esesesssssssssisisisisisisiss veveeveeeevveveeveeevee rrrrrredededdedeedeedededdeveveveveeveveveee eeeeelellleeeeeloopooppooopppo memmememeeeemeememeeeementnnntntntntnntntnntntntntntnnnnnnn ...... ThThThTThTTTThTThThheeeeeeeeeeee leleleleevevevvvvvvvvevvv llll fffofoffof aaaaaaaaaaarcrcrcrcrchhhhhihihiteeetteeeecccctctcttccccc ururalalll ddddddddddddddddddddddeteetttettteetteetttaiaiaiaiaaiaaillllll isisii eeeextxtxtxttttxtxttttenenenennennnnnnnnenennenenensisisisisisissisisisiisisssisis vevevevveeeveveeveveeevveveve,, asasaasasasaasss

issssssssssissssissisiss eeeeeeeeeeeeeeevvvivvivvivivvvvivvvvvvv dedededeed nntntntntntnnntntntttn iinnnnnnnn ththhhthhhhhhhthhhhhheeeeeeeeeeeeeeeeeeeee ququuququuuuquuuuuquuquuuqqq aalalalaaaalaaa itititititittitittititttty,y,y,y,,y,,yyyyy sssssoopopoo hhhihihhihiistststststss iciciciccicccccccatatatatattattatatataatttioioioioioioioooooioioioioioiooonnnnnnnn ananananannaannananaanannnnannnddddddddddddddddd stststststststssstststsstststsssstssstylylyyylylllyylyylylyylyyyyyyyy eeeeeeeee ofofofofofofoffofofofff tttttttttthehehehehehheheheheheheheheeeheheeheheeee fififififififififififififififinnnnnnnnnnnnnisisisisiisisisiisissssshehehehhehehehheedddddddddddddddd prprprprprprprprpppp ojojjojoojojojecececcececcecececececeect,tt,t,tt,ttttt,t,t,t,t,ttttttttt wwwwwwwhihhihihiiiihihihiiii hchchhchchchch sssssettttetetetets ssssssssss ssss sss aa aaaaaaa neneneneeneeeneeneeeeeeeeeeeww w wwww ww bebebbebbebencncncncncncn hhhhhhmhmh araraaaaaaaaaaaaaa k k

inininininininnininninnnninnnininin rrrretetettetttetetttttte aiaiiaiaiaiaiaiaaia llllllll cecececececeeececececcecc ntnnttntnttntttrerererererererer sssssssssssssssssss onoonoonnononnnoononnooooooooooo tttttttttttthehheheheheheeeeeeehhheee GGGGGGGGGGGGGGGGGGGGGGGooloooooooooo ddddddddddd CoCoCoCoCoCoCoCoCoCooCoCoCCCCCoasaasassssasasasasassasasasttt.tt.t.tt.tttt.

www.masterbuilders.asn.au

1300 30 50 10

Central Queensland

35 Derby StreetPO Box 631Rockhampton Queensland 4700

Telephone (07) 4920 3555

Facsimile (07) 4921 [email protected]

Brisbane(Head Offi ce andRegistered Offi ce)

417 Wickham TerraceBrisbane Queensland 4000

Telephone (07) 3225 6444

Facsimile (07) 3225 6545

[email protected]

Burnett Wide Bay

Unit 2, 162 Boat Harbour DrivePO Box 358Hervey Bay Queensland 4655

Telephone (07) 4125 9900

Facsimile (07) 4124 7235

[email protected]

Far North Queensland

310–314 Gatton Street Manunda Queensland 4870

Telephone (07) 4048 8770

Facsimile (07) 4048 8771

[email protected]

Downs & Western

166 Hume StreetToowoomba Queensland 4350

Telephone (07) 4699 4100

Facsimile (07) 4639 5144

d&[email protected]

Gold Coast

18 Central Park AvenueAshmore Queensland 4214

Telephone (07) 5597 7077

Facsimile (07) 5597 7044

[email protected]

North Queensland

Master Builders HouseUnit 1, 316 Sturt StreetPO Box 5801Townsville Queensland 4810

Telephone (07) 4760 4600

Facsimile (07) 4771 5777

[email protected]

Mackay & Whitsunday

Suite 2, 40 Evans AvenuePO Box 3188North Mackay Queensland 4740

Telephone (07) 4967 1290

Facsimile (07) 4967 1299

m&[email protected]

Sunshine Coast

Level 1, 91 King StreetPO Box 1458Buderim Queensland 4556

Telephone (07) 5453 5260

Facsimile (07) 5453 5269

[email protected]

Master Builders offi ce locations

With nine offi ces throughout Queensland, Master Buildersregional footprint is unmatched by any other industryorganisation in Queensland. Master Builders can help you wherever you are working.

QMBA-14249 Annual Report 2011 08-11€¦ · the phone guided search for consumers. Promotion via...

Documents

Transcript of QMBA-14249 Annual Report 2011 08-11€¦ · the phone guided search for consumers. Promotion via...