8/16/2019 Qiao 2016

http://slidepdf.com/reader/full/qiao-2016 1/10

Full length article

An alginate-based platform for cancer stem cell research

Shu-pei Qiao a,1, Yu-fang Zhao a,1, Chun-feng Li a,1, Yan-bin Yin a, Qing-yuan Meng b, Feng-Huei Lin c,d,Yi Liu a, Xiao-lu Hou a, Kai Guo a, Xiong-biao Chen e,f , Wei-ming Tian a,⇑

a Bio-X Center, School of Life Science and Technology, Harbin Institute of Technology, Harbin 150080, PR Chinab State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, PR Chinac Division of Biomedical Engineering and Nanomedicine Research, National Health Research Institutes, Miaoli, Taiwan, ROC d Institute of Biomedical Engineering, College of Medicine and College of Engineering, National Taiwan University, Taipei, Taiwan, ROC e Division of Biomedical Engineering, University of Saskatchewan, Saskatoon, Canadaf Department of Mechanical Engineering, University of Saskatchewan, Saskatoon, Canada

a r t i c l e i n f o

 Article history:

Received 3 November 2015

Received in revised form 14 April 2016

Accepted 18 April 2016

Available online xxxx

Keywords:

Alginate

Hyaluronic acid

Platform

Cancer stem cell

Niche

a b s t r a c t

As the primary determinants of the clinical behaviors of human cancers, the discovery of cancer stem

cells (CSCs) represents an ideal target for novel anti-cancer therapies (Kievit et al., 2014). Notably,

CSCs are difficult to propagate in vitro, which severely restricts the study of CSC biology and the develop-

ment of therapeutic agents. Emerging evidence indicates that CSCs rely on a niche that controls their dif-

ferentiation and proliferation, as is the case with normal stem cells (NSCs). Replicating the  in vivo  CSC

microenvironment  in vitro  using three-dimensional (3D) porous scaffolds can provide means to effec-

tively generate CSCs, thus enabling the discovery of CSC biology. This paper presents our study on a novel

alginate-based platform for mimicking the CSC niche to promote CSC proliferation and enrichment. In

this study, we used a versatile mouse 4T1 breast cancer model to independently evaluate the matrix

parameters of a CSC niche – including the material’s mechanical properties, cytokine immobilization,

and the composition of the extracellular matrix’s (ECM’s) molecular impact – on CSC proliferation and

enrichment. On this basis, the optimal stiffness and concentration of hyaluronic acid (HA), as well as epi-

dermal growth factor and basic fibroblast growth factor immobilization, were identified to establish theplatform for mimicking the 4T1 breast CSCs (4T1 CSCs) niche. The 4T1 CSCs obtained from the platform

show increased expression of the genes involved in breast CSC and NSC, as compared to general 2D or 3D

culture, and 4T1 CSCs were also demonstrated to have the ability to quickly form a subcutaneous tumor

in homologous Balb/c mice in vivo. In addition, the platform can be adjusted according to different param-

eters for CSC screening. Our results indicate that our platform offers a simple and efficient means to iso-

late and enrich CSCs in vitro, which can help researchers better understand CSC biology and thus develop

more effective therapeutic agents to treat cancer.

Statement of Significance

As the primary determinants of the clinical behaviors of human cancers, the discovery of cancer stem

cells (CSCs) represents an ideal target for novel anti-cancer therapies. However, CSCs are difficult to prop-

agate   in vitro, which severely restricts the study of CSC biology and the development of therapeutic

agents. Emerging evidence indicates that CSCs rely on a niche that controls their differentiation and pro-

liferation, as is the case with normal stem cells (NSCs). Replicating the   in vivo  CSC microenvironmentin vitro  using three-dimensional (3D) porous scaffolds can provide means to effectively generate CSCs,

thus enabling the discovery of CSC biology. In our study, a novel alginate-based platform were developed

for mimicking the CSC niche to promote CSC proliferation and enrichment.

 2016 Published by Elsevier Ltd. on behalf of Acta Materialia Inc.

1. Introduction

Cancer is a major disease with detrimental health effects and is

also associated with high incidence and mortality rates worldwide

[2]. There have been significant challenges in developing effective

http://dx.doi.org/10.1016/j.actbio.2016.04.032

1742-7061/  2016 Published by Elsevier Ltd. on behalf of Acta Materialia Inc.

⇑ Corresponding author.

E-mail address:  tianweiming@hit.edu.cn (W.-m. Tian).1 Equal contribution.

Acta Biomaterialia xxx (2016) xxx–xxx

Contents lists available at   ScienceDirect

Acta Biomaterialia

j o u r n a l h o m e p a g e :   w w w . e l s e v i e r . c o m / l o c a t e / a c t a b i o m a t

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016),   http://dx.doi.org/

10.1016/j.actbio.2016.04.032

8/16/2019 Qiao 2016

http://slidepdf.com/reader/full/qiao-2016 2/10

treatments for cancer due to the complexity of its pathogenesis

and molecular mechanisms, which have not been fully understood

[3,4]. Growing evidence has suggested that cancer is a stem cell-

based disease, and it is analogous to the growth of normal prolifer-

ative tissues such as bone marrow, skin and intestinal epithelium,

and that the growth of cancer tumors is fated by the cancer stem

cells (CSCs), which possess the capacity for self-renewal, unlimited

proliferation, and multidrug and radiotherapy resistance   [5]. As

such, discovering the CSCs will greatly facilitate the development

of novel research strategies to investigate the occurrence, develop-

ment, and recurrence of tumors  [6–8].

Although much progress has been made in the study of CSCs,

many issues remain to be addressed by research. One issue is the

difficulties to isolate and propagate CSCs owing to the small per-

centage of CSCs found in tumors. For example, only about 2% of 

breast tumor cells are comprised of CSCs, and 0.1–1% of acute mye-

loid leukemia (AML) cells are CSCs [9,10]. The most common meth-

ods used to isolate CSCs are serum-free culture and fluorescence-

activated cell sorting (FACS); however, both methods have certain

shortcomings. Serum-free culture requires large volumes of expen-

sive and specialized media and is frequently unsuccessful due to

the small percentage of CSCs found in the tumor of origin. The FACS

approach requires costly antibodies and dedicated equipment,

yielding low numbers of viable cells. Therefore, there is an essen-

tial need to establish new and extensive screening methods to iso-

late and propagate CSCs  in vitro  [11,12].

Normal stem cells (NSCs) have been found to reside within a

‘‘stem cell niche”, which plays critical roles in the maintenance of 

stem cell characteristics, such as pluripotency and self-renewal

[13]. Recent data imply that CSCs also share a similar niche as

NSCs, referred to as the ‘‘CSC niche”, which regulates their stem-

ness and proliferation   [14,15]. The CSC niche is complex and

includes diverse stromal cells, the extracellular matrix (ECM),

and soluble factors secreted from the niche’s cells [15].  Mounting

evidence suggests that the ECM is an essential noncellular compo-

nent of the adult stem cell niche and that its rigidity and organiza-

tion play important roles in stem cell differentiation and woundhealing, as well as in cancer pathologies  [16–20]. Porous hydrogel

is widely used to mimic NSCs or the tumor microenvironment’s

ECM, and substantial evidence from recent studies has suggested

that it can regulate stem cell differentiation, while promoting

CSC selection and proliferation by adjusting the stiffness of the

hydrogel  [21–23]. Furthermore, emerging evidence has supported

the idea that three-dimensional (3D) culture can promote cell

reprogramming and tumor malignancy; and that in the tumor

microenvironment where CSCs and non-CSCs maintain balanced,

3D culture can promote the reprogramming of non-CSCs to CSCs

[20,24]. Evidence from recent studies has also shown that it is fea-

sible to proliferate and enrich CSCs by culturing the tumor cells on

the porous hydrogel [1,25].

As a major glycosaminoglycan of the ECM, hyaluronic acid (HA)has been described as one of the components of the stem cell niche.

HA has been found enriched in many types of tumors and associ-

ated with tumor growth and invasion [26–29]. Growing evidence

has demonstrated that CSCs share many similar signaling path-

ways with NSCs; however, there is an imbalance in these pathways

[30]. Researchers investigated the use of epidermal growth factor

(EGF) and basic fibroblast growth factor (bFGF) in maintaining

the stemness and proliferation of NSCs   [31]. Subsequently, many

researchers have isolated CSCs from various tumors via serum-

free culture combined with EGF and bFGF  [32,33]. As cytokines

of the CSC niche, EGF and bFGF can stimulate CSC self-renewal

and stemness [14].

In this paper, we present the synthesis and material character-

ization, and perform   in vitro  studies on alginate-based 3D poroushydrogels for mimicking the CSC microenvironment ECM. In our

study, we also demonstrate that the stiffness of the hydrogels

can be modulated by changing the concentration of alginate used

for cross-linking. HA is added to alginate-based hydrogels at differ-

ent molecular weights and concentrations, with limited influence

on the stiffness of the hydrogel, and that EGF and bFGF, cytokines

of the CSC niche, can be covalently linked to the oxidized alginate

hydrogel and the cytokines which chosen to link to the oxidized

alginate hydrogel could be changed for different needs. On this

basis, a platform that features with the optimized stiffness and

HA concentration as well as immobilized EGF and bFGF was devel-

oped and used for the rapid and efficient isolation of 4T1 breast

CSCs with high expression of CD44 and Sca-1 as well as low

expression of CD24, which were proven as breast CSCs markers

and often used for breast CSCs isolation from 4T1 breast cancer

cells [33]. Taken together, we illustrate the novel  in vitro   platform

comprised of the ECMwith appropriate stiffness, cytokines, and HA

is promising to mimic the  in vivo  CSC niche for isolating thus dis-

covering and treating the CSCs.

2. Materials and methods

 2.1. Cell lines and materials

Mouse 4T1 breast cancer cell lines were purchased from the

Institute of Biochemistry and Cell Biology, Chinese Academy of 

Sciences (Shanghai, People’s Republic of China). 2B11 hybridoma

cells for secreting the crypito-1 antibody, were purchased from

the Biosynthesis Biotechnology Company (Beijing, People’s Repub-

lic of China). Dulbecco’s Modified Eagle’sMedium:Nutrient Mixture

F-12 (DMEM/F-12), Roswell Park Memorial Institute (RPMI) 1640

medium, B-27 supplement, GlutaMAXTM supplement, and fetal

bovine serum(FBS) were purchased from Thermo Fisher Scientific

(Waltham, MA, USA). Propidium iodide(PI), calcein, phalloidin,

and 4,6-diamidino-2-phenylindole (DAPI) were purchased from

Sigma–Aldrich Co. (St Louis, MO, USA). bFGF and EGF were pur-

chased from Peprotech(RockyHill, NJ, USA). Mouse monoclonal

CD44 primary antibodies conjugated with FITC, mouse monoclonalCD24 primary antibodies conjugated with phycoerythrin (PE),

mouse monoclonal MDR1 primary antibodies, mouse monoclonal

Dclk1 primary antibodies, FITC-conjugated goat polyclonal

secondary antibodies to rabbit immunoglobulin (Ig)G, and

rhodamine-conjugated rat polyclonal secondary antibodies to rab-

bit IgG were purchased from Abcamplc (Cambridge, MA, USA).

 2.2. Experimental animals

Balb/c female mice (SPF), 6–8 weeks of age, were provided by

the Laboratory Animal Center of Harbin Medical University. All ani-

mals were fed ad libitumand kept under the normal 12-h light/12-

hourdark cycle. All procedures were approved by the University

Ethics Committee of the Harbin Institute of Technology.

 2.3. Synthesis of hydrogel and its physicochemical characterization

Alginate (low viscosity) and HA were purchased from Sigma–

Aldrich Co. (St Louis, MO, USA). Alginate hydrogels were prepared

as previously reported   [34,35]. Briefly, alginate was dissolved in

100 mL of distilled water to a concentration of 20 mg/mL. The algi-

nate was purified by the addition of ethanol. Then, the precipitated

alginate was dialyzed, lyophilized, and dissolved in distilled water

to obtain different concentrations. The alginate hydrogel was pre-

pared through cross-linking with calcium ions, and the alginate–

HA hydrogel was formed through the addition of HA. The gelation

process and the mechanical properties of the alginate hydrogels

were evaluated by examining the time of gelation onset and theevolution of elasticity at 37 C in constant strain mode by means

2   S.-p. Qiao et al./ Acta Biomaterialia xxx (2016) xxx–xxx

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016),   http://dx.doi.org/

10.1016/j.actbio.2016.04.032

8/16/2019 Qiao 2016

http://slidepdf.com/reader/full/qiao-2016 3/10

of a Bohlin Gemini II rheometer (Malvern Instruments, Malvern,

UK) using parallel plate geometry (40 mm in diameter), as in our

previous study [36].

 2.4. Immobilization of growth factors in oxidized alginate

The oxidized alginate was obtained by mixing sodium peroxide

and sodium alginate (in distilled water) with a mass ratio of 1:2.

The reaction was conducted at 4 C for 2 h and was terminated by

the addition of ethylene glycol; the degree of oxidation was evalu-

ated by measuring the concentration of sodium peroxide which

remained after 2 h. Then, the oxidized alginate was lyophilized at

20 C anddissolved in distilled water to achieve a 1.3% concentra-

tion. EGF and bFGF immobilized oxidized alginate was prepared by

dissolving EGF andbFGF(50 ng/mL) in an oxidizedalginate solution

while stirring. The EGFand bFGFimmobilized oxidizedalginatewas

collected and lyophilized at 20 C. The concentration of EGF and

bFGF in the supernatant was analyzed using an ultraviolet (UV)-

Vis spectrophotometer (UV-2250; Shimadzu Corporation, Kyoto,

 Japan) at 280 nm to evaluate the immobilization ratio.

 2.5. 2D cell culture and cell seeding on hydrogels

Mouse 4T1 breast cancer cells were grown in RPMI 1640 med-

ium, and the hybridoma 2B11 cells were grown in DMEM/F-12

medium supplemented with 10% FBS (Thermo Fisher Scientific,

Waltham, MA, USA) and 1% antibiotic–antimycotic (Thermo Fisher

Scientific, Waltham, MA, USA). Both were incubated in a humidi-

fied atmosphere of 5% CO2   at 37 C, with media changed every

other day. The mouse 4T1 breast cancer cells were digested from

monolayer cultures and seeded onto the alginate or alginate–HA

hydrogels, then incubated in a humidified atmosphere of 5% CO2

at 37 C and grown in DMEM/F-12 media supplemented with 1%

B-27 with media changed every other day.

 2.6. Scanning electron microscopy

Cell clones were released from our developed screening plat-

form, and then fixed with 2.5% glutaraldehyde for 30 min at

37 C, followed by incubation in 0.1 M sodium cacodylate buffer

containing 2.5% glutaraldehyde overnight at 4 C. After dehydra-

tion by serial washing twice in each increasing ethanol concentra-

tion (0%, 30%, 50%, 70%, 85%, 95%, and 100%), the samples were

critical point dried, sectioned, mounted, and sputter coated with

platinum before imaging with a JSM-7000 scanning electron

microscope (SEM) (JEOL, Tokyo, Japan).

 2.7. RNA extraction and reverse transcription

The total RNA of 4T1 breast cancer cell tumor spheroids from

the 3D alginate hydrogel culture was extracted using Trizol reagentaccording to the manufacturer’s instructions, and RNA quality was

assessed by agarose gel electrophoresis. The complementary (c)

DNA synthesis was performed using 1 lg of total RNA, oligo (dT)

primer (Promega Corporation, Madison, WI, USA), and reverse

transcriptase (Promega Corporation, Madison, WI, USA) according

to the manufacturer’s protocol.

 2.8. Quantitative real-time PCR

Real-time polymerase chain reaction (PCR) was performed on a

7500 real-time PCR system (Applied Biosystems; Thermo Fisher

Scientific, Waltham, MA, USA) using the FastStart Universal SYBR 

Green Master [Rox] (Hoffman-La Roche Ltd., Basel, Switzerland).

The PCR conditions were set as follows: 2 min at 60 C; 10 min at95 C; 40 cycles of 15 s at 95 C; 1 min at 60 C; and 30 s at

72 C. The primer sequences used for quantitative real-time PCR 

are shown in   Table 1. All of the primers were designed to span

genomic introns to avoid the amplification of contaminated geno-

mic DNA. Gene expression was normalized with the GAPDH

expression level. Quantitative real-time PCR analyses were per-

formed in triplicate and repeated at least three times.

 2.9. Phalloidin/DAPI staining and immunostaining 

To assess the cell clones’ morphology, which were formed by

seeding the 4T1 breast cancer cells onto alginate hydrogels, the cell

clones were released fromthe alginate microcapsules using sodium

citrate. Samples were stained with rhodamine-conjugated phal-

loidin and DAPI. For phalloidin–DAPI staining, samples were fixed

with 4% paraformaldehyde for 15 min and permeabilized with 1%

Triton X-100 in PBS for 5 min at room temperature with gentle

rocking. The samples were then washed three times for 5 min with

1 mL of PBS at room temperature. A total of 700lL of rhodamine-

conjugated phalloidin (0.8 U/mL in 1% BSA in PBS) was added to

each sample and they were incubated for 30 min at room tempera-

ture with gentle rocking; phalloidin binds to F-actin. The samples

were then washed three times for 5 min with 1 mL of PBS at roomtemperature, and nuclei were stained with DAPI staining solution

(1.0 lg/mL in PBS) for 10 min at room temperature. Samples were

washed three times for 5 min with 1 mL of PBS at room tempera-

ture and visualized with a Leica SP5 confocal microscope (Leica

Microsystems, Wetzlar, Germany). Immunofluorescence analysis

was performed on the tumor spheroid (which formed 7 days after

the4T1 breast cancercells were seeded onto our platform) to assess

protein expression within the cultured cell clones. Tumor spheroids

were released from our platform with the addition of sodium

citrate. Tumor spheroids were fixed with 4% paraformaldehyde

for 15 min and permeabilized with 1% Triton X-100 in PBS for

5 min at room temperature with gentle rocking. Then, the samples

were blocked with 2% BSA (Sigma–Aldrich Co., St Louis, MO, USA) in

PBS for 1 h and incubated with mouse monoclonal CD44 primary

antibody conjugated with FITC, mouse monoclonal CD24 primary

antibody conjugated with PE, mouse monoclonal MDR1 primary

antibody, and mouse monoclonal Dclk1 primary antibody. Samples

were washed three times with PBS beforeincubation with theFITC–

conjugated secondary antibody for 1 h at room temperature. Cell

nuclei were counterstained with DAPI (300 nM in D-PBS; Thermo

Fisher Scientific, Waltham, MA, USA) for 10 min. Images were

obtained on an inverted fluorescent microscope (Nikon Instru-

ments, Melville, NY, USA).

 2.10. Tumorigenesis assay

Tumor spheroids, which were formed in our platform over

7 days, were released using sodiumcitrate, and they were used to

determine cell count. Cells (500 or 2000) were injected subcuta-

neously into the flanks of Balb/c female mice that were 6–8 weeks

 Table 1

Primer information for real-time stem-loop RT-PCR.

Primer

name

Forward (50–30) Reverse (50–30)

GAPDH    CATGGCCTTCCGTGTTCCTA CCTGCTTCACCACCTTCTTGA

CD44   GAATGTAACCTGCCGCTACG GGAGGTGTTGGACGTGAC

CD24   CTTCTGGCACTGCTCCTACC GAGAGAGAGCCAGGAGACCA

SCA1   TGGACACTTCTCACACTA CAGAGCAAGAGGGTCTGCAGGAG

 ABCG2   AGCAGCAAGGAAAGATCCAA GGAATACCGAGGCTGATGAA

Tert    GCACTTTGGTTGCCCAATG GCACGTTTCTCTCGTTGCG

Nestin   CCCTGAAGTCGAGGAGCTG CTGCTGCACCTCTAAGCGA

Nanog    TCTTCCTGGTCCCCACAGTTT GCAAGAATAGTTCTCGGGATGAA

Sox2   CATCCACTTCTACCCCACCTT AGCTCCCTGTCAGGTCCTT

S.-p. Qiao et al./ Acta Biomaterialia xxx (2016) xxx–xxx   3

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016),   http://dx.doi.org/

10.1016/j.actbio.2016.04.032

8/16/2019 Qiao 2016

http://slidepdf.com/reader/full/qiao-2016 4/10

old. Two-dimensional cultured cells were implanted with growth

factor-reduced matrigel at the same cell number as the one on

hydrogels. Tumors were measured using calipers, and the volume

was calculated based on the modified ellipsoidal formula, i.e.,

tumor volume = (length width2) 0.5 [37].

 2.11. Statistic analysis

The results are presented as the mean ± standard deviation. Stu-

dent’s two-tailed t -test was performed to compare the differences

between the experimental and control groups. A P -value < 0.05 (⁄)

was considered significant; a   P -value < 0.01 (⁄⁄) was considered

very significant.

3. Results

 3.1. Conditions optimized for mimicking the CSC niche

Recent work has revealed that the niche of CSCs support CSC

self-renewal and regulates their proliferation and differentiation

[14,38]. In our study, we aimed to establish an   in vitro   platform

that could partly mimic the CSC niche. We also designed the plat-form in such a way that its component structure was tunable for

different needs. To achieve this aim, an alginate-based hydrogel

was used to mimic the elasticity of the ECM within the CSC niche;

cytokines of the niche were immobilized to the alginate-based

hydrogel, and HA of the ECM was added into the hydrogel. In this

study, we cultured the tumor cells in alginate-HA hydrogel with

serum-free culture. The tumor spheroids comprised by CSCs were

obtained through culturing while the tumor spheroids size and

number was used to evaluate the proliferation and enrichment of 

CSCs as previously reported  [22]. In this way, the optimal condi-

tions of the CSC niche were identified (Fig. 1).

 3.1.1. Effect of alginate-based hydrogel with different mechanical

 properties on CSC enrichment The importance of physical microenvironments in regulating

stem cell proliferation and differentiation has been increasingly

recognized   [18,39–41]. Moreover, considerable evidence indicates

that the material properties of hydrogels play an important role

in selection and growth of tumorigenic cells  [20,21]. In our study,

we developed calcium cross-linked alginate hydrogels to mimic

the ECM’s elasticity and then to identify the optimal material prop-

erties to isolate CSCs. For this purpose, we prepared alginate with

different concentrations in order to synthesize hydrogels featuring

different degrees of elastic stiffness. Alginate is known for its non-

toxicity and low immunogenicity, and it creates excellent flexible

scaffolds for transplanted cells in different animal species. The

characterization of the HA–alginate hydrogel was shown in the

SEM images.

The elastic stiffness of alginates, which have concentrations

ranging from 1% to 1.6%, was detected. The results showed that

alginate concentrations of 1%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, and

1.6% corresponded to an elasticity of 190 Pa, 210 Pa, 270 Pa,

710 Pa, 950 Pa, 1070 Pa, and 4700 Pa, respectively (Supplementary

Fig. 1). The characterization of alginate hydrogels with different

concentrations were shown in the SEM images in  Supplementary

Fig. 2 and the pore size of alginate hydrogels also were detected

(Supplementary Fig. 2). In order to determine the elastic stiffness

most suitable for CSC proliferation and spheroid formation, we

selected hydrogels with elastic stiffness levels of 190 Pa, 270 Pa,

950 Pa, and 4700 Pa for this study. We determined that an alginate

hydrogel of 950 Pa (1.4%) represented the optimal hydrogel for

cancer cell proliferation and spheroid formation (Fig. 2A and B).

About 10000 4T1 cancer cells in RPMI 1640 medium, which had

been trypsinized from conventional 2D rigid dishes, were mixed

with alginate solution. The cells were trapped individually in the

3D alginate hydrogel and maintained in DMEM/F-12 medium with

1% B27. Inside the alginate hydrogel (950 Pa), about 27 ± 3 spher-

oid colonies formed and increased from Day 3 to Day7 (Fig. 2C);

some cells at the bottom of the hydrogels near the rigid dish exhib-

ited spread morphology. In contrast, inside the other hydrogels

(190Pa, 270 Pa, or 4700Pa), the spheroid colony number

decreased dramatically as the culture time increased. The 950 Pa

alginate hydrogel led to the development of a larger tumor spher-oid size than the other hydrogels (Fig. 2A, B, and D). The number

Fig. 1.   The scheme to show the process of establish a novel alginate-based platform for mimicking the CSC niche to promote CSC enrichment and treatment. Versatile mouse

4T1 breast cancer was usedas a model, the optimal stiffness and epidermal growth factor and basic fibroblast growth factor immobilization, as well as optimal concentration

of hyaluronic acid (HA), were chosen to establish the platform that was used to mimic the 4T1 breast cancer stem cell (CSCs) niche. The CSCs that were selected by the

platform we developed could form a subcutaneous tumor with high frequency after inoculated to normal Balb/c mice. On the other hand, our alginate-based platform withgrafting cripto-1 antibody could be applied in a CSC treatment study.

4   S.-p. Qiao et al./ Acta Biomaterialia xxx (2016) xxx–xxx

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016),   http://dx.doi.org/

10.1016/j.actbio.2016.04.032

8/16/2019 Qiao 2016

http://slidepdf.com/reader/full/qiao-2016 5/10

and size of the spheroid colony dramatically increased after cultur-

ing the cells from the 7-day alginate hydrogel, suggesting that the

cells selected by the alginate hydrogels exhibited a better capacity

to form spheroid colonies, and that these colonies also grew more

rapidly.

 3.1.2. Effect of hydrogel-immobilized cytokines on CSC enrichment 

Serum-free culture, a commonly used method to isolate CSCs,

requires the constant supplementation of EGF and bFGF in the cul-ture medium [32,33]. Cytokine immobilization can effectively pro-

long the biological activity of these factors  [42]. Obtaining a signal

from the cytokines allows the cells to be maintained for a longer

amount of time, and it also promotes efficiency without having

to continuously add to the medium, resulting in cost savings. The

oxidation of sodium alginate produced aldehyde groups, which

form unstable amines found within the free amino groups of the

cytokines; and these amines covalently link the cytokines to the

alginate polymer chain. To illustrate the effectiveness of this

immobilization, an antibody, which was labeled with red fluores-

cence, was used for examination. As shown in   Supplementary

Fig. 3, red fluorescence was observed in the immobilized red

fluorescence-labeled antibody group, but not in the control group.

This result showed that the method we used was able to immobi-lize cytokines on hydrogels. Furthermore, we also detected the

remaining EGF and FGF after encapsulation by staining them with

their antibodies labeled with fluorescence, which also demon-

strated the growth factor are sequestered. We immobilized EGF

and bFGF on the alginate hydrogels to investigate whether this

method would be better than a direct addition. We compared the

spheroid colonies formed and tumor spheroid size among three

groups, i.e., the control group (without EGF and bFGF), the immo-

bilization group (with EGF and bFGF immobilized on the alginate

hydrogels), and the solution group (with EGF and bFGF directlyadded to the culture medium). Seven days after cell seeding, the

size of the tumor spheroids in the immobilization group reached

127.3 ± 7.9 lm in diameter, and they were larger than those of 

the other groups (Fig. 3A, B, and D). Notably, the cells in the control

group almost stopped growing at Day 5. In contrast, inside the algi-

nate hydrogel-immobilized cytokines, about 41.0 ± 1.0 spheroid

colonies formed; this number was significantly higher than that

of the other two groups (Fig. 3C), suggesting that immobilized

cytokines can promote CSC proliferation and enrichment.

 3.1.3. Effect of low and high molecular weight HA with different 

concentrations on CSC enrichment 

Considerable evidence indicates that low-concentration HA can

promote stem cell proliferation [43]; while high-concentration HAcan keep the stem cells in a dormant state and thus induce a

Fig. 2.   Tumorsphere formation in an alginate-based hydrogel with different degrees of stiffness. A. A single 4T1 breast cancer cell grew into tumorspheres in alginate

hydrogels of different stiffness levels throughout the course of culture from day 1 to day 7. Scale bar: 50 lm. B. The observation of the cytoskeleton of the multicellular 4T1

tumor spheroid after 7 days in culture in an alginate hydrogel withdifferent levels of stiffness; the multicellular 4T1 tumor spheroid was released fromthe hydrogel and was

stained with phalloidin for the cytoskeleton (red) and DAPI for the nucleus (blue); it was imaged with an inverted fluorescent microscope. Scale bar: 20 lm. C. Tumorsphere(round colony) number as a function of culture time: day1 to day7. The 950 Pa alginate hydrogel seemsto be optimal forsustainingthe spheroidcolony number. Mean ± SD;

n = 3 (for the 190 Pa,270 Pa,950 Pa,and 4700 Pa alginate hydrogels); independentexperiments. D. Colony size of thetumorspheres as a functionof culture time andhydrogel

stiffness. Apparently, the 950 Pa hydrogel best promotes tumor growth. Mean ± SD;   n = 3 (for 190 Pa, 270 Pa, 950 Pa, and 4700 Pa alginate hydrogels); independent

experiments.

S.-p. Qiao et al./ Acta Biomaterialia xxx (2016) xxx–xxx   5

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016),   http://dx.doi.org/

10.1016/j.actbio.2016.04.032

8/16/2019 Qiao 2016

http://slidepdf.com/reader/full/qiao-2016 6/10

multidrug-resistant phenotype   [44]. Considering the important

role of HA in stem cells, in our study, we developed an HA–alginate

hydrogel of varying concentrations of HA. The hybrid hydrogel

loaded with the same number of cells from the 2D culture was

implanted to analyze the effect of different concentrations on HA

for CSC enrichment and proliferation. The addition of HA shows

limited influence on the material properties of the hydrogel (Sup-

plementary Fig. 4). In our study, low molecular weight (LMW) HA

with concentrations of 0.5%, 1%, and 1.5% was used to develop the

HA–alginate hydrogel, while the alginate hydrogel without HAserved as a control. With the increasing number of filtration days,

the group of 1.5% concentration led to a higher spheroid colony

number (47 ± 1) than the control group, and other concentrations

showed suppressed tumor spheroid formation. However, there

was no significant difference between the control group and the

group of 1.5% concentration in terms of tumor spheroid size

(131.3 ± 8.5 lm) (Fig. 4A–D). Similar to the results of the low-

concentration LMW-HA, we also found that with increasing con-

centrations of LMW-HA, more spheroid colonies were formed,

which means that the proliferation of CSCs was promoted. HA

interacts with a specific cell-surface receptor, CD44, which has

been shown to be a marker of 4T1 CSCs and a receptor for HA

[45,46]. In addition, we performed experiments to discover if the

hydrogel with a higher concentration of LMW-HA can further pro-mote CSC proliferation. Specifically, hydrogels with concentrations

of 2%, 2.5%, and 3% were prepared, respectively, and their influ-

ences on CSC proliferation and enrichment were examined. The

results showed that the spheroid colony number and the tumor

spheroid size in the hydrogel with higher concentrations of 

LMW-HA were much less than those of the control group ( Supple-

mentary Fig. 5). Also, we performed experiments to discover if the

high molecular weight (HMW) HA can have the same effect as the

HMW-HA has on the CSC proliferation. For this purpose, hydrogels

with 0.5%, 1%, and 1.5% concentrations of HMW-HA were prepared.

The results showed that the addition of HMW-HA reduced the pro-liferation of CSCs (Supplementary Fig. 6). Taken together, these

data suggest that LMW-HA is preferred than HMW-HA for use

and that the hydrogel with a concentration of 1.5% LMW-HA is

the best one among those examined, in order to promote the CSC

proliferation.

 3.2. Characterization of the stem-like cancer cells that were selected by

the platform we developed

Based on the data obtained from the aforementioned  in vitro

tumor spheroid formation experiments, we developed a platform

with the optimal elements and then used it to select CSCs from

4T1 breast cancer cells. We wondered whether the tumor spher-

oids formed through our platform acquired more efficient tumori-genicity than those cultured on conventional 2D rigid dishes. For

Fig. 3.   Effect of cytokine immobilization on tumorsphere formation. A. Tumorsphere formation by 4T1 breast cancer cells in different groups (without the addition of 

cytokines in the control group; directly adding the cytokine to the medium in the solution group; and immobilization of the cytokine added to the alginate hydrogel in the

immobilization group). Scale bar: 50 lm. B. Observations of the cytoskeleton of the multicellular 4T1 tumor spheroid after 7 days in culture for the different groups; the

multicellular 4T1 tumor spheroid was stained with phalloidin for the cytoskeleton (red) and DAPI for the nucleus (blue); it was imaged with an inverted fluorescent

microscope. Scale bar: 20lm. C. Tumorsphere (round colony) number as a function of culture time: day 1 to day 7. Cytokine immobilization significantly promoted theformation of the tumor spheroid. Mean ± SD; n = 3 (for the different groups); independent experiments. D. Colony size of the tumorsphere as a function of culture time and

cytokine immobilization. Apparently, cytokine immobilization enhanced the proliferation of the tumor spheroid. Mean ± SD; n   = 3 (for the different groups); independent

experiments.

6   S.-p. Qiao et al./ Acta Biomaterialia xxx (2016) xxx–xxx

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016),   http://dx.doi.org/

10.1016/j.actbio.2016.04.032

8/16/2019 Qiao 2016

http://slidepdf.com/reader/full/qiao-2016 7/10

this purpose, a single colony was selected from the platform we

developed via pipetting, and 1000 or 2000 of these cells were sub-

cutaneously inoculated to normal Balb/c mice each time. We found

that all mice with 1000 and 2000 injected cells could form subcu-

taneous tumors. These cells grew rapidly   in vivo, with palpable

tumors observed on Day 5 for 2000 injected cells and Day 7 for

1000 injected cells (Supplementary Fig. 7). In contrast, subcuta-

neously injecting either 1000 or 2000 4T1 breast cancer cells that

were dissociated directly from the conventional 2D rigid dishes

did not form tumors which is consistent with another study show-

ing that the 4T1 cells subcutaneous injection to Balb/c mice can’t

form tumors only the cell number is over 104 [47]. This   in vivo

tumor formation data suggests that the cells within the spheroidsthat formed in the platform may share similar features with stem

cells; and that these cells are also more tumorigenic. To further test

this idea, the tumor spheroids were released from our platform and

their morphology was assessed via SEM. As shown in the SEM

images in Supplementary Fig. 8A–C, a condensed cell mass similar

to a neural stem cell mass was formed. As well, the characteriza-

tion of the HA–alginate hydrogel is shown in the SEM images in

Supplementary Fig. 8D; the hydrogel is highly porous and features

an interconnected pore network, which contributes to transporting

nutrients and waste products. Furthermore, we cultured 4T1 cells

in over platform over the course of 7 days and then examined

the RNA isolation of the cells in the formed tumor spheroids.

A panel of stem cell markers (Nestin,  Tert ,  Nanog , and  Sox2) and

breast cancer stem cell markers (CD44,   CD24, and   Sca-1) weredetermined by quantitative real-time reverse transcription

(qRT)-PCR. The expression of stem cell markers  Nestin, Tert , Nanog ,

and Sox2 were upregulated, which was consistent with the expres-

sion of 4T1 breast CSC markers   CD44   and Sca-1, and which has

been reported by many studies, when compared with the controls

that were cultured in conventional 2D rigid dishes (Fig. 5A and B).

It is known that CSCs showed more drug resistance. To determine

whether the CSCs selected by our platform are more drug resistant,

the MDR1 protein – which is responsible for CSC drug resistance –

was detected by immunofluorescence analysis (Fig. 6D). The CSCs

from our platform were more drug resistant than the 3D control

and 2D cultured cells. In addition, CD44, CD24, and Dclk1 (which

were found to be markers of tumor stem cells) expression was

determined by immunofluorescence, and the results were consis-tent with those found for MDR1 (Fig. 5C and E).

 3.3. A tentative study of the treatment of CSCs through our platform

In our study, we attempted to demonstrate that our platform

was not only effective for use in CSC isolation, but it could also

be applied in a CSC treatment study. Increasing evidence suggests

that cripto-1 silencing decreases the number of CSCs and limits

tumor growth  [43–46]. Therefore, we used the cripto-1 antibody

to silence cripto-1 and to perform a tentative study on CSC treat-

ment through our platform. The cripto-1 antibodies were secreted

by the 2B11 hybridoma and were immobilized to our platform

through the method described above. As a control, an irrelevant

antibody was immobilized to our platform. The CSCs that wereselected by our platform were encapsulated in the platform-

Fig. 4.  Effect of low-concentration LMW-HA addition on tumorsphere formation. A. A single 4T1 cell grew into tumorspheres in HA–alginate hydrogel with the addition of 

different concentrations of LMW-HA during the culture course from day 1 to day 7. Scale bar: 50 lm. B. Observation of the cytoskeleton of the multicellular 4T1 tumor

spheroid after 7 daysin culture in HA–alginate hydrogels with different concentrations of LMW-HA; the multicellular 4T1 tumor spheroid was stained withphalloidin for the

cytoskeleton (red) and DAPI for the nucleus (blue); it was imaged with an inverted fluorescent microscope. Scale bar: 20lm. The tumorsphere (round colony) number (C), as

well as thecolony size of thetumorsphere (D), in differentHA–alginate hydrogels was quantified from culture day1 to day7. The addition of the1.5% concentration of LMW-

HA promoted tumor spheroid formation. Mean ± SD; n  = 3 (for the different groups); independent experiments.

S.-p. Qiao et al./ Acta Biomaterialia xxx (2016) xxx–xxx   7

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016),   http://dx.doi.org/

10.1016/j.actbio.2016.04.032

8/16/2019 Qiao 2016

http://slidepdf.com/reader/full/qiao-2016 8/10

immobilized cripto-1 antibody and in the platform-immobilized

control antibody, and both were cultured in stem cell medium

for 3 days. Images of live and dead cells are shown in Supplemen-

tary Fig. 9, illustrating that more dead cells were found in the

platform-immobilized cripto-1 antibody relative to the control

platform. In addition, the 1000–2000 CSCs that were selected by

the platform we developed were treated by cripto-1; they werethen sorted out and subcutaneously inoculated to normal Balb/c

mice. In response, no tumors formed in these mice. These results

suggest that the platform we developed can be applicable to the

isolation, study, and treatment of CSCs.

4. Discussion

The establishment of a tunable and universal   in vitro   platform

for CSC isolation, purification, and research applications remains

challenging in cancer research. Although numerous cell surface

markers have been identified and can be used for the isolation of 

CSCs, the use of these surface markers has been controversial,

and their relevance to CSC has not been clear. Analogous to the reg-ulation of NSCs by their ‘‘niche”, CSCs are also believed to reside in

niches [14,48,49]. There is now overwhelming evidence pertaining

to the idea that the niche surrounding CSCs largely governs their

cellular fate and simultaneously supports CSC self-renewal

[15,50–51]. Recent work has revealed that 3D culture can maintain

the stemness and enhance the self-renewal of stem cells; addition-

ally, it can promote non-stem cell reprogramming   [24,52–54].

Non-CSC tumor cells are also part of the CSC niche. Given the sim-

ilarity of the signaling pathway involved in maintaining the stem-

ness between stem cells and CSCs, we elected to use an alginate-

based hydrogel to mimic the ECM of stem cells so as to isolate

poorly-differentiated CSCs. The mechanical properties of the ECM

are important determinants of a stem cell’s fate, as shown by prior

studies that highlight their effects on CSC proliferation and stem-ness [22,23]. In our study, alginate was used for preparing hydrogel

due to its nontoxicity and elasticity. There is an interesting phe-

nomenon we noticed during preforming the rheological study, that

is a dramatic difference in the stress relaxation behavior of the

materials was observed. The viscosity of an alginate solution

depends on the concentration of the polymer and the MW distribu-

tion. Two G blocks of adjacent polymer chains can be cross-linked

with multivalent cations through interactions with the carboxylicgroups in the sugars, which leads to the formation of a gel network.

The overall gel stiffness depends on the polymer MW distribution

composition (i.e., the M/G ratio), and the stoichiometry of the algi-

nate with the chelating cation. Therefore, we postulate that the big

variation was due to the different composition ratio of M/G in the

alginate by oxidation.

What’s more, compared with other materials, alginate is hard to

be broken down by the enzymes produced by cells. In our previous

study, we have examined the durability of alginate scaffolds with

the results that alginate scaffolds are stable or durable in shape

for one month in the culture medium  [55].   Furthermore, most

study were carried out during 1 week, therefore, the durability of 

the scaffold is not a big concern in current study. Besides, the algi-

nate does not contains cell receptor, thus minimizing the interfer-ence among various factors   [56]. We prepared hydrogels from

alginate, with different stiffness by adjusting the concentration of 

alginate, and then examined and determined the optimal mechan-

ical properties for CSC screening, by means of 4T1 breast cancer

cells as a model. It is known that the stiffness of stromas (tumors

growths) are typically different; As such, our aim is to discover if 

certain mechanical properties can be achieved according to the

various demands of different types of CSC screening by changing

the concentration of the alginate. Serum-free culture is one

method that is often used to isolate CSCs via the addition of EGF

and bFGF [32,33]. To maintain the activity of the factors for isolat-

ing CSCs, these factors must be continuously added to the media

used and as a result, this approach is not considered effective.

EGF and bFGF have been found to promote CSC proliferation inmany solid tumors; in fact, these are the factors that are produced

Fig. 5.   Upregulation of cancer and normal stem cell-associated genes in 4T1 spheroid cells cultured in our platform. A. The expression of CSC markers in 4T1 tumor spheroid

cells cultured in our platform and 4T1 cells cultured in 2D rigid dishes was quantified by real-time PCR. B. The expression of stem cell markers in 4T1 tumor spheroid cells

cultured in our platform and 4T1 cells cultured in 2D rigid dishes was quantified by real-time PCR. A total of 5–8 mice per group; data represent the mean ± SD of three

independent experiments. C, D and E. Expression of CD44, CD24, MDR1, and Dclk1 by 4T1 tumor spheroids cultured in our platform for 7 days; conventional 3D and 2D

cultured 4T1 cells served as control. Measurements were performed using immunofluorescence.

8   S.-p. Qiao et al./ Acta Biomaterialia xxx (2016) xxx–xxx

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016),   http://dx.doi.org/

10.1016/j.actbio.2016.04.032

8/16/2019 Qiao 2016

http://slidepdf.com/reader/full/qiao-2016 9/10

by cells in the tumor environment [57]. As the major component of 

the CSC niche, numerous cytokines play pivotal roles in CSC self-

renewal and differentiation [58,59]. In our study, the oxidation of 

sodium alginate was achieved via synthesis; this process was able

to produce various aldehyde groups, which can form unstable ami-

nes found within the free amino groups in the cytokines. Thus, the

unstable amines that were found had covalently linked the cytoki-

nes to the alginate polymer chain.

Wehave demonstrated that the immobilization of EGF and bFGF

to the oxidized alginate can promote CSC proliferation and enrich-

ment. Not only do the mechanical properties of the ECMimpact the

proliferation and stemness of CSCs, their extracellular matrix pro-

teins also contribute to this biology. For example, the glycosamino-

glycan HA and the membrane-bound form of the cytokine stem cell

factor constitute key components of the CSC niche   [60]. HA was

added to the alginate at different concentrations to develop HA–al-

ginate hydrogel. Notably, with the addition of HA, the elastic stiff-

ness of the alginate hydrogel did not change much. Our data

showed that the optimal concentration of HA for CSC proliferation

is 1.5%. Although there was no significant difference between the

control group andthe 1.5% LMW-HAgroupin terms of tumor spher-

oid size (131.3 ± 8.5lm), the 1.5% LMW-HA group could lead to a

higher spheroid colony number (47 ± 1). Furthermore, the 1.5%

LMW-HA group can significantly up-regulate the expression of 

MDR1, which has been proven as CSCs marker by that MDR1 high

expression helps the survival of CD44 high CSC [61].

The objective our study was to identify a suitable material to

support CSC proliferation by developing an easily tunable hydrogel

system. In the present study, our results successfully demonstrated

that culturing the 4T1 breast cancer cells on the alginate-based

tunable platform we developed, which contained optimal elements

of the CSC niche, promoted CSC proliferation. The platform was

able to effectively and efficiently enrich the CSCs, and the stemness

of these CSCs was verified using the gold-standard tumor forma-

tion assay, whereby cells are subcutaneously inoculated to normal

Balb/c mice. Only those 4T1 CSCs isolated from our tunable plat-

form grew tumors at low numbers, whereas large numbers of cellscultured on conventional 2D rigid dishes did not show tumor for-

mation. Additionally, cells cultured on our platform displayed an

increased expression of stem cell-related genes such as   Nestin,

Sox2, Tert , Nanog ,  Sca1, and Dlk1.

For further optimize the efficacy of isolating the CSCs, we did

the combination assessment of different factors, however, no sig-

nificant differences were observed. Different types of CSCs from

different tissue will suit distinct microenvironment, and in current

study we used breast cancer as a model to explain the usefulness of 

the platform. These alginate-based hydrogels were designed to

easily adapt to other types of CSCs, both for CSC isolation and for

research applications. Given the wide range of biological and

mechanical parameters for these hydrogels, it will be possible to

engineer a matrix that promotes additional and specific CSC func-tions. Therefore, in future study of isolating the patient derived

CSCs, we can quickly design a specific combination for different

types of CSCs by modulating the three critical factors affecting

the efficiency CSCs growth. We anticipate that the platform or sim-

ilar platforms will significantly enable and facilitate the study of 

CSCs, and thus help determine associated clinical outcomes for

cancer therapy.

5. Conclusions

A novel alginate-based platform that features the optimum

stiffness and concentration of HA and immobilized EGF and bFGF

was developed and our results showed that culturing the 4T1breast cancer cells on the alginate-based tunable platform we

developed promoted CSCs proliferation and enrichment, as exem-

plified by using 4T1 breast cancer cells. We believe similar plat-

forms can be readily developed for other types of CSCs. Taken

together, the alginate-based tunable platform presented in this

paper is able to offer a simple and efficient means to isolate and

enrich CSCs in vitro, which can help researchers better understand

CSC biology and thus develop more effective therapeutic agents to

treat cancer.

 Acknowledgments

This research is supported by the National Natural Science

Foundation of China (Grants 81361128005 and 50903024), the

National Science and Technology Support Program of China (No.

2012 BAI 17B04) and the Fundamental Research Funds for the Cen-

tral Universities (Grant No. HIT. MKSTISP. 2016 37). English-

language editing of this manuscript was provided by Journal Prep.

 Appendix A. Supplementary data

Supplementary data associated with this article can be found, in

the online version, at   http://dx.doi.org/10.1016/j.actbio.2016.04.032.

References

[1]  F.M. Kievit, S.J. Florczyk, M.C. Leung, K. Wang, J.D. Wu, J.R. Silber, et al.,

Proliferation and enrichment of CD133(+) glioblastoma cancer stem cells on

3D chitosan-alginate scaffolds, Biomaterials 35 (2014) 9137–9143.

[2] R. Siegel, J. Ma, Z. Zou, A. Jemal, Cancer statistics, 2014, CA Cancer J. Clin. 64

(2014) 9–29.

[3]  M. Rebucci, C. Michiels, Molecular aspects of cancer cell resistance to

chemotherapy, Biochem. Pharmacol. 85 (2013) 1219–1226.

[4] J.A. Hickman, R. Graeser, R. de Hoogt, S. Vidic, C. Brito, M. Gutekunst, et al.,

Three-dimensionalmodels of cancer for pharmacology and cancer cell biology:

capturing tumor complexity in vitro/ex vivo, Biotechnol. J. 9 (2014) 1115–

1128.

[5]  E. Vlashi, F. Pajonk, Cancer stem cells, cancer cell plasticity and radiation

therapy, Semin. Cancer Biol. 31 (2015) 28–35.

[6] C.A. O’Brien, A. Kreso, C.H.M. Jamieson, Cancer stem cells and self-renewal,

Clin. Cancer Res. 16 (2010) 3113–3120.

[7] B.S. Zhou, H. Zhang, M. Damelin, K.G. Geles, J.C. Grindley, P.B. Dirks, Tumour-

initiating cells: challenges and opportunities for anticancer drug discovery,

Nat. Rev. Drug Discovery 8 (2009) 806–823.

[8] P. Dalerba, R.W. Cho, M.F. Clarke, Cancer stem cells: models and concepts,

Annu. Rev. Med. 58 (2007) 267–284.

[9] B.M. Boman, M.S. Wicha, Cancer stem cells: a step toward the cure, J. Clin.

Oncol. 26 (2008) 2795–2799.

[10]  T. Lapidot, C. Sirard, J. Vormoor, B. Murdoch, T. Hoang, J. Caceres-Cortes, et al.,

A cell initiating human acute myeloid leukaemia after transplantation into

SCID mice, Nature 367 (1994) 645–648.

[11]  S.E. Kelly, A. Di Benedetto, A. Greco, C.M. Howard, V.E. Sollars, D.A. Primerano,

et al., Rapid selectionand proliferation of CD133(+) cells from cancer cell lines:

chemotherapeutic implications, PLoS ONE 5 (2010) e10035.

[12]  J. Lee, S. Kotliarova, Y. Kotliarov, A. Li, Q. Su, N.M. Donin, et al., Tumor stem

cellsderived fromglioblastomas cultured in bFGF and EGF more closely mirror

the phenotype and genotype of primary tumors than do serum-cultured cell

lines, Cancer Cell 9 (2006) 391–403.[13]  L. Li, W.B. Neaves, Normal stem cells and cancer stem cells: the niche matters,

Cancer Res. 66 (2006) 4553–4557.

[14]  D. Boral, D. Nie, Cancer stem cells and niche mircoenvironments, Front. Biosci.

(Elite Ed) 4 (2012) 2502–2514.

[15]  V. Plaks, N. Kong, Z. Werb, The cancer stem cell niche: how essential is the

niche in regulating stemnessof tumor cells?, Cell Stem Cell 16 (2015) 225–238

[16]   F. Gattazzo, A. Urciuolo, P. Bonaldo, Extracellular matrix: a dynamic

microenvironment for stem cell niche, Biochim. Biophys. Acta 2014 (1840)

2506–2519.

[17]  A.J. Engler, H.L. Sweeney, D.E. Discher, J.E. Schwarzbauer, Extracellular matrix

elasticity directs stem cell differentiation, J. Musculoskelet. Neuronal Interact.

7 (2007) 335.

[18]  F. Chowdhury, S. Na, D. Li, Y.C. Poh, T.S. Tanaka, F. Wang, N. Wang, Material

properties of the cell dictate stress-induced spreading and differentiation in

embryonic stem cells, Nat. Mater. 9 (2010) 82–88.

[19]   J. Kshitiz, P. Park, W.Kim, A.J. Helen, A. Engler, Levchenko, D.H. Kim, Controlof 

stem cell fate and function by engineering physical microenvironments,

Integr. Biol. (Camb) 4 (2012) 1008–1018.

[20]   O. Chaudhuri, S.T. Koshy, D.C.C. Branco, J.W. Shin, C.S. Verbeke, K.H. Allison,et al., Extracellular matrix stiffness and composition jointly regulate the

S.-p. Qiao et al./ Acta Biomaterialia xxx (2016) xxx–xxx   9

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016),   http://dx.doi.org/

10.1016/j.actbio.2016.04.032

8/16/2019 Qiao 2016

http://slidepdf.com/reader/full/qiao-2016 10/10

induction of malignant phenotypes in mammary epithelium, Nat. Mater. 13

(2014) 970–978.

[21]  S. Han, K. Yang, Y. Shin, J.S. Lee, R.D. Kamm, S. Chung, et al., Three-dimensional

extracellular matrix-mediated neural stemcell differentiation in a microfluidic

device, Lab Chip 12 (2012) 2305–2308.

[22]  J. Liu, Y. Tan, H. Zhang, Y. Zhang, P. Xu, J. Chen, et al., Soft fibrin gels promote

selection and growth of tumorigenic cells, Nat. Mater. 11 (2012) 734–741.

[23]  X. Yang, S.K. Sarvestani, S. Moeinzadeh, X. He, E. Jabbari, Three-dimensional-

engineered matrix to study cancer stem cells and tumorsphere formation:

effect of matrix modulus, Tissue Eng. Part A 19 (2013) 669–684.

[24]  J. Han, L. Chen, G. Luo, B. Dai, X. Wang, J. Dai, Three-dimensional culture maypromote cell reprogramming, Organogenesis 9 (2013) 118–120.

[25]   S.J. Florczyk, K. Wang, S. Jana, D.L. Wood, S.K. Sytsma, J.G. Sham, F.M. Kievit,

et al., Porous chitosan-hyaluronic acid scaffolds as a mimic of glioblastoma

microenvironment ECM, Biomaterials 34 (2013) 10143–10150.

[26]  D.N. Haylock, S.K. Nilsson, Stem cell regulation by the hematopoietic stem cell

niche, Cell Cycle 4 (2005) 1353–1355.

[27]   A. Pietras, A.M. Katz, E.J. Ekstrom, B. Wee, J.J. Halliday, K.L. Pitter, et al.,

Osteopontin-CD44 signaling in the glioma perivascular niche enhances cancer

stem cell phenotypes and promotes aggressive tumor growth, Cell Stem Cell

14 (2014) 357–369.

[28]  B.P. Toole, T.N. Wight, M.I. Tammi, Hyaluronan-cell interactions in cancer and

vascular disease, J. Biol. Chem. 277 (2002) 4593–4596.

[29]   R.K. Sironen, M. Tammi, R. Tammi, P.K. Auvinen, M. Anttila, V.M. Kosma,

Hyaluronan in human malignancies, Exp. Cell Res. 317 (2011) 383–391 .

[30]   C. Aguilar-Gallardo, C. Simon, Cells, stem cells, and cancer stem cells, Semin.

Reprod. Med. 31 (2013) 5–13.

[31]  D.J. Martens, V. Tropepe, D. van Der Kooy, Separate proliferation kinetics of 

fibroblast growth factor-responsive and epidermal growth factor-responsive

neural stem cells within the embryonic forebrain germinal zone, J. Neurosci.

20 (2000) 1085–1095.

[32]  Z. Pan, J. Hooley, D.H. Smith, P. Young, P.E. Roberts, J.P. Mather, Establishment

of human ovarian serous carcinomas cell lines in serum free media, Methods

56 (2012) 432–439.

[33]   H. Matilainen, X.W. Yu, C.W. Tang, M.V. Berridge, M.J. McConnell, Sphere

formation reverses the metastatic and cancer stem cell phenotype of the

murine mammary tumour 4T1, independently of the putative cancer stem cell

marker Sca-1, Cancer Lett. 323 (2012) 20–28.

[34]  C.A. Lopez, L. Deladino, M. Martino, Effect of starch filler on calcium-alginate

hydrogels loaded with yerba mate antioxidants, Carbohydr. Polym. 95 (2013)

315–323.

[35]  L.B. Priddy, O. Chaudhuri, H.Y. Stevens, L. Krishnan, B.A. Uhrig, N.J. Willett, R.E.

Guldberg, Oxidized alginate hydrogels for bone morphogenetic protein-2

delivery in long bone defects, Acta Biomater. 10 (2014) 4390–4399.

[36]  X. Bai, R. Fang, S. Zhang, X. Shi, Z. Wang, X. Chen, et al., Self-cross-linkable

hydrogels composed of partially oxidized alginate and gelatin for myocardial

infarction repair, J. Bioactive Compat. Polym. 28 (2013) 126–140.

[37]  S. Naito, A.C. von Eschenbach, R. Giavazzi, I.J. Fidler, Growth and metastasis of tumor cells isolated from a human renal cell carcinoma implanted into

different organs of nude mice, Cancer Res. 46 (1986) 4109–4115.

[38]   S. Matsuda, T. Yan, A. Mizutani, T. Sota, Y. Hiramoto, M. Prieto-Vila, et al.,

Cancer stem cells maintain a hierarchy of differentiation by creating their

niche, Int. J. Cancer 135 (2014) 27–36.

[39]  F. Chowdhury, Y. Li, Y.C. Poh, T. Yokohama-Tamaki, N. Wang, T.S. Tanaka, Soft

substrates promote homogeneous self-renewal of embryonic stem cells via

downregulating cell-matrix tractions, PLoS ONE 5 (2010) e15655.

[40]  K. Ye, X. Wang, L. Cao, S. Li, Z. Li, L. Yu, et al., Matrix stiffness and nanoscale

spatial organization of cell-adhesive ligands direct stemcell fate, Nano Lett. 15

(2015) 4720–4729.

[41]  Y. Navaro, N. Bleich-Kimelman, L. Hazanov, I. Mironi-Harpaz, Y. Shachaf, S.

Garty, et al., Matrix stiffness determines the fate of nucleus pulposus-derived

stem cells, Biomaterials 49 (2015) 68–76.

[42]  T. Pompe, K. Salchert, K. Alberti, P. Zandstra, C. Werner, Immobilization of 

growth factors on solid supports for the modulation of stem cell fate, Nat.

Protoc. 5 (2010) 1042–1050.

[43]   P.Y. Chen, L.L. Huang, H.J. Hsieh, Hyaluronan preserves the proliferation and

differentiation potentials of long-term cultured murine adipose-derived

stromal cells, Biochem. Biophys. Res. Commun. 360 (2007) 1–6.

[44]   M.A. Solis, Y.H. Chen, T.Y. Wong, V.Z. Bittencourt, Y.C. Lin, L.L. Huang,

Hyaluronan regulates cell behavior: a potential niche matrix for stem cells,

Biochem. Res. Int. 2012 (2012) 346972.

[45]  L.Y. Bourguignon, K. Peyrollier, W. Xia, E. Gilad, Hyaluronan-CD44 interaction

activates stem cell marker Nanog, Stat-3-mediated MDR1 gene expression,and ankyrin-regulated multidrug efflux in breast and ovarian tumor cells, J.

Biol. Chem. 283 (2008) 17635–17651.

[46]  S. Ricardo, A.F. Vieira, R. Gerhard, D. Leitao, R. Pinto, J.F. Cameselle-Teijeiro,

et al., Breast cancer stem cell markers CD44, CD24 and ALDH1: expression

distribution within intrinsic molecular subtype, J. Clin. Pathol. 64 (2011) 937–

946.

[47]   B.A. Pulaski, S. Ostrand-Rosenberg, Mouse 4T1 breast tumor model, Curr.

Protoc. Immunol. (2001). Chapter 20, Unit 20.2.

[48]   V. Silva-Vargas, E.E.Crouch, F. Doetsch, Adult neural stemcells and their niche:

a dynamic duo during homeostasis, regeneration, and aging, Curr. Opin.

Neurobiol. 23 (2013) 935–942.

[49]  J. Voog, D.L. Jones, Stem cells and the niche: a dynamic duo, Cell Stem Cell 6

(2010) 103–115.

[50]  E. Fuchs, T. Tumbar, G. Guasch, Socializing with the neighbors: stem cells and

their niche, Cell 116 (2004) 769–778.

[51]   T. Xie, L. Li, Stem cells and their niche: an inseparable relationship,

Development 134 (2007) 2001–2006.

[52]  Y. Li, G. Guo, L. Li, F. Chen, J. Bao, Y.J. Shi, et al., Three-dimensional spheroid

culture of human umbilical cord mesenchymal stem cells promotes cell yield

and stemness maintenance, Cell Tissue Res. 360 (2015) 297–307.

[53]  J. Wei, J. Han, Y. Zhao, Y. Cui, B. Wang, Z. Xiao, et al., The importance of three-

dimensional scaffold structure on stemness maintenance of mouse embryonic

stem cells, Biomaterials 35 (2014) 7724–7733.

[54]  S. Han, Y. Zhao, Z. Xiao, J. Han, B. Chen, L. Chen, et al., The three-dimensional

collagen scaffold improves the stemness of rat bone marrow mesenchymal

stem cells, J. Genet. Genomics 39 (2012) 633–641.

[55]  H. Zheng, S. Liu, W. Tian, H. Yan, Y. Zhang, Y. Li, A three-dimensional in vitro

culture model for primary neonatal rat ventricular myocytes, Curr. Appl. Phys.

12 (2012) 826–833.

[56]   A.D. Augst, H.J. Kong, D.J. Mooney, Alginate hydrogels as biomaterials,

Macromol. Biosci. 6 (2006) 623–633.

[57]  Y. Feng, X. Dai, X. Li, H. Wang, J. Liu, J. Zhang, et al., EGF signalling pathway

regulates colon cancer stem cell proliferation and apoptosis, Cell Prolif. 45

(2012) 413–419.

[58]  Y. Ma, D. Liang, J. Liu, K. Axcrona, G. Kvalheim, K.E. Giercksky, J.M. Nesland,

et al., Synergistic effect of SCF and G-CSF on stem-like properties in prostate

cancer cell lines, Tumour Biol. 33 (2012) 967–978.[59]  C. Ginestier, S. Liu, M.E. Diebel, H. Korkaya, M. Luo, M. Brown, et al., CXCR1

blockade selectively targets human breast cancer stem cells in vitro and in

xenografts, J. Clin. Invest. 120 (2010) 485–497.

[60]  R.L. Driessen, H.M. Johnston, S.K. Nilsson, Membrane-bound stem cell factor is

a key regulator in the initial lodgment of stem cells within the endosteal

marrow region, Exp. Hematol. 31 (2003) 1284–1291.

[61]   Y. Miyatake, N. Sheehy, S. Ikeshita, W.W. Hall, M. Kasahara, Anchorage-

dependent multicellular aggregate formation induces CD44 high cancer stem

cell-like ATL cells in an NF-kappaB- and vimentin-dependent manner, Cancer

Lett. 357 (2015) 355–363.

10   S.-p. Qiao et al./ Acta Biomaterialia xxx (2016) xxx–xxx

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016),   http://dx.doi.org/