PROTEOMICS APPROACH ON THE IDENTIFICATION OF

VIRULENCE FACTORS OF ENTEROPATHOGENIC AND

ENTEROHEMORRHAGIC ESCHERICHIA COLI (EPEC AND EHEC)

AND FURTHER CHARACTERIZATION OF TWO EFFECTORS:

ESPB AND NLEI

BY

LI MO (M. SC.)

A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE

2006

i

ACKNOWLEDGEMENTS

I wish to express my heartfelt gratitude to my main supervisor, Professor Hew Choy

Leong for his care and guidance. His clement character and esteemed research passion

inspirit me through my study. I wish to express my heartful thanks to my co-supervisor,

Associate Professor Leung Ka Yin for his supervision and advice. He had planned

properly and provided many opportunities for my research. I would sincerely thank

Professor Ilan Rosenshine from the Hebrew University, Israel, for his sound instruction

and generous sharing of ideas and experiences.

My Special thanks will also go to my PhD. Committee members. Thank you for spending

so much time in reviewing my thesis and audit my presentation. I would like to take this

opportunity to thank Dr. Lin Qingsong, Dr. John Foo, Ms Wang Xianhui and Ms Kho

Say Tin from the Protein and Proteomics Center for their kind assistance in mass

spectrometry, protein sequencing and data analysis. Further thank goes to Mr. Shashikant

Joshi for his reviewing and suggestions on my thesis.

My appreciation also goes to my previous and present lab members: Dr Yu Hongbing,

Dr Seng Eng Khuan, Dr Srinivasa Rao, Dr Tan Yuan Peng, Dr Yamada, Dr. Li Zhengjun,

Dr. Xie Haixia , Ms Tung Siew Lai, Mr. Zheng Jun, Mr. Peng Bo, Mr. Zhou Wenguang,

Ms Tang Xuhua, Mr. Liu Yang, Mr. Wang Fan, Mr. Chen Liming, for their

encouragement, help, assistance and company.

I would also like to thank my good friends Wang Xiaoxing, Hu Yi, Qian Zuolei, Sheng

Donglai, Luo Min, Tu Haitao, Sun Deying, Alan John Lowton. I appreciate their

friendship and their valuable suggestions, advice and help throughout my study. My

fellow labmates and other friends who have helped me one-way or another during the

course of my project are also greatly appreciated.

Last, but not least, I would like to thank my family members, my father, my mother and

my sister, who are always standing by me to give their utmost support. Their courage and

consolidation is the most powerful strength and is never separated by the distance, which

company me throughout my PhD process.

ii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ····························································································· i

TABLE OF CONTENTS································································································ii

LIST OF PUBLICATIONS RELATED TO THIS STUDY········································ ix

LIST OF FIGURES ········································································································ x

LIST OF TABLES ·······································································································xiii

LIST OF ABBREVIATIONS ······················································································xiv

SUMMARY ··················································································································xvi

Chapter I. Introduction ·································································································· 1

I.1. Escherichia coli-the opportunistic infectious pathogen ······································ 2

I.1.1. Pathogenic E. coli ··························································································· 2

I.1.2. Epidemiology of EPEC ·················································································· 5

I.1.3. Epidemiology of EHEC ················································································· 6

I.2. Pathogenesis and virulence factors of EPEC and EHEC··································· 7

I.2.1. EPEC pathogenesis and virulence factors···················································· 8

I.2.1.1. Attaching and effacing histopathology ·················································· 8

I.2.1.2. Localized Adherence (LA) and Bundle Forming Pili (BFP) ·············· 10

I.2.1.3. EAF plasmids ························································································ 11

I.2.1.4. Invasion·································································································· 12

iii

I.2.1.5. Flagella··································································································· 13

I.2.1.6. Serine Protease - EspC·········································································· 14

I.2.1.7. Heat-stable enterotoxin (EAST1). ························································ 14

I.2.2. EHEC pathogenesis and virulence factors ················································· 15

I.2.2.1. Shiga toxin ····························································································· 15

I.2.2.2. Intestinal adherence factors ································································· 16

I.2.2.3. Invasion·································································································· 17

I.2.2.4. Flagella··································································································· 18

I.2.2.5. pO157 plasmid······················································································· 19

I.2.2.6. Serine protease ······················································································ 19

1.2.2.6.1. EspP ································································································ 19

I.2.2.6.2. StcE ································································································· 20

I.2.2.7. Heat-stable enterotoxin (EAST1). ························································ 21

I.2.2.8. Iron transport.······················································································· 22

I.2.3. Type Three Secretion System (TTSS) in EPEC and EHEC ····················· 22

I.2.3.1. Pathogenicity island (PAI)···································································· 23

I.2.3.2. Components of TTSS in EPEC and EHEC ········································· 24

I.2.3.2.1. Components of TTSS basal body ·················································· 25

I.2.3.2.2. TTSS translocators········································································· 26

I.2.3.2.3. LEE encoded adhesin····································································· 27

I.2.3.2.4. LEE encoded TTSS regulators ······················································ 29

I.2.3.2.5. Switches of TTSS translocators and effectors ······························ 29

I.2.3.3.6. TTSS chaperons ············································································· 30

iv

I.2.3.3.7. TTSS secreted Effectors································································· 30

I.3. Objectives ············································································································ 33

Chapter II. Common materials and methods······························································ 35

II.1. Common used medium and buffer··································································· 35

II.2. Bacteria strains and plasmids··········································································· 35

II.3. Tissue culture····································································································· 35

II.4. Molecular biology techniques ··········································································· 36

II.4.1. Genomic DNA isolation·············································································· 36

II.4.2. Cloning DNA fragments and transformation into E. coli cells················ 36

II.4.3. Analysis of plasmid DNA ··········································································· 37

II.4.4. Plasmid DNA isolation and purification ··················································· 37

II.4.5. DNA sequencing ························································································· 38

II.4.6. Sequence analysis ······················································································· 38

II.4.7. Southern hybridization ·············································································· 39

II.5. Protein techniques ····························································································· 40

II.5.1. Preparation of ECPs from E. coli strains ················································· 40

II.5.2. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)

································································································································ 40

II.5.3. Visualization of protein bands/spots (Coomassie blue staining and silver

staining)·················································································································· 41

II.5.4. Western blotting ························································································· 42

v

Chapter III. Comparative proteomics analysis of extracellular proteins of

enterohemorrhagic and enteropathogenic Escherichia coli and their ······················· 44

Abstract······················································································································ 45

III.1. Introduction ····································································································· 46

III.2. Materials and methods ···················································································· 48

III.2.1. Bacterial strains and culture conditions ·················································· 48

III.2.2. Proteins isolation and assay······································································ 49

III.2.3. One- and two-dimensional gel electrophoresis········································ 49

III.2.4. Tryptic in-gel digestion and MALDI-TOF MS analysis························· 50

III.3. Results and discussion ····················································································· 51

III.3.1. ECP production ························································································ 51

III.3.2. Extracellular Proteomes of EHEC and EPEC ········································ 59

III.3.3. Identification of Ler and IHF regulated proteins ··································· 63

III.3.4. Applications and conclusions ··································································· 67

Chapter IV. Characterization of EspB as a translocator and an effector and its

involvement in EPEC autoaggregation········································································ 68

Abstract······················································································································ 69

IV.1 Introduction ······································································································ 70

IV.2. Materials and methods ···················································································· 72

IV.2.1. Bacterial strains and plasmids ································································· 72

IV.2.1. Fractionation of infected HeLa cells ························································ 73

IV.2.2. Invasion assay···························································································· 73

vi

IV.2.3. Examination of bacterial surface exposed structure by transmission

electron microscopy (TEM) ·················································································· 74

IV.2.4. Phase contrast microscopy ······································································· 74

IV.2.5. Construction of plasmid for expression of EspB-TEM and β-lactamase

based translocation assay······················································································ 75

IV.2.6. Edman N-terminal sequencing ································································· 75

IV.3. Results··············································································································· 76

IV.3.1. Survey of the two forms of EspB······························································ 76

IV.3.2. Mutation of espB did not affect the secretion of other extracellular

proteins··················································································································· 77

IV.3.3. Mutation of espB mutant abolished the translocation of effectors ········ 80

IV.3.4. EspB is translocated into infected HeLa cells·········································· 80

IV.3.5. EspB is involved in the autoaggregation·················································· 83

IV.3.6. EspB mutant does not form the autoaggregation ··································· 83

IV.3.7. ∆espB mutant showed less extracellular filamentous appendages ········· 86

IV.3.8. ∆espB mutant has lower invasion ability ················································· 87

IV. 4. Discussion ········································································································ 89

IV. 5. Conclusion ······································································································· 92

Chapter V. Identification and Characterization of NleI, a New Non-LEE-encoded

Effector of Enteropathogenic Escherichia coli (EPEC) ·············································· 93

Abstract······················································································································ 94

V.1. Introduction ······································································································· 95

vii

V.2. Material and methods ······················································································· 98

V.2.1. Bacteria strains and culture conditions····················································· 98

V.2.2. Tissue culture conditions············································································ 98

V.2.3. Construction of deletion mutants and plasmids ······································· 98

V.2.4. Flow cytometric analysis ············································································ 99

V.2.5. 2-D SDS-PAGE and proteomics ······························································ 100

V.2.6. Fractionation of infected HeLa cells························································ 100

V.2.7. Expression and Immunoblot analysis······················································ 101

V.2.8. Translocation assay ·················································································· 102

V.2.9. Fluorescence microscopy for observation of translocation, transfection

and actin condensation························································································ 102

V.3. Results ·············································································································· 106

V.3.1. Identification of NleI from EPEC sepL and sepD mutants ···················· 106

V.3.2. NleI is located within a prophage-associated island in EPEC ··············· 107

V.3.3. NleI is a secreted protein and the secretion of NleI is TTSS-dependent113

V.3.4. NleI is translocated into the host cells ····················································· 116

V.3.5. CesT is involved in the translocation but not the stabilization of NleI · 119

V.3.6. NleI is localized in the host cytoplasm and membrane ·························· 119

V.3.7. NleI is regulated by SepD but not regulated by Ler and SepL at the

transcriptional level····························································································· 124

V.3.8. NleI is not involved in the filopodia and pedestal formation ················· 125

V.4. Discussion········································································································· 128

V.5. Conclusion········································································································ 130

viii

Chapter VI. General conclusions and future directions ··········································· 132

VI.1. General conclusions ······················································································· 132

VI.2. Future directions···························································································· 134

Reference ····················································································································· 137

ix

LIST OF PUBLICATIONS RELATED TO THIS STUDY

1. Li, M., I. Rosenshine, S.L. Tung, X.H. Wang, D. Friedberg, C.L. Hew, and K.Y.

Leung. 2004. Comparative proteomics analysis of extracellular proteins of

enterohemorrhagic and enteropathogenic Escherichia coli and their ihf and ler

mutants. Appl. Environ. Microbiol. 70:5274-5282.

2. Li, M., I. Rosenshine, H.B. Yu, C. Nadler, E. Mills, C.L. Hew, and K.Y. Leung.

Identification and characterization of NleI, a new non-LEE-encoded effector of

enteropathogenic Escherichia coli (EPEC). (Microbes and Infection. 2006.

Accepted.)

3. Li, M., I. Rosenshine, and K. Y. Leung. Characterization of EspB as a translocator

and an effector and its involvement in EPEC autoaggregation. (In preparation)

x

LIST OF FIGURES

Fig. I.1. Characteristic EPEC A/E lesion observed in the ileum after oral inoculation of gnotobiotic piglets.

9

Fig. I.2. Genetic organization of the EPEC / EHEC Locus of Enterocyte Effacement (LEE) pathogenicity island.

10

Fig. I.3. Schematic representation of the EPEC/EHEC type III secretion apparatus.

28

Fig. III.1. Growth and protein secretion of EHEC EDL933 and EPEC E2348/69 in DMEM at 37oC with 5% (v/v) CO2.

52

Fig. III.2. Comparison of ECP production among EHEC EDL933 and EPEC E2348/69 wild type strains and their ler mutants.

53

Fig. III.3. Extracellular proteins from EHEC EDL933. 54

Fig. III.4. Extracellular proteins from EPEC E2348/69. 55

Fig. III.5. Comparative proteome analysis of EHEC EDL933 wild type strain, the ler mutant (DF1291) and ihf mutant (DF1292).

65

Fig. III.6. Comparative proteome analysis of EPEC E2348/69 wild type strain, the ler mutant (DF2) and ihf mutant (DF1).

66

Fig. III.7. One-D SDS PAGE of the ECPs from EHEC EDL933 and EPEC E2348/69 wild type strains, the ler mutants and ihf mutants.

66

Fig. IV.1. Extracellular proteins (ECPs) from EPEC E2348/69 (a) and EHEC EDL933 (b) treated with alkaline phosphatase.

77

Fig. IV.2. Protein secretion of EPEC strains in DMEM at 37oC.

78

xi

Fig. IV.3. Comparative proteomics analysis of ECP from EPEC E2348/69 wild type strain and the ∆espB mutant.

79

Fig. IV.4. Western blot analysis of Triton X-100 insoluble and soluble fractions of HeLa cells after infected with the EPEC wild type and the ∆espB mutant and detected with anti-Tir antibody.

79

Fig. IV.5. Demonstration of the translocation of EPEC EspB proteins into live HeLa cells by using TEM-1 fusions and fluorescence microscopy.

82

Fig. IV.6. Autoaggregation of EPEC in DEM culture is conferred by EspB. 84

Fig. IV.7. Microscopic observation of EPEC demonstration of EPEC E2348/69, ΔespB and ΔespB / pQEespB strains cultured in DMEM.

85

Fig. IV.8. Transmission electron microscopy showed the extracellular filamentous appendages of the EPEC wild type and ∆espB mutant.

86

Fig. IV.9. EPEC espB mutant showed reduced ability to invade HeLa cells. 88

Fig. V.1. Comparative analysis of the extracellular proteomes (ECPs) from the EPEC wild type E2348/69, the sepL::Tn10 mutant, and the ∆sepD mutant.

109

Fig. V.2. Graphic representation of the putative prophage-associated island that contains NleI by comparing the EPEC E2348/69 and the E. coli K12 MG1655 genomes.

110

Fig. V.3. Southern blot analysis of genomic DNA from EPEC E2348/69, Citrobacter rodentium DBS100 (CR), EHEC EDL933, and E. coli K12 MG1655.

111

Fig. V.4. Comparative proteome analysis of the ECPs from EPEC sepL::Tn10 mutant, sepL::miniTn10Kan ∆nleI mutant and sepL::miniTn10Kan ∆nleI / pACAYCnleI mutant.

112

Fig. V.5. Western blot analysis of secreted proteins and total proteins of EPEC E2348/69 wild type and the TTSS secretion mutant escN::TnPhoA expressing pSAnleI-6His with anti-6His antibody.

114

xii

Fig. V.6. NleI is secreted into the culture supernatant and translocated into live HeLa cells in a TTSS-dependent manner.

115

Fig. V.7. Demonstration of the translocation of EPEC effector proteins into live HeLa cells by using TEM-1 fusion proteins.

118

Fig. V.8. NleI is translocated by the EPEC wild type E2348/69 into HeLa cells in a CesT-dependent manner.

121

Fig. V.9. Western blot analysis of HeLa cell fractions after infection of the EPEC E2348/69 wild type and the TTSS secretion mutant escN::TnphoA expressing pSAnleI-6His.

122

Fig. V.10. Confocal microscopy demonstrates that NleI is localized in the cytoplasm and the nuclei of HeLa cells.

123

Fig. V.11. Flow cytometric analysis of the GFP intensity of the EPEC wild type E2348/69, ler::Kan, sepL::Tn10, and ∆sepD mutants, carrying pDN-gfp or pDNnleI-gfp.

126

Fig.V.12. NleI is not affecting actin condensation underneath the EPEC infection sites.

127

xiii

LIST OF TABLES

Table II.1. Bacterial strains and plasmid used in this study

43

Table III.1. Bacteria strains used in this study

48

Table III.2. Summary of the common extracellular proteins of EHEC and

EPEC identified by MALDI-TOF MS

56

Table III.3. Summary of the specific extracellular proteins of EHEC and EPEC respectively identified by MALDI-TOF MS

58

Table IV.1. Bacteria strains and plasmids used in this study 72

Table V.1. Bacteria strains and plasmids used in this study

104

Table V.2. Oligonucleotides used in this study

105

xiv

LIST OF ABBREVIATIONS

1D one-dimensional

2D two-dimensional

aa amino acid

Ampr ampicillin-resistant

BCIP 5-bromo-4-chloro-3-indolyl phosphate

bp base pairs

BSA bovine serum albumin

CFU colony forming units

Cm centimeter(s)

Cmr chloramphenicol-resistant

ºC degree Celsius

DMEM Dulbecco's Modified Eagle Medium

DNA deoxyribonucleic acid

ECP extracellular protein

EDTA ethelyne diamine tetra acetic acid

FBS fetal bovine serum

g gravitational force

HBSS Hank’s balanced salts solution

HEPES N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid

IEF isoelectric focussing

IPTG isopropyl-thiogalactoside

kb kilobase

Kanr kanamycin-resistant

l litre(s)

LB Luria-Bertani broth

LBA Luria-Bertani agar

M molarity, moles/dm3

MALDI matrix-assisted laser desorption ionization

MEM minimal essential medium

xv

mg milligram(s)

min Minute

ml milliliter(s)

mM milli moles/dm3

MOI multiplicity of infection

NBT Nitro blue tetrazolium

orf open reading frame

OD optical density

% Percentage

PAGE Poly acrylamide gel electrophoresis

PBS phosphate buffered saline

PCR polymerase chain reaction

pI isoeletric point

PPD Primary Prtoduction Department

ppm parts per million

PVDF Polyvinylidene difluoride

s second

SDS sodium dodocyl sulfate

Tcr tetracycline-resistant

TE Tris-EDTA

TOF time-of-flight

TTSS type III secretion system

U unit(s)

µg microgram(s)

µl microlitre(s)

wt wild type

v/v volume per volume

w/v weight per volume

X-gal 5- bromo-4-chloro-3-indolyl-B-D-galactopyranoside

xvi

SUMMARY Enteropathogenic and enterohemorrhagic Escherichia coli (EPEC and EHEC) are two

closely related human pathogens responsible for sever diarrhea in many countries. The

hallmark of infections caused by EHEC and EPEC is the attaching and effacing (A/E)

lesions on the epithelial cells. EPEC and EHEC utilize the type III secretion systems

(TTSSs) encoded on the locus of enterocyte effacement (LEE) to secrete and translocate

several effectors into host cells. The effectors may subvert the host signaling transduction

pathways and consequently cause diseases.

To further understand the pathogenesis and dissect the virulence of EPEC and EHEC, a

proteomics approach was used to analyze the extracellular protein (ECP) profiles of

EPEC, EHEC and their various mutants. Several common or strain specific virulence

factors identified from the extracellular proteomes of EPEC and EHEC indicate the close

relationship and variations between these two pathogens. Some novel proteins were also

identified by this proteomics approach, such as putative adhesins, secreted proteins and

phage related proteins. These novel proteins provided new candidates for exploiting

potential virulence factors of EPEC and EHEC.

One of the major secreted proteins, EspB, was found to have two dominant forms in

extracellular proteomics profiles of EPEC and EHEC. The two forms of EspB were

shown to remain unmodified at their N-terminus and they were unphosphorylated. With a

translocation signal at N-terminus, EspB was demonstrated to be an effector and to be

translocated into the host cells by TTSSs. By mutagenesis study, EspB was shown to be

xvii

involved in the EPEC aggregation and the ∆espB mutant has a lower invasion ability

when compared to the wild type. Transmission electron microscopy (TEM) showed that

EspB may affect the surface filamentous TTSS composition which may mediate the

bacteria cell interaction.

Furthermore, a putative effector, NleI, was identified from EPEC sepL and sepD mutants

by comparative proteomics study. NleI was found to be encoded outside the LEE region

and to exist in other A/E pathogens including EHEC and Citrobacter rodentium (CR).

The expression of NleI was found to be regulated by SepD at the transcriptional level.

After identifying the secretion and translocation signal at its N-terminal, NleI was

demonstrated to be translocated into HeLa cells in a TTSS dependent manner and the

translocation was facilitated by CesT. Using sub-cellular fractionation and fluorescence

microscopy, NleI was found to be localized in HeLa cell membrane and cytosol without

obvious cytotoxic effect. Fluorescent actin staining (FAS) indicated that NleI did not

affect the filopodia and pedestal formation of HeLa cells during infection.

This study has established a proteomics platform for accelerating the understanding of

EPEC and EHEC pathogenesis and identifying markers for laboratory diagnosis of these

pathogens. The discovery of new secreted proteins and new effectors by comparative

proteomics approach has provided valuable information on new virulence factors in

EPEC and EHEC. These results further supported the notion that EPEC and EHEC may

use multiple virulence factors to exploit the host cells and many factors may coordinate to

subvert different facets of host cellular processes.

1

Chapter I. Introduction

Microbial infection is one of the major causes of disease and mortality in humans.

Although infectious diseases have reduced the threat significantly due to improved

hygiene and sanitation, they are still a major public health problem worldwide. More

attention and efforts have been directed to study the mechanisms of infectious diseases

and to develop the diagnostic methods with particular emphasis on microbes. Among the

wide variety of infectious micro organisms, bacteria are problematic pathogens causing

many morbidity and mortality associated outbreaks around the world. The consequence

elicited by bacterial infections are diverse including food poisoning, diarrhea, meningitis,

lyme disease, pneumonia, tooth ache, anthrax, and even some forms of cancers

(www.who.int). Diarrhea is one of the most important illness caused by enteric bacteria,

with over 2 million deaths occurring each year, particularly among infants younger than 5

years old (www.who.int). Much research has been focused upon the pathogensis of these

bacteria in order to understand their mechanisms of infection and to develop the

diagnostics and therapeutics for these pathogens. Enteropathogenic Escherichia coli

(EPEC) and enterohemorrhagic Escherichia coli (EHEC) are two of the most common

human pathogens which constitute a significant risk to human health worldwide. The

present study attempts to investigate and understand the pathogenesis of EPEC and

EHEC. Approaches for understanding the pathogenesis of EPEC and EHEC, which

involves studying the molecular and cellular basis of microbial pathogenesis and host-

pathogen interaction, are the major focuses.

2

I.1. Escherichia coli-the opportunistic infectious pathogen

Among the members of the normal micro biota of the human intestine, E. coli strains are

the predominant facultative anaerobic inhabitants of the intestines of all animals,

including humans. When aerobic culture methods are used, E. coli strains are the

dominant species found in feces. These organisms typically colonize the gastro-intestinal

tract within a few hours and interact with the hosts after settling down on certain sites.

Once established, E. coli strains may persist for months or years. Resident strains shift

over a long period (weeks to months), and more rapidly after enteric infection or

antimicrobial chemotherapy that perturbs the normal flora. Normally E. coli strains serve

useful functions in animal bodies by suppressing the growth of harmful bacterial species

and by synthesizing appreciable amounts of vitamins. Remaining harmlessly confined to

the intestinal lumen, E. coli strains usually interact with host cells to derive mutual

benefit. Most E. coli live inside the human gastro-intestinal tract without causing any

symptoms of disease. However, a minority of E. coli strains are capable of causing

human illness by several different mechanisms and are called “pathogenic E. coli”.

I.1.1. Pathogenic E. coli

Diseases caused by pathogenic E. coli are numerous and include urinary tract infections

(UTI), meningitis, diarrhea, wound infections, septicemia and even endocarditic disease.

A lot of efforts have been put on to identify pathogenic E. coli and there have been

significant advances in our understanding of the pathogenesis of E. coli infection.

Urinary tract infections are a serious health problem affecting millions of people each

year. Most infections of the urinary tract are caused by one type of bacteria called

3

uropathogenic E. coli (UPEC) and are by far the second most common type of bacteria

infection in the body (Foxman et al., 2000). UTI can range in severity from asymtomatic

through bacteriuria, cystitis and pyelonephritis. UPEC colonizes from the feces or

perineal region and ascend the urinary tract to the bladder. With the aid of specific

adhesins, such as type 1 fimbria, S fimbria, P fimbria and Dr family of adhesins, UPEC is

able to colonize the bladder (Mulvey et al., 2000; Bahrani-Mougeot et al., 2002). To

acquire iron during or after colonization, UPEC produces siderophore and hemolysin and

utilizes the hemoglobin and heme released from lysed erythrocytes (Hantke et al., 2003).

These virulence factors function jointly causing the infection and inflammatory

symptoms in the urinary tract.

Meningitis is the inflammation of the membranes covering the brain and spinal cord.

Though multiple organisms may cause meningitis, E. coli is the leading agent responsible

for around 20% of the neonatal meningitis cases (Health et al., 2003). Meningitis is a

substantial cause of morbidity and mortality in neonates. Typically transmitted via

respiratory droplets, E. coli strains invade the blood stream of infants from the

nasopharynx or gastro-intestinal (GI) tract and are carried to the meninges where they

usually lead to infection of the meninges. The K1 E. coli is considered the major

pathogenic strain of E. coli that causes neonatal meningitis.

Pathogenic E. coli are also well known for their ability to cause intestinal diseases. Six

classes of E. coli that cause diarrhea diseases are now recognized: enterotoxigenic E. coli

(ETEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAggEC), diffusely

4

adherent E. coli (DAEC), EHEC and EPEC (Nataro and Kaper, 1998). Each class falls

within a serological subgroup and manifests distinct features in pathogenesis. ETEC is an

important cause of diarrhea in infants and travelers in developing countries or regions of

poor sanitation. It was first isolated from piglets and was further identified as a human

pathogen too. ETEC colonizes the surface of the small bowel mucosa and causes diarrhea

through secretion of heat-labile (LT) and heat-stable (ST) enterotoxins. EIEC closely

resembles Shigella in their invasive mechanisms and the nature of clinical illness they

produce. EIEC penetrates and multiplies within epithelial cells of the colon causing

widespread cell destruction. The clinical syndrome is similar to Shigella dysentery and

includes a dysentery-like diarrhea with fever. The distinguishing feature of EAggEC

strains is their ability to attach to tissue culture cells in an aggregative manner. These

strains are associated with persistent diarrhea in young children. DAEC displays a

diffusive adherence phenotype to cultured HEp-2 cells. They are responsible for some

diarrhea cases in children of ages from 1-5 years. Their surface fimbria and outer

membrane protein may mediate the diffusive adherence phenotype of DAEC. EPEC and

EHEC are two major pathotypes of diarrhea E. coli. They can induce watery diarrhea or

bloody diarrhea, and thus, are distinct from other diarrhea E. coli groups. These two

pathogenic E. coli affect the infants and adults world wide and have become the well

recognized human pathogens. Our present work is mainly focused on EPEC and EHEC

and the epidemiology and pathogenesis of these two pathogens will be further discussed

in the following paragraphs.

5

I.1.2. Epidemiology of EPEC

EPEC refers to an important category of diarrheagenic E. coli that were first identified in

epidemiological studies in the 1940s and 1950s as causes of epidemic and sporadic

infantile diarrhea (Levine and Edelman, 1984). EPEC is an established aetiological agent

of human diarrhea and remains an important cause of infant mortality in developing

countries (Nataro and Kaper, 1998). The most notable feature of the epidemiology due to

EPEC is the striking age distribution seen in persons infected with this pathogen. EPEC

infection is primarily a disease of infants younger than 2 years and the infection can often

be quite severe, and many clinical reports emphasize the severity of the disease (Bower et

al., 1989; Rothbaum et al., 1982). Several outbreaks of diarrhea due to EPEC have been

reported in healthy adults, presumably due to ingestion of a large inoculum from a

common source (Viljamen, et al., 1990; Hedberg et al., 1997). Sporadic disease has also

been seen in some adults with compromising factors such as diabetics, achlohydria

(Levine and Edelman, 1984).

The transmission of EPEC is through fecal-oral route with contaminated hands and

materials. The reservoir of EPEC infection is thought to be symptomatic or asymptomatic

children or adult carriers (Levine and Edelman, 1984). Numerous studies have

documented the spread of infection through hospitals, nurseries, and day care centers

from an index case (Bower et al., 1989, Wu and Peng 1992). Epidemiologic studies in

several countries have shown high backgrounds of asymptomatic carriage. In

symptomatic patients, EPEC can be isolated from stools up to 2 weeks after cessation of

symptoms (Hill et al., 1991). Although animals such as rabbits, pigs, and dogs have

EPEC-like organisms associated with disease (Zhu et al., 1994; Nakazato et al., 2004),

6

the serotypes found in these animal pathogens are usually not human serotypes (Krause et

al., 2005; Leomil et al., 2005).

I.1.3. Epidemiology of EHEC

EHEC is the causative agents of hemorrhagic colitis, a bloody diarrhea that usually

occurs without fecal leukocytosis or fever. Although more than 25 serotypes of EHEC

have been isolated from hemorrhagic colitis cases, O157:H7 is the predominant EHEC

serotype isolated in outbreaks of hemorrhage colitis (Griffin 1995). EHEC O157:H7 was

the cause of several large outbreaks of disease in North America, Europe, Japan and some

developing countries (Griffin and Tauxe 1991, Yoshioka et al., 1999). Numerous

epidemiological studies have demonstrated an association between hemorrhagic colitis

caused by EHEC and the subsequent development of a life-threatening systemic

complication referred to as the hemolytic uremic syndrome (HUS) (Boyce et al., 1995).

HUS most commonly presents as acute renal failure accompanied by the swelling and

detachment of glomerular endothelial cells and hemolytic anemia with schistocytosis.

HUS following EHEC infection is now recognized as the most common cause of

pediatric acute renal failure in many developed nations. Patients with EHEC infections

are also at increased risk of neurological abnormalities such as seizures, cortical

blindness and coma (Siegler 1995).

EHEC can be transmitted by food and water and from person to person. Most cases are

caused by ingestion of contaminated foods, particularly foods of bovine origin. A very

7

low infectious dose for EHEC infection has been estimated from outbreak investigations.

EHEC has a wide reservoir of various animals, including cattle, sheep, goats, pigs, cats,

dogs, chicken and gulls (Beutin et al., 1993; Griffin and Tauxe 1991; Johnson et al., 1996;

Wai et al., 1996). The most important animal host other than human is cattle. High rates

of colonization of Shiga-like toxins (Stxs) positive EHEC have been found in bovine

herds in many countries.

I.2. Pathogenesis and virulence factors of EPEC and EHEC

Pathogenic E. coli strains differ from those that predominate in the enteric flora of

healthy individuals in that they are more likely to express virulence factors which are

molecules directly involved in pathogenesis but ancillary to normal metabolic functions.

In addition to their roles in disease processes, these virulence factors presumably enable

the pathogenic strains to explore niches unavailable to commensal strains, and thus to

spread and persist in the bacterial community. EPEC and EHEC colonize the intestinal

mucosa, subvert the intestinal epithelial cell signal transduction and demolish the

function of host cells, and subsequently cause diarrhea diseases. These two enteric E. coli

are closely related pathogens sharing many similarities in their virulence determinants.

Many similar virulence factors of EPEC and EHEC distinguish them from non-

pathogenic E. coli strains. Though EHEC strains are considered to have evolved from

EPEC strains through acquisition of bacteriophages encoding Shiga-like toxins (Stxs)

(Reid et al., 2000; Wick et al., 2005), there are still differences in their pathogenesis

independent of Stxs activity. To expound the difference and similarity of EPEC and

EHEC, their pathogenesis and virulence factors will be separately discussed below.

8

I.2.1. EPEC pathogenesis and virulence factors

Although EPEC was the first E. coli to be associated with human disease, it was not until

the late 1980s and early 1990s that the mechanisms and bacterial gene products used by

EPEC to induce the attaching and effacing lesions and diarrhea disease started to be

unraveled.

I.2.1.1. Attaching and effacing histopathology

The typical histopathology changes caused by EPEC infections is the attaching and

effacing (A/E) lesion, which can be observed in intestinal biopsy specimens from patients

or infected animals and can be reproduced in cell cultures (Polotsky et al., 1977; Moon,

et al., 1983; Andrade, et al., 1989; Ulshen and Rollo, 1980). This striking phenotype is

characterized by effacement of microvilli and intimate adherence between the bacterium

and the epithelial cell membrane (Fig. I.1.). Marked cytoskeletal changes including the

accumulation of polymerized actin, are seen directly beneath the adherent bacteria, where

the bacteria sit upon a pedestal-like structure (Fig. I.1.; Taylor et al., 1986; Jerse et al.,

1990). These pedestal structures can extend up to 10 mm out from the epithelial cell in

pseudopod like structures (Moon et al., 1983). It is observed that the composition of the

A/E lesion contained high concentrations of polymerized filamentous actin (Knutton et

al., 1989). This observation led to the development of the fluorescent-actin staining (FAS)

test which enabled the screening of clones and mutants, resulted in the identification of

the bacterial genes involved in producing this pathogenic lesion. Similar A/E lesions are

seen in animal and cell culture models of EHEC, Citrobacter rodentium (CR), Hafnia

alvei and a variety of E. coli strains isolated from animals. Thus, EPEC strains are the

9

prototype of an entire family of enteric pathogens that produce A/E lesions on the

epithelial cells. The proteins which are responsible for A/E lesion are encoded in Locus

of Enterocyte Effacement (LEE) pathogenicity island (PAI) (Fig. I.1.) This LEE PAI

composed of 41 genes which are organized in five major polycistronic operons (LEE1-

LEE5). Many virulence features of the A/E pathogens are related to this LEE PAI which

will be discussed in detail in the type III secretion system (TTSS) section (I.2.3).

Fig. I.1. Characteristic EPEC A/E lesion observed in the ileum after oral inoculation of gnotobiotic piglets. Note the intimate attachment of the bacteria to the enterocyte membrane with disruption of the apical cytoskeleton. Note the loss of microvilli and the formation of a cup-like pedestal to which the bacterium is intimately attached (highlighted by circle). Reprinted from Baldini et al., 1983b.

10

Fig. I.2. Genetic organization of the EPEC / EHEC Locus of Enterocyte Effacement

(LEE) pathogenicity island. (This figure was reprinted from Deng et al., 2004)

I.2.1.2. Localized Adherence (LA) and Bundle Forming Pili (BFP)

In the early 1980s, investigators reported that EPEC strains adhere to tissue culture cells

in densely packed three-dimensional clusters on the surface of the host cells (Baldini et

al., 1983). This particular pattern of EPEC strains adherence was known as localized

adherence (LA). This pattern of adherence is so characteristic of and specific to EPEC

strains that it can be used as the basis for diagnostics (Cravioto et al., 1991). It is found

that the factor mediating this LA of EPEC was certain rope-like fimbriae called bundle

forming pili (BFP) (Giron et al., 1991). Strains of E. coli produce various types of

adherence pili, some of which may be involved in pathogenicity (Hacker 1992). The BFP

produced by EPEC are 50 to 500 nm wide and 14 to 20 μm long (Giro’n et al., 1993).

The BFP of EPEC exists as bundles and intertwines with BFPs of other bacterial cells to

11

create three dimensional networks. The genes encoding BFP share 41% identity with the

toxin co-regulated pilus (tcp) gene of V. cholerae (Donnenberg et al., 1992). However,

several of the genes are unique in EPEC in which homologues are barely found in other

species. In addition, the protein sequence of BFP shared homology and other

characteristics with the type IV pili of Pseudomonas aeruginosa, Neisseria gonorrhea

and Moraxella bovis (Giro’n et al., 1997). Recently, Khursigara and co-workers (2001)

have identified that BFP binds to the lipid phosphatidylethanolamine, and it has been

proposed that this could be responsible for BFPs interaction with both the host and other

bacterial cells. BFP may be partially or wholly responsible for the LA phenotype by the

recruitment of bacteria in the environment of the host cell (Giron et al., 1993). A recent

data also indicated that the structure of BFP and the intact function of BFPs are required

for the full virulence of EPEC (Bieber et al., 1998).

I.2.1.3. EAF plasmids

The genes coding for BFP of EPEC are located in a large plasmid called EPEC adherence

factor (EAF) plasmid (Baldini et al., 1983). A number of EPEC strains contain a large,

50-70 MDa plasmid and share extensive homology as EAF plasmid among EPEC strains

(Nataro, et al., 1987). Plasmid encoded regulators (Pers) are encoded in a cluster of perA,

perB, perC genes at the downstream of the bfp gene cluster in the same EAF plasmid.

These perABC genes encode transcriptional activators that positively regulate several

genes in the chromosome and on the EAF plasmid. PerA is homologue to an AraC family

of bacteria regulators and activate the expression of the down stream gene perC. The

production of PerC can increase the expression of the chromosomal eae (E. coli attaching

12

and effacing) and espB (E. coli secreted protein B) genes, as well as that of genes

encoding 20 kD, 33 kD and 50 kD outer membrane proteins (Gomez-Duarte et al., 1995).

The BFP structural gene bfpA is also under the control of per operon since it is described

that bfpTVW regulatory gene cluster which regulates bfpA expression is in fact allelic

with perABC (Zhang and Donnenberg, 1996).

The importance of the EAF plasmid was investigated by many groups and it is reported

that this large plasmid is involved in the LA on the human epithelia cells and the

adherence to piglet intestinal epithelial cells (Baldini et al., 1983). The plasmid cured

derivative did not process this adherence property and transformation of this plasmid to

non-adherent E. coli. strain enabled this strain to adhere to HEp-2 cells (Baldini et al.,

1986). The crucial importance of EAF plasmid in human disease was tested by using the

wild type E2348/69 strain and the plasmid-cured derivatives and the results indicated that

the plasmid was necessary for full virulence of EPEC in volunteers (Levine et al., 1985).

I.2.1.4. Invasion

Several investigators have shown that EPEC strains are capable of entering a variety of

epithelial cell lines (Andrade et al., 1989; Miliotis 1989). Furthermore, some published

photographs of animal and human EPEC infections showed apparently intracellular

bacteria (Moon, 1983). However, unlike the intracellular pathogens such as Shigella spp.,

EPEC strains do not multiply intracellularly or escape from phagocytic vacuoles and thus

do not appear to be specifically adapted for intracellular survival. The invasion phenotype

is very useful in studying the molecular genetics of EPEC because many of the genes

13

involved in invasion are also involved in forming the A/E lesion. Donnenberg et al.

(1990) have used TnphoA and the gentamicin protection assay to isolate mutants deficient

in cell entry. bfpA or dsbA loci affect the EPEC invasion property which are also required

to produce functional BFP fimbriae. intimin and espB mutants were also deficient in

intimate adherence as well as invasion. sep/esc genes encoding the TTSS proteins were

also deficient in invasion. These results indicate that there is significant overlap between

genes responsible for the invasion process and genes involved in producing attaching and

effacing lesion.

I.2.1.5. Flagella

The EPEC flagellum consists of components that facilitate the export of flagellar proteins

and flagellar assembly (Aldridge and Hughes, 2002). Flagella are major organelles that

are important in the pathogenesis of EPEC. For EPEC, flagella are sufficient to induce

interleukin (IL)-8 releases in T84 cells via activation of the Erk and p38 pathways (Giron

et al., 2002). EPEC flagella are important for adherence and the mutation of fliC reduces

adherence. Purified flagella bind to the epithelia cells and block the binding of EPEC

(Zhou et al., 2003). Epidemiological studies of EPEC infection have revealed that EPEC

strains isolated throughout the world belong to a restricted number of O antigen

serogroups, and notably to a limited number of flagellar (H) antigen types (Nataro and

Kaper, 1998). Giron and co-workers (2002) investigated the involvement of flagella as an

adhesin of EPEC and the biological relevance of flagella expression by bacteria adhering

to cultured epithelial cells. They demonstrated that the flagella produced by EPEC

contribute to the adherence properties of the bacteria and that a molecule secreted by

14

eukaryotic cells induces their expression. Data also showed that there exists a molecular

relationship between flagella, virulence-associated TTSS, Per, and quorum sensing.

However, Cleary and co-worker (2004) observed the adhesion of wild-type EPEC strain

E2348/69 and a set of isogenic single, double and triple mutants to differentiated human

intestinal Caco-2 cells and they found no evidence that flagella contribute to EPEC

adhesion.

I.2.1.6. Serine Protease - EspC

EspC is a large serine protease with 110 kD molecular weight and is secreted by EPEC

and related strains of E. coli. It is homologous to members of the autotransporter protein

family, which includes IgA proteases of Neisseria gonorrhoeae and Haemophilus

influenzae, Tsh protein produced by avian pathogenic E. coli, SepA of Shigella flexneri,

and AIDA-I of DAEC (Stein et al., 1996). This heat-labile factor blocks lymphocyte

proliferation and production of interferon-γ, IL-2, IL-4 and IL-5 in response to a variety

of stimuli (Klapproth et al., 1996; Malstrom and James 1998). EspC produces an

enterotoxic effect, which is indicative of internalization and cleavage of the calmodulin-

binding domain of fodrin and resulting in actin cytoskeleton disruption. Recently, it has

been observed that EspC does not function in a manner similar to the homologous Pet

protein, a serine protease specific to enteroaggregative E. coli (Navarro-Garcia et al.,

2004).

I.2.1.7. Heat-stable enterotoxin (EAST1).

15

Many EPEC strains produce a low-molecular-weight heat-stable protein called EAST1

which is encoded by astA gene (Savarino et al., 1996). The EPEC strain E2348/69 was

found to contain two copies of the astA gene, one in the chromosome and another one in

the EAF plasmid. The significance of this toxin in EPEC pathogenesis is unknown. Some

EAF-negative EPEC-like organisms responsible for outbreaks of disease in adults also

contained the astA gene (Viljanen et al., 1990). More frequently isolation of EPEC strains

containing astA from adults other than from EPEC strains lacking astA might yield

insights into the striking age distribution seen with infections due to EPEC.

I.2.2. EHEC pathogenesis and virulence factors

Initially, EHEC was distinguished from other strains of E. coli by its serotype, namely

O157:H7. But subsequently, it was found to produce Shiga toxin (Stx), which has

become the defining feature of this pathotype. An inflammatory response is also induced

in response to EHEC intimate adherence, the A/E histopathology.

I.2.2.1. Shiga toxin

Shiga toxins, also known as verotoxins and Shiga-like toxins, occur in two major

antigenic groups, namely Stx1 (VT-I) and Stx2 (VT-II) (Paton and Paton 1998). Shiga

toxin was first identified in S. dysenteriae (O’ Brien et al., 1992) where it is

chromosomally encoded. But the genes for its production are readily transmitted between

E. coli strains by toxin-encoding bacteriophages. The EHEC that are most commonly

associated with human disease, are lysogenized with λ-like bacteriophage that encode the

structural genes for Stx1 and/or Stx2 (Strockbine et al. 1986). The Stx family is

16

composed of Shiga toxin (Stx), and a group of closely related toxins elaborated by EHEC,

which are designated Stx2, Stx2c and Stx2e (Scotland and Smith 1997). The production

of Stx1 from EHEC and S. sysenteriae is repressed by iron and reduced temperature, but

expression of Stx2 is unaffacted by these factors (O’ Brien and Holmes 1987). Although

there is antigenic heterogeneity among the members of the Stx family, all the biologically

active toxins characterized to date share an AB5 molecular configuration; in other words,

a single enzymatically active A-subunit protein in noncovalent association with a

pentamer of receptor-binding B-subunit proteins.

EHEC can produce severe or even fatal renal and neurological complications as a result

of the translocation of Shiga toxins across the gut (O’ Brien and Holmes 1987).

Production of a potent Stx is essential for many of the pathological features as well as the

life-threatening sequelae of EHEC infection. In contrast to advances in the genetics and

biochemistry of Stxs, the precise role of the toxins in the pathogenesis of hemorrhagic

colitis and HUS has yet to be fully elucidated. The myriad of metabolic events may lead

to intravascular coagulation, which results in thrombocytopenia, microangiopathic

hemolytic anemia, with erythrocyte fragmentation and renal failure. However the

pathogenesis is a multi-step process, involving a complex interaction between a range of

bacterial and host factors (O’ Brien et al., 1996).

I.2.2.2. Intestinal adherence factors

It is generally assumed that the colon and perhaps also the distal small intestine are the

principal sites of EHEC colonization in humans, although this has not been demonstrated

17

directly (Boyce et al., 1995). Within EHEC strains belonging to serotype O157:H7, there

is heterogeneity in adherence, and this may reflect differences in mechanisms. Some

strains adhered in a diffuse fashion, with bacteria distributed evenly over the surface of

the epithelial cells. Other strains formed tight clusters or microcolonies at a limited

number of sites on the epithelial surface. The existence of intestinal adherence factors of

Stx-producing E. coli strains of serotypes O157:H7 is suggested by the isolation of

serotypes other than O157:H7 that lack the eae gene but are still associated with bloody

diarrhea or HUS in humans, was reported (Dytoc et al., 1994; Scotland et al., 1994).

Type 1 fimbriae were suggested to be involved in the adherence of some EHEC strains

(Durno et al., 1989). The best-characterized EHEC adherence phenotype, however, is

intimate or attaching and effacing (A/E) adherence. This property is exhibited by a

subgroup of EHEC strains, which is highly similar to EPEC (refer to EPEC A/E lesion).

The genes which are responsible for this phenotype will be discussed in more detail

below in the TTSS section (I.2.3).

I.2.2.3. Invasion

EHEC strains have also been examined for their capacity to invade epithelial cells. It is

found that EHEC strains differ from other enteric pathogens (e.g., salmonellae, shigellae,

and EPEC) in that they are unable to efficiently invade HEp-2 and Henle 407 cells

(Oelschlaeger et al., 1994). However, O157:H7 EHEC strains were taken up by T24

bladder cells and HCT-8 cells, although individual EHEC strains varied in their invasive

capacity. The invasion process was dependent upon both bacterial protein synthesis and

host cell microfilaments (Oelschlaeger et al., 1994). However, McKee and O’Brien (1995)

18

reported that the level of uptake of O157:H7 EHEC by HCT-8 cells was significantly

lower than that of EPEC or Shigella flexneri strains and no greater than that of a

commensal E. coli strain. In a recent report, Luck and co-workers (2005) compared the

adherence properties of LEE-negative EHEC against LEE positive strains in vitro and

reported that a number of EHEC LEE-negative serotypes were internalized by epithelial

cells compared with EHEC O157:H7 that remained extracellular. Invasion was shown to

be dependent on an intact actin cytoskeleton and microtubule function, along with active

GTPases, but was not dependent on the activity of tyrosine kinases. The study suggested

that LEE negative EHEC strains may use a mechanism of host cell invasion to colonize

the intestinal epithelium which may compensate for the lack of the LEE and hence the

inability to form A/E lesions (Luck et al., 2005).

I.2.2.4. Flagella

The EHEC flagella are likely to be similar to EPEC which are major organelles that are

important in the pathogenesis of EHEC. However, the role for EHEC O157:H7 flagella is

equivocal. Purified H7 antigen did not inhibit adherence of EHEC O157:H7 to HEp-2

cells, whereas purified H6 flagella of EPEC have been demonstrated to inhibit in vitro

adherence (Giron et al., 2002). The different flagellin structures of EHEC O157:H7 and

EPEC O127:H6 may drive the different binding and tropism property. EHEC flagella

have been shown to play a role in persistence in chickens and seemed to be required for

long-term persistence in animal (Best et al., 2005). Given the importance of type III

secretion for the colonization of EHEC and EPEC and the structural relationship of the

19

TTSS with flagella, a cross-talk between TTSS and flagella system is likely to exist

during the colonization process.

I.2.2.5. pO157 plasmid

E. coli O157:H7 and most other EHEC strains associated with human disease possess a

94 - 104 kb plasmid called pO157 (Schmidt et al., 1994; Schmidt et al., 1996). The role

of this plasmid in pathogenesis is not certain since the majority of animal studies

performed with EHEC strains lacking this plasmid show no difference when compared

with the plasmid-containing parental strain. Sequence analysis of pO157 plasmid from

EHEC led to the detection of genes encoding enterohemolysin, catalase-peroxidase and

putative adherence factors in this plasmid (Schmidt et al., 1995; Brunder et al., 1996).

The two serine proteases, EspP and StcE/TagA, are also encoded in this O157 plasmid

(Brunder et al., 1997; Lathem et al., 2002). A gene cluster for a type II secretion system

is found in this plasmid and StcE/TagA is secreted by this system (Lathem et al., 2002).

This plasmid also encodes a hemolysin of the RTX family (Schmidt et al., 1995, Bauer

and Welch 1996). In a collection of O111 :H- EHEC strains from Germany, this

hemolysin was expressed in 88% of strains isolated from patients with HUS but in only

22% of patients with diarrhea without HUS (Beutin et al., 1993). Epidemiological

evidence suggests a stronger correlation of the presence of this plasmid with the

development of HUS rather than diarrhea (Schmidt and Karch, 1996).

I.2.2.6. Serine protease

1.2.2.6.1. EspP

20

A putative virulence factor encoded on pO157 is the extracellular serine protease EspP

(Brunder et al., 1997). The espP gene encodes a 1,300-amino-acid protein, which is

subsequently subjected to N- and C-terminal processing during the secretion process and

come out with a mature form of apparent size of 104 kDa. EspP has homology

(approximately 70%) to EspC, a 110-kDa EPEC secreted protein, and to a lesser degree

to immunoglobulin A1 (IgA1) proteases of H. influenzae and Neisseria spp. The region

of homology includes the serine-containing proteolytic active site. EspP did not exhibit

IgA1 protease activity in vitro but was capable of cleaving pepsin, an activity which was

inhibited by the serine protease inhibitor phenylmethylsulfonyl fluoride. EspP was also

able to cleave human coagulation factor V. Thus, it is suggested that the secretion of

EspP by EHEC colonizing the gut could result in exacerbation of hemorrhagic disease

(Brunder et al. 1997). Similar report from Djafari and co-workers (1997) also showed

that EspP is cytotoxic for Vero cells. A role for EspP in pathogenesis is also consistent

with the presence of antibodies to the protease in sera from five of six children with

EHEC infection but not in sera from age-matched controls.

I.2.2.6.2. StcE

StcE, or Tag A, is a secreted protease of C1 esterase inhibitor from EHEC (Lathem et al.,

2002). It is secreted via the type II secretion apparatus and is a metalloprotease that

specifically cleaves C1 esterase inhibitor (a member of the serine protease inhibitor

family), having no protease activity on other serine protease inhibitors, extracellular

matrix proteins or universal protein targets. StcE is encoded in the pO157 plasmid of

EHEC O157:H7 (Lathem et al., 2002) together with EspP. The bacterial protease is

21

positively regulated by the LEE-encoded regulator - Ler ( Elliott et al., 2000; Li et al.,

2004) and resulting pathology may include localized proinflammatory and coagulation

responses, causing tissue damage, intestinal oedema and thrombotic abnormalities

(Lathem et al., 2002). A result of StcE cleavage of C1-INH is the enhancement of C1-

INH ability to inhibit complement-mediated lysis of host ovine erythrocytes (Grys et al.,

2005). This is due to direct interaction between StcE, host cells and C1-INH. Thus,

through cleavage at the N-terminal domain, StcE treated C1-INH also provides a

significantly increased serum resistance for E. coli K12, showing a StcE induced

protection system against complement for the infecting bacteria and infected host cells

(Lathem et al., 2004). Through protease activity on glycoproteins and the resultant

cleavage from the host cell, StcE helps block the clearance of EHEC O157 through

glycoprotein destruction and contributes to the intimate adherence of the bacteria to host

cell surfaces (Grys et al., 2005).

I.2.2.7. Heat-stable enterotoxin (EAST1).

Another virulence factor that might contribute to the pathogenesis of the watery diarrhea

often seen during the early stages of EHEC infection is the enterotoxin EAST1 which is

encoded by astA gene. This is a 39-amino-acid enterotoxin that was initially recognized

in certain strains of EAggEC and is distinct from the heat-stable toxins produced by

ETEC (Savarino 1991). Other Stx-producing EHEC strains including O26:H11 and non-

O157/O26 strains also carry the astA gene (Savarina et al., 1996). In these strains, there

were two copies of astA, which were located on the chromosome. Enterotoxicity for

rabbit ileal tissue was confirmed by testing culture ultrafiltrates (10 kDa) of three of the

22

astA1 O157:H7 strains in Ussing chambers. The significance of EAST1 in the

pathogenesis of disease due to EHEC is unknown but it could possible account for some

of the non-bloody diarrhea frequently seen in persons infected with these strains.

I.2.2.8. Iron transport.

EHEC O157:H7 contains a specialized iron transport system which allows this organism

to use heme or hemoglobin as an iron source (Law and Kelly 1995). A 69-kDa outer

membrane protein encoded by the chuA (E. coli heme utilization) gene is synthesized in

response to iron limitation, and expression of this protein in a laboratory strain of E. coli

was sufficient for utilization of heme or hemoglobin as the iron source (Torres and Payne

1997). A gene homologous to chuA is also present in strains of S. dysenteriae I, but not in

other Shigella spp. or in other Shiga toxin-producing E. coli strains such as those of

serotype O26:H11 (Mills and Payne 1995). The growth of E. coli O157:H7 is stimulated

by the presence of heme and hemoglobin, and the lysis of erythrocytes by one or more of

the hemolysins reported for this pathogen could release these sources of iron, thereby

aiding infection.

I.2.3. Type Three Secretion System (TTSS) in EPEC and EHEC

TTSS is machinery by which bacteria inject many effector proteins across bacteria and

eukaryotic cells membranes to reach host cells target. It is a common virulence

mechanism which is conserved in many human, animal and plant pathogens. The genes

encoding a functional TTSS are usually residing in a pathogenicity island (PAI). EPEC

and EHEC also utilize TTSS to deliver virulence factors (effector proteins) into

23

eukaryotic cells. The filamentous TTSSs have high similarity in between EPEC and

EHEC which are both encoded in PAI of LEE. These filamentous TTSSs also confer the

capacity to form A/E lesions in EPEC and EHEC which are the major virulence factor in

these two pathogens. The following sections will review the common features of the

chromosomal PAI of LEE and the filamentous TTSS complex in EPEC and EHEC.

I.2.3.1. Pathogenicity island (PAI)

The term ‘pathogenicity island’ (PAI) is used to depict a cluster of virulence-associated

genes that are collocated on the bacteria chromosome of pathogenic bacteria but are

absent from non-pathogenic varieties of the same species (Hacker and Kaper, 2000).

Newly emerging data also suggest that PAIs may exist in plasmids or bacteriophage

genomes (Hacker and Kaper, 2000). The PAIs were first described in human pathogens

of the E. coli family Enterobcteriaceae (Hacker and Kaper, 1990), but are also present in

plant pathogens (Jackson et al., 1999). And they have recently been found in the genomes

of various pathogens of humans, animals and plants (Hacker and Kaper 2000). PAIs

usually occupy relatively large genomic region, covering more than 10-200 kb DNA

regions. They often show evidence of having been acquired from other bacteria. This

evidence includes the PAIs DNA consist regions that differ from the core genome in G+C

content in general and in different codon usage; flanked by small directly repeated

sequence; associated with transfer RNA genes and carry cryptic or functional genes

encoding mobility factors at their termini, such as integrase, transposases insertion

sequences or parts of these elements (Kaper et al., 1999). Together, these observations

suggest that PAIs may be transferred horizontally between bacteria by processes

24

involving bacterial viruses or plasmids. The ongoing processes of rearrangement, deletion

and transfer of PAIs have suggested a strong impact on microevolution and adaptation of

pathogenic microbes during the infectious process. The widespread occurrence of the

PAIs reveals that these genetic elements have been adapted after the long evolutionary

journey. Virulence factors encoded on PAIs represent the entire spectrum of bacterial

virulence factors, from adhesins to invasins, from secretion system to toxins, and from

modulins to host defense avoidance mechanisms.

I.2.3.2. Components of TTSS in EPEC and EHEC

The PAI that contributes to the adhesive ability of EPEC and EHEC is termed the LEE

because EPEC and EHEC require it to produce A/E lesions on enterocytes (Frankel et al.,

1998). The LEE is absent from the non-pathogenic laboratory strain of E. coli K-12, but

when LEE is transferred to this strain, it was bestowed A/E capacity upon epithelial cells

(Jarvis et al., 1995). Nucleotide sequence analysis of the LEE region of EPEC and EHEC

revealed the presence of 41 open reading frames (ORFs), most of which are organized

into five polycistronic operons named LEE1 through LEE5. Generally, the LEE genes

encode: (i) the components of the type III secretory pathway basal body; (ii) a series of

translocator proteins termed E. coli-secreted proteins (Esp), which are secreted via this

pathway; (iii) an outer membrane protein adhesin known as intimin that is encoded by the

eae gene; (iv) three global regulators which regulate the expression of most of the LEE

genes; (v) two molecular switches which control the secretion of translocators and

effectors; (vi) chaperon proteins for translocators and effectors; (vii) effector proteins

which can be secreted and translocated into host cells. Functions of some of the proteins

25

encoded by these genes in LEE region have been assigned while some genes still

remained cryptic.

I.2.3.2.1. Components of TTSS basal body

The TTSS apparatus of EPEC and EHEC are multicomponent organelles assembled by

approximately 20 proteins (Fig. I.2; Garmendia et al., 2005). Components of the basal

body are broadly conserved among virulence TTSS and flagellar systems (Aizawa 2001;

Tampakaki et al., 2004). EscC and EscV are the main components of the outer and inner

membrane ring structures, respectively (Hueck 1998; Gauthier et al., 2003). EscC

belongs to the secretin family of proteins, which are found in all TTSSs and are involved

in the transport of molecules across the outer membrane by formation of a large homo-

multimeric annular complex. EscV is predicted to have seven transmembrane domains

and to form the EPEC and EHEC inner membrane ring structures. The presence of a

putative signal sequence indicates that the protein is likely to be directed to the inner

membrane through the sec pathway, as observed for EscV homologues in other TTSSs.

EscJ, which also contains a sec-dependent signal sequence, is highly conserved within

TTSSs (Hueck 1998). EscJ and its homologues are lipoproteins proposed to span the

periplasm, serving as a bridge between the inner and outer membrane protein rings (Deng

and Huang 1999). Those protein shares sequence similarity within the domain of the

flagellar protein FliF that is believed to line the central pore of the inner membrane ring

and proposed to form part of the proximal rod structure (Ueno et al., 1994). EscJ is

required for the secretion of more distal apparatus components across the outer

membrane, as an escJ mutant failed to assemble functional TTSS machinery (Crepin et

26

al., 2005). EscN is a cytoplasmic protein which binds to inner membrane components of

TTSS (Gauthier et al., 2003). It is believed to be the energy source for the TTSS export

machinery since it shares homology with the F0F1 ATPase and has a putative ATP-

binding site (Hueck 1998). It is suggested that the EscN ATPase interacts with the TTSS

basal components and facilitates protein secretion or translocation (Akeda and Galan

2005; Pozidis et al., 2003).

I.2.3.2.2. TTSS translocators

The translocators such as EspA, EspB and EspD are TTSS secreted proteins that are

required for the translocation of the effector proteins into the host cytoplasm (Frankel et

al., 1998; Fig. I.1). EspA is localized in the TTSS needle tip by the addition of new

subunits at the tip to form a helical tube with a hollow central channel, connecting the

bacterial needle complex to the host cell and thereby forming a conduit through which

effector proteins are transported (Daniell et al. 2003; Crepin et al., 2005). EspB and EspD

are inserted into the membrane of infected cells where they are thought to form

translocation pores in the host cell membrane (Wachter et al., 1999; Ide et al., 2001;

Shaw et al., 2001). EspD is required for polymerization of EspA filaments and cell

attachment and hemolysis (Knutton et al., 1998; Kresse et al., 1999; Daniell et al., 2001).

Besides playing structural role in host membrane to help other effectors’ transportation,

EspB can be detected in cytoplasm of infected cells, which implies that EspB may also

have an additional function as an effector (Wolff et al., 1998). EspA, EspB and EspD are

essential for the pathogenesis of EPEC and are regarded as virulence factors (Abe et al.,

1998; Donnenberg et al., 1993; Tacket et al., 2000).

27

I.2.3.2.3. LEE encoded adhesin

Intimin is an adhesin expressed by EPEC and EHEC which is required for tight binding

to host cells (Jerse et al., 1990). This adhesion is encoded by eae gene located in LEE5

operon and exported via the general secretory pathway. Intimin is highly conserved

among EPEC and EHEC strains with overall 83% protein identity (Yu et al., 1992). The

homology of intimin comes from the N-terminus, while the C-terminus of intimin

contains the receptor-binding residues exhibit diversity (Frankel et al., 1994; Oswald et

al., 2000). After exported from bacteria cytosol, intimin is inserted into the bacterial outer

membrane where it interacts with its receptors Tir and form intimate attachment. Besides

the interaction with Tir, intimin can also bind to host generated receptors (Reece et al.,

2001). It was shown that tissue tropisms for the γ subtype which expressed by EHEC

O157:H7 was follicle-associated in humans and cattle. While α subtype expressed by

EPEC P127:H7 shows a more broad specificity (Phillios and Frankel, 2000; Phillips et al.,

2000; Naylor et al., 2003). The role of intimin in human and animal disease was tested

and results indicated that intimin is essential for full virulence of EPEC and EHEC

(Donnenberg et al., 1993a; Donnenberg et al., 1993b; Deng et al., 2004).

28

Fig. I.3. Schematic representation of the EPEC/EHEC type III secretion apparatus. The basal body of the TTSS is composed of the secretin EscC, the inner membrane proteins EscR, EscS, EscT, EscU, and EscV, and the EscJ lipoprotein, which connects the inner and outer membrane ring structures. EscF constitutes the needle structure, whereas EspA subunits polymerize to form the EspA filament. EspB and EspD form the translocation pore in the host cell plasma membrane, connecting the bacteria with the eukaryotic cell via EspA filaments. The cytoplasmic ATPase EscN provides the energy to the system by hydrolyzing ATP molecules into ADP. SepD and SepL have been represented as cytoplasmic components of the TTSS which may serve as switches for TTSS. (This figure is reprinted from Garmendia et al., 2005)

29

I.2.3.2.4. LEE encoded TTSS regulators

The central positive LEE encoded regulator (Ler) is encoded in the LEE1 operon and is

primarily an anti-repressor which is essential for the expression of most of the LEE genes

(Bustamante et al., 2001; Elliot et al., 2000). Ler is an auto-regulator which will also

regulate the expression of itself in order to maintain proper amount in the bacterial cells

for regulation net work (Berdichevsky et al., 2004). GrlA and GrlR are another two

recently identified LEE-encoded regulators which are highly conserved in all A/E

pathogens (Deng et al., 2004). GrlA acts as a positive regulator for LEE expression

including ler. With the reciprocally positive regulation between each other, GrlA and Ler

form a positively transcriptional regulatory loop to maintain an appropriate

spatiotemporal response during the infection (Barba et al., 2005). GrlR functions as a

negative regulator for LEE (Deng et al., 2004, Lio et al., 2004) and it would control the

production of Ler and other TTSS proteins when it is highly expressed.

I.2.3.2.5. Switches of TTSS translocators and effectors

LEE also encodes two switches responsible for translocators and effectors secretion.

SepL, is a soluble cytoplasmic protein and associates with the bacteria membrane fraction,

which is required for the A/E effect (Kresse et al., 2000; O’Connell et al., 2004). It is

encoded in the LEE4 operon which contains espA, espD and espB genes. sepD, also

known as rorf6, is localized within the LEE2 operon in between escC and escJ. It is

found that SepD is a required component of the EPEC TTSS and will interact with SepL

to form a membrane bound complex (Creasey et al., 2003; O’Connell et al., 2004). SepL

30

and SepD are showed to be essential for the secretion of TTSS translocators but not

effectors (Deng et al., 2004). It is postulated that SepL and SepD form a molecular switch

that controls the secretion of translocators and effectors as a conserved feature in all A/E

pathogens, including CR, EHEC and EPEC (Deng, et al., 2005).

I.2.3.3.6. TTSS chaperons

To day, five LEE-encoded chaperones have been identified for EPEC and EHEC. CesAB

is the chaperon for translocator proteins EspA and EspB (Creasey et al., 2003a). CesAB

stabilizes and interacts with EspA and EspB specifically in bacterial cytosol prior to the

secretion. CesD is an inner membrane bound protein and serves as a bivalent chaperon

for translocator protein EspB and EspD (Wainwright and Kaper, 1998). CesD2 is another

chaperon for EspD which appears to be required for proper secretion of EspD (Neves et

al., 2003). CesF is the chaperon for effector protein EspF, which is necessary for the

stability and translocation of EspF and for EPEC to reduce transepithelial electrical

resistance (TER) (Elliott et al., 2002). CesT is a LEE encoded TTSS chaperon for multi-

effectors (Abe et. al., 1999; Creasey et. al., 2003b; Thomas et. al., 2005). It plays a vital

role in stabilization and recruitment of LEE and non-LEE encoded effectors and assures

their secretion efficiency.

I.2.3.3.7. TTSS secreted Effectors

TTSS secreted effector proteins are translocated into host cells by the functional TTSS

for the purpose of modulating signal transduction pathways and cellular processes

(Hueck 1998). Genes encoding translocated effectors have been found both within and

31

outside the LEE pathogenicity islands that encode the TTSS. To date, 6 EPEC LEE-

encoded TTSS-translocated effectors have been identified: Tir (EspE), EspF, EspG, EspH,

Map and SepZ (EspZ) (Kenny et al., 1997; McNamara et al., 2001; Elliott et al., 2001;

Tu et al., 2003; Kenny and Jepson 2000; Kanack et al., 2005). EPEC and EHEC TTSS

translocate effector protein, Tir, into host cells (Kenny et al., 1997). After translocation,

Tir is inserted into the host cell plasma membrane and serves as a bacterial receptor for

the bacterial outer membrane protein intimin (Jerse et al., 1990; Kelly et al., 1990). In the

plasma membrane, Tir adopts a hairpin-loop topology featuring a central extracellular

domain that binds intimin (Luo et al., 2000). The interaction between Tir and intimin

leads to the actin polymerization and the intimate attachment of EPEC and EHEC to

hosts plasma membranes and formation of an actin-rich pedestal, beneath the adherent

bacterium (Moon et al., 1983; Knutton et al., 1989). Mitochondria associate protein (Map)

was translocated by TTSS and targets to the mitochondria (Kenny and Jepson, 2000). It

has been suggested to disrupt mitochondria normal functions and initiate filopodium

formation immediately upon interaction with the host cell via the GTPase Cdc42 (Jepson

et al., 2003). In constrast, Alto and co-workers (2006) recentely found that Map mimics

Cdc42 rather than using Cdc42 for filopodia formation. In contrast, EspH represses

filopodium formation and enhances the formation of actin-rich pedestals (Tu et al., 2003).

EspG is a 44-kDa protein homologous to VirA, a translocated protein of S. flexneri that

triggers host microtubule destabilization. It is indicated that EspG together with another

homologue EspG2 can disrupt microtubules network, enhance perturbation of the tight

junction barrier and even alter epithelial paracellular permeability (Tomson et al., 2005;

Matsuzawa et al., 2005). EspF disrupts intestinal barrier function and therefore

32

potentially contributes to EPEC diarrhea. EspF also plays a role in epithelial cell

apoptosis. An interesting feature worth to be noted is all the LEE-encoded effectors

except Tir are dispensable for A/E lesion formation.

In addition, A/E pathogens secrete a number of non-LEE-encoded effectors. Newly

identified effectors located outside of the LEE locus include Cif, NleA/EspI, Tccp/EspFu,

EspJ and EspG2 (Marches et al., 2003; Gruenheid et al., 2004; Mundy et al., 2004;

Campellone et al., 2004; Garmendia et al., 2004; Dahan et al., 2005; Shaw et al., 2005;

Matsuzawa et al., 2005). Cif is carried on a lambdoid phage and triggers an irreversible

cytopathic effect in HeLa cells, which is characterized by the progressive recruitment of

focal adhesions, assembly of stress fibers, and arrest of the cell cycle. EspI/NleA is

carried within prophage CP-933P, localized to the Golgi, and is required for full

virulence in the C. rodentium model. TccP/EspFu is an EHEC O157 effector that is

carried on prophage CP-933U and translocated into host cells, where it displays an Nck-

like activity. EspJ is a TTSS secreted effector protein encoded by prophage CP-933U of

attaching and effacing pathogens that modulates the infection dynamics of clearance of

the pathogen from the host's intestinal tract (Dahan et al., 2005). In addition to these

effectors, Deng and co-worker (2004) recently identified 7 new non-LEE-encoded

effector proteins NleB, NleC, NleD, NleE, NleF, NleG from CR by using systematical

mutagenesis and proteomics approaches. These Nles have been shown to be secreted by

CR in sepD and sepL mutants and their secretion are TTSS dependent. Although some of

the Nles have been shown to be translocated into host cells (Marches et al., 2005), their

functions have yet to be further characterized.

33

I.3. Objectives

It is reported that several virulence factors from EPEC and EHEC perturb different facets

of the host physiology, resulting in the cumulative effect of diarrhea. The objective of this

study was to use proteomics approach to identify the virulence factors of EPEC and

EHEC. The virulence factors from EPEC and EHEC were characterized using approaches

in molecular biology, biochemistry and cellular biology to provide an in-depth

understanding of the EPEC and EHEC pathogenesis, which may be analogous diseases in

human and animals.

Secreted or surface exposed proteins from pathogens may play essential roles in the

processes of pathogen-host interaction, thus contributing to the virulence. Initially, a

proteomics approach was used to compare the ECPs between the EPEC and EHEC wild

type and their respective ler and ihf mutants in order to identify virulence factors from

EPEC and EHEC (Chapter III). The comparative proteomics profiles were used to depict

the close relationship and differences between EPEC and EHEC. Extracellular virulence

factors, including known virulence determinants and potential virulence proteins, were

studied in an integrative manner to reveal the pathogenicities of EPEC and EHEC.

EspB was one of the dominant secreted protein identified from EPEC and EHEC ECP

proteomes and was reported to be a virulence factor. Thus, EspB was further

characterized in Chapter IV. This includes the observation and survey of different forms

34

of EspB, as well as the investigation of the property of EspB as an effector and a

translocator and the involvement of EspB in the EPEC aggregation formation.

Effector proteins are key virulence factors used by A/E pathogens to subvert host cell

signaling pathway. Since SepL and SepD constitute a molecular switch for controlling

the secretion of translocators and effectors, the sepL and sepD mutants were used to

identify effectors from A/E pathogens. In Chapter V, a novel effector - NleI was

identified from EPEC sepL and sepD mutants by comparative proteomics. The

translocation property and sub-cellular localization of NleI were further characterized.

35

Chapter II. Common materials and methods

II.1. Common used medium and buffer

Luria-Bertani (LB) broth from Difco laboratories was used for the normal maintenance

and propagation of E. coli for molecular microbiology procedures. Dulbecco’s modified

eagle medium (DMEM) with L-glutamine, 25 mM HEPES buffer and pyridoxine

hydrochloride but without phenol red (Gibco BRL) was used for culturing HeLa cells,

EPEC and EHEC strains to induce extracellular protein (ECP) secretion.

Phosphate buffered saline (PBS) was used for washing and resuspension of the bacteria.

PBS contained 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4 and 1.4 mM KH2PO4, and

the pH was adjusted to 7.2.

II.2. Bacteria strains and plasmids

The bacterial strains and plasmids used in this thesis are listed in Table II.1. E. coli

strains were grown on LB agar (Difco) plates or in LB broth (Difco) or DMEM

supplemented as needed with ampicillin (Amp, 100 µg/ml), chloramphenicol (Chl, 30

µg/ml), kanamycin (Kan, 50 µg/ml), and streptomycin (Str, 50 µg/ml). Cultivation of

bacteria in DMEM was carried out at 5% (v/v) CO2 atmosphere, 37oC. Stock cultures of

E. coli were maintained at -80°C as a suspension in supplemented LB broth containing

25% (v/v) glycerol.

II.3. Tissue culture

36

HeLa cells were cultured in DMEM (Gibco BRL) supplemented with 10% heat-

inactivated fetal bovina serum (FBS) and penicillin (200 IU/ml) and streptomycin (100

µg/ml). The cells were grown in cell culture flasks (100 ml) at 37oC in a humidified

atmosphere of 5% CO2. Before experiment, Hela cells were washed with PBS or DMEM

to remove FBS and antibiotics.

II.4. Molecular biology techniques

II.4.1. Genomic DNA isolation

E. coli strains were grown in LB broth cultured at 37°C overnight. Bacterial genomic

DNA was extracted using QIAGEN Genomic DNA Purification Kit according to the

manufacturer’s protocols. After the mini-preparation, the purified genomic DNA was

dissolved in TE buffer (10 mM Tris-HCl, and 1 mM EDTA, pH 7.5) and stored at -20°C

for future use.

II.4.2. Cloning DNA fragments and transformation into E. coli cells

PCR amplified DNA fragments were cloned into the pGEM-T Easy vector system

(Promega, USA) following the manufacturer’s instructions and were transformed into E.

coli JM109 or E. coli DH5α. E. coli competent cells were prepared and transformed as

described by Sambrook and co-workers (1989). After transformation, bacteria were

recovered in LB broth and plated on LB agar plates containing ampicillin,

isopropylthiogalactoside (IPTG, Bio-Rad), 5-bromo-4-chloro-3-indolyl-β-D

galactopyranoside (X-gal, Bio-Rad), to allow for blue-white colony selection.

37

II.4.3. Analysis of plasmid DNA

To check the potential clones with target DNA fragments inserted in plasmids, the boiling

lysis procedure was used as described by Holmes and Quingley (1981). Briefly, 20 μl of

overnight bacterial culture was obtained and spun at 8000 × g for 2 min. The bacterial

pellet was resuspended in 3 μl of sterile water, followed by addition of 8 μl of STET

solution [0.1 M NaCl, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH 8.0), 5% Triton X-

100, 0.8 μg/μl lysozyme and 10 μg/μl RNase A]. Subsequently, the tubes were placed on

boiling water bath for 30 s and allowed to cool down to room temperature. One µl of 10 ×

buffer of appropriate restriction enzyme and 0.1 - 0.2 units of restriction enzyme was

added and the tubes were incubated at appropriate temperature for 30 min. The raw

digested DNA samples were analyzed by gel electrophoresis using 1% (w/v) agarose gel

(Seakem®, BioWhittaker Molecular Applications) followed by staining in ethidium

bromide. Clones containing the right insert in the plasmids were chosen for performing

further experiments. Alternatively, for low copy plasmids, PCR amplification was used to

screen those desired clones by using primers specific for the inserted DNA.

II.4.4. Plasmid DNA isolation and purification

E. coli strains containing desired plasmids were cultured in LB broth (with appropriate

antibiotics) and incubated in an orbital shaker (Forma scientific) with 225 rpm shaking at

37°C overnight for plasmid isolation. Plasmid DNA was isolated using the QIAGEN

Plasmid Mini Purification Kit (QIAGEN Spin columns, QIAGEN GmbH). The

concentration and quality of the plasmid DNA were determined by measuring the OD260

and OD280 using a spectrophotometer (Shimadzu UV-1601, Japan).

38

II.4.5. DNA sequencing

The ABI PRISM BigDye Terminator version 3.1 Cycle Sequencing Ready Reaction Kit

was used to perform sequencing PCR reaction (Applied Biosystems). The sequencing

reaction mix consisted of: 1 µl of autoclaved water, 100 to 200 ng of the plasmid DNA or

40 to 50 ng of PCR product, 0.5 µl of 2.5 µM primer and 1 µl of BigDye. Sequencing

PCR reaction was carried out in GeneAmp PCR system 2400 or 2700 (Applied

Biosystems) using the conditions: 1 min at 96 oC, 25 cycles of denaturation 96oC, 10 s,

annealing 50oC, 5 s, extension 60oC, 1 min 45 s. The PCR product was precipitated by

NaAc solution [1 µl of NaAc (pH 3.6), 2.5 µl of water and 15.5 µl of 100% ethanol].

After centrifugation at 14000× g for 20 min, the pellet obtained was washed with 500 µl

of 70% ethanol twice. Later the pellet was air dried and stored at -20°C. Prior to

sequencing, 12 µl of Hi-Di™ Formamide (Applied Biosystems) was added to dissolve

the pellet and the sample mixture was loaded into 96 well sequencing plate. DNA

sequencing was carried out on ABI PRISM® 3100 genetic analyzer using the dye

termination method.

II.4.6. Sequence analysis

Sequence assembly and further editing were carried out with Vector NTI DNA analysis

software (InforMax). BLASTN, BLASTP and BLASTX sequence homology analyses

and a protein conserved-domain database analysis (CDD search) were performed using

the BLAST network server of the National Center for Biotechnology Information

(NCBI) (http://www.ncbi.nlm.nih.gov/BLAST; Altschul et al., 1990).

39

II.4.7. Southern hybridization

Corresponding DNA probe was labeled by nick translation with biotin 14-dATP using

the BluGene Non-Radioactive Nucleic Acid Detection System (Invitrogen).

Approximately, 5 - 10 µl of PCR product or 1 - 2 µg of plasmid DNA was digested using

appropriate restriction enzymes and incubated with the labeling mixture at 37 oC for 6 -

12 h according to manufacturer’s protocol. Approximately 2 - 4 µg of genomic DNA of

EPEC, EHEC or CR strains was digested with appropriate restriction enzymes prior to

Southern analysis. The digested DNA were resolved by electrophoresis on 1% agarose

gel and stained with ethidium bromide. After washing, DNA in the gel was transferred to

a Hybridization Transfer Membrane (Gene Screen Plus, Perkin Elmer) for overnight at

room temperature. The next day, the transferred DNA was cross-linked to a membrane

using UV-transilluminator (SPS-TF, Vilber Lourmat) for 5 min and air-dried. The nylon

membrane with DNA was incubated with the pre-hybridization solution (DIG Easy Hyb,

Roche Diagnostics GmbH) and further incubated with the hybridization solution which

contained heat denatured, biotin labeled probe in the hybridization bags (Invitrogen) for

overnight at 42°C. After hybridization, the membrane was washed and blocked with DIG

Wash and Block Buffer Set (Roche Diagnostics GmbH) and incubated with alkaline

phosphatase (AP) conjugated anti-digoxigenin antibody for 1 h in blocking solution.

After wash with washing solution for 3 times, the hybridization result was visualized by

incubating membrane with 10 ml detection buffer containing 200 µl of NBT / BCIP stock

solution (Roche Diagnostics GmbH) in the dark. The membrane was observed once in 5 -

10 min till the appearance of bands and wash with TE buffer to terminate the reaction.

40

II.5. Protein techniques

II.5.1. Preparation of ECPs from E. coli strains

To prepare the extracellular proteins (ECPs) from E. coli strains, bacteria were cultured in

LB broth overnight. Then the overnight LB cultures were diluted at 1:50 into DMEM and

incubated for 6 to 9 h according to strains at 37 oC in a 5% (v/v) CO2 atmosphere. Bacterial

cells were removed from the culture by centrifugation (5500 × g, 10 min, 4 oC) and the

supernatant was filtered through a 0.22 µm low protein binding filter (Millex, Millipore).

The ECP fraction was isolated by TCA precipitation (Shimizu et al., 2002) and the protein

pellet was washed with –20 oC acetone thrice and air-dried. The protein pellet was

solubilized in ReadyPrep Reagent 3 [5 M urea, 2 M thiourea, 2% (w/v) CHAPS, 2% (w/v)

SB 3-10, 40 mM Tris, and 0.2% (w/v) Bio-Lyte 3/10 ampholyte; Bio-Rad]. Insoluble

materials were removed by centrifugation at 18 000 × g for 10 min at room temperature and

protein samples were stored at –20 oC until analysis. Protein concentration was determined

by using the Bio-Rad protein assay kit with bovine serum albumin as the standard.

II.5.2. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)

Ten to fiften % polyacrylamide gels were used for protein separation based on molecular

weight property. Normal SDS-PAGE was performed according to a standard protocol

(Sambrook et al., 1989). Briefly, different percentage of acrylamide resolving gel

solution was poured into the gap between two glass plates and the 4% stacking gel was

layered on top of the resolving gel and a clean Teflon comb was immediately inserted.

After the stacking gel had polymerized, the Teflon comb was carefully removed and the

wells were washed with milli-Q water to remove any traces of unpolymerized acrylamide.

41

Prior to loading the protein samples, the sodium-dodecyl (SDS) gel-loading buffer (50

mM Tris-HCl, 100 mM DTT [Bio-Rad], 2% [w/v] SDS, 0.1% [w/v] bromophenol blue

(Bio-Rad), 10% glycerol) was added and the samples were boiled for 5 min. After

loading the samples, the electrophoresis apparatus was attached to an electric power

supply and a constant current of 5 mA per gel was applied. After the dye front has moved

into the resolving gel, the current was increased to 15 mA per gel.

II.5.3. Visualization of protein bands/spots (Coomassie blue staining and silver

staining)

50% methanol (v/v), 10% acidic acid solution (v/v) with 0.1% (w/v) Coomassie Brilliant

Blue R-250 (Bio-rad) (Meyer and Lamberts, 1965; Sambrook et al., 1989) was used to

stain the 1D or 2D SDS-PAGE for 1 h or overnight and de-stained with 20% methanol

(v/v) and 10% acetic acid (v/v).

For more sensitive detection of proteins in the gel, silver staining (Blum et al., 1987) was

performed. The gel was first fixed in 50% (v/v) methanol and 10% (v/v) acetic acid for at

least 30 min, followed by 15 min in 50% (v/v) methanol. After that, the gel was washed 4

times (5 min each) with milli-Q water, followed by treated with 0.02% (w/v) fresh

prepared sodium thiosulfate solution for 1 min, and washed another 2 times (1 min each)

with milli-Q water. Freshly prepared silver nitrate (0.2 μg/ml) (Merck) solution was then

added and the gel was stained for 25 min. After staining, the gel was washed twice (1 min

each) with milli-Q water and developed in 3% [w/v] sodium carbonate, 0.025% [v/v]

formalin [Sigma] solution for 5 - 10 min till the desired patterns appreaed. The

42

developing was stopped by 1.4% (w/v) EDTA for 10 min and washed with mili-Q water

twice.

II.5.4. Western blotting

Proteins from EPEC, EHEC or HeLa cells were resolved using a 12.5% SDS-PAGE gel.

Proteins from SDS-PAGE were electro-blotting transferred onto a PVDF membrane

(Bio-Rad) according to the manufacture instructions in a semi-dry transfer system (Trans-

Blot SD cell, Bio-Rad). The membranes were then blocked with 5% milk solution and

then incubated in appropriately diluted primary antibody for 1 h or overnight. After wash

with PBS-T for three times, the membrane was incubated with appropriate secondary

antibody solution (goat anti-rabbit IgG or goat anti-mouse IgG secondary antibody

conjugated with alkaline phohpatase (AP) or horseradish peroxidase (HRP). Positive

bands were visualized by using bromocholoroindolyl phosphate (BCIP) and nitroblue

tetrazolium (NBT) as substrates for AP-conjugated secondary antibodies. Alternatively,

the enhanced Chemiluminescence Detection Kit (Pierce) was used as substrate to give a

more sensitive detection for HRP conjugated secondary antibodies, and followed by

exposure on to a Kodak film (Kodak).

43

Table II.1. Bacterial strains and plasmid used in this study

Strain or plasmid Genotype and/or relevant property Source / Reference

E. coli strains

DH5α SupE44 ∆lac U169 (ø80lacZ∆M15)

hsdR17 recA1 endA1 gyrA96 thi-1

relA1; Amps

Hanahan, 1983

MC1061(λpir) (λpir), thi thr-1 leu6 proA2 his-4 argE2

lacY1 galK2 ara14 xyl5 supE44, λpir

Rubires et al., 1997

SM10(λpir) thi thr leu tonA lacY supE recA::RP4-2-

Tc::Mu Kmr λpir

Miller and

Melakanos, 1988

JM109 Cols, Amps Promega

S17-1(λpir) thi pro hsdR hsdM+ recA [RP42-Tc::Mu-Km::Tn7

(Tpr Smr)Tra+]

Simon et al., 1983

BL21-DE3

E2348/69 Wild type EPEC O127:H6, Smr J. Kaper

EDL933

Wild type EHEC O157:H7, Slt1, Slt2 negative

derivative

J. Leong

Plasmids

pGEM®-T Easy vector Cloning vector; Ampr Promega

pACYC184 Tetr, Cmr Amersham

pRE112 Suicide vector; R6K ori sacB Cmr Edwards et al., 1989

44

Chapter III. Comparative proteomics analysis of extracellular proteins

of enterohemorrhagic and enteropathogenic Escherichia coli and their

ihf and ler mutants

Part of this chapter has been published in:

Li, M., I. Rosenshine, S.L. Tung, X.H. Wang, D. Friedberg, C.L. Hew, and K.Y. Leung.

2004. Comparative proteomics analysis of extracellular proteins of enterohemorrhagic

and enteropathogenic Escherichia coli and their ihf and ler mutants. Appl. Environ.

Microbiol. 70:5274-5282.

45

Abstract

EHEC and EPEC are closely related human pathogens responsible for food-borne

epidemics in many countries. In this study, a proteomics approach was used to analyze

the extracellular protein profiles of EHEC EDL933 and EPEC E2348/69, and their ihf

and ler mutants. The proteins were separated by using two-dimensional (2-D) SDS

PAGE followed by matrix-assisted laser desorption/ionization time-of-flight mass

spectrometry (MALDI-TOF MS) and subsequently by searching among protein database.

Fifty-nine major protein spots from their extracellular proteomes were identified,

including six proteins of unknown functions. Twenty-six of them were conserved

between EHEC EDL933 and EPEC E2348/69 while some of them are strain specific

proteins. Four common extracellular proteins (EspA, EspB, EspD and Tir) were regulated

by both IHF and Ler in EHEC EDL933 and EPEC E2348/69. TagA in EHEC EDL933,

EspC and EspF in EPEC E2348/69 were present in the wild type strains but absent in

their respective ler and ihf mutants, while FliC was overexpressed in the ihf mutant of

EPEC E2348/69. These results showed the relation and divergence of EHEC and EPEC

in an integrated view from their secretion proteom. And that proteomics was

demonstrated to be a powerful platform technology for accelerating the understanding of

EHEC and EPEC pathogenesis and identifying markers for laboratory diagnosis of these

pathogens.

46

III.1. Introduction

EHEC and EPEC are closely related human pathogens (Donnenberg and Whittam, 2001).

They can colonize the intestinal mucosa and induce diarrhea disease in a wide range of

animals including rabbits, dogs, piglets, cattle and humans. EHEC, especially those of

serotype O157:H7 which produce Shiga-like toxin (Stx), is a common cause of diarrhea,

hemorrhagic colitis, and hemolytic uremic syndrome, while EPEC is the most common

bacterial cause of infant diarrhea (Nataro and Kapper, 1998). Both have been implicated in

food-borne outbreaks in many countries and cause diarrhea by colonizing the intestinal

mucosa (Nataro and Kapper, 1998; Paton and Paton, 1998). EHEC and EPEC are

distinguished from other pathogenic E. coli strains by their ability to produce a

characteristic histopathological feature known as the A/E lesion on the mucosa (Frankel et

al., 1998; Nataro and Kapper, 1998). The AE lesion is characterized by destruction of the

microvilli and induction of actin-based pedestal formation underneath the eukaryotic

membrane at the site of attachment (Donnenberg et al., 1997). EHEC and EPEC secrete

many ECPs and some of them are characterized as virulence factors such as EspA, EspB,

EspC and Tir. A TTSS is conserved in EHEC and EPEC which is necessary for the

formation of AE lesions (Jarvis et al., 1995; Jarvis and Kapper, 1996). TTSS is encoded in

a chromosomal pathogenicity island designated as LEE, which is a major secretion

apparatus for secreting virulence factors which interact directly with the host (Kenny and

Finlay 1995; McDaniel et al., 1995). The LEE encoded regulator (Ler) activates most of the

genes within the LEE region and is central to the process of AE lesion formation (Mellies et

al., 1999). The integration host factor (IHF) is a histone-like protein which can bind to

specific DNA consensus sites and bend the DNA to form a nucleoprotein complex (Nash et

47

al., 1996; Rice et al., 1996). The IHF is involved in a wide variety of cellular processes,

including directly activating the expression of the ler transcriptional unit, and Ler in turn

mediates the expression of the other LEE genes (Goosen and van de Putte, 1995; Friedberg

et al, 1999). The expression of both IHF and Ler is needed to elicit the actin rearrangement

associated with AE lesions.

Proteomics offers a powerful platform technology for the study of protein expression and

identification. This is a useful tool for the analysis of the disease process and bacteria-

host interactions at the protein level. Recent advances in micro-sequencing and mass

spectrometry, combined with the availability of the complete genome sequence allowing

the identification of proteins from either the sequences of single peptides or even the

masses of a number of peptides (Pappin et al., 1993). The DNA sequences of two EHEC

genomes were determined recently (Hayashi et al., 2001; Perna et al. 2001), and the

EPEC genome sequence will be completed soon (refer to Sanger Institute website,

http://www.sanger.ac.uk/Projects/Microbes). Therefore, EHEC and EPEC are ideal

organisms for proteomics analysis.

Here we use the proteomics approach to analyze the extracellular proteomes of EHEC

and EPEC in order to give further insight into the pathogenesis and divergence of these

two emerging pathogens. Comparative proteomics analysis among the wild type strains,

the ler and ihf mutants were used to identify putative virulence factors from EHEC and

EPEC.

48

III.2. Materials and methods

III.2.1. Bacterial strains and culture conditions

The wild type strains of EHEC, EPEC and their mutants used in this study are listed in

Table III.1. EHEC ler and ihf mutants were constructed by using the Lambda Rad system

as described earlier (Friedberg et al, 1999; Yona-Nadler et al., 2003). E. coli strains were

routinely cultured at 37oC in Luria-Bertani (LB) broth without shaking. When required,

media were supplemented with ampicillin (Amp, 100 µg/ml), kanamycin (Kan, 50 µg/ml),

and streptomycin (Str, 100 µg/ml).

Table III. 1. Bacterial strains used in this study

Strain Description Reference or source

E2348/69 Wild type EPEC O127:H6, Smr J. Kaper

EDL933

Wild type EHEC O157:H7, Slt1, Slt2 negative derivative

J. Leong

DF2 EPEC E2348/69 ler::kan Friedberg et al. (1999)

DF1 EPEC E2348/69 ihfA::kan Friedberg et al. (1999)

DF1291 EDL933 ler::Kan This study

DF1292 EDL933 ihf::Kan This study

49

III.2.2. Proteins isolation and assay

To prepare the ECPs of EHEC and EPEC, overnight cultures in LB were diluted at 1:50

into DMEM and incubated for 9 and 6 h, respectively at 37 oC in a 5% (v/v) CO2

atmosphere. Bacterial cells were removed from the culture by centrifugation (5500 xg, 10

min, 4 oC) and the supernatant was filtered through a 0.22 µm low protein binding filter

(Millex, Millipore). The ECP fraction was isolated by TCA precipitation (Shimizu et al.,

2002) and the protein pellet was washed with –20 oC acetone thrice and air-dried. The

protein pellet was solubilized in ReadyPrep Reagent 3 [5M urea, 2M thiourea, 2% (w/v)

CHAPS, 2% (w/v) SB 3-10, 40 mM Tris, and 0.2% (w/v) Bio-Lyte 3/10 ampholyte; Bio-

Rad] and were stored at –20 oC until analysis. Protein concentration was determined by

using the Bio-Rad protein assay kit with bovine serum albumin as the standard.

III.2.3. One- and two-dimensional gel electrophoresis

ECPs in the amount of 10 to 30 g that gave similar profiles of background proteins were

used to generate the extracellular proteomes of different strains for comparative analysis.

One-dimensional (1-D) SDS PAGE was carried out following a standard protocol

(Sambrook et al., 1989). Two-dimensional (2-D) SDS PAGE was performed with the

EttanTM IPGphor™ Isoelectric Focusing System (Amersham) according to the

manufacturer’s instructions. Dry gel strips were rehydrated for 12 h at room temperature

with 8 M urea, 2% (w/v) CHAPS, 0.5% IPG buffer, 50 mM DTT, and a trace amount of

bromophenol blue. For the first dimension, the ECP samples were separated using 18 cm

rehydrated Immobiline DryStrips with a non-linear gradient pH 3-10 (Amersham) using a

cup-loading system and focused at 500 V for 1.5 h, 4000 V for 2 h, 8000 V for 40000 Vh.

50

Following isoelectric focusing, IPG strips were reduced, alkylated and detergent-

exchanged. 2-D SDS PAGE was carried out in 12.5% sodium dodecyl sulfate-

polyacrylamide gels (20 × 20 cm) and the proteins were visualized with silver staining.

Computer-assisted gel analysis using PD-QUEST Version 7.1.0 (Bio-Rad) was

performed on images captured with a Molecular Dynamics Personal Densitometer (Bio-

Rad). ECP samples were isolated from at least three independent cultures. More than

three separate gels of each sample were analyzed. Protein spots that displayed dominant

and consistent patterns were selected for further identification.

III.2.4. Tryptic in-gel digestion and MALDI-TOF MS analysis

The protein spots of interest were excised from the 2-D gels and digested with porcine

sequencing grade modified trypsin (Promega) following the procedure described by

Shevchenko and coworkers (1996). The extracted peptides were resuspended in 0.1%

(v/v) trifluoroacetic acid (TFA) and 50% (v/v) acetonitrile (ACN). The peptide mixture

(0.5 μl) was spotted on a MALDI target plate simultaneously with 0.5 μl of matrix

solution [a saturated solution of α–cyano-4-hydroxycinnamic acid dissolved in 0.1% (v/v)

TFA and 50% (v/v) ACN]. Peptide mass fingerprint maps of tryptic peptides were

generated by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry

(MALDI-TOF MS) using a Voyager DE-STR Biospectrometry work station mass

spectrometer (Applied Biosystems). All the spectra were obtained in reflectron mode

using an accelerating voltage of 20 kV and a delayed extraction of 150 ns. Mass

calibration was performed using a peptide mixture (angiotensin I) 1296.6853 [M+H]+ and

ACTH (18-39 clip) 2465.1989 [M+H]+ as an external standard. The internal calibration

51

using two peptides arising from trypsin autoproteolysis 842.51[M+H]+ and 2211.10

[M+H]+ was carried out wherever possible. Peptide masses were searched against the

NCBInr database using the MS-Fit program (http://prospector.ucsf.edu) and the Mascot

software (http://www.matrixscience.com) setting a mass tolerance of 50 ppm (internal

calibration) or 200 ppm (external calibration). Proteins with a minimum of four matching

peptides and the sequence coverage exceeding 20% with the match proteins were

considered positive.

III.3. Results and discussion

III.3.1. ECP production

The wild type strains EHEC EDL933, EPEC E2348/69, and their respective ler mutants

(DF1291 for EHEC and DF2 for EPEC) and ihf mutants (DF1292 for EHEC and DF1 for

EPEC) were grown in DMEM for the production of ECPs. EPEC E2348/69 grew slightly

faster in the early log phase and produced greater amounts of ECPs than EHEC EDL933

in DMEM (Fig. III.1). The ECP production of the wild type strains EHEC EDL933 and

EPEC E2348/69 at 6 h was higher than their respective ihf and ler mutants (Fig. III.2)

suggesting that the wild type strains produced more extracellular proteins in the

supernatants. Nine-hour culture for EHEC strains and six-hour culture for EPEC strains

were used for the optimum production of ECPs to construct the extracellular proteomes.

52

02

46

810

1214

1618

20

0 1.5 3 4.5 6 7.5 9 10.5 12

Culture time (h)

ECP

conc

entra

tion

(µg/

ml)

0

0.2

0.4

0.6

0.8

1

1.2

1.4

OD

600n

m

Fig. III.1. Growth and protein secretion of EHEC EDL933 and EPEC E2348/69 in DMEM at 37oC with 5% (v/v) CO2. Growth of EHEC EDL933 ( ) and EPEC E2348/69 ( ) was measured using the optical density at 600 nm. Open bar, ECP production of EHEC EDL933; solid bar, ECP production of EPEC E2348/69. Results are expressed as means ± SEM from three independent experiments.

53

0

2

4

6

8

10

12

EDL933 DF1291 DF1292 E2348/69 DF2 DF1

E. coli strain

ECP

conc

entra

tion

(µg/

ml)

Fig. III.2. Comparison of ECP production among EHEC EDL933 and EPEC E2348/69 wild type strains and their ler mutants (DF1291 for EHEC and DF2 for EPEC) and ihf mutants (DF1292 for EHEC and DF1 for EPEC). EHEC and EPEC strains were cultured in DMEM at 37oC with 5% (v/v) CO2 for 6 h. Results are expressed as means ± SEM from three independent experiments.

54

Fig. III.3. Extracellular proteins from EHEC EDL933. Proteins were separated by 2-D SDS PAGE using IPG of pH 3-10NL. Proteins highlighted were identified by peptide mass mapping using MALDI-TOF MS. Numbers represent the spot identifications listed in Tables III.2 and III.3.

22

24

26

27 28

20

23

19

14

15

1

86

9

7

43

2

12

5

10 11

17

2529

18

16

21

13

MW

124

49

20

35

28

(kDa

80

7

pH 3 pH 10

55

Fig. III.4. Extracellular proteins from EPEC E2348/69. Proteins were separated by 2-D SDS PAGE using IPG of pH 3-10NL. Proteins highlighted were identified by peptide mass mapping using MALDI-TOF MS. Numbers represent the spot identifications listed in Tables III.2 and III.3.

pH 3 pH 10

8

5

7

6

12

30

23

3

2

9

4

31

1

14

22

32

10

11 17

19

2120

24 25

16 15

13

18

26

124

49

20

35

28

MW (kDa)

80

7

56

Table III. 2. Summary of the common extracellular proteins of EHEC and EPEC identified by MALDI-TOF MS Spot no. (from EHEC

or EPEC) Sequence

coverage (%) Protein MW(Da)/

pI (Caculated) Matched

E. coli stain NCBI

Access# Matched protein name in EHEC and other E coli databases ler / ihf

regulated 1-EHEC 45% 58022.5 / 5.01 EDL933 15804222 Translocated intimin receptor Tir + / + 1-EPEC 27% 56843.5 / 5.16 E2348/69 2665524 + / + 2-EHEC 44% 69115.0 / 4.83 EDL933 15799694 Hsp70 (DnaK) - / - 2-EPEC 39% 69115.0 / 4.83 EDL933 15799694 - / - 3-EHEC 30% 57319.6 / 4.81 EDL933 15804735 Hsp60 (GroEL) - / - 3-EPEC 27% 57319.6 / 4.81 EDL933 15804735 - / - 4-EHEC 31% 61046.4 / 5.95 EDL933 15801469 Oligopeptide transport periplasmic binding protein - / - 4-EPEC 38% 61046.4 / 5.95 EDL933 15801469 - / - 5-EHEC 33% 60331.5 / 6.21 EDL933 15804087 Dipetide transport periplasmic binding protein - / - 5-EPEC 35% 60331.5 / 6.21 EDL933 15804087 - / - 6-EHEC 47% 45610.7 / 5.32 EDL933 15803300 Enolase - / - 6-EPEC 42% 45610.7 / 5.32 EDL933 15803300 - / - 7-EHEC 43% 43232.1 / 5.24 EDL933 15804570 Protein chain elongation factor EF-Tu - / - 7-EPEC 54% 43232.1 / 5.24 EDL933 15804570 - / - 8-EHEC 45% 41130.3 / 5.08 EDL933 15803460 Phosphoglycerate kinase - / - 8-EPEC 20% 41118.2 / 5.08 K12 16130827 - / - 9-EHEC 26% 39083.2 / 5.32 EDL933 15804216 EspD + / + 9-EPEC 37% 39473.4 / 5.13 E2348/69 1668720 + / +

10-EHEC 24% 41123.6 / 4.97 EDL933 15801009 Hypothetical protein - / - 10-EPEC 21% 41123.6 / 4.97 EDL933 15801009 - / - 11-EHEC 27% 38791.0 / 5.24 EDL933 15801238 Spermidine/putrescine periplasmic transport protein - / - 11-EPEC 22% 38791.0 / 5.24 EDL933 15801238 - / - 12-EHEC 46% 32630.6 / 5.33 EDL933 15804215 EspB + / + 12-EPEC 68% 33140.8 / 5.24 E2348/69 1169453 + / + 13-EHEC 40% 42383.9 / 6.02 EDL933 15803459 Fructose-bisphosphate aldolase class II - / -

57

13-EPEC 27% 42383.9 / 6.02 EDL933 15803459 - / - 14-EHEC 21% 45344.7 / 6.03 EDL933 15803076 Serine hydroxymethyltransferase - / - 14-EPEC 20% 45344.7 / 6.03 EDL933 15803076 - / - 15-EHEC 45% 35532.5 / 6.61 EDL933 15802193 Glyceraldehyde-3-phosphate dehydrogenase A - / - 15-EPEC 45% 35532.5 / 6.61 EDL933 15802193 - / - 16-EHEC 41% 38668.1 / 9.30 EDL933 15801691 Putative receptor - / - 16-EPEC 39% 38686.1 / 9.30 EDL933 15801691 - / - 17-EHEC 29% 37200.8 / 5.99 EDL933 15800816 Outer membrane protein 3a - / - 17-EPEC 36% 37200.8 / 5.99 EDL933 15800816 - / - 18-EHEC 34% 36030.3 / 5.64 EDL933 15802270 Putative adhesin - / - 18-EPEC 28% 36030.3 / 5.64 EDL933 15802270 - / - 19-EHEC 22% 34905.8 / 5.89 EDL933 15800491 Unknown protein encoded by prophage CP-933K - / - 19-EPEC 26% 34905.8 / 5.89 EDL933 15800491 - / - 20-EHEC 38% 26995.0 / 5.07 EDL933 15802999 Phosphoribosylaminoimidazole-succinocarboxamide synthetase - / - 20-EPEC 35% 26995.0 / 5.07 EDL933 15802999 - / - 21-EHEC 50% 26971.8 /5.64 EDL933 15804508 Triosephosphate isomerase - / - 21-EPEC 32% 26971.8 /5.64 EDL933 15804508 - / - 22-EHEC 41% 28556.4 / 5.85 EDL933 15800464 Phosphoglyceromutase 1 - / - 22-EPEC 53% 28556.4 / 5.85 EDL933 15800464 - / - 23-EHEC 44% 20574.1 / 4.78 EDL933 15804217 EspA + / + 23-EPEC 35% 20468.9 / 4.52 E2348/69 1018995 + / + 24-EHEC 34% 20761.4 / 5.03 EDL933 15800320 Alkyl hydroperoxide reductase C22 protein - / - 24-EPEC 54% 20761.4 / 5.03 EDL933 15800320 - / - 25-EHEC 51% 23104.6 / 5.95 EDL933 15804445 Protein disulfide isomerase I - / - 25-EPEC 41% 23118.6 / 5.95 CFT073 26250621 (Thiol:disulfide interchange protein dsbA precursor ) - / - 26-EHEC 47% 18266.0 / 4.73 EDL933 15802950 PTS system, glucose-specific IIA component - / - 26-EPEC 33% 18266.0 / 4.73 EDL933 15802950 - / -

58

Table III. 3. Summary of the specific extracellular proteins of EHEC and EPEC respectively identified by MALDI-TOF MS Spot no. (from

EHEC or EPEC) Sequence

coverage ( %) Protein MW(Da)/

pI (calculated) Matched

E. coli strain NCBI

Access # Matched protein name in EHEC and other E coli databases ler / ihf

regulated

27-EHEC 30% 141758.4 / 6.36 EDL933 3822134 EspP - / - 28-EHEC 28% 99548.5 / 6.39 EDL933 10955349 TagA + / +

29-EHEC 43% 24691.8 / 6.11 EDL933 15802406 Hypothetical protein - / -

30-EPEC 30% 140860.9 / 5.61 E2348/69 1764164 EspC + / + 31-EPEC 27% 20977.7 / 10.61 E2348/69 2865308 EspF + / + 32-EPEC 24% 17879.9 / 6.96 EDL933 15802663 Putative superinfection exclusion protein B of prophage CP-933V - / -

33-EPEC 23% 52982.7 / 4.51 E2348/69 5107855 FliC - / +

59

III.3.2. Extracellular Proteomes of EHEC and EPEC

ECPs from EHEC EDL933 and EPEC E2348/69 were subjected to 2-D SDS PAGE,

consistent and dominant extracellular protein spots were excised for the tryptic in-gel

digestion, MALDI-TOF MS analysis and a protein database search. Fifty-nine of them

were identified (Tables III. 2 and 3) which covered most of the prominent proteins. A

total of 29 and 30 proteins were identified for EHEC EDL933 and EPEC E2348/69,

respectively (Figs. III.3 and 4). Peptide mass fingerprints generated from the EHEC

EDL933 protein spots were assigned to the complete genome database of EHEC EDL933

for protein identification. Since the genome sequence of EPEC E2348/69 is not available,

peptide mass fingerprints generated from the EPEC E2348/69 protein spots were then

compared to a limited library of ORFs of EPEC E2348/69 and other E. coli genomes

database such as EHEC EDL933, K-12 and CFT073 (Tables III. 2 and 3).

Among these 59 proteins in the EHEC EDL933 and EPEC E2348/69 extracellular

proteomes, 26 proteins were produced in both strains (Table III. 2). Three of the Esp

proteins (EspA, EspB, and EspD) appeared as the most prominent protein spots

distributed from the acidic to neutral pH range (pH 3-6) in both EHEC EDL933 and

EPEC E2348/69 extracellular proteomes. EspB and EspD are components of the TTSS

translocon and are required for the delivery of the translocated intimin receptor (Tir) via

the TTSS needle complex with a filamentous extension formed by EspA (Ebe et al., 1998;

Kenny et al., 1997; Knutton et al., 1998; Wolff et al., 1998). High molecular weight heat

shock proteins Hsp60 (GroEL) and Hsp70 (DnaK), which may function as chaperons in

the type II and type IV secretion systems with less specificity for the target preprotein

60

(China and Goffaux ,1999), were accumulated in the acidic region in the EHEC EDL933

and EPEC E2348/69 extracellular proteomes. In Legionella pneumophila and

Helicobacter pylori, Hsp60 and Hsp70 were reported to be involved in colonization,

attachment and invasion (Bernard and Goffaux, 1999). The identification of similar heat

shock proteins in the extracellular proteomes of EHEC and EPEC may suggest their

participation in pathogenesis. One protein from EHEC EDL933 and EPEC E2348/69,

which has high similarity to an unknown protein encoded by prophage CP-933K in

EHEC, and another protein from EPEC E2348/69, which is homologous to a putative

superinfection exclusion protein B of prophage CP-933V in EHEC, were identified in the

respective proteomes. Many phage proteins have been reported as virulence factors

(Boyd and Brussow, 2002) which implicate these two putative prophage-encoded

proteins may play important roles in EHEC and EPEC pathogenesis.

Several enzymes that are involved in different metabolic processes were found in the

extracellular proteomes of EHEC EDL933 and EPEC E2348/69. These were nucleotide

metabolic enzymes such as phosphoribosylaminoimidazole-succinocarboxamide synthase,

enzymes in the glycolytic pathway such as glyceraldehyde-3-phosphate dehydrogenase,

phosphoglycerate kinase, triosephosphate isomerase, phosphoglycerate mutase, and

enolase, and some amino acid metabolism enzymes such as serine

hydroxymethyltransferase, and one detoxification enzyme alkyl hydroperoxide reductase

C22. Furthermore, some outer membrane, periplasmic and cytosolic proteins were also

detected in the extracellular proteomes.

61

Uncommon extracellular proteins, EspP, TagA (also called StcE, 24), and a hypothetical

protein were found only in EHEC EDL933. EspP is a secreted serine protease which

cleaves pepsin and human coagulation factor V and was proposed to be a contributing

factor in mucosal hemorrhage in patients (Brunder et al., 1997). TagA is an extracellular

metalloprotease and was recently reported as a protease that specifically cleaved C1

esterase inhibitor (C1-INH) (Lathem et al., 2002). These two proteases are encoded in the

EHEC large plasmid pO157 and are regarded as the virulence factors of EHEC. EspC,

EspF, a hypothetical protein, and a putative superinfection exclusion protein B of

prophage CP-933V were found in EPEC E2348/69. EspC is a secreted immunoglobulin

A protease-like protein encoded within a second pathogenicity island in the EPEC

chromosome and was regarded as an enterotoxin (Millies et al., 2001). We also identified

EspF in EPEC E2348/69 which induces epithelial cell death but the mechanism remains

unknown (Crane et al., 2001). The genome of EHEC EDL933 also contains the espF

gene and the encoded protein shares 93.4% identity at the amino acid level with the EspF

of EPEC E2348/69. The reason for not detecting EspF in the ECPs of EHEC EDL933

may be due to the low level of secretion of EspF and its extremely basic pI.

The EHEC and EPEC are very similar pathogens. They colonize the intestinal mucosa,

subvert intestinal epithelial cell function, and produce the characteristic AE lesion via

their secreted and membrane proteins (Jarvis et al., 1995; Jarvis and Kapper, 1996). From

the ECP proteomics profiles, twenty-six of these proteins, 90% and 87% of the total

identified proteins respectively, are common in EHEC EDL933 and EPEC E2348/69,

62

which demonstrate the close relationship between these two pathogens. At the same time,

there are several proteins (such as TagA, EspP and EspC) which are exclusively produced

by EHEC EDL933 or EPEC E2348/69. This shows there are variations between these

two E. coli strains. Our proteome profiles of EHEC EDL933 and EPEC E2348/69 have

demonstrated both the similarity and divergence of these two pathogens. The variability

in proteins that may interact with the host suggests that these variable proteins may be

subject to natural selection for evasion of the host immune system or serve to spread a

particular strain in a given population (Donnenberg and Whittam, 2001).

The most prominent proteins in the EHEC EDL933 and EPEC E2348/69 extracellular

proteomes are mainly secreted proteins such as EspA, EspB, EspC, EspD, EspF, EspP,

TagA and Tir. The heat shock proteins (such as Hsp60 and Hsp70) which help protein

refolding and prevent protein degradation have been reported earlier to be released into

the extracellular fraction (Pugsley, 1993). Though some outer membrane, periplasmic

and cytosolic proteins are detected in our extracellular proteome profiles, this is probably

due to the lysis of the bacteria in the culture or the formation of blebs (Yaron et al., 2000).

Some protein spots could not be identified possibly due to their low molecular weights

which would not produce enough peptides for the fingerprint analysis. Despite these

limitations, our results show that the coupling of silver staining and MALDI-TOF

analysis is a sensitive method for protein detection and the extracellular proteomes we

generated are reliable and reproducible.

63

III.3.3. Identification of Ler and IHF regulated proteins

The extracellular proteomes of EHEC EDL933 and EPEC E2348/69 give an integrated

overview of the ECP profiles and can be used as a reference for the global analysis of

protein expressions in pathogenic E. coli (such as EHEC and EPEC) under various

culture conditions, and for comparison between wild types and mutant strains.

Comparison of extracellular proteomes among the wild type strains, and the ler and ihf

mutants revealed that four common protein spots namely EspA, EspB, EspD, and Tir

were present only in the wild type strains of both EHEC EDL933 and EPEC E2348/69

while absent in the ler and ihf mutants (Figs. III.5 and 6). These four proteins are TTSS

secretion proteins which are highly conserved in EHEC EDL933 and EPEC E2348/69

with a small degree of divergence: espB (74.01 % identity), espA (84.63 % identity),

espD (80.36 % identity), and tir (66.48 % identity) (Perna et al., 1998). They are

regulated by Ler and IHF at the transcription level (Beltrametti et al., 1999; Mellies et al.,

1999; Friedberg et al., 1999), and their expression is dependent upon culture conditions,

growth phase and host contact (Rosenshine et al., 1996; Hiroyuki et al., 2002; Yoh et al.,

2003). EspF is also co-transcribed with espADB and regulated by Ler (Elliott et al., 2000).

However, EspF was identified only in EPECE2348/69 and not in EHEC EDL933.

The differences in protein profiles of the wild type strains and the ler and ihf mutants

could be attributed to the lost functions of Ler and IHF which resulted in the decreased

protein secretion for the ler and ihf mutants. On the other hand, there are other Ler and

IHF regulated TTSS proteins that have not been identified here. This may be due to

higher translocation levels compared to secretion levels such as for EspH (Tu et al.,

64

2003), or due to their extreme acidic or basic isoelectric points, which would allow them

to migrate beyond our normal IPG gel strip range and thus not be visualized by 2-D SDS

PAGE.

We also identified one flagella component protein, FliC that is solely present in EPEC

2348/69 ihf mutants (Fig. III.6). This proteomics result indicates that ihf depressed the

expression of FliC, which is consistent with a report that IHF mediates the repression of

flagella in EPEC (Yona-Nadler et al., 2003).

Comparison of 1-DE profiles of ECPs of EHEC EDL933 and EPEC E2348/69, and their

respectively ler and ihf mutants showed that a protein band of around 110 kDa was

regulated by Ler and IHF (Fig. III. 7). Elliott and coworkers (2000) also reported that Ler

regulated a 110 kDa protein in both EPEC E2348/69 and EHEC EDL933. This protein

was identified as EspC in EPEC using an anti-EspC antibody while the identity of the

equivalent 110 kDa protein in EHEC remained unclear. In the extracellular proteome of

EHEC EDL933, TagA was found to be regulated by Ler with a similar molecular weight

but a different isoelectric point than EspC (ca. 110 kDa) (Figs III. 5 and 7). The

expression level of Tag A was much lower in the ler mutant than the wild type indicating

that TagA was regulated by Ler. By using the proteomics approach, we have identified

this cryptic110 kDa protein as TagA in EHEC EDL933, which could not be identified by

Elliott and coworkers using an anti-EspC antibody (Elliott et al., 2000).

65

Fig. III.5. Comparative proteome analysis of EHEC EDL933 wild type strain, the ler mutant (DF1291) and ihf mutant (DF1292). Proteins were separated by 2-D SDS PAGE using IPG of pH 3-10NL. Proteins highlighted with circles were detected only in the wild type strain and were missing in the ler and ihf mutants. Numbers represent the spot identifications listed in Tables III.2 and III.3.

DF1292pH 3 pH 10

DF1291pH 3 pH 10

23

1

28

9 12

EDL933 pH 3 pH 10

49

20

35

28

MW (kDa)

80 124

66

Fig. III.6. Comparative proteome analysis of EPEC E2348/69 wild type strain, the ler mutant (DF2) and ihf mutant (DF1). Proteins were separated by 2-D SDS PAGE using IPG of pH 3-10NL. Proteins highlighted with circles were detected only in the wild type strain and were missing in the ler and ihf mutants. The triangle highlighted a protein that was present only in the ihf mutant. Numbers represent the spot identifications listed in Tables III.2 and III.3.

Fig. III.7. One-D SDS PAGE of the ECPs from EHEC EDL933 and EPEC E2348/69 wild type strains, the ler mutants (DF1291 for EHEC and DF2 for EPEC) and ihf mutants (DF1292 for EHEC and DF1 for EPEC). Only the high molecular weight bands were showed. The ca.110 kDa protein bands were present in EHEC EDL933 and EPEC E2348/69 but not in their respective ler and ihf mutants.

~110kDa EDL933 DF1291 DF1292

E2348/69 DF2 DF1~110kDa

DF1

33

pH 3 pH 10 pH 3 pH 10 DF2

pH 3 pH 10 E2348/69

1

12 9

23

30

31

MW (kDa)

80

35

49

28

20

124

67

III.3.4. Applications and conclusions

The ability of pathogenic bacteria to cause disease in a susceptible host is determined by

multiple factors acting individually or together at different stages of infection. Proteomics

can provide an integrated view of the gene products of certain bacteria for such global

analysis. The secretion of virulence factors is a common feature of many pathogenic

bacteria, thus it is important to generate extracellular proteomes to facilitate studies in

bacterial pathogenesis. For the first time, the extracellular proteomes of EHEC EDL933

and EPEC E2348/69 were provided and a proteomics approach was used to analyze the

extracellular proteins of these two closely related human pathogens. These proteome

profiles can help link the virulence determinants in an integrated manner, and also

facilitate the characterization of changes in mutants. In this study, several virulence

proteins regulated by Ler and IHF have been confirmed, and some interesting features

were found for further investigation.

EHEC serotypes other than O157:H7 and EPEC are not routinely identified in most

clinical microbiology laboratories. Thus the characteristic proteins of EHEC and EPEC,

as identified in their extracellular proteomes, could also be used as new diagnostic tests

for these pathogens. For example, EspA, EspB, EspD and Tir are common in EHEC

EDL933 and EPEC E2348/69, while EspP and TagA are specific for EHEC EDL933 and

EspC is specific to EPEC E2348/69. In addition, many other diarrhea-causing strains of E.

coli cannot be easily isolated in the clinical microbiology laboratory and a proteomics

analysis of these strains may reveal biomarkers that could be used in their diagnosis.

68

Chapter IV. Characterization of EspB as a translocator and an effector

and its involvement in EPEC autoaggregation

The results from this chapter are included in the following manuscript:

Li, M., I. Rosenshine, and K. Y. Leung. Characterization of EspB as a translocator and

an effector and its involvement in EPEC autoaggregation. (In preparation)

69

Abstract

EspB is a major secreted protein in EPEC and EHEC when cultured in a minimal

medium. It is shown to be an essential virulence factor of EPEC and EHEC and is

implicated to have roles in multiple functions. In this study, different experimental

approaches were used in an attempt to identify the roles of EspB in EPEC and EHEC.

Two forms of EspB were identified in the extracellular proteome of EPEC and EHEC. It

was found that these two forms of EspB were not due to the cleavage of N-ternimal

signal region nor were due to the phosphorylation of residues of EspB. 2-D SDS PAGE

of the ECP of ∆espB strain showed that the ∆espB mutant did not affect the secretion of

other extracellular proteins. However the ∆espB mutant was shown to be defective in the

translocation of effectors, such as Tir. Using β-lactamase reporter system, EspB was

shown to contain the typical secretion and translocation signal in the first 20 residues.

Translocation was demonstrated for EspB showing that EspB is an effector. EspB was

found to be involved in the autoaggregation of EPEC and a ∆espB mutant displayed

diffuse growing pattern in liquid culture medium. Transmission electron microscopy

(TEM) showed that the bacterial cells surface of ∆espB was smooth without protrusive

filamentous organelles. Moreover, the ∆espB mutant displayed less invasion ability when

compared to the EPEC wild type in HeLa cells.

70

IV.1 Introduction

EPEC and EHEC are important causal agents of food born diarrhea in developed and

developing countries. They both can cause A/E lesions in the colonized intestine

enterocytes which is characteristic of EPEC and EHEC (Frankel et al., 1998). EPEC and

EHEC use TTSS to colonize the host gastro-intestinal track and secrete a lot of proteins

to overcome peristaltic clearance and thus gain access to host-derived nutrients. EspA,

EspB and EspD are three major TTSS dependent secretion proteins (Galan 2001; Collmer

et al., 2002), which have been posited to play several functions in the process of infection.

EspA is a main component of the filamentous structure localized in the TTSS needle tip

and formed a hollow tube through which effector proteins are transported (Daniell et al.

2003; Crepin et al., 2005). EspD is a hydrophobic protein with acidic pI and is secreted

by EPEC and EHEC. It has two putative transmembrane domains and has been observed

in the host cell membrane (Wachter et al., 1999). It is hypothesized that EspD monomers

can interact with each other through a coiled-coil domain to form the main structure of

the translocation pore in the host membrane. EspD is also known to be required for the

polymerization of EspA filaments (Knutton et al., 1998; Kresse et al., 1999).

EspB is a major secreted protein of EPEC and EHEC and is a key virulence factor of

EPEC and EHEC in humans and animal models (Abe et al., 1998; Tacket et al., 2000).

As being an approximately 38 kD protein, EspB has one putative transmembrane domain

and three putative coiled-coil domains. EspB is hypothesized to be inserted into the

membrane of infected cells which together with EspD are thought to form a translocation

pores in the host cell membrane (Wachter et al., 1999; Ide et al., 2001; Shaw et al., 2001).

It is demonstrated that EspB protein is needed for the full pore formation and the

71

subsequently hemolytic effect (Warawa et al., 1999). EspB, EspD and EspA together can

form a filamentous protein translocation apparatus through which effector proteins were

translocated.

Besides acting as an essential component of the translocation apparatus in host membrane

to help other effectors’ transportation, EspB itself seems to be translocated and can be

detected in cytoplasm of infected cells implying that EspB may also have an additional

function as an effector (Taylor et al., 1998; Wolff et al., 1998). Recently, EspB from

EHEC was found to bind to the cytoskeleton protein β-catenin in HeLa cells (Kodama et

al., 2002). Other authors have found that the EspB of EPEC can interact with α-1-

antitrypsin and that this interaction plays a role in pore formation (Knappstein et al.,

2004). Luo and Donnenberg (2006) used random mutated espB to identify the different

domains involved in effector translocation and as a component of the translocation pore.

They found that the principle role of EspB is to form a pore in the host cell membrane, as

determined by hemolytic activity, which can be separated from its role in protein

translocation.

Since several functions have been attributed to EspB, more roles were assigned to this

protein. Using proteomics approach, two forms of EspB were identified in ECP profiles

of EPEC and EHEC. The involvement of EspB in the EPEC aggregation was also

observed. The present study aims to characterize the possible duel roles of EspB to

provide complete functional features of EspB.

72

IV.2. Materials and methods

IV.2.1. Bacterial strains and plasmids

The bacterial strains and plasmids used in this study are listed in Table IV.1.

Table IV. 1. Bacteria strains and plasmids used in this study

Strains or plasmids Description Reference or source

Strains

E2348/69 Wild type EPEC O127:H6, Smr J. Kaper

EDL933

Wild type EHEC O157:H7, Slt1, Slt2 negative derivative

J. Leong

∆espB E2348/69 in-frame deletion of espB This study

Plasmids

pQE31 coliE1; lacI ; Ampr Qiagen

pQEespB Residues 1-193 of EspB fused to TEM-1 This study

pCXespB Residues 1-193 of EspB fused to TEM-1 This study

pCXespB20 Residues 1-21 of EspB fused to TEM-1 This study

73

IV.2.1. Fractionation of infected HeLa cells

Infection of HeLa cells with EPEC strains and fractionation of HeLa cells infected with

EPEC strains were prepared as described previously (Tu et al., 2003). Briefly, HeLa cells

(5 x 106 cells / 100 mm dish) were infected with 100 µl of overnight EPEC wild type and

∆espB mutant culture. After 5 h infection, HeLa cells were washed 3 times and lyzed by

1% Triton X-100. Centrifugation was applied to precipitate all insoluble components

including cell membrane, nuclei, large cytoskeleton complexes, and attached bacteria.

Cytosolic proteins in the supernatant were recovered as the soluble fraction.

IV.2.2. Invasion assay

Invasion of HeLa cells was monitored by the gentamicin protection assay as previously

described (Rosenshine et al., 1996), with small modification. Briefly, one day before

infection, HeLa cells were seeded into 24 wells plate using 2-3 x105 cell / well. Bacterial

colonies were inoculated into 4 ml LB liquid medium and incubated at 37oC overnight

without shaking. On the day of infection, bacteria were subcultured into DMEM using

1:50 dilution. Before infection, HeLa cells were washed with PBS for 2-3 times to

remove the antibiotic and serum. After incubating bacterial culture in 37 oC, 5% CO2

incubator for 1 h, 1 ml/well bacterial culture were added into HeLa cell culture plate and

incubate at 37oC in a CO2 incubator for 3.5 h. After infection, the bacterial culture was

removed and HeLa cells were washed with PBS. HeLa cells were further incubated with

1 ml DMEM containing 100ug/ml gentamicin for additional 2h. 2 hours later, the DMEM

with gentamicin was removed and the HeLa cells were washed with PBS for three times.

After wash, the HeLa cells were lysed in 1 ml lysis solution containing 1% TritonX-100

74

and 10 mM MgSO4. The number of viable intracellular bacteria was quantified by plating

onto LB plates supplemented with 30ug/ml streptomycin and CFU counting. The

invasion rates were calculated from the mean of two wells in triplicate experiments.

IV.2.3. Examination of bacterial surface exposed structure by transmission electron

microscopy (TEM)

The glutaraldehyde/ruthenium red/uranyl acetate method was used to stain the cells

(Mustaftschiev et al., 1982). A drop of bacterial culture was placed on a coated grid for 1

min and blotted with filter paper. The grid was then floated on the top of an equal-volume

mixture of 1% glutaraldehyde in 0.2 M cacodulate buffer (pH 7) with specimen slide

down for 1 min. The grid was picked up and blotted with filter paper. A drop of 1%

ruthenium red in water was then added. After the incubation for 2 min, the grid was

blotted again and stained with 0.05% uranyl acetate for 1 min. The grid was then blotted.

TEM observation was performed after the grid was dried.

IV.2.4. Phase contrast microscopy

After culturing EPEC wild type, ∆espB mutant and ∆espB / pQEespB strains in DMEM

for 6 h, bacteria culture were stained with Crystal Violet and transfered to glass slides

covered with coverslips and examined under Axiovert 25 CFL inverted phase-constrast

microscope (Carl-Zsiss, Germany) at 100× magnification. Photographs were taken using

a digital camera.

75

IV.2.5. Construction of plasmid for expression of EspB-TEM and β-lactamase based

translocation assay

Plasmids pCXespB and pCXespB20, encoding the TEM-1 fusion with EspB or the first

20 residues of EspB, were obtained by ligating the full espB gene and the first 60 bp of

espB gene with β-lactamase gene. Translocation of EspB and the first 20 amino acids of

EspB were assayed with the β-lactamase reporter system as described by Charpentier and

Oswald (2004). Briefly, overnight LB cultures of the EPEC wild type and the mutants of

escN::TnphoA carrying pCX341, pCXespB and pCXespB20 were diluted 1:50 in DMEM

and incubated at 37oC in a 5% CO2 atmosphere for 2 h. The preactivated bacteria at an

MOI of 100:1 were added to HeLa cells grown on cover slips in 24-well culture plates.

Infections were allowed to proceed for 1h and then induced with 1 mM IPTG for an

additional 1h. Monolayers were then washed three times with Hanks’ balanced salt

solution (HBSS) (Invitrogen), loaded for 1 h with 1 μM CCF2/AM (Invitrogen) and

washed twice with HBSS (Charpentier and Oswald, 2004). The cover slips were mounted

to slides and were observed on a fluorescence microscope (Olympus, BX60) with a 4’,6’-

diamidino-2-phenylindole (DAPI) filter set (340- to 380-nm excitation and 425-nm long-

pass emission).

IV.2.6. Edman N-terminal sequencing

The regions of the two spots of EspB were excised from 2-D gel and transferred onto

PVDF membrane and visualized by commassie blue staining. Amino-terminal

sequencing of the two EspB protein samples were performed by automated Edman

degradation using the ABI Procise Protein Sequencing System (USA). An on-line

76

reverse-phase HPLC (PTH-C18 column) with an on-line 785A phenylthiohydantoin

(PTH)-amino acid 140C analyser were used to identify the PTH amino acids.

IV.3. Results

IV.3.1. Survey of the two forms of EspB

Using the proteomics approach, two dominant EspB spots were found in both EHEC

EDL933 and EPEC E2348/69 extracellular proteomes (Figs. III.3 & 4). EspB was shown

to have multiple functions (Tacket et al., 2000). It is possible that EspB may be present in

different forms via modifications for different functions. N-terminal sequencing was

carried out to examine the possible modification of the two spots of EspB. However, the

first 20 residues of the N-terminal of the two EspB spots were identical which suggested

that no cleavage was observed (data not shown). It was found that EspB has serine and

threonine rich domains, which may be phosphorylated to produce two forms in the

supernatant. Therefore, the ECPs of EHEC and EPEC were treated with alkaline

phosphatase and 2-D gels were used to check the possible phosphorylation modification.

However the 2-D gels showed no detectable de-phosphorylation (Fig. IV.1.) and the two

forms of EspB were still present in the 2-D gels. These data suggested that the two forms

of EspB proteins may not be due to the N-terminal processing or phosphorylation of

certain residues of EspB.

77

Fig. IV.1. Extracellular proteins (ECPs) from EPEC E2348/69 (a) and EHEC EDL933 (b) treated with alkaline phosphatase. Proteins were separated by 2-D SDS PAGE using IPG of pH 4-7L. Proteins highlighted were the two major forms of EspB identified by peptide mass mapping using MALDI-TOF MS.

IV.3.2. Mutation of espB did not affect the secretion of other extracellular proteins

EspB is one of the dominant proteins in the ECPs of EHEC EDL933 and EPEC E2348/69,

which is central to EPEC and EHEC interactions with host cells in vitro (Foubister et al.,

1994; Tacket et al., 2000; Kodama et al., 2002). It is found that EPEC ∆espB mutant

produced much less ECPs when compared to the wild type (Fig. IV.2.). The

complemented strain ∆espB/pQEespB has higher ECP secretion than ∆espB mutant

suggesting the partial complementation of the EspB. To further test the reduced secretion

of the ∆espB was due to the lower amount of EspB or other ECPs, 2-D SDS PAGE was

used to get an integrated view of the extracellular proteome of the ∆espB mutant. Fig.

IV.3. showed that only the EspB protein was missing in the 2-D profile of the ∆espB

mutant when compare to the EPEC wild type. Such result indicated that the ∆espB

mutant may not affect the secretion of other ECPs and EspB is the dominant secreted

protein in the ECPs of EPEC and EHEC.

EspB

a EspB

b

78

0

2

4

6

8

10

12

1.5 3 4.5 6 7.5 9 10.5 12

Culture time

ECP

conc

entra

tion

(µg/

ml)

Fig. IV.2. Protein secretion of EPEC strains in DMEM at 37oC with 5% (v/v) CO2. Open bar, ECP production of EPEC E2348/69; grey bar, ECP production of EPEC ∆espB; black bar, ECP production of ∆espB / pQEespB. Results are expressed as means ± SEM from three independent experiments.

79

Fig. IV.3. Comparative proteomics analysis of ECP from EPEC E2348/69 wild type strain and the ∆espB mutant. Proteins were separated by 2-D SDS PAGE using IPG of pH 3-10NL. Proteins highlighted with circles were secreted proteins identified by MALDI-TOF-MS. The EspB protein was missing from the ECP of ∆espB mutant.

Fig. IV.4. Western blot analysis of Triton X-100 insoluble and soluble fractions of HeLa cells after infected with the EPEC wild type E2348/69 and the ∆espB mutant and detected with anti-Tir antibody.

Tir

EspB EspD

EspA

EspC

pH 3 pH 10 E2348/69

49

20

35

28

MW (kDa) 124 80

pH 3 pH 10

EspA

EspD

Tir EspC ∆espB

80

IV.3.3. Mutation of espB mutant abolished the translocation of effectors

Although the ∆espB mutant did not affect the secretion of other proteins, EspB was

shown to be inserted into the target cell membrane which facilitates the translocation of

effectors (Ide et al., 2001). To further characterize the translocator property of EspB,

HeLa cells were infected with the EPEC wild type and the ∆espB mutant. After the

infection for 5 h, HeLa cells were fractionated by 1% Triton X-100. Western blot by

using anti-Tir antibody showed that Tir can be detected in the TritonX-100 soluble

fraction of the HeLa cells infected with the EPEC wild type but not in the sample infected

with the ∆espB mutant (Fig. IV.4.). This result indicated that EspB was important for the

translocation of TTSS effectors.

IV.3.4. EspB is translocated into infected HeLa cells

Although EspB is proposed to have some characteristics of an effector and can be

detected in cytoplasm of infected cells (Tailor et al., 1998; Wolff et al., 1998), the

translocation of EspB was not verified. To elucidate the character of EspB as an effector,

the TEM β-lactamase system was used to visualize the translocation of EspB into the host

cells. Full length of EspB was fused to β-lactamase to create EspB-TEM fusion protein

using plasmid pCX341 (Charpentier & Oswald. 2004). The plasmid expressing a full

length EspB-TEM fusion protein (pCXespB) was transformed into the EPEC wild type

strain E2348/69 and the escN::TnphoA mutant and assayed for its translocation by

loading infected HeLa cells with fluorescent β-lactamase substrate CCF2/AM. Under the

fluorescence microscope, HeLa cells infected with EPEC / TEM (negative control, empty

vector) remained green, indicating the absence of TEM-1 activity in the cell cytosol (Fig.

81

IV.5a). In contrast, cells infected with EPEC strains expressing EspB-TEM appeared blue,

indicating that TEM-1 was translocated into the host cells (Fig. IV. 5b). However, only

green fluorescent signal was detected within living HeLa cells infected with the EPEC

escN::TnphoA mutant (Fig. IV. 5d), which indicated that EspB-TEM fusion protein is not

translocated into infected cells by the EPEC escN::TnphoA mutants.

It was reported that the first 20 codons of certain TTSS effectors mediated secretion and

translocation of LEE encoded effectors (Charpentier and Oswald 2004). To assess if

EspB similarly possesses the effector characteristic secretion and translocation signal at

its N-terminus, the first 20 residues of EspB was fused to TEM-1 (pCXespB-20) and the

translocation property was assayed in EPEC wild type and escN::TnphoA mutant

backgroud. It was found that blue fluorescent signal was detected in HeLa cells infected

with EPEC wild type but not escN::TnphoA strain expressing EspB20-TEM (Fig. IV.5c

and 5e). These results showed that EspB was an effector protein which can be

translocated into host cells. The translocation signal is in the first 20 amino acids of EspB

and the translocation of EspB was TTSS dependent.

82

Fig. IV.5. Demonstration of the translocation of EPEC EspB proteins into live HeLa cells by using TEM-1 fusions and fluorescence microscopy. HeLa cells were infected with EPEC wild type strains E2348/69 and escN::TnphoA mutant expressing different TEM-1 fusion proteins. β-lactamase activity in HeLa cells is revealed by the blue fluorescence emitted by the cleaved CCF2/AM product, whereas uncleaved CCF2 emits a green fluorescence.

83

IV.3.5. EspB is involved in the autoaggregation

During the analysis of ECP production, EPEC wild type strain E2348/69 was found to

aggregate in the culture tube and settle down on the bottom after 6 h of culturing in

DMEM medium at 37oC without shaking. On the other hand, the ∆espB mutant did not

display the autoaggregation phenotype as the wild type. However the complemented

strain E2348/69 ∆espB / pQEespB could restore autoaggregation and form precipitate in

the culture tube (Fig. IV.6). Further more, the EPEC ler mutant and ihf mutant which

could not secrete any EspB protein were found to diffuse in the broth culture without

forming any aggregation (data not shown). These observations triggered the speculation

that EspB may contribute to EPEC aggregation phenotype. This is an interesting

phenotype since the autoaggregation associates with the micro-colony formation and will

contribute to the virulence of EPEC. Further experiments were carried out to identify the

role of EspB which involves in the aggregation property.

IV.3.6. EspB mutant does not form the autoaggregation

To further verify that the autoaggregation of the EPEC bacteria was due to the

interactions of the bacteria cells, Phase-contrast microscopy was used to show the

aggregation formation of EPEC. After culturing the EPEC wild type, ∆espB mutant and

∆espB / pQEespB strains in DMEM for 6 h, bacteria culture were stained with crystal

violet and transfer to glass slides and observed under phase-constrast microscopy.

Microscopic observation showed that many bacterial cells were clumped together in the

EPEC wild type, but no clumping of cells was observed in the ∆espB (Fig. IV.7.).

84

Individual bacteria of espB mutants were found in the culture medium. The clumping of

bacteria was observed also in the complemented ∆espB with pQEespB. This clumping

phenotype suggested that the EPEC wild type strain can form autoaggregation when

cultured in minimal medium DMEM and EspB may be involved in the aggregation

phenotype and this phenotype can be restored in the ∆espB mutant by suppling EspB in

tran.

Fig. IV.6. Autoaggregation of EPEC in DEM culture is conferred by EspB. After 6 h of culturing, the EPEC wild type and ∆espB /pQEespB strains formed aggregation at the bottom of the culture tubes and the supernatant were clear, while ∆espB mutant failed to aggregate and a distributed throughout the DMEM culture.

E2348/69 espB espB/pQEespB

85

Fig. IV.7. Microscopic observation of EPEC demonstration of EPEC E2348/69 (wild type), ΔespB and ΔespB / pQEespB strains cultured in DMEM for 6 h. E2348/69 and ΔespB / pQEespB strains showed clumping pattern while ΔespB strain grew in a diffusive pattern with single cells in the medium. Arrows indicate the clumping of bacterial cells.

E2348/69 espB espB / pQEespB

86

Fig. IV.8. Transmission electron microscopy showed the extracellular filamentous appendages of the EPEC wild type E2349/69 (a) and ∆espB (b) mutant. The arrows are highlighting the filamentous structures on the extracellular surface of EPEC wild type but on the ∆espB mutant.

IV.3.7. ∆espB mutant showed less extracellular filamentous appendages

To further access what structures may contribute to the aggregation phenotype of EPEC,

transmission electron microscopy was used to examine the surface feature of the EPEC

wild type and the ∆espB mutant. Electron micrographs of the wild type EPEC cells and

the ∆espB mutant grown in DMEM showed that the EPEC cells either do not possess

flagella or rarely. The EPEC wild type had many extracellular filamentous appendages on

the surface but not on the surface of the ∆espB mutant (Fig. IV. 8). These results

indicated that EspB may interact or affect the expression of some surface exposed

ba

87

structures of EPEC results in the aggregation phenotype. And this surface exposed

structure might be the extracellular filamentous TTSS appendages.

IV.3.8. ∆espB mutant has lower invasion ability

Although EPEC is minimally internalized into non-intestinal cell lines in vitro, this

phenotype has been very useful in studying the molecular genetics of EPEC because

many of the genes involved in invasion are also involved in forming the A/E lesion

(Donnenberg et al., 1989; Donnenberg et al., 1990; Jepson et al., 2003).

In order to further characterize the role of EspB in the cellular invasion by EPEC, the

invasion of HeLa cells by the EPEC wild type and the ∆espB mutant were compared. A

gentamicin HeLa cell assay was used and the recovery of the EPEC wild type and the

∆espB mutant were measured. A three fold less invasion ratio of the ∆espB mutant

compared to the wild type EPEC was observed (Fig. IV. 9). And the complemented strain

∆espB/pQEespB partially restored the invasion phenotype in ∆espB (Fig. IV. 9)

indicating that EspB did involve in the invasion process.

88

0

0.2

0.4

0.6

0.8

1

1.2

E2348/69 ∆espB ∆espB/pQEespB

EPEC strains

% S

ervi

val r

ate

of b

acte

ria w

ithin

Hel

a ce

lls (a

gain

st E

PEC

wild

type

)

Fig. IV.9. EPEC espB mutant showed reduced ability to invade HeLa cells. HeLa cells were infected with the EPEC wild type E2348/69, ΔespB and ΔespB / pQEespB mutants for 6 h. HeLa cells were washed, harvested in PBS and lysed with PBS containing 1% Triton X-100. The cell lysates were diluted serially and plated on LB plates. After overnight incubation, colony forming unit (CFU) were scored and presented as a percentage of those observed with the wild type.

89

IV. 4. Discussion

Many key virulence factors shared by the A/E pathogens are found at the site of

enterocyte effacement (Frankel et al., 1998). EspB is one of the secreted proteins which

is identified in the culture medium and on the membrane of the infected cells. Due to the

multiple roles of EspB, different forms of EspB may exist after modifications to perform

different functions. By the proteomics approach, two dominant EspB spots were found in

both EHEC EDL933 and EPEC E2348/69 extracellular proteomes (Figs. III. 3 & 4). N-

terminal sequencing of these two EspB proteins and alkaline phosphatase analysis did not

show any detectable modification. The two EspB spots in the 2-D gel may not be due to

the improper separation since different pH range gel strips were used to separate EPEC

and EHEC ECPs while the two forms of EspB always appeared together. Further

characterization is needed to determine the possible modification and function of these

two forms of EspB proteins.

EspB is a dominant secreted protein in EPEC and EHEC when cultured in minimal

medium. Some other translocators and effectors have also been identified in the ECPs of

EPEC and EHEC when cultured in DMEM. It is possibile that bacteria will express

different amount of secretion molecules to favorite certain environmental conditions and

there may be competition between translocators and effectors. Thus, it was speculated

that a ∆espB mutant may increase the secretion of certain effectors. However, the ECP of

a ∆espB mutant in EPEC did not show increased secretion of effectors. This result was

similar to a triple deletion mutant (∆espABD) in CR (Deng et al., 2005) which did not

increase the effectors secretion. This phenomenon indicated that the secretion of

90

translocators and effectors may under different regulation network and some other

internal or external signals may trigger the expression of the translocators and effectors.

Although EspB was found to have no effect on the secretion of effectors, EspB was

shown to be needed for the translocation of other effectors. The ∆espB mutant abolished

the translocation of Tir indicating that EspB, which secreted by the TTSS, is needed for

efficient delivery of effectors to the host cell. These results further supported the role of

EspB as a critical translocator component which is indispensable for TTSS effector

translocation.

Interestingly, besides acting as a translocator, EspB was identified to have the character

of an effector. There are reports showing identification of EspB in the cytoplasm of the

infected host cells (Taylor et al., 1998; Wollf et al., 1998). However, some researchers

argued that the limitation of fractionation method may introduce contamination in

between different cell fractions (Blocker et al., 2000). Using β-lactamase in combination

with fluorescent substrate CCF2/AM in this study, EspB was shown to be translocated

into the cytoplasm of infected HeLa cells. The identification of the secretion and

translocation signal in the N-terminal of EspB further showed that EspB can be a TTSS

secreted effector. Collectively, EspB was demonstrated to possess duel characters as a

TTSS translocator and a TTSS translocated effector.

During the analysis of ECP production, the autoaggregation phenotype of EPEC was

observed when cultured in DMEM. In the present study, the wild type EPEC showed

91

autoaggregation after 6 h of culture in DMEM, while the ∆espB did not aggregate. And

the complemented strain of ∆espB can form aggregation similar to the wild type EPEC.

The incapable formation of autoaggregation in the ∆espB mutant indicated that there may

be a significant change in the cell surface properties of the ∆espB mutant. There are

various surface components implicated in the autoaggregation of E. coli including antigen

43 (Ag43) (Hasman et al., 1999), curli (Prigent-Combaret et al., 2001) and fimbriae

(Schembri et al., 2001). To further characterize the possible surface change in the ∆espB

mutant, transmission electron microscope was used to visualize the surface structure of

the ∆espB mutant. Transmission electron microscopy pictures showed that the surface of

the ∆espB mutant was smoother than the EPEC wild type strain which showed some

filamentous appendages on the extracellular surface of bacteria cells. Based on the length,

the protrusion structure on the surface of EPEC wild type could be the filamentous TTSS

needle complex. It is reported that A/E pathogens use EspA, EspD and EspB together to

form the filamentous needle structure to contact with host closly. It is possible that the

∆espB mutant abolished the filamentous needle structure which resulted in the smooth

surface without filamentous protrusion. To further verify this hypothesis, immuno-

staining using antibody against translocators are needed to verify the component of the

protrusion structure. The results here suggest that the autoaggregation may be related to

the TTSS proteins such as EspB and the TTSS needle complex may serve as surface

signal conductor which is involved in the EPEC cell communication and aggregation.

Unlike true intracellular pathogens such as Shigella spp., EPEC strains do not appear to

be specifically adapted for intracellular survival. However, the invasion phenotype has

92

been very useful in studying the molecular genetics of EPEC because many of the genes

involved in invasion are also involved in forming the A/E lesion. Donnenberg et al. (155)

have used TnphoA and the gentamicin protection assay to isolate mutants deficient in cell

entry and found certain invasion mutant with the defect genes within TTSS cluster. In

this study, EspB was found to be important for invasion process which support the

finding that TTSS genes are not only responsible for A/E lesion but also are involved in

the invasion process. EspB may be involved in the invasion process as a component of

the TTSS needle complex, and may act as a signal molecule interacting with host cells,

which implied by the effector property of EspB.

IV. 5. Conclusion

In this study, two forms of EspB were identified from 2-D SDS PAGE of ECPs from

EHEC and EPEC, which indicated the modification and multiple functions for EspB. It

was found that the N-terminals of the two forms of EspB were not cleaved. No

detectable phosphorylation of these two forms of EspB was identified either. Further

experiments are needed to find out the possible modification of these two forms of EspB.

In this study, EspB was shown to be a multi-functional molecule which served as a

translocator and an effector. As a translocator, EspB was demonstrated to be necessary

for effector translocation. For the first time, EspB was visualized to be a TTSS

translocated effector by TEM-1 reporter system. At the same time, EspB was found to be

involved in the autoaggregation and invasion process of EPEC. These data further

indicated that EspB is a virulence factor of dual functions and involved in many

pathogenesis processes.

93

Chapter V. Identification and Characterization of NleI, a New Non-

LEE-encoded Effector of Enteropathogenic Escherichia coli (EPEC)

Part of this chapter has been submitted for publication:

Li, M., I. Rosenshine, H.B. Yu, C. Nadler, E. Mills, C.L. Hew, and K.Y. Leung.

Identification and characterization of NleI, a new non-LEE-encoded effector of

enteropathogenic Escherichia coli (EPEC). (Submitted)

94

Abstract

EPEC, a major gastro-intestinal pathogen and a cause of infantile diarrhea in many

developing countries, is a prototype for a group of pathogens causing characteristic A/E

lesions on intestinal epithelia. A/E pathogens utilize a LEE-encoded TTSS as a molecular

apparatus to deliver effector proteins into host cells. These effectors have been identified

as potential virulence factors in A/E pathogens including EPEC, EHEC, rabbit EPEC

(REPEC) and Citrobacter rodentium (CR). We used a proteomics approach to identify a

new non-LEE-encoded effector, NleI, from the EPEC sepL and sepD mutants. The nleI

gene is located in a prophage-associated island and next to the gene cluster of nleBCD.

Southern blot and bioinformatics analyses showed that nleI was present in other A/E

pathogens including EHEC and CR but not in E. coli K12. We demonstrated that NleI is

secreted and translocated into HeLa cells in a TTSS-dependent manner and that the first

20 amino acids of NleI contain the secretion and translocation signal. CesT was found to

be involved in the translocation but not the stabilization of NleI. At the transcription level,

the expression of NleI is found to be under the control of SepD but not Ler and SepL. We

showed that NleI did not affect filopodia and pedestal formation of HeLa cells during

infection. After translocation, NleI can be detected in the cytoplasmic and membrane

fractions of HeLa cells. Accumulated NleI can also be visualized throughout the HeLa

cells by using fluorescence microscopy.

95

V.1. Introduction

EPEC is an important enteric pathogen for humans, causing severe diarrhea in infants.

Infection with EPEC induces A/E lesions in enterocytes, characterized by the localized

destruction of brush border microvilli, intimate adhesion and formation of actin pedestals

beneath the attached bacteria (Frankel et al., 1998). A/E pathogens include EHEC, which

can lead to hemorrhagic colitis and hemolytic uremic syndrome in humans (Nataro and

Kapper, 1998), and several other animal pathogens including Citrobacter rodentium (CR)

and rabbit enteropathogenic E. coli (REPEC) (Agin et al., 1996; Vallance et al., 2002).

One of the emerging themes in the pathogenesis of EPEC and other A/E organisms is that

they employ a conserved protein secretion machinery, TTSS, to cause diseases in their

hosts (Cornelis and Gijsegem, 2000). The TTSS of A/E pathogens is located within a

chromosomal PAI designated the LEE which is necessary for the formation of A/E

lesions. This LEE-encoded TTSS is evolutionarily related to the flagellar apparatus and

consists of more than 20 proteins that form a molecular complex spanning both inner and

outer membranes of the bacteria. It is postulated that the TTSS apparatus acts as a

molecular syringe, secreting and injecting bacterial proteins into the culture medium and

the host cell cytoplasm (Cornelis, 2002). Some of these secreted proteins have been

shown to subvert the host cell functions, and to facilitate bacterial proliferation and

disease development.

TTSS dependent secretion proteins can be characterized into two categories, translocators

and effectors (Galan, 2001; Collmer et al., 2002). Translocators such as EspA, EspB and

EspD are TTSS secreted proteins that are required for the translocation of the effector

96

proteins into the host cytoplasm (Frankel et al., 1998). EspA, EspB and EspD are

essential for the pathogenesis of EPEC and are demonstrated as virulence factors in

human volunteer studies (Abe et al., 1998; Ide et al., 2001; Shaw et al., 2001; Tacket et

al., 2000; Wachter et al., 1999). Effector proteins are translocated from the bacterial

cytoplasm directly into the host cell cytoplasm by the TTSS, whereby causing

modulation of signal transduction pathways and cellular processes (Hueck, 1998). Genes

encoding translocated effectors have been found both within and outside of the LEE

pathogenicity island. To date, seven EPEC LEE-encoded effectors have been identified:

EspB, Tir (EspE), EspF, EspG, EspH, Map and SepZ (EspZ) (Elliott et al., 2001; Kanack

et al., 2005; Kenny et al., 1997; Kenny and Jepson 2000; McNamara et al., 2001; Tu et

al., 2003; Wolff et al., 1998). In addition, A/E pathogens secrete a number of non-LEE-

encoded effectors including Cif, NleA/EspI, TccP/EspFu, EspJ and EspG2 (Marches et

al., 2003; Gruenheid et al., 2004; Mundy et al., 2004; Garmendia et al., 2004;

Campellone et al., 2004; Dahan et al., 2005; Matsuzawa et al., 2005; Shaw et al., 2005).

Recently, seven new non-LEE-encoded effectors of NleB, NleC, NleD, NleE, NleF,

NleG, and NleH have been identified from CR and EPEC by systematic mutagenesis and

proteomics approaches (Deng et al., 2004; Thomas et. al., 2005). These Nles have been

shown to be secreted by CR in a TTSS-dependent manner, and NleC and NleD from

EPEC and EHEC are reported to be translocated into HeLa cells via the LEE-encoded

TTSS (Marches et al., 2005). However, the exact functions of these non-LEE-encoded

effectors have yet to be further characterized.

97

sepL is the first gene in the LEE4 operon of EPEC which contains espA, espD and espB.

SepL, a soluble cytoplasmic protein associating with the bacteria membrane fraction, is

required for the A/E effect (Kresse et al., 2000; O’Connell et al., 2004). sepD, also

known as rorf6, is located within the LEE2 operon of EPEC. It is reported that SepD is an

important component of the EPEC TTSS and interacts with SepL to form a membrane-

bound complex (Creasey et al., 2003a; O’Connell et al., 2004). Both SepL and SepD are

indicated to be essential for the secretion of translocators (Deng et al., 2005). An

interesting feature from the sepL and sepD mutants is that both of them exhibit enhanced

secretion of effectors without secreting any translocators (Deng et al., 2004). It is

postulated that SepL and SepD form a molecular switch that controls the secretion of

translocators and effectors as a conserved feature in all A/E pathogens, including CR,

EHEC and EPEC (Deng, et al., 2005).

Here, we used a proteomics approach to identify a new non-LEE-encoded effector, NleI,

from the EPEC sepL and sepD mutants. We demonstrated that NleI is secreted into the

culture medium and translocated into infected cells by EPEC through the LEE-encoded

TTSS. CesT was found to be involved in the translocation but not stabilization of NleI.

At the transcriptional level, the GFP reporter assay showed that NleI is regulated by

SepD but not by Ler and SepL. After infection, NleI can be identified by Western blot

analysis and by confocol fluorescence microscopy inside the HeLa cell cytoplasm and

cell membrane. Thus, our data indicates that NleI is a new non-LEE-encoded effector of

EPEC.

98

V.2. Material and methods

V.2.1. Bacteria strains and culture conditions

The bacterial strains and plasmids used for this study are listed in Table V.1. E. coli

strains were routinely cultured at 37oC in Luria-Bertani broth or in Dulbecco modified

Eagle medium (DMEM) without shaking. When required, the medium was supplemented

with ampicillin (100 μg/ml), chloramphenicol (30 μg/ml), kanamycin (50 μg/ml), and

streptomycin (50 µg/ml). Cultivation of bacteria in DMEM was carried out in 37oC, 5%

(v/v) CO2 atmosphere.

V.2.2. Tissue culture conditions

HeLa cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) at

37oC in a humidified atmosphere of 5% CO2. Before infection, HeLa cells were washed

three times with DMEM to remove FBS and antibiotics. Infections were carried out in 10

mm tissue culture dishes, except for infections carried out in 24-well plates in which

HeLa cells were grown on round coverslips.

V.2.3. Construction of deletion mutants and plasmids

The primers used for the construction of deletion mutants and recombinant plasmids are

listed in Table V.2. Nonpolar deletion mutants were constructed according to the method

for suicide plasmid pRE112 (Edwards et al., 1998) or overlap extension PCR (Ho et al.,

1989). Primer sets dnleIF1, dnleR1, dnleF2, and dnleR2 were used to generate in-frame

deletion mutant of ΔnleI, and dsepDF1, dsepDR1, dsepDF2, and dsepDR2 were used to

99

generate ΔsepD from either the EPEC wild type E2348/69 chromosome or the EPEC

sepL::Tn10 chromosome. For the construction of ΔcesT, the cesT gene was replaced by a

kanamycin cassette using the lambda Red system (Datsenko and Wanner, 2000) with

primers dcesTF and dcesTR. For the construction of pACYCnleI, the complete nleI gene

was obtained by PCR with EPEC E2348/69 genomic DNA as the template and cloned

into pACYC184. Plasmids pSAnleI, pSAsepD, pSAnleI-6His and pSAnleI-Flag were

constructed by amplifying the corresponding DNA fragments with the primers listed in

Table V.2. and cloning into pSA10. For the construction of a GFP reporter system, a

promoterless complete gfp gene derived from pVIK105 (Kalogeraki and Winans, 1997)

was cloned into plasmid pDN19lacΩ to create plasmid pDNgfp. An nleI putative

promoter region fused to gfp was cloned into pDN19lacΩ to create plasmid pDNnleI-gfp.

To construct plasmids expressing TEM fusions, nleI, map and tir were amplified from

EPEC genomic DNA using specific primers (Table 2) and cloned into the pCX341

plasmid (Charpentier and Oswald, 2004) to create effector-TEM fusions.

V.2.4. Flow cytometric analysis

The EPEC wild type E2348/69 and mutant strains carrying the appropriate plasmids were

cultured in LB overnight, subcultured at 1:100 dilution into DMEM and incubated at

37oC in 5% (v/v) CO2 incubator without shaking. In each experiment, the EPEC wild

type E2348/69 was used as a negative control for non-fluorescence sample. For each

sample, 50,000 bacterial-sized particles were analyzed in a FACS Calibur cytometer

(Becton Dickison). The GFP was detected at 525 nm in the FL1 channel. Data were

100

analyzed by using software WinMDI (Version 2.8). The geometric mean of the

fluorescence of each strain in three independent experiments was calculated.

V.2.5. 2-D SDS-PAGE and proteomics

Extracellular proteins of EPEC strains were prepared as described previously (Li et al.,

2004). Protein spots of interested were excised manually and in-gel digestion of proteins

was performed using a trypsin digestion protocol. Peptides were analyzed with Applied

Biosystems 4700 Proteomics Analyzer MALDI-TOF/TOF (Applied Biosystems) Mass

Spectrometer. Spectra were searched against the NCBI database with MASCOT (Matrix

Science) or the on-going EPEC genome from Sanger Institute

(http://www.sanger.ac.uk/projects/Escherichia_Shigella).

V.2.6. Fractionation of infected HeLa cells

Infection of HeLa cells with EPEC and fractionation of EPEC infected HeLa cells were

prepared as described previously (Tu et al., 2003; Gruenheid et al., 2004). Briefly, HeLa

cells (5 x 106 cells/100 mm dish) were infected with 100 µl of overnight bacterial culture

expressing NleI-6His tags. After 3 h infection, IPTG (1mM) was added and infection was

allowed to proceed for an additional 2 h. After 5 h of infection, HeLa cells were washed 3

times and lyzed by 1% Triton X-100. Centrifugation was applied to precipitate all

insoluble components including cell membrane, nuclei, large cytoskeleton complexes,

and attached bacteria. Cytosolic proteins in the supernatant were recovered as the soluble

fraction. For sub-cellular fractionation, after 5 h infection, HeLa cells were washed three

101

times with ice-cold PBS and resuspended in homogenization buffer (3 mM imidazole,

250 mM sucrose, 0.5 mM EDTA, pH 7.4) supplemented with COMPLETE protease

inhibitor cocktail (Roche) and mechanically disrupted by passage through a 21.5-gauge

needle. The homogenate was centrifuged gently (3000 xg) for 15 min at 4oC to pellet

unbroken cells, bacteria, nuclei and cytoskeletal components. The supernatant was

subjected to high speed ultracentrifugation at 100000 xg for 30 min at 4oC in a TL100

centrifuge (Beckman) to separate host cell membranes (pellet) from cytoplasm

(supernatant). The pellets were resuspended in 1x Laemmli buffer to make up the equal

volume as supernatant. Equal volume of both fractions was dissolved in SDS-PAGE

sample buffer. After boiling for 5 minutes, samples were separated by SDS-PAGE and

subjected to Western blot analysis.

V.2.7. Expression and Immunoblot analysis

Overnight bacterial cultures grown without shaking at 37ºC, were diluted 1:50 in DMEM,

and grown without shaking, in 5% CO2, at 37ºC, for 3.5 h. The pellet containing total

proteins were recovered and lysed as well. Samples for Western blot analysis were

resolved by SDS-PAGE (10 to12 % polyacrylamide). Proteins were transferred to PVDF

membrane, and immunoblots were blocked in 5% non-fat dried milk in TBS, pH 7.4,

containing 0.1% Tween 20 (TBST) for 1 h at room temperature or overnight at 4oC and

then incubated with primary antibody in TBST for 1 h at room temperature. Membranes

were washed 3 times in TBST and then incubated with a 1:2000 dilution of goat anti-

mouse antibody (Santa Cruz) for 1 h at room temperature. Membranes were washed as

described above. Antigen-antibody complexes were visualized with an enhanced

102

Chemiluminescence Detection Kit (Pierce), followed by exposure on to Kodak film

(Kodak). The following primary antibodies were used: anti-β-lactamase (QED

Biosciences), anti-6His (Qiagen), anti-calnexin (Stressgen) and anti-tubulin (Sigma). For

TEM assay, the different bacteria cultures was adjusted according to the cell density

(OD600 measurements), mounted on SDS-PAGE gel and then transferred to a

nitrocellulose membrane. Binding of secondary anti-mouse IgG conjugated to alkaline

phosphatase (Sigma) was detected using BCIP/NBT (Promega).

V.2.8. Translocation assay

Translocation assay was performed as described previously (Charpentier and Oswald,

2004) with following modifications. Bacterial strains were diluted by a factor of 5

immediately before infection to achieve multiplicity of infection of about 40:1 (bacteria

to HeLa cell). Infection was allowed to proceed for only 60, 90 or 120 min and no IPTG

was added (as pCX341 and its derivatives have a significant level of basal expression).

Fluorescence was quantified on a SPECTRAFluor Plus microplate reader (TECAN) with

excitation at 405 nm, and emission detected via 465-nm and 535-nm filters. Translocation

was expressed as the emission ratio at 465/535 nm to normalize the ß-lactamse activity to

cell loading and number of cells present in each well, corrected for the background

fluorescence in both channels.

V.2.9. Fluorescence microscopy for observation of translocation, transfection and

actin condensation

103

Translocation of NleI and the first 20 amino acids of NleI were assayed with the β-

lactamase reporter system as described by Charpentier and Oswald (2004). Briefly,

overnight LB cultures of the EPEC wild type and the mutants of escN::TnphoA carrying

pCX341, pCXtir, pCXNleI and pCXNleI20 were diluted 1:50 in DMEM and incubated at

37oC in a 5% CO2 atmosphere for 2 h. The preactivated bacteria at an MOI of 100:1 were

added to HeLa cells grown on cover slips in 24-well culture plates. Infections were

allowed to proceed for 1h and then induced with 1 mM IPTG for an additional 1h.

Monolayers were then washed three times with Hanks’ balanced salt solution (HBSS)

(Invitrogen), loaded for 1 h with 1 μM CCF2/AM (Invitrogen) and washed twice with

HBSS. The cover slips were mounted to slides and were observed on a fluorescence

microscope (Olympus, BX60) with a 4’,6’-diamidino-2-phenylindole (DAPI) filter set

(340- to 380-nm excitation and 425-nm long-pass emission). Pictures were taken under a

true color camera. To analyze the NleI location, HeLa cells were transfected for 48 h, and

fixed for 30 min in 4% formaldehyde. Actin stress fibers and nuclei were labeled with

phalloidin (Alexa 633, Sigma) and Hoechst, respectively and observe on a fluorescence

microscope (Olympus, BX60) with a FITC filter set or a RFP filter set.

104

Table V.1. Bacteria strains and plasmids used in this study Strain or plasmid Description Reference or source

Strains

DBS100 Wild type C. Rodentium ATCC 51459 Schauer and Falkow, 1993

EDL933 Wild type EHEC O157:H7, Slt1, Slt2-negative derivative J. Leong

E2348/69 Prototypic EPEC strain, O127:H6, Smr Donnenberg et al. (1990)

MG1655 Wild type E. coli K12

∆cesT::kan (EM2018) E2348/69 cesT::kan This study

∆nleI E2348/69 in-frame deletion of nleI This study

∆sepD E2348/69 in-frame deletion of sepD This study

ler::kan (DF2) E2348/69 ler::kan Friedberg et al. (1999)

escN::TnphoA (27-3-2(1)) E2348/69 escN::TnphoA Donnenberg et al. (1990)

sepL::Tn10 (SN23) E2348/69 sepL::Tn10 This study

sepL::Tn10 ∆ nleI E2348/69 sepL::Tn10; in-frame deletion of NleI This study

SM10 (λpir ) thi thr leu tonA lacY supE recA-RP4-2-Tc-Mu Kmr pir Rubirés et al. (1997)

Plasmids

pACYC184 Tetr, Cmr Amersham

pACYCnleI pACYC with nleI fragment This study

pCX341 pBR322 derivative, cloning vector used to fuse EPEC effectors to the mature form of TEM-1 β-lactamase Charpentier et al.(2004)

pCXmap (pCX394) Residues 1-204 of Map plus Map regulatory region fused to TEM-1 Charpentier, unpublished data

pCXtir (pCX392) Residues 1-551 of Tir plus Tir regulatory region fused to TEM-1 This study

pCXnleI Residues 1-193 of NleI fused to TEM-1 This study

pCXnleI20 Residues 1-21 of NleI fused to TEM-1 This study

pDN19lacΩ Promoterless lacZ oriV oriT Tetr Strr Ω fragment Totten et al. (1990)

pDN-gfp pDN19 fused to GFP This study

pDNnleI-gfp pDN19 with nleI putative promoter region fused to GFP This study

pEGFP-N1 Kanr BD Biosciences Clontech

pEGFPnleI pEGFP-N1 with nleI fragment This study

pGEMT-Easy Ampr Promega

pRE112 pGP704 suicide plasmid; pir dependent; Cmr; oriT oriV sacB Edwards et al. (1998)

pRE∆nleI pRE112 with nleI fragment deleted 477 base pair This study

pSA10 pKK177-3 derivative, lacI, Ampr Schlosser-Silverman et al. 2000

pSAnleI pSA10 with nleI fragment This study

pSAnleI-6His pSA10 with nleI fragment and 6his tag at C terminal This study

pSAsepD pSA10 with sepD fragment This study

105

Table V.2. Oligonucleotides used in this study

Name Sequence (5’ to 3’) dnleI-F1 GGGAGCTCAAGGGAGATAAAGGAGAG dnleI-R1 GGGAGCTCGTGCACCTGAATATCTCT dnleI-F2 ATGGATCCTGATTGTAAGTCCAGAAC dnleI-R2 ATGGATCCGAGGATGATTGAATACCT dsepD-F1 GCTATTTGTTTGACAGTG dsepD-R1 CCTCTTTATCAAGACTTT dsepD-F2 GAACAATAATAATGGCATAGCATAGGACGAATTGTGTAA dsepD-R2 GCTATGCCATTATTATTGTTC dcesTF ATGTCATCAAGATCTGAACTTTTATTAGATAGGTTTGCGGAAAAAATTGGGTGTA

GGCTGGAGCTGCTTC dcesTR TTATCTTCCGGCGTAATAATGTTTATTATCGCTTGAGCTAATTTCCTCTATCATAT

GAATATCCTCCTTAG pACYC-nleIF GGGAATTCGGGTTCACAAAAAAACCG pACYC-nleIR GGAGTACTGTTAACATATAGCTTGGG pCX-mapF GGTTGGGTACCGTATGTGCAAGATCTTTGCAAAATTG pCX-mapR GCGAATTCCCCAGCCGAGTATCCTGCACATTG pCX-nleIF CGGCATATGCCATCATTAGTTTCAGG pCX-nleIR CGGGAATTCTTATCCTTTATGACAAAGTT pCX-nleI20R CGGGAATTCCGAAGAACCTGCATTCCGGT pCX-tirF GGTTGGGTACCCAAAAAGGTCTCTATAGACGTTTAAA pCX-tirR GCGAATTCCCAACGAAACGTACTGGTCCCGG pEGFP-nleIF GGGAATTCATGCCATCATTAGTTTCAGG pEGFP-nleIR GGGGATCCTTATCCTTTATGACAAAG pSA-nleI-F GGGAATTCATGCCATCATTAGTTTCAGG pSA-nleI-R GGGTCGACTCACTTATCCTTTATGACAAAGT pSA-nleI-hisR GGGTCGACTCAGTGGTGGTGGTGGTGGTGCTTATCCTTTATGACAAAGT pSA-nleI-flagR CGGGTCGACTCACTTGTCGTCATCGTCTTTGTAGTCCTTATCCTTTATGACAAAGTpSA-sepDF CGGAATGAATTCATGAACAATAATAATGGC pSA-sepDR CGGAATGTCGACTTACACAATTCGTCCTAT pDNFuz-gfp-F GCGAGGAATTCTCGAAATTCGGAGGAAACAAAGATGAGTA pDNFuz-gfp-R GCAGTGGATCCCTATTTGTATAGTTCATCCATGCCA pDNPro-nleI-F CGGGAATTCCCATGGCAGGATGTTAAG pDNPro-nleI-R CGGGGATCCGCTCTGCGTATTAACCGA

106

V.3. Results

V.3.1. Identification of NleI from EPEC sepL and sepD mutants

SepL was reported to be an important component of TTSS and to control the secretion of

TTSS proteins (O’Connell et al., 2004). To have an integrated view of the secretion

profile of the EPEC sepL mutant, we used a proteomics approach to compare the

extracellular proteomes of the EPEC wild type E2348/69 and the EPEC sepL::Tn10

mutant (Figs. V.1.A and B). The two-dimensional (2-D) SDS PAGE profile of the ECP

of the sepL::Tn10 mutant showed that majority of the secreted proteins are those of TTSS

effectors, namely Tir, EspF, EspG, EspH, Map and NleA (Fig. V.1.B). No translocators,

such as EspA, EspB, and EspD, were identified in the ECP of the EPEC sepL::Tn10

mutants but they were present in the ECP of the wild type E2348/69 (Fig. V.1.A; Li et al.,

2004). There is a report showing that SepL and SepD control the TTSS hierarchy of

translocators and effectors in EPEC, EHEC and CR (Deng et al., 2005). A double mutant

of sepL and sepD was found to exhibit the same secretion phenotype as their single

mutants (Deng et al., 2004). To further characterize whether the sepD mutant will also

have similar proteomics profile in EPEC, a sepD non-polar deletion mutant was created

and the ECP of ∆sepD was generated. Similar extracellular proteomic profile from the

∆sepD mutant and sepL::Tn10 mutant could be observed (Fig. V.1.C). These results

confirmed the earlier observation that SepL and SepD positively regulated the expression

and secretion of translocators and that their respective mutants altered the secretion

profile of CR (Deng et al., 2005). Among these secreted proteins, we identified one new

protein with molecular weight of approximately 20 kDa. This protein is homologous to

Z2075 from the EHEC EDL933 which is located in a prophage island CP933O. Since the

107

EPEC sepL::Tn10 and the ∆sepD mutants preferentially secrete effectors, this newly

identified protein may be an effector protein from EPEC. We named this protein NleI

since it is located outside the LEE locus in EPEC E2348/69.

V.3.2. NleI is located within a prophage-associated island in EPEC

NleI is located in a region where nleBCD and many other phage-related genes are present

(Fig. V.2.). Comparing the genome of EPEC E2348/69 with that of E. coli K12 MG1655

showed that this region is absent from the genome of the non-pathogenic E. coli K-12

MG1655 strain (Fig. V.2.) (coli-BASE website, http://colibase.bham.ac.uk). The region is

inserted between the conserved backbone genes (torT and torS) of E. coli K12 MG1655.

It has many characteristics of a prophage-associated island, such as the presence of phage

structural proteins, putative transposase fragments, phage tail proteins and other

prophage-associated open reading frames (ORFs). Thus, NleI may be encoded within a

pathogenicity island (PAI) containing horizontally transferred genes. However, the

overall G + C content (50%) of this region did not differ significantly to that of the EPEC

E2348/69, indicating that it might have been acquired from species with G + C content

similar to that of EPEC, or that the base composition of this region has gradually adapted

to the genome of EPEC.

Many virulence factors are phage encoded, including cholera toxin and Shiga toxin

(Waldor and Mekalanos, 1996; Huang et al., 1987). Newly identified non-LEE-encoded

effectors, NleB, NleC and NleD, are encoded in the same prophage-associated regions as

NleI in EPEC. Secretion and tranlocation of NleC and NleD have been demonstrated in

108

EHEC, EPEC and CR although their exact roles in pathogenesis remain to be elucidated

(Deng et al., 2004; Marches et al., 2005). Considering the presence of nleI in a prophage-

associated island and its location close to nleBCD, we speculate that nleI may be

horizontally transferred with nleBCD and play a yet undefined role in the pathogenicity

of EPEC.

To further investigate the number of copies and distribution of nleI gene in EPEC, EHEC

and CR, an nleI probe was prepared and a Southern blot was carried out against the

EcoRV and HindIII digested genomic DNA from EPEC E2348/69, EHEC EDL933, CR

DBS100, and E. coli K12 MG1655. The Southern blot showed that there was only one

full copy of nleI in EPEC E2348/69 while there were several copies in EHEC EDL933

and CR DBS100 (Fig. V.3.) No signal was detected from the E. coli K12 MG1655

genomic DNA (Fig. V.3.), indicating that nleI may be absent from the E. coli K12

MG1655 strain. These results are consistent with our bioinformatics analysis. Although

NleI has only one full copy encoded in the EPEC E2348/69 genome, it has many

homologues in the EHEC EDL933, such as Z2075 encoded by a prophage CP-933O,

Z6025 encoded by a cryptic prophage CP-933P, Z2339 encoded by a prophage CP-933R

and Z2149, a phage or prophage encoded protein. This information suggests that the

region where nleI resides in EPEC is possibly acquired through horizontal gene transfer,

and EHEC and CR may contain more than one insertion from the same phage.

109

Fig. V.1. Comparative analysis of the extracellular proteomes (ECPs) from the EPEC wild type E2348/69 (A), the sepL::Tn10 mutant (B), and the ∆sepD mutant (C). The proteins were separated by 2-D SDS PAGE using IPG at pH 3 to 10. The circled proteins were identified by MALDI-TOF/TOF MS. The new non-LEE-encoded effector is labeled as NleI.

110

Fig. V.2. Graphic representation of the putative prophage-associated island that contains NleI by comparing the EPEC E2348/69 and the E. coli K12 MG1655 genomes. The transcriptional direction of each orf is indicated by an arrowhead (coli-BASE website, http://colibase.bham.ac.uk, 6). Annotations of orfs are based on the homologs from the published EHEC EDL933 genome.

111

Fig. V.3. Southern blot analysis of genomic DNA from EPEC E2348/69 (lanes 1 and 5), Citrobacter rodentium DBS100 (CR) (lanes 2 and 6), EHEC EDL933 (lanes 3 and 7), and E. coli K12 MG1655 (lanes 4 and 8). The genomic DNA samples were digested with EcoRV (lanes 1 to 4) or HindIII (lanes 5 to 8), and labeled with nleI DNA as a probe.

112

Fig. V.4. Comparative proteome analysis of the ECPs from EPEC sepL::Tn10 mutant (A), sepL::miniTn10Kan ∆nleI mutant (B) and sepL::miniTn10Kan ∆nleI / pACAYCnleI mutant (C). The proteins were separated by 2-D SDS PAGE using IPG at pH 3 to 10. The circled proteins indicated the new non-LEE-encoded effector, NleI and were identified by MALDI-TOF-MS-MS.

113

V.3.3. NleI is a secreted protein and the secretion of NleI is TTSS-dependent

The non-LEE-encoded effectors of EPEC, EHEC and CR were reported to be secreted by

LEE-encoded TTSSs (Marches et al., 2003; Gruenheid et al., 2004). To confirm the

expression and secretion of NleI, we created a nleI deletion mutant in the EPEC

sepL::Tn10 mutant background. The analysis of ECPs of EPEC sepL::Tn10, sepL::Tn10

∆nleI, and the complementary mutant sepL::Tn10 ∆nleI /pACYCnleI verified the

expression and secretion of NleI (Fig. V.4. A, B and C). To confirm the secretion of

NleX was TTSS dependent, a plasmid expressing NleI with 6xHis-tag at its C-terminal

was constructed (pSAnleI-6His) and transformed into the EPEC wild-type E2348/69 and

a TTSS defective mutant escN::TnphoA. Total bacteria-associated proteins and secreted

proteins were obtained from these strains and detected by anti-6His antibody. Western

blot analysis of the bacterial pellets and culture supernatant revealed that the NleI-6His

fusion protein was produced at a similar level in both bacterial pellets (Fig. V.5).

However, NleI-6His could be detected only in the extracellular proteins of EPEC wild-

type E2348/69 but not in the TTSS defective mutant escN::TnphoA (Fig. V.5). These

results indicate that NleI is a secreted protein and it is secreted via the LEE-encoded

functional TTSS.

To further verify the secretion property of NleI, we constructed a NleI-TEM fusion

protein using plasmid pCX341 (Charpentier and Oswald. 2004). The plasmid expressing

NleI-TEM fusion protein (pCXnleI) was transformed into the EPEC wild type E2348/69

and the escN::TnphoA mutant. Western blot analysis of the bacterial pellets and culture

supernatant revealed that the NleI-TEM fusion protein was produced at similar levels in

114

the wild type E2348/69 and the escN::TnphoA mutant bacterial pellets (Fig. V.6.A).

However, NleI-TEM could be detected only in the culture supernatant from the EPEC

wild type E2348/69 but not from the TTSS defective mutant escN::TnphoA (Fig. V.6.B).

These results indicate that NleI is secreted via the LEE-encoded functional TTSS.

Fig. V.5. Western blot analysis of secreted proteins and total proteins of EPEC E2348/69 wild type and the TTSS secretion mutant escN::TnPhoA expressing pSAnleI-6His with anti-6His antibody.

115

Fig. V.6. NleI is secreted into the culture supernatant and translocated into live HeLa cells in a TTSS-dependent manner and the secretion and translocation signal is at the first 20 amino acids. Western blot analyses of TEM-1 fusion proteins of bacterial pellets (A) and culture supernatants (B) from different EPEC strains and probed with anti-β-lactamase antibody . Demonstration of the translocated NleI into live HeLa cells by using TEM-1 fusion proteins from different EPEC strains. The presence of TEM fusions in HeLa cells is revealed by a blue fluorescence due to cleaving of CCF2/AM by the β-lactamase activity of TEM, whereas uncleaved CCF2/AM emits a green fluorescence (B).

116

V.3.4. NleI is translocated into the host cells

To verify the translocation property of NleI, we used the EPEC wild type and various

mutants expressing NleI-TEM fusion protein to infect HeLa cells and assayed its

translocation probability by loading infected HeLa cells with fluorescent β-lactamase

substrate CCF2/AM. Under the fluorescence microscope, HeLa cells infected with

EPEC/pCX341 (negative control, vector encoding unfused TEM) remained green,

indicating the absence of TEM-1 activity in HeLa cell cytosol (Fig. V.7.A). In contrast,

cells infected with EPEC strains expressing NleI-TEM and Tir-TEM (positive control)

appeared blue, indicating that TEM-1 was translocated into the host cells (Fig. V.7.B and

D). However, only green fluorescent signal was detected within living HeLa cells when

infected with the EPEC escN::TnphoA mutant expressing NleI-TEM and Tir-TEM,

indicating that TEM fusion proteins were not translocated into infected cells in the TTSS

defective mutant background (Fig. V.7.E and G).

We also compared the translocation efficiency of NleI-TEM into HeLa cells with Map-

TEM and unfused TEM in EPEC. After infecting HeLa cells for 60, 90 or 120 min,

EPEC strains were then washed off and the HeLa cells were incubated with the ß-

lactamase substrate, CCF2/AM. The blue to green fluorescence ratio, indicative of the

amount of TEM-fused protein within the HeLa cells, was determined (Fig. V.8.). HeLa

cells infected with EPEC expressing NleI-TEM had a significantly higher blue to green

fluorescence ratio than HeLa cells infected with EPEC expressing unfused TEM

(background), showing that the NleI-TEM fusion was translocated into HeLa cells.

However, the NleI-TEM fusion was translocated less efficiently than Map-TEM as the

117

latter induced a higher blue to green fluorescence ratio in HeLa cells compared with the

former, albeit similar protein expression levels (Fig. V.8. lanes 1 and 2).

It was reported that the first 20 codons of Tir, EspF, Map and Cif mediated secretion and

translocation of these LEE and Non-LEE encoded effectors (Charpentier and Oswald

2004). To assess if NleI similarly possesses secretion and translocation signals at its N-

terminus, we constructed fusions of the first 20 residues of NleI to TEM (pCXnleI-20).

This plasmid was expressed in the EPEC wild type E2348/69 and the escN::TnphoA

mutant to observe the translocation efficiency using anti-β-lactamase antibody and

fluorescence microscopy. As expected, blue fluorescent signal was detected only in the

wild type but not in the escN::TnphoA background, indicating the first 20 amino acids

was sufficient for the secretion and translocation of NleI (Fig. V.7.C and F). These results

show that NleI is an effector protein which can be translocated into host cells. The

translocation signal is in the first 20 amino acids of NleI and the translocation is TTSS

dependent.

118

Fig. V.7. Demonstration of the translocation of EPEC effector proteins into live HeLa cells by using TEM-1 fusion proteins. β-lactamase activity in HeLa cells is revealed by the blue fluorescence emitted by the cleaved CCF2/AM product, whereas uncleaved CCF2/AM emits a green fluorescence.

119

V.3.5. CesT is involved in the translocation but not the stabilization of NleI

CesT is a LEE-encoded chaperone shown to affect the translocation efficiency of a large

number of EPEC effectors (Abe et. al., 1999; Creasey et. al., 2003b; Thomas et. al.,

2005). In order to determine whether NleI translocation was CesT dependent, the NleI-

TEM fusion was introduced into a ∆cesT background. While the NleI-TEM expression

was not affected (Fig. V.8. lanes 2 and 3), its translocation was reduced to background

level in the ∆cesT background (Fig. V.8.). The NleI translocation efficiency is therefore

dependent on CesT. CesT was shown to stabilize several effectors such as Tir and NleA

(Thomas et al., 2005). However, similar amount of NleI-TEM and two fusion protein

bands were observed in both the EPEC wild type (Fig. V.8. lane 2) and in the ∆cesT

mutant (Fig. V.8. lane 3), indicating that CesT is not required for NleI stabilization. In

contrast, less Tir and Map were observed in the ∆cesT mutant, which indicated that CesT

is required for the stabilization of Tir and Map (data not shown; Elliott et. al., 1999;

Creasey et al., 2003b).

V.3.6. NleI is localized in the host cytoplasm and membrane

HeLa cells were infected with the EPEC wild type E2348/69 or with the EPEC

escN::TnphoA mutant, both harboring pSANleIpSAnleI-6His. After 5 h of infection,

Triton X-100 soluble and insoluble factions were analyzed by 1-DE and Western blotting

using the anti-6His antibody. NleI was found in the Triton X-100 soluble fraction

prepared from the wild type EPEC infected cells but not from the escN::TnphoA mutant

infected cells (Fig. V.9.A). The presence of NleI in the Triton X-100 soluble fraction

suggests that NleI may interact with some cytosolic molecules. The NleI from the

120

insoluble fraction was mainly from the attached bacteria, but might also be from NleI

associated with host cell components insoluble in Triton X-100. To further localize NleI,

sub-fractionation of the infected HeLa cells was conducted. Proteins from different sub-

cellular fractions were subjected to Western blotting using anti-6His, anti-α-tubulin and

anti-calnexin antibodies. α-tubulin and calnexin are sub-cellular markers for cytosolic and

membrane proteins in HeLa cells, respectively. Data showed that NleI-6His is localized

in both host cell cytoplasmic and membrane fractions (Fig. V.9.B). To visualize the

location of NleI, a plasmid pEGFP-nleI was constructed and transfected into HeLa cells.

After 24 h of transfection, HeLa cells were fixed and stained with Hoechst and Pholloidin

and analyzed by confocal microscopy. The GFP signal could be observed throughout the

HeLa cells including the nuclei, similar to HeLa cells transfected with the empty vector

pEGFP-N1 (Fig. V.10).

.

121

Fig. V.8. NleI is translocated by the EPEC wild type E2348/69 into HeLa cells in a CesT-dependent manner. Translocation into HeLa cells by EPEC/pCXmap (filled circles), EPEC/pCXnleI (filled squares), EPEC/pCX341 (filled triangles) or ΔcesT/pCXNleI (open squares). The results shown are the average of duplicate wells in three independent experiments. The insets shows the whole cell lysates of the EPEC wild type E2348/69 carrying pCXmap (lane 1, Map-TEM), pCX341 (lane 4, TEM) or pCXnleI (lanes 2, NleI-TEM) as well as a lysate of a ΔcesT mutant carrying pCXnleI (lane 3, NleI-TEM) were subjected to Western blot analysis and probed with anti-β-lactamase antibody. TEM-1 fused or unfused proteins are marked on the right. NleI-TEM fusion proteins were expressed as two protein bands. Molecular mass markers, in kilo Daltons, are indicated on the left.

122

Fig. V.9. Western blot analysis of Triton X-100 soluble and insoluble fractions of HeLa cells after infection of the EPEC E2348/69 wild type and the TTSS secretion mutant escN::TnphoA expressing pSAnleI-6His probed with anti-6His antibody (A). Western blot analysis of infected HeLa cell fractions (B). HeLa cells were infected with the EPEC wild type E2348/69 or with the escN::TnPhoA mutant expressing 6His-tagged NleI and subjected to subcellular fractionation by differential centrifugation. Fractions were analyzed by Western blot using anti-6His, anti-tubulin and anti-calnexin antibodies.

123

Fig. V.10. Confocal microscopy demonstrates that NleI is localized in the cytoplasm and the nuclei of HeLa cells. HeLa cells were transfected with pEGFPnleI for 24 h and fixed with 4% para-formaldehyde.

124

V.3.7. NleI is regulated by SepD but not regulated by Ler and SepL at the

transcriptional level

It is reported that the LEE-encoded auto-regulator, Ler, can positively regulate effectors

such as Tir and non-LEE-encoded protein TagA (Elliott et al., 2000; Haack et al., 2003).

Our proteomics results (Fig. V.1.A, B and C) also showed that the secretion levels of

NleI and other effectors is much higher in the EPEC sepL::Tn10 and ∆sepD mutants than

the EPEC wild type E2348/69. To determine if the expression of NleI is regulated by Ler,

SepL and SepD at the transcriptional level, a plasmid which contained the nleI promoter

region fused with a promoterless gfp gene (pDNnleI-gfp) was introduced into the EPEC

wild type E2348/69, ler::kan, sepL::Tn10 and ∆sepD mutants. The green fluorescence

signals were determined by flow cytometry and were compared among all these EPEC

strains (Fig. V.11). The wild type EPEC containing pDNnleI-gfp had a significant higher

gfp expression than the wild type containing pDNgfp (vector without putative promoter

region), indicating that a promoter is present in front of the nleI gene. The GFP intensity

of the EPEC wild type, ler::kan and sepL::Tn10 mutants containing pDNnleI-gfp were

found to be comparable, which suggested that NleI is not under the control of Ler and

SepL at the transcriptional level. However, the GFP intensity of the ∆sepD/pDNnleI-gfp

strain had a significant higher level compared to the other strains (Fig. V.11). And the

complementary strain ∆sepD/pDNnleI-gfp /pSAsepD displayed weaker GFP intensity

compared to ∆sepD/pDNnleI-gfp strain, which was similar to the GFP intensity of wild

type harboring pDNnleI-gfp. These results suggest that SepD negatively regulates NleI

while Ler and SepL may not regulate NleI at the transcriptional level.

125

V.3.8. NleI is not involved in the filopodia and pedestal formation

EPEC uses the TTSS to translocate effector proteins to interact with the eukaryotic

cytoskeleton and cause actin condensation and cytoskeleton rearrangement (Frankel et al.,

1998). Tir is one of the effector proteins delivered by EPEC into host cells, becoming an

integral plasma membrane protein and a receptor for the EPEC outer membrane adhesin,

intimin (Jerse et al., 1990; Kelly et al., 1990). The interaction between Tir and intimin

leads to intimate attachment of EPEC to the host cell membrane and formation of an

actin-rich pedestal beneath the adherent bacterium (Moon et al., 1983; Knutton et al.,

1989). EspH is also shown to be a modulator of the host actin cytoskeleton, down-

regulating filopodia formation and enhancing pedestal formation (Tu et al., 2003). To

investigate if NleI is also involved in the process of the cell cytoskeleton re-arrangement,

actin staining was carried out to examine the actin condensation underneath the EPEC

attaching sites. HeLa cells were infected with the EPEC wild type, the ∆nleI mutant, and

the overexpressor of NleI (E2348/69/pSAnleI) for 15, 45 and 90 min and then fixed and

stained with phalloidin-rhodamine. Fluorescence microscopy was used to observe the

formation of filopodia and pedestals. Actin staining results suggested that the intensity of

actin condensation beneath the EPEC wild type, ∆nleI mutant and E2348/69/pSAnleI was

at comparable levels (Fig. V.12). These results indicated that NleI was not involved in the

filopodia and pedestal formation in infected HeLa cells.

126

Fig. V.11. Flow cytometric analysis of the GFP intensity of the EPEC wild type E2348/69, ler::Kan (DF2), sepL::Tn10, and ∆sepD mutants, and a complementary strain ∆sepD/pSAsepD carrying pDN-gfp or pDNnleI-gfp. In each individual experiment 50,000 bacterial-sized particles were analyzed. The fluorescence intensity of each particle is reported on the x axis and the number of bacterial-sized particles is shown on the y axis (A). The geometric mean of the fluorescence detected by the flow cytometry for EPEC strains are analyzed (B). The values represent the means ± the standard deviations (SD) from three independent experiments.

B

127

Fig.V.12. NleI is not affecting actin condensation underneath the EPEC infection sites. Transfected cells were infected with EPEC wild type, ∆nleI and ∆nleI/pSAnleI for 15min, fixed and stained with phalloidin-rhodamine. The arrows highlighted the actin condensation underneath the attached EPEC strains.

E2348/69

E2348/69 ∆nleI

E2348/69 ∆nleI / pSAnleI

RFP Phase-contrast

128

V.4. Discussion

To date, six LEE-encoded effectors and 12 non-LEE-encoded effectors have been

identified by various research groups. After comparing the ECPs of the EPEC wild type,

the sepL::Tn10 and the ΔsepD mutants, we have identified a new non-LEE-encoded

effector, NleI. By using TEM-1 reporter system, NleI was shown to contain secretion and

translocation signals at its N-terminal. Two protein bands were found from the NleI-TEM

fusion proteins in both the EPEC wild type and the escN::TnphoA mutant background

(Fig. V.6.A1). This might be due to the cleavage of NleI inside the bacterial cytoplasm. It

is speculated that effector proteins will quickly undergo degradation if they are not

translocated. This may explain why NleI is not identified in the ECP of the EPEC wild

type when grown in DMEM medium (Fig. V.1.). Interestingly, the first 20 residues of

NleI-TEM fusion showed only one band (Fig. V.6.A1), which indicate that the cleavage

site is located at the N-terminal probably after the first 20 amino acids. The TTSS

chaperone CesT was shown to maintain the steady-state of Tir and Map in bacterial

cytosol (Abe et al., 1999; Elliott et al., 1999; Creasey et al., 2003b) and also to facilitate

the secretion of at least 7 effectors, including 3 non-LEE encoded effectors NleA, NleF

and NleH (Thomas et al., 2005). We found that CesT is also actively involved in the

secretion and translocation of NleI while it does not seem to be required for the stability

of NleI in the EPEC cytoplasm. This result extends the roles of CesT in facilitating

efficient secretion and translocation of non-LEE-encoded effectors.

Using sub-cellular fractionation and GFP tagged transfection, we showed that NleI is

localized throughout the HeLa cells (Fig. V.9 and 10). Although the GFP signal was

129

detected in the HeLa cell nuclei, it is possible that the GFP could have diffused into the

nuclei since the GPF signal from the vector was also observed in the nuclei (Fig. V.10).

Further experiments are needed to verify that whether the GFP signal in nuclei is due to

NleI or just due to diffusion. We have also used immuno-staining to localize NleI-Flag in

EPEC infected HeLa cells. The signal was localized throughout the cells and no specific

localization was identified (data not shown). Some EPEC effectors, such as EspH, were

shown to be toxic to host cells (Tu et al. 2003). However, no significant cytotoxic effect

on HeLa cells was observed when comparing HeLa cells transfected with the pEGFP-nleI

and the pEGFP empty vector. We also overexpressed NleI in yeast cells using the pYES2

plasmid to test for its cytotoxicity. Yeast cells harboring the NleI overexpression vector

grew similarly to yeast cells harboring the empty pYES2 vector under β-galactose

induction (data not shown). Our data indicate that NleI is localized in eukaryotic cells in a

diffused pattern and there is no obvious cytotoxic effect to eukaryotic cells.

In this study, a proteomics approach was used to show that sepL::Tn10 and ΔsepD

mutants display a higher secretion level of effectors than the wild type EPEC.

Our data confirm previous studies (Deng et al., 2005) that the sepL and sepD mutants

exhibited an increased secretion of effectors but a reduced secretion of translocators.

Deng et al. (2005) also reported that SepL and SepD did not regulate the translocators

and effectors that are encoded within the LEE regions at the transcriptional level.

However, by measuring the expression of GFP in EPEC strains containing pDNnleI-gfp,

we found that SepD but not SepL negatively regulated the expression of NleI at the

transcriptional level (Fig. V.11.). The expression of EPEC LEE-encoded effectors and

130

LEE-encoded TTSS components including SepD are regulated by Ler (Elliott et al., 2000;

Deng et al., 2004). It is therefore intriguing that nleI expression was increased in the

sepD mutant but not in the ler mutant. In addition, we have found that the basal level of

SepD from in tran plasmid pSAsepD in the ΔsepD background can restore the secretion

of translocators and depress the secretion of some effectors to the similar level of the

EPEC wild type (data not shown). It is possible that very low levels of SepD are

sufficient for nleI repression. Whether this regulatory cascade is unique to NleI or

common to other Nles requires further investigation.

Garmendia and Frankel (2005) reported that the expression of effectors EspJ and

TccP/EspFu is not regulated by Ler. Our data here add one more non-LEE-encoded

effector, NleI, which, while not regulated by Ler, is dependent on TTSS for secretion and

translocation. It is possible that some other regulatory molecules control the expression of

the non-LEE encoded effectors. Besides genetic regulations on effectors, environmental

factors including host contact may also influence the secretion and translocation of

effector molecules (Galan and Collmer, 1999).

V.5. Conclusion

One new non-LEE encoded effector, NleI, was identified by comparative proteomics.

NleI was shown to be secreted and translocated into HeLa cells. The expression of NleI

was shown to be regulated by SepD at transcriptional level. It was demonstrated that NleI

possesses secretion and translocation signal at its N-terminal and the translocation of NleI

is facilitated by CesT. NleI was found to localize in host cells while the exact function

131

remains elusive. These results add a new member to the growing pool of effectors from

the A/E pathogens. Further analysis of the interactions of NleI and host may illuminate

how NleI is involved in the cellular signal transduction and provide more insights into the

EPEC pathogenesis.

132

Chapter VI. General conclusions and future directions

VI.1. General conclusions

EPEC and EHEC strains are well recognized enteric pathogenic E. coli and still remain as

public threat worldwide. Though many research groups have devoted much effort to

studying the virulence of EPEC and EHEC, there are still many other virulence factors

from EPEC and EHEC to be discovered and understood. Efforts aimed at identification

and characterization of virulence factors and elucidation of the functions of the identified

virulence factors are the major focus of this study.

Since most virulence factors are secreted or are located on the bacterial cell surface

(Finlay, 1996), an attempt was made to compare the ECP profiles of EPEC and EHEC

and their various mutants to identify virulence factors from EPEC and EHEC. Proteomics

approach using 2-D SDS PAGE in combination with MALDI-TOF MS followed by a

protein database search were used in the first step to analyze the extracellular protein

profiles of EHEC EDL933 and EPEC E2348/69, and their various mutants (Li et al.,

2004). This study resulted in the identification of many virulence determinants such as

EspA, EspB, EspD, Tir, EspC, EspP and StcE (TagA). Several potential virulence factors

were also identified in this study, including some phage related proteins and hypothetical

proteins. The proteomics profiles of EHEC and EPEC have demonstrated both the

similarity and divergence of these two pathogens in an integrative view. The results

obtained will help in understanding the pathogenesis of EPEC and EHEC and highlight

some candidate proteins for further study of EPEC and EHEC pathogenesis.

133

Since EspB is one of the prominent secreted protein identified from EPEC and EHEC by

proteomic approach, it was further characterized. Results showed that the two dominant

forms of EspB from EPEC and EHEC were not due to the N-terminal cleavage or

phosphorylation. EspB was identified as an effector which possesses the secretion and

translocation signal at its N-terminus. The dependence of the secretion and translocation

of EspB on TTSS substantially supported the notion that EspB was a TTSS dependent

effector protein. Interestingly, EspB was found to be involved in the autoaggregation of

EPEC and the property of EspB involved in this process was further characterized. It was

indicated that EspB may affect the TTSS assembly which resulted in the defect of TTSS

filamentous structure and further affected the autoaggregation and invasion of EPEC.

This study suggests that one of the TTSS translocator component, EspB, may be involved

in the EPEC self interaction as well as interaction with host cells.

Since SepL and SepD can control the secretion of translocators and effectors,

comparative proteomics was applied to identify effector proteins from EPEC sepL and

sepD mutants. This led to the identification of a new effector protein, NleI, which was

present in the ECP profiles of both EPEC sepL and sepD mutants but absent from that of

the wild type. Construction of deletion mutants and reporter fusions confirmed the

expression and translocation property of NleI. CesT was demonstrated to be involved in

translocation but not stabilization of NleI. Cellular experiments showed that NleI was not

involved in the actin condensation and pedestal formation. No specific location of NleI

can be observed in host cells and no cytotoxicity effect of NleI to the host cell was

134

detected. More intriguingly, SepD was first shown to regulate the expression of NleI at

the transcriptional level, which is a new regulation network for Nles. Collectively, these

results added in a new effector into the effector pools of A/E pathogens and provided

clues for the roles of non-LEE encoded effectors in the pathogenesis of EHEC and EPEC.

The experimental data in these studies may reveal features common to other enteric

pathogens as well as strategies unique to A/E lesion-causing bacteria. New discovery

here may accelerate the processes of diagnostics and curative approaches to diseases

caused by EPEC and EHEC and may pave the way towards the development of new

therapies for diarrheas.

VI.2. Future directions

Using proteomics approach, many new proteins were identified from the ECPs of EPEC

and EHEC (Table III 1 and 2). Some of them displayed certain virulence properties

similar to known proteins from E. coli or other species, such as putative adhesin, putative

receptor. Two phage related proteins were also identified from the ECPs of EPEC and

EHEC. To characterize the secretion property of these secreted proteins and the

localization of the adhesins would be the pursuit in the next step. The involvements of

these novel proteins in the cellular process need to be further verified by in vitro

experiments, such as adhesion and invasion assay, FAS assay, cell cytotoxicity assay.

And functional studies of these novel proteins revealed by this proteomic data may lead

to the discovery of novel virulence determinants from EPEC and EHEC.

135

The mechanism of EspB as a TTSS translocator is well characterized. However, it may

still be a new concept for EspB to act as a TTSS effector. From the effector aspect, EspB

may be actively involved in the interplay of bacteria and host cells. The contribution of

EspB in the EPEC autoaggregaton and invasion showed some clues for EspB as to play

dual roles in bacteria and host interface. Immuno-staining using anti-EspB antibody to

display the participation of EspB in the extracellular filamentous structure in EPEC is

needed to verify the involvement of TTSS in EPEC autoaggregation. Structural biology

provides an extensive tool for the understanding the obscure mechanism of certain

molecules and gives chances to solve interesting biological problems. EspB can be

overexpressed, purified and optimized for crystallography study to solve its molecular

structure. Identification of the biochemical and structural properties of EspB in addition

to functional studies may provide important implications for the multiple roles of EspB

and the embedded mechanism of EspB in pathogenesis possess.

NleI is a novel non-LEE encoded effector from EPEC identified in this study. The

secretion and translocation property of NleI have been verified in this study. However,

the cellular function of NleI remains elusive. As for the functional assay for NleI, many

approaches have been employed, such as the adhesion and invasion assay, the inducible

nitric oxide synthase (iNOS) assay, the fluorescence actin staining (FAS) assay, and the

cell apoptosis assay (data not shown). Unfortunately, all tests failed to come out with

concrete phenotype for NleI. Pull down assay can be done by overexpressing NleI in

mammalian cells to search for the possible binding partner of NleI. Limited phenotypic

assays and non-availability of suitable animal models for EPEC add to the difficulty to

136

assign functions for effectors in EPEC. NleI showed many homologues in CR and

southern blot also verified the multi-copies of NleI in CR. nleIs can be knocked out in CR

and the infection property of CR wild type and nleI mutants in mice can be compared.

These experiments will be better ways to characterize the virulence characteristics of NleI

in animal model. The additional experiments, such as the transepithelia electrical

resistance (TER) assay by using polarized MDCK cells, the anti-phagocytosis activity

against macrophage, can also be used to characterize NleI as a new effector from the

cellular level.

137

Reference

1. Abe, A., U. Heczko, R. G. Hegele, and B. B. Finlay. 1998. Two enteropathogenic

Escherichia coli type III secreted proteins, EspA and EspB, are virulence factors. J.

Exp. Med. 188:1-10.

2. Abe, A., M. de Grado, R. A. Pfuetzner, C. Sanchez-Sanmartin, R. Devinney, J.

L. Puente, N. C. Strynadka, and B. B. Finlay. 1999. Enteropathogenic

Escherichia coli translocated intimin receptor, Tir, requires a specific chaperone for

stable secretion. Mol. Microbiol. 33:1162-1175.

3. Agin, T. S., J. R. Cantey, E. C. Boedeker, and M. K. Wolf. 1996.

Characterization of the eaeA gene from rabbit enteropathogenic Escherichia coli

strain RDEC-1 and comparison to other eaeA genes from bacteria that cause

attaching-effacing lesions. FEMS Microbiol. Lett. 144:249-258.

4. Aizawa, S. I. 2001. Bacterial flagella and type III secretion systems. FEMS

Microbiol. Lett. 202:157-164.

5. Akeda, Y. and J. E. Galan. 2005. Chaperone release and unfolding of substrates in

type III secretion. Nature 437:911–915.

6. Alto, N. M., F. Shao, C. S. Lazar, R. L. Brost, G. Chua, S. Mattoo, S. A.

McMahon, P. Ghosh, T. R. Hughes, C. Boone, and J. E. Dixon. 2006.

Identification of a bacterial type III effector family with G protein mimicry

functions. Cell. 124:133-145.

7. Andrade, J. R., V. F. Da Veiga, M. R. De Santa Rosa, and I. Suassuna. 1989.

An endocytic process in HEp-2 cells induced by enteropathogenic Escherichia coli.

J. Med. Microbiol. 28:49-57.

8. Bahrani-Mougeot, F. K., N. W. Gunther IV, M. S. Donnenberg, and H. L. T.

Mobley. 2002. Uropathogenic Escherichia coli, p. 239-268. In M. S. Donnenberg

(ed.), Escherichia coli: virulence mechanisms of a versatile pathogen. Academic

Press, San Diego, Calif.

9. Baldini, M. M., J. B. Kaper, M. M. Levine, and H. W. Moon. 1983a. Molecular

nature of adhesion in enteropathogenic Escherichia coli. Lancet 2:218.

138

10. Baldini, M. M., J. B. Kaper, M. M. Levine, D. C. Candy, and H. W. Moon.

1983b. Plasmid-mediated adhesion in enteropathogenic Escherichia coli. J. Pediatr.

Gastroenterol. Nutr. 2:534-538.

11. Baldini, M. M., J. P. Nataro, and J. B. Kaper. 1986. Localization of a

determinant for HEp-2 adherence by enteropathogenic Escherichia coli. Infect.

Immun. 52:334-336.

12. Barrett, T. J., J. B. Kaper, A. E. Jerse, and I. K. Wachsmuth. 1992. Virulence

factors in Shiga-like toxin-producing Escherichia coli isolated from humans and

cattle. J. Infect. Dis. 165:979-980.

13. Bauer, M. E., and R. A. Welch. 1996. Characterization of an RTX toxin from

enterohemorrhagic Escherfchia coli 0157:H7. Infect. Immun. 64:167-l75.

14. Beltrametti, F., A. U. Kresse, and C. A. Guzman. 1999. Transcriptional

regulation of the esp genes of enterohemorrhagic Escherichia coli. J. Bacteriol.

181:3409-3418.

15. Berdichevsky, T., D. Friedberg, C. Nadler, A. Rokney, A. Oppenheim, and I.

Rosenshine. 2004. Ler is a negative autoregulator of the LEE1 operon in

enteropathogenic Escherichia coli. J. Bacteriol. 187:349-357.

16. Beutin, L., D. Geier, H. Steinruck, S. Zimmermann, and F. Scheutz. 1993.

Prevalence and some properties of verotoxin (Shiga-like toxin)-producing

Escherichia coli in seven different species of healthy domestic animals. J. Clin.

Microbiol. 31:2483-2488.

17. Beutin, L., S. Aleksic, S. Zimmermann, and K. Gleier. 1994. Virulence factors

and phenotypic traits of verotoxigenic strains of Escherichia coli isolated from

human patients in Germany. Med. Microbiol. Immunol. (Berlin) 183:13-21.

18. Best, A., R. M. La Ragione, A. R. Sayers, and M. J. Woodward. 2005. Role for

flagella but not intimin in the persistent infection of the gastrointestinal tissues of

specific-pathogen-free chicks by Shiga toxin-negative Escherichia coli O157:H7.

Infect. Immun. 73:1836-1846.

19. Bieber, D., S. W. Ramer, C. Y. Wu, W. J. Murray, T. Tobe, R. Fernandez, and

G. K. Schoolnik. 1998. Type IV pili, transient bacterial aggregates, and virulence

of enteropathogenic Escherichia coli. Science. 280:2114-2118.

139

20. Blocker, A., D. Holden and G. Cornelis. 2000. Type III secretion systems: what is

translocator and what is translocated? Cell. Microbiol. 2:387-390.

21. Bower, J. R., B. L. Congeni, T. G. Cleary, R. T. Stone, A. Wanger, B. E.

Murray, J. J. Mathewson, and L. K. Pickering. 1989. Escherichia coli O114:

nonmotile as a pathogen in an outbreak of severe diarrhea associated with a day

care center. J. Infect. Dis. 160:243-247.

22. Boyce, T. G., D. L. Swerdlow, and P. M. Griffin. 1995. Current concepts:

Escherichia coli O157:H7 and the hemolytic-uremic syndrome. N. Engl. J. Med.

333:364-368.

23. Boyd, E. F., and H. Brussow. 2002. Common themes among bacteriophage-

encoded virulence factors and diversity among the bacteriophages involved. Trends

Microbiol. 10:521-529.

24. Brunder, W., H. Schmidt, and H. Karch. 1996. KatP, a novel catalaseperoxidase

encoded by the large plasmid of enterohaemorrhagic Escherichia coli O157:H7.

Microbiology 142:3305-3315.

25. Brunder, W., H. Schmidt, and H. Karch. 1997. EspP, a novel extracellular serine

protease of enterohaemorrhagic Escherichia coli O157:H7 cleaves human

coagulation factor V. Mol. Microbiol. 24:767-778.

26. Burland, V., Y. Shao, N. T. Perna, G. Plunkett, H. J. Sofia, and F. R. Blattner.

1998. The complete DNA sequence and analysis of the large virulence plasmid of

Escherichia coli O157:H7. Nucleic. Acids. Res. 26:4196-4204.

27. Bustamante, V.H., F. J. Santana, E. Calva, and J. L. Puente. 2001.

Transcriptional regulation of type III secretion genes in enteropathogenic

Escherichia coli: Ler antagonizes H-NS-dependent repression. Mol. Microbiol. 39,

664-678.

28. Campellone, K. G., D. Robbins, and J. Leong. 2004. EspFu is a translocated

EHEC effector that interacts with Tir and N-WASP and promotes Nck independent

actin assembly. Dev. Cell 7:217-228.

29. Charpentier, X., and E. Oswald. 2004. Identification of the secretion and

translocation domain of the enteropathogenic and enterohemorrhagic Escherichia

140

coli effector Cif, using TEM-1 β-lactamase as a new fluorescence based reporter. J.

Bacteriol. 186:5486-5495.

30. Chaudhuri, R. R., A. M. Khan, and M. J. Pallen. 2004. coliBASE: an online

database for Escherichia coli, Shigella and Salmonella comparative genomics.

Nucleic Acids Res. 32:296-299.

31. Chen, H. D., and G. Frankel. 2005. Enteropathogenic Escherichia coli: unraveling

pathogenesis. FEMS Microbiol. Rev. 29:83-98.

32. China, B., and F. Goffaux. 1999. Secretion of virulence factors by Escherichia

coli. Vet. Res. 30:181-202.

33. Chiu, H. J., and W. J. Syu. 2005. Functional analysis of EspB from

enterohaemorrhagic Escherichia coli. Microbiology. 151:3277-3286.

34. Clarke, S. C., R. D. Haigh, P. P. Freestone, and P. H. Williams. 2003. Virulence

of enteropathogenic Escherichia coli, a global pathogen. Clin. Microbiol. Rev.

16:365-378.

35. Cleary, J., L. C. Lai, R. K. Shaw, A. Straatman-Iwanowska, M. S. Donnenberg,

G. Frankel, S. Knutton. 2004. Enteropathogenic Escherichia coli (EPEC) adhesion

to intestinal epithelial cells: role of bundle-forming pili (BFP), EspA filaments and

intimin. Microbiology. 150:527-538.

36. Collmer, A., M. Lindeberg, T. Petnicki-Ocwieja, D. J. Schneider, and J. R.

Alfano. 2002. Genomic mining type III secretion system effectors in Pseudomonas

syringae yields new picks for all TTSS prospectors. Trends Microbiol. 10:462-469.

37. Cornelis, G. R., and F. Van Gijsegem. 2000. Assembly and function of type III

secretory systems. Annu. Rev. Microbiol. 54:735-774.

38. Cornelis, G. R. 2002. Yersinia type III secretion: send in the effectors. J. Cell Biol.

158:401-408.

39. Crane, J. K., B. P. McNamara, and M. S. Donnenberg. 2001. Role of EspF in

host cell death induced by enteropathogenic Escherichia coli. Cell. Microbiol.

3:197-211.

40. Cravioto, A., A. Tello, A. Navarro, J. Ruiz, H. Villafán, F. Uribe, and C. Eslava.

1991. Association of Escherichia coli HEp-2 adherence patterns with type and

duration of diarrhoea. Lancet 337:262-264.

141

41. Creasey, E. A., D. Friedberg, R. K. Shaw, T. Umanski, S. Knutton, I.

Rosenshine, and G. Frankel. 2003a. CesAB is an enteropathogenic Escherichia

coli chaperone for the type-III translocator proteins EspA and EspB. Microbiology.

149:3639-3647.

42. Creasey, E. A., R. M. Delahay, A. A. Bishop, R. K. Shaw, B. Kenny, S. Knutton,

and G. Frankel. 2003b. CesT is a bivalent enteropathogenic Escherichia coli

chaperone required for translocation of both Tir and Map. Mol. Microbiol. 47:209-

221.

43. Creasey, E. A., R. M. Delahay, S. J. Daniell, and G. Frankel. 2003c. Yeast two-

hybrid system survey of interactions between LEE-encoded proteins of

enteropathogenic Escherichia coli. Microbiology 149:2093-2106.

44. Crepin, V.F., R. Shaw, C. M. Abe, S. Knutton, and G. Frankel. 2005a. Polarity

of enteropathogenic Escherichia coli EspA filament assembly and protein secretion.

J. Bacteriol. 187:2881-2889.

45. Crepin, V. F., S. Prasannan, R. K. Shaw, R. K. Wilson, E. Creasey, C. M. Abe,

S. Knutton, G. Frankel, and S. Matthews. 2005b. Structural and functional

studies of the enteropathogenic Escherichia coli type III needle complex protein

EscJ. Mol. Microbiol. 55:1658-1670.

46. Dahan, S., S. Wiles, R. M. La Ragione, A. Best, M. J. Woodward, M. P. Stevens,

R. K. Shaw, Y. Chong, S. Knutton, A. Phillips, and G. Frankel. 2005. EspJ is a

prophage-carried type III effector protein of attaching and effacing pathogens that

modulates infection dynamics. Infect. Immun. 73:679-686.

47. Daniell, S. J., R. M. Delahay, R. K. Shaw, E. L. Hartland, M. J. Pallen, F. Booy,

F. Ebel, S. Knutton, and G. Frankel. 2001. Coiled-coil domain of

enteropathogenic Escherichia coli type III secreted protein EspD is involved in

EspA filament-mediated cell attachment and hemolysis. Infect. Immun. 69: 4055-

4064.

48. Daniell ,S. J., E. Kocsis, E. Morris, S. Knutton, F. P. Booy, and G. Frankel.

2003. 3D structure of EspA filaments from enteropathogenic Escherichia coli. Mol.

Microbiol. 49:301-308.

142

49. Datsenko, K. A, and B. L. Wanner. 2000. One-step inactivation of chromosomal

genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA

97:6640-6645.

50. Deng, W., J. L. Puente, S. Gruenheid, Y. Li, B. A. Vallance, A. Va´zquez, J.

Barba, J. A. Ibarra, P. O’Donnell, P. Metalnikov, K. Ashman, S. Lee, D. Goode,

T. Pawson, and B. B. Finlay. 2004. Dissecting virulence: systematic and

functional analyses of a pathogenicity island. Proc. Natl. Acad. Sci. USA 101:3597-

3602.

51. Deng W, Y. Li, P. R. Hardwidge, E. A. Frey, R. A. Pfuetzner, S. Lee, S.

Gruenheid, N. C. J. Strynakda, J. L. Puente, and B. B. Finlay. 2005. Regulation

of type III secretion hierarchy of translocators and effectors in attaching and

effacing bacterial pathogens. Infect. Immun. 73:2135-2146.

52. Deng, W. L., and H. C. Huang. 1999. Cellular locations of Pseudomonas syringae

pv. syringae HrcC and HrcJ proteins, required for harpin secretion via the type III

pathway. J. Bacteriol. 181:2298-2301.

53. Djafari, S., F. Ebel, C. Deibel, S. Kramer, M. Hudel, and T. Chakraborty. 1997.

Characterization of an exported protease from Shiga toxin-producing Escherichia

coli. Mol. Microbiol. 25:771–784.

54. Donnenberg, M. S., A. Donohue-Rolfe, and G. T. Keusch. 1989. Epithelial cell

invasion: an overlooked property of enteropathogenic Escherichia coli (EPEC)

associated with the EPEC adherence factor. J. Infect. Dis. 160: 452-459.

55. Donnenberg, M. S., S. B. Calderwood, A. Donohue-Rolfe, G. T. Keusch, and J.

B. Kaper. 1990. Construction and analysis of TnphoA mutants of enteropathogenic

Escherichia coli unable to invade Hep-2 cells. Infect. Immun. 58:1565-1571.

56. Donnenberg, M. S., C. O. Tacket, S. P. James, G. Losonsky, J. P. Nataro, S. S.

Wasserman, J. B. Kaper, and M. M. Levine. 1993a. Role of the eaeA gene in

experimental enteropathogenic Escherichia coli infection. J. Clin. Invest. 92:1412-

1417.

57. Donnenberg, M. S., S. Tzipori, M. L. McKee, A. D. O’Brien, J. Alroy, and J. B.

Kaper. 1993b. The role of the eae gene of enterohemorrhagic Escherichia coli in

intimate attachment in vitro and in a porcine model. J. Clin. Invest. 92:1418-1424.

143

58. Donnenberg, M. S., J. B. Kaper, and B. B. Finlay. 1997. Interactions between

enteropathogenic Escherichia coli and host epithelial cells. Trends Microbiol.

5:109-114.

59. Donnenberg, M. S., and T. S. Whittam. 2001. Pathogenesis and evolution of

virulence in enteropathogenic and enterohemorrhagic Escherichia coli. J. Clinic.

Invest. 107:539-548.

60. Durno, C., R. Soni, and P. Sherman. 1989. Adherence of vero cytotoxinproducing

Escherichia coli serotype O157:H7 to isolated epithelial cells and brush border

membranes in vitro: role of type 1 fimbriae (pili) as a bacterial adhesin expressed

by strain CL-49. Clin. Invest. Med. 12:194-200.

61. Dytoc, M., L. Fedorko, and P. M. Sherman. 1994. Signal transduction in human

epithelial cells infected with attaching and effacing Escherichia coli in vitro.

Gastroenterology 106:1150-1161.

62. Ebel, F., C. Deibel, A. U. Kresse, C. A. Guzman, and T. Chakraborty. 1996.

Temperature- and medium-dependent secretion of proteins by Shiga toxin-

producing Escherichia coli. Infect. Immun. 64:4472-4479.

63. Ebel, F., T. Podzadel, M. Rohde, A. U. Kresse, S. Kramer, C. Deibel, C. A.

Guzman, and T. Chakraborty. 1998. Initial binding of Shiga toxin-producing

Escherichia coli to host cells and subsequent induction of actin rearrangements

depend on filamentous EspA-containing surface appendages. Mol. Microbiol.

30:147-161.

64. Edwards, R. A., L. H. Keller, and D. M. Schifferli. 1998. Improved allelic

exchange vectors and their use to analyze 987P fimbria gene expression. Gene

207:149-157.

65. Elliott, S. J., L. A. Wainwright, T. K. McDaniel, K. G. Jarvis, Y. K. Deng, L. C.

Lai, B. P. McNamara, M. S. Donnenberg, and J. B. Kaper. 1998. The complete

sequence of the locus of enterocyte effacement (LEE) from enteropathogenic

Escherichia coli E2348/69. Mol. Microbiol. 28:1-4.

66. Elliott, S. J., S. W. Hutcheson, M. S. Dubois, J. L. Mellies, L. A. Wainwright,

M. Batchelor, G. Frankel, S. Knutton, and J. B. Kaper. 1999. Identification of

144

CesT, a chaperone for the type III secretion of Tir in enteropathogenic Escherichia

coli. Mol. Microbiol. 33:1176-1189.

67. Elliott, S. J., V. Sperandio, J. A. Giro′ n, S. Shin, J. L. Mellies, L. Wainwright,

S. W. Hutcheson, T. K. McDaniel, and J. B. Kaper. 2000. The locus of

enterocyte effacement (LEE)-encoded regulator controls expression of both LEE-

and Non-LEE-encoded virulence factors in enteropathogenic and

enterohemorrhagic Escherichia coli. Infect. Immun. 68:6115-6126.

68. Elliott, S. J., E. O. Krejany, J. L. Mellies, R. M. Robins-Browne, C. Sasakawa,

and J. B. Kaper. 2001. EspG, a novel type III system-secreted protein from

enteropathogenic Escherichia coli with similarities to VirA of Shigella flexneri.

Infect. Immun. 69:4027-4033.

69. Elliott, S.J., C. B. O'Connell, A. Koutsouris, C. Brinkley, M. S. Donnenberg, G.

Hecht, and J. B. Kaper. 2002. A gene from the locus of enterocyte effacement that

is required for enteropathogenic Escherichia coli to increase tight-junction

permeability encodes a chaperone for EspF. Infect. Immun. 70:2271-2277.

70. Foubister, V., I. Rosenshine, M. S. Donnenberg, and B. B. Finlay. 1994. The

eaeB gene of enteropathogenic Escherichia coli is necessary for signal transduction

in epithelial cells. Infect. Immun. 62:3038-3040.

71. Foxman, B., R. Barlow, H. D’Arcy, B. Gillespie, and J. D. Sobel. 2000. Urinary

tract infection: self-reported incidence and associated costs. Ann. Epidemiol.

10:509-515.

72. Francis, C. L., A. E. Jerse, J. B. Kaper, and S. Falkow. 1991. Characterization of

interactions of enteropathogenic Escherichia coli O127:H6 with mammalian cells in

vitro. J. Infect. Dis. 164:693-703.

73. Frankel, G., D. C. A. Candy, P. Everest, and G. Dougan. 1994. Characterization

of the C-terminal domains of intimin-like proteins of enteropathogenic and

enterohemorrhagic Escherichia coli, Citrobacter freundii, and Hafnia alvei. Infect.

Immun. 62:1835-1842.

74. Frankel, G., A. D. Phillips, I. Rosenshine, G. Dougan, J. B. Kaper, and S.

Knutton. 1998. Enteropathogenic and enterohaemorrhagic Escherichia coli: more

subversive elements. Mol. Microbiol. 30:911-921.

145

75. Friedberg, D., T. Umanski, Y. Fang, and I. Rosenshine. 1999. Hierarchy in the

expression of the locus of enterocyte effacement genes of enteropathogenic

Escherichia coli. Mol. Microbiol. 34:941-952.

76. Galan, J. E., and A. Collmer. 1999. Type III secretion machines: bacterial devices

for protein delivery into host cells. Science. 284:1322-1328.

77. Galan, J. E. 2001. Salmonella interactions with host cells: type III secretion at

work. Annu. Rev. Cell Dev. Biol. 17:53-86.

78. Garmendia, J., A. D. Phillips, M. F. Carlier, Y. Chong, S. Schuller, O. Marches,

S. Dahan, E. Oswald, R. K. Shaw, S. Knutton, and G. Frankel. 2004. TccP is an

enterohaemorrhagic Escherichia coli O157:H7 type III effector protein that couples

Tir to the actin-cytoskeleton. Cell. Microbiol. 6:1167-1183.

79. Garmendia, J., and G. Frankel. 2005. Operon structure and gene expression of

the espJ-tccP locus of enterohaemorrhagic Escherichia coli O157:H7. FEMS

Microbiol. Lett. 247:137-145.

80. Garmendia, J., G. Frankel, and V. F. Crepin. 2005. Enteropathogenic and

enterohemorrhagic Escherichia coli infections: translocation, translocation,

translocation. Infect Immun. 73:2573-2585.

81. Gauthier, A., J. L. Puente, and B. B. Finlay. 2003. Secretin of the

enteropathogenic Escherichia coli type III secretion system requires components of

the type III apparatus for assembly and localization. Infect. Immun. 71:3310-3319.

82. Giron, J. A., A. S. Ho, and G. K. Schoolnik. 1991. An inducible bundle forming

pilus of enteropathogenic Escherichia coli. Science 254:710-713.

83. Giron, J. A., A. S. Ho, and G. K. Schoolnik. 1993. Characterization of fimbriae

produced by enteropathogenic Escherichia coli. J. Bacteriol. 175: 7391-7403.

84. Giron, J. A., O. G. Gomez-Duarte, K. G. Jarvis, and J. B. Kaper. 1997. Longus

pilus of enterotoxigenic Escherichia coli and its relatedness to other type-4 pili - a

minireview. Gene 192:39-43.

85. Giron, J. A., A. G. Torres, E. Freer, and J. B. Kaper. 2002. The flagella of

enteropathogenic Escherichia coli mediate adherence to epithelial cells. Mol.

Microbiol. 44:361-379.

146

86. Gomez-Duarte, O. G., and J. B. Kaper. 1995. A plasmid-encoded regulatory

region activates chromosomal eaeA expression in enteropathogenic Escherichia coli.

Infect Immun. 63:1767-1776.

87. Goosen, N., and P. van de Putte. 1995. The regulation of transcription initiation

by integration host factor. Mol. Microbiol. 16:1-7.

88. Griffin, P. M., and R. V. Tauxe. 1991. The epidemiology of infections caused by

Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated

hemolytic uremic syndrome. Epidemiol. Rev. 13:60-98.

89. Griffin, P. M. 1995. Escherichia coli O157:H7 and other enterohemorrhagic

Escherichia coli, p. 739-761. In M. J. Blaser, P. D. Smith, J. I. Ravdin, H. B.

Greenberg, and R. L. Guerrant (ed.), Infections of the gastrointestinal tract. Raven

Press, New York, N.Y.

90. Gruenheid, S., I. Sekirov, N. A. Thomas, W. Deng, P. O’Donnell, D. Goode, Y.

Li, E. A. Frey, N. F. Brown, P. Metalnikov, T. Pawson, K. Ashman, and B. B.

Finlay. 2004. Identification and characterization of NleA, a non-LEE-encoded type

III translocated virulence factor of enterohemorrhagic Escherichia coli O157:H7.

Mol. Microbiol. 51:1233-1249.

91. Grys, T. E., M. B. Siege, W. W. Lathem, and R. A. Welch. 2005. The StcE

protease contributes to intimate adherence of enterohemorrhagic Escherichia coli

O157:H7 to host cells. Infect. Immun. 73:1295-1303.

92. Hacker, J., L. Bender, M. Ott, J. Wingender, B. Lund, R. Marre, and W.

Goebel. 1990. Deletions of chromosomal regions coding for fimbriae and

hemolysins occur in vivo and in vitro in various extraintestinal Escherichia coli

isolates. Microb. Pathog. 8:213-225.

93. Hacker, J. 1992. Role of fimbrial adhesins in the pathogenesis of Escherichia coli

infections. Can. J. Microbiol. 38:720-727.

94. Hacker, J., and J. B. Kaper. 2000. Pathogenicity islands and the evolution of

microbes. Annu. Rev. Microbiol. 54:641-679.

95. Haack, K. R., C. L. Robinson, K. J. Miller, J. W. Fowlkes, and J. L. Mellies.

2003. Interaction of Ler at the LEE5 (tir) operon of enteropathogenic Escherichia

coli. Infect. Immun. 71:384-392.

147

96. Hamada, D., T. Kato, T. Ikegami, K. N. Suzuki, M. Hayashi, Y. Murooka, T.

Honda, and I. Yanagihara. 2005. EspB from enterohaemorrhagic Escherichia coli

is a natively partially folded protein. FEBS J. 272:756-768.

97. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J.

Mol. Biol. 166:557-580.

98. Hantke, K., Nicholson, G., Rabsch, W., and Winkelmann, G. 2003.

Salmochelins, siderophores of Salmonella enterica and uropathogenic Escherichia

coli strains, are recognized by the outer membrane receptor IroN. Proc. Natl. Acad.

Sci. USA 100: 3677-3682.

99. Hasman, H., T. Chakraborty, and P. Klemm. 1999. Antigen-43-mediated

autoaggregation of Escherichia coli is blocked by fimbriation. J. Bacteriol.

181:4834-4841.

100. Hayashi, T., K. Makino, M. Ohnishi, K. Kurokawa, K. Ishii, K. Yokoyama, C.

G. Han, E. Ohtsubo, K. Nakayama, T. Murata, M. Tanaka, T. Tobe, T. Iida, H.

Takami, T. Honda, C. Sasakawa, N. Ogasawara, T. Yasunaga, S. Kuhara, T.

Shiba, M. Hattori, and H. Shinagawa. 2001. Complete genome sequence of

enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a

laboratory strain K-12. DNA Res. 8:11-22.

101. Heath, P. T., N. K. Nik. Yusoff, and C. J. Baker. 2003. Neonatal meningitis

Archives of Disease in Childhood Fetal and Neonatal Edition. 88:173-178.

102. Hedberg, C. W., S. J. Savarino, J.M. Besser, C. J. Paulus, V. M. Thelen, L. J.

Myers, D. N. Cameron, T. J. Barrett, L. B. Kaper, and M. T. Osterholm. 1997.

An outbreak of foodborne illness caused by Escherichia coli O39:NM, an agent not

fitting into the existing scheme for classifying diarrheogenic E. coli. J. Infect. Dis.

176:1625-1628.

103. Hill, S. M., A. D. Phillips, and J. A. Walker-Smith. 1991. Enteropathogenic

Escherichia coli and life threatening chronic diarrhoea. Gut 32:154-158.

104. Hiroyuki, A., T. Ichiro, T. Toru, O. Akiko, and S. Chihiro. 2002. Bicarbonate

ion stimulates the expression of locus of enterocyte effacement-encoded genes in

enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 70:3500-3509.

148

105. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site-

directed mutagenesis by overlap extension using the polymerase chain reaction.

Gene 77:51-59.

106. Hoffman, P. S., and R. A. Garduno. 1999. Surface-associated heat shock proteins

of Legionella pneumophila and Helicobacter pylori: roles in pathogenesis and

immunity. Infect. Dis. Obstet. Gynecol. 7:58-63.

107. Huang, A., J. Friesen, and J. L. Brunton. 1987. Characterization of a

bacteriophage that carries the genes for production of Shiga-like toxin 1 in

Escherichia coli. J. Bacteriol. 169:4308-4312.

108. Hueck, C. J. 1998. Type III protein secretion systems in bacterial pathogens of

animals and plants. Microbiol. Mol. Biol. Rev. 62:379-433.

109. Ide, T., S. Laarmann, L. Greune, H. Schillers, H. Oberleithner, and M. A.

Schmidt. 2001. Characterization of translocation pores inserted into plasma

membranes by type III-secreted Esp proteins of enteropathogenic Escherichia coli.

Cell. Microbiol. 3: 669-679.

110. Jackson, R. W., E. Athanassopoulos, G. Tsiamis, J. W. Mansfield, A. Sesma, D.

L. Arnold, M. J. Gibbon, J. Murillo, J. D. Taylor, and A. Vivian.1999.

Identification of a pathogenicity island, which contains genes for virulence and

avirulence, on a large native plasmid in the bean pathogen Pseudomonas syringae

pathovar phaseolicola. Proc. Natl. Acad. Sci. USA 96:10875-10880.

111. Jarvis, K. G., J. A. Giron, A. E. Jerse, T. K. McDaniel, M. S. Donnenberg, and

J. B. Kaper. 1995. Enteropathogenic Escherichia coli contains a putative type III

secretion system necessary for the export of proteins involved in attaching and

effacing lesion formation. Proc. Natl. Acad. Sci. USA 92:7996-8000.

112. Jarvis, K. G., and J. B. Kaper. 1996. Secretion of extracellular proteins by

enterohemorrhagic Escherichia coli via a putative type III secretion system. Infect.

Immun. 64:4826-4829.

113. Jepson, M. A., S. Pellegrin, L. Peto, D. N. Banbury, A. D. Leard, H. Mellor,

and B. Kenny. 2003. Synergistic roles for the Map and Tir effector molecules in

mediating uptake of enteropathogenic Escherichia coli (EPEC) into non-phagocytic

cells. Cell. Microbiol. 5:773-783.

149

114. Jerse, A. E., J. Yu, B. D. Tall, and J. B. Kaper. 1990. A genetic locus of

enteropathogenic Escherichia coli necessary for the production of attaching and

effacing lesions on tissue culture cells. Proc. Natl. Acad. Sci. USA 87:7839-7843.

115. Johnson, J. R. 1991. Virulence factors in Escherichia coli urinary tract infection.

Clin. Microbiol. Rev. 4:80-128.

116. Johnson, R. P., R. C. Clarke, J. B. Wilson, S. C. Read, K. Rahn, S. A. Renwick,

K. A. Sandhu, D. Alves, M. A. Karmali, H. Lior, S. A. McEwen, J. S. Spika,

and C. L. Gyles. 1996. Growing concerns and recent outbreaks involving non-

O157:H7 serotypes of verotoxigenic Escherichia coli. J. Food Prot. 59:1112-

1122.

117. Kalogeraki, V. S., and S. C. Winans. 1997. Suicide plasmids containing

promoterless reporter genes can simultaneously disrupt and create fusions to target

genes of diverse bacteria. Gene 188:69-75.

118. Kanack, K. J., J. A. Crawford, I. Tatsuno, M. Karmali, and J. B. Kaper, 2005.

SepZ/EspZ is secreted and translocated into HeLa cells by the enteropathogenic

Escherichia coli type III secretion system. Infect. Immun. 73:4327-4337.

119. Kaper, J. B., and J. Hacker (eds). 1999. Pathogenicity Islands and Other Mobile

Virulence Elements. Washington, DC: Am. Soc. Microbiol.

120. Karmali M. A. 1989. Infection by verocytotoxin-producing Escherichia coli. Clin.

Microbiol. Rev. 2:15-38.

121. Kenny, B., and B. B. Finlay. 1995. Protein secretion by enteropathogenic

Escherichia coli is essential for transducing signals to epithelial cells. Proc. Natl.

Acad. Sci. USA 92:7991-7995.

122. Kenny, B., R. DeVinney, M. Stein, D. J. Reinscheid, E. A. Frey, and B. B.

Finlay. 1997. Enteropathogenic Eshcerichia coli (EPEC) transfers its receptor for

intimate adherence into mammalian cells. Cell 91:511-520.

123. Kenny, B., and M. Jepson. 2000. Targeting of an enteropathogenic Escherichia

coli (EPEC) effector protein to host mitochondria. Cell. Microbiol. 2:579-590.

124. Khursigara, C., M. Abul-Milh, B. Lau, J. A. Giron, C. A. Lingwood, and D. E.

Foster. 2001. Enteropathogenic Escherichia coli virulence factor bundle-forming

150

pilus has a binding specificity for phosphatidylethanolamine. Infect. Immun.

69:6573-6579.

125. Klapproth, J. M., M. S. Donnenberg, J. M. Abraham, H. L. T. Mobley, and S.

P. James. 1995. Products of enteropathogenic Escherichia coli inhibit lymphocyte

activation and lymphokine production. Infect.Immun. 63:2248-2254.

126. Klapproth, J. M., M. S. Donnenberg, J. M. Abraham, and S. P. James. 1996.

Products of enteropathogenic E. coli inhibit lymphokine production by

gastrointestinal lymphocytes. Am.J.Physiol.Gastrointest.Liver Physiol. 271:841-848.

127. Knappstein, S., T. Ide, M. A. Schmidt, and G. Heusipp. 2004. Alpha 1-

antitrypsin binds to and interferes with functionality of EspB from atypical and

typical enteropathogenic Escherichia coli strains. Infect. Immun. 72:4344-4350.

128. Knutton, S., M. M. McConnell, B. Rowe, and A. S. McNeish. 1989a. Adhesion

and ultrastructural properties of human enterotoxigenic Escherichia coli producing

colonization factor antigens III and IV. Infect. Immun. 57:3364-3371.

129. Knutton, S., T. Baldwin, P. H. Williams, and A. S. McNeish. 1989b. Actin

accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new

diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli.

Infect. Immun. 57:1290-1298.

130. Knutton, S., I. Rosenshine, M. J. Pallen, I. Nisan, B. C. Neves, C. Bain, C.

Wolff, G. Dougan, and G. Frankel. 1998. A novel EspA-associated surface

organelle of enteropathogenic Escherichia coli involved in protein translocation

into epithelial cells. EMBO J. 17:2166-2176.

131. Kodama, T., Y. Akeda, G. Kono, A. Takahashi, K. Imura, T. Iida, and T.

Honda. 2002. The EspB protein of enterohaemorrhagic Escherichia coli interacts

directly with β-catenin. Cell. Microbiol. 4:213-222.

132. Krause, G., S. Zimmermann, and L. Beutin. 2005. Investigation of domestic

animals and pets as a reservoir for intimin-(eae) gene positive Escherichia coli

types. Vet. Microbiol. 106:87-95.

133. Kresse, A. U., M. Rohde, and C. A. Guzman. 1999. The EspD protein of

enterohemorrhagic Escherichia coli is required for the formation of bacterial

151

surface appendages and is incorporated in the cytoplasmic membranes of target

cells. Infect. Immun. 67: 4834-4842.

134. Kresse, A. U., F. Beltrametti, A. Muller, F. Ebel, and C. A. Guzman. 2000.

Characterization of SepL of enterohemorrhagic Escherichia coli. J. Bacteriol.

182:6490-6498.

135. Lathem, W. W., T. E. Grys, S. E. Witowski, A. G. Torres, J. B. Kaper, P. I.

Tarr, and R. A. Welch. 2002. StcE, a metalloprotease secreted by Escherichia coli

O157:H7, specifically cleaves C1 esterase inhibitor. Mol. Microbiol. 45:277-288.

136. Lathem, W. W., T. Bergsbaken, and R. A. Welch. 2004. Potentiation of C1

esterase inhibitor by StcE, a metalloprotease secreted by Escherichia coli O157:H7.

J. Exp. Med. 199: 1077-1087.

137. Law, D., and J. Kelly. 1995. Use of heme and hemoglobin by Escherichia coli

O157 and other Shiga-like-toxin-producing E. coli serogroups. Infect. Immun.

63:700-702.

138. Leomil, L A. F. G. de Castro, G. Krause, H. Schmidt and L. Beutin. 2005.

Characterization of two major groups of diarrheagenic Escherichia coli O26 strains

which are globally spread in human patients and domestic animals of different

species. FEMS Microbiol. Lett. 249:335-342.

139. Levine, M. M, J. B. Kaper, R. E. Black and M. L. Clements. 1983. New

knowledge on pathogenesis of bacterial enteric infections as applied to vaccine

development. Microbiol. Rev. 47:510-550.

140. Levine, M. M., and R. Edelman. 1984. Enteropathogenic Escherichia coli of

classic serotypes associated with infant diarrhea: epidemiology and pathogenesis.

Epidemiol. Rev. 6:31-51.

141. Li, M., I. Rosenshine, S. L. Tung, X. H. Wang, D. Friedberg, C. L. Hew, and K.

Y. Leung, 2004. Comparative proteomic analysis of extracellular proteins of

enterohemorrhagic and enteropathogenic Escherichia coli strains and their ihf and

ler mutants. Appl. Environ. Microbiol. 70:5274-5282.

142. Luck, S. N., V. Bennett-Wood, R. Poon, R. M. Robins-Browne and E. L.

Hartland. 2005. Invasion of epithelial cells by locus of enterocyte effacement-

negative enterohemorrhagic Escherichia coli. Infect. Immun. 73: 3063-3071.

152

143. Luo, W., and M. S. Donnenberg. 2006. Analysis of the Function of

Enteropathogenic Escherichia coli EspB by Random Mutagenesis. Infect. Immun.

74:810-820.

144. Luo, Y., E. A. Frey, R. A. Pfuetzner, A. L. Creagh, D. G. Knoechel, C. A.

Haynes, B. B. Finlay, and N. C. Strynadka. 2000. Crystal structure of

enteropathogenic Escherichia coli intimin-receptor complex. Nature. 405:1073-

1077.

145. Malstrom,C. and S. James. 1998. Inhibition of murine splenic and mucosal

lymphocyte function by enteric bacterial products. Infect. Immun. 66:3120-3127.

146. Marchés, O., S. Wiles, F. Dziva, R. M. La Ragione, S. Schüller, A. Best, A. D.

Phillips, E. L. Hartland, M. J. Woodward, M. P. Stevens, and G. Frankel. 2005.

Characterization of two non-locus of enterocyte effacement-encoded type III-

translocated effectors, NleC and NleD, in attaching and effacing pathogens. Infect.

Immun. 73:8411-8417.

147. Marchés, O., T. N. Ledger, M. Boury, M. Ohara, X. Tu, F. Goffaux, J. Mainil,

I. Rosenshine, M. Sugai, J. De Rycke, and E. Oswald. 2003. Enteropathogenic

and enterohaemorrhagic Escherichia coli deliver a novel effector called Cif, which

blocks cell cycle G2/M transition. Mol. Microbiol. 50:1553-1567.

148. Matsuzawa, T., A. Kuwae, S. Yoshida, C. Sasakawa, and A. Abe. 2004.

Enteropathogenic Escherichia coli activates the RhoA signalling pathway via the

stimulation of GEF-H1. EMBO J. 23:3570-3582.

149. Matsuzawa T, Kuwae A, and Abe A. 2005. Enteropathogenic Escherichia coli

type III effectors EspG and EspG2 alter epithelial paracellular permeability. Infect.

Immun. 73:6283-6289.

150. McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A

genetic locus of enterocyte effacement conserved among diverse enterobacterial

pathogens. Proc. Natl. Acad. Sci. USA 92:1664-1668.

151. McKee, M. L., and A. D. O’Brien. 1995. Investigation of enterohemorrhagic

Escherichia coli O157:H7 adherence characteristics and invasion potential reveals a

new attachment pattern shared by intestinal E. coli. Infect. Immun. 63:2070-2074.

153

152. McNamara, B. P., A. Koutsouris, C. B. O’Connell, J. P. Nougayrede, M. S.

Donnenberg, and G. Hecht. 2001. Translocated EspF protein from

enteropathogenic Escherichia coli disrupts host intestinal barrier function. J. Clin.

Invest. 107:621-629.

153. Mellies, J. L., S. J. Elliott, V. Sperandio, M. S. Donnenberg, and J. B. Kaper.

1999. The Per regulon of enteropathogenic Escherichia coli: identification of a

regulatory cascade and a novel transcriptional activator, the locus of enterocyte

effacement (LEE)-encoded regulator (Ler). Mol. Microbiol. 33: 296-306.

154. Mellies, J. L., F. Navarro-Garcia, I. Okeke, J. Frederickson, J. P. Nataro, and

J. B. Kaper. 2001. espC pathogenicity island of enteropathogenic Escherichia coli

encodes an enterotoxin. Infect. Immun. 69:315-324.

155. Miller, J. H. 1972. Experiments in Molecular Genetics. Cold Spring Harbor, NY:

Cold Spring Harbor Laboratory.

156. Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in

construction of insertion mutations: osmoregulation of outer membrane proteins and

virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 170: 2575-

2583.

157. Mills, M., and S. M. Payne. 1995. Genetics and regulation of heme iron transport

in Shigella dysenteriae and detection of an analogous system in Escherichia coli

O157:H7. J. Bacteriol. 177:3004-3009.

158. Moon, H. W., S. C. Whipp, R. A. Argenzio, M. M. Levine, and R. A. Giannella.

1983. Attaching and effacing activities of rabbit and human enteropathogenic

Escherichia coli in pig and rabbit intestines. Infect. Immun. 41:1340-1351.

159. Mulvey, M. A., J. D. Schilling, J. J. Martinez, and S. J. Hultgren. 2000. Bad

bugs and beleaguered bladders: interplay between uropathogenic Escherichia coli

and innate host defenses. Proc. Natl. Acad. Sci. U S A. 97:8829-8835.

160. Mundy, R., L. Petrovska, K. Smollett, N. Simpson, R. K. Wilson, J. Yu, X. Tu,

I. Rosenshine, S. Clare, G. Dougan, and G. Frankel. 2004. Identification of a

novel Citrobacter rodentium type III secreted protein, EspI, and roles of this and

other secreted proteins in infection. Infect. Immun. 72:2288-2302.

154

161. Mustaftschie, S., J. Vasse, and G. Truchet. 1982. Exostructures of Rhizobium

meliloti. FMS Micriobiol. Lett. 13: 171-175.

162. Nakazato, G., C. Gyles, K. Ziebell, R. Keller, L. R. Trabulsi, T. A. T. Gomes, K.

Irino, W. D. Da Silveira, and A. F. P. De Castro. 2004. Attaching and effacing

Escherichia coli isolated from dogs in Brazil: characteristics and serotypic

relationship to human enteropathogenic E. coli (EPEC). Vet. Microbiol. 101:269-

277.

163. Nash, H. A. 1996. The HU and IHF proteins: accessory factors for complex

protein-DNA assemblies, p. 149. In E. C. C. Lin and A. C. Lynch (ed.), Regulation

of Gene Expression in Escherichia coli. Austin, TX: Chapman, Hall.

164. Nataro, J. P., K. O. Maher, P. Mackie, and J. B. Kaper. 1987. Characterization

of plasmids encoding the adherence factor of enteropathogenic Escherichia coli.

Infect. Immun. 55:2370-2377.

165. Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin.

Microbiol. Rev. 11:142-201.

166. Navarro-Garcia, F., A. Canizalez-Roman, B. Q. Sui, J. P. Nataro and Y.

Azamar. 2004. The serine protease motif of EspC from enteropathogenic

Escherichia coli produces epithelial damage by a mechanism different from that of

pet toxin from enteroaggregative E. coli. Infect Immun 72: 3609-3621.

167. Naylor, S. W., J. C. Low, T. E. Besser, A. Mahajan, G. J. Gunn, M. C. Pearce, I.

J. McKendrick, D. G. Smith, and D. L. Gally. 2003. Lymphoid follicle-dense

mucosa at the terminal rectum is the principal site of colonization of

enterohemorrhagic Escherichia coli O157:H7 in the bovine host. Infect. Immun. 71:

1505–1512.

168. Neves, B.C., R. Mundy, L. Petrovska, G. Dougan, S. Knutton, and G. Frankel.

2003. CesD2 of enteropathogenic Escherichia coli is a second chaperone for the

type III secretion translocator protein EspD. Infect. Immun. 71:2130-2141.

169. Newman, J. V., B. A. Zabel, S. S. Jha, and D. B. Schauer. 1999. Citrobacter

rodentium espB is necessary for signal transduction and for infection of laboratory

mice. Infect. Immun. 67:6019-6025.

155

170. Nougayrede, J. P., P. J. Fernandes, and M. S. Donnenberg. 2003. Adhesion of

enteropathogenic Escherichia coli to host cells. Cell. Microbiol. 5:359-372.

171. O’Brien, A. D., V. L. Tesh, A. Donohue-Rolfe, M. P. Jackson, S. Olsnes, K.

Sandvig, A. A. Lindberg, and G. T. Keusch. 1992. Shiga toxin: biochemistry,

genetics, mode of action, and role in pathogenesis. Curr. Top. Microbial. Immunol.

180:65-94.

172. O’Connell, C. B., E. A. Creasey, S. Knutton, S. Elliott, L. J. Crowther, W. Luo,

M. J. Albert, J. B. Kaper, G. Frankel, and M. S. Donnenberg. 2004. SepL, a

protein required for enteropathogenic Escherichia coli type III translocation,

interacts with secretion component SepD. Mol. Microbiol. 52:1613-1625.

173. Oelschlaeger, T. A., T. J. Barrett, and D. J. Kopecko. 1994. Some structures and

processes of human epithelial cells involved in uptake of enterohemorrhagic

Escherichia coli O157:H7 strains. Infect. Immun. 62:5142-5150.

174. Oswald, E., H. Schmidt, S. Morabito, H. Karch, O. Marches, and A. Caprioli.

2000. Typing of intimin genes in human and animal enterohemorrhagic and

enteropathogenic Escherichia coli: characterization of a new intimin variant.

Infect. Immun. 68:64-71.

175. Pappin, D. J. C., P. Hojrup, and A. J. Bleasby. 1993. Rapid identification of

proteins by peptide-mass fingerprinting. Current. Biol. 3:327-332.

176. Paton, J.C., and A.W. Paton. 1998. Pathogenesis and diagnosis of Shiga toxin-

producing Escherichia coli infections. Clin. Microbiol. Rev. 11:450-479.

177. Perna, N. T., G. F. Mayhew, G. Posfai, S. J. Elliott, M. S. Donnenberg, J. B.

Kaper, and F. R. Blattner. 1998. Molecular evolution of a pathogenicity island

from enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 66:3810-3817.

178. Perna, N. T., G. Plunkett III, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G.

F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Posfai, J. Hackett, S.

Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T.

Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen,

D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of

enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529-533.

179. Phillips, A. D., and G. Frankel. 2000. Intimin-mediated tissue specificity in

156

enteropathogenic Escherichia coli interaction with woman intestinal organ cultures.

J. Infect. Dis. 181: 1496–1500.

180. Phillips, A. D., S. Navabpour, S. Hicks, G. Dougan, T. Wallis, and G. Frankel.

2000. Enterohaemorrhagic Escherichia coli O157:H7 target Peyer’s patches in

humans and cause attaching/effacing lesions in both human and bovine intestine.

Gut 47: 377–381.

181. Polotsky, Y. E., E. M. Dragunskaya, V. G. Seliverstova, T. A. Avdeeva, M. G.

Chakhutinskaya, I. Ke´tyi, A. Verte´nyi, B. Ralovich, L. Emody, I. Ma´lovics,

N. V. Safonova, E. S. Snigirevskaya, and E. I. Karyagina. 1977. Pathogenic

effect of enterotoxigenic Escherichia coli and Escherichia coli causing infantile

diarrhea. Acta Microbiol. Acad. Sci. Hung. 24:221-236.

182. Pozidis, C., A. Chalkiadaki, A. Gomez-Serrano, H. Stahlberg, I. Brown, A. P.

Tampakaki, A. Lustig, G. Sianidis, A. S. Politou, A. Engel, N. J. Panopoulos, J.

Mansfield, A. P. Pugsley, S. Karamanou, A. Economou. 2003. Type III protein

translocase: HrcN is a peripheral ATPase that is activated by oligomerization. J.

Biol. Chem. 278:25816-25824.

183. Prigent-Combaret, C., E. Brombacher, O. Vidal, A. Ambert, P. Lejeune, P.

Landini, and C. Dorel. 2001. Complex regulatory network controls initial

adhesion and biofilm formation in Escherichia coli via regulation of the csgD gene.

J. Bacteriol. 183:7213-7223.

184. Puente, J. L., D. Bieber, S. W. Ramer, W. Murray, and G. K. Schoolnik. 1996.

The bundle-forming pili of enteropathogenic Escherichia coli: transcriptional

regulation by environmental signals. Mol. Microbiol. 20:87-100.

185. Pugsley, A. P. 1993. The complete general secretory pathway in gram-negative

bacteria. Microbiol. Rev. 57:50-108.

186. Rice, P. A., S. W. Yang, K. Mizuuchi, and H. A. Nash. 1996. Crystal structure of

an IHF-DNA complex: a protein induced DNA U-turn. Cell 87:1295-1306.

187. Rosenshine, I., S. Ruschkowski, and B. B. Finlay. 1996. Expression of

attaching/effacing activity by enteropathogenic Escherichia coli depends on growth

phase, temperature, and protein synthesis upon contact with epithelial cells. Infect.

Immun. 64:966-973.

157

188. Rubires, X., F. Saigí, N. Piqué, N. Climent, N., S. Merino, S. Albertí, J. M.

Tomas, and M. Regue. 1997. A gene (wbbL) from Serratia marcescens N28b (O4)

complements the rfb50 mutation of Escherichia coli K-12 derivatives. J. Bacteriol.

179:7581-7586.

189. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a

laboratory manual. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring

Harbor, N.Y.

190. Schauer, D. B., and S. Falkow. 1993. Attaching and effacing locus of a

Citrobacter freundii biotype that causes transmissible murine colonic hyperplasia.

Infect. Immun. 61:2486-2492.

191. Schembri, M. A., G. Christiansen, and P. Klemm. 2001. FimH-mediated

autoaggregation of Escherichia coli. Mol. Microbiol. 41:1419-1430.

192. Schlosser-Silverman, E., M. Elgrably-Weiss, I. Rosenshine, R. Kohen, and S.

Altuvia. 2000. Characterization of Escherichia coli DNA lesions generated within

J774 macrophages. J. Bacteriol. 182:5225-5230.

193. Schmidt, H., H. Karch, and L. Beutin. 1994. The large-sized plasmids of

enterohemorrhagic Escherichia coli O157 strains encode hemolysins which are

presumably members of the E. coli a-hemolysin family. FEMS Microbiol. Lett.

117:189-196.

194. Schmidt H, Beutin L, Karch H. 1995. Molecular analysis of the plasmid-encoded

hemolysin of Escherichia co/i 0157:H7 strain EDL 933. Infect. Immun. 63:1055-l

061.

195. Schmidt, H., and H. Karch. 1996a. Enterohemolytic phenotypes and genotypes of

Shiga toxin-producing Escherichia co/i 0111 strains from patients with diarrhea and

hemolytic uremic syndrome. J. Clin. Microbial. 34:2364-2367.

196. Schmidt, H., C. Kernbach, and H. Karch. 1996b. Analysis of the EHEC hly

operon and its location in the physical map of the large plasmid of

enterohaemorrhagic Escherichia coli O157:H7. Microbiology 142:907-914.

197. Schmidt H, B. Henkel, and H. Karch. 1997. A gene cluster closely related to type

II secretion pathway operons of Gram-negative bacteria is located on a large

158

plasmid of enterohemorrhagic Escherichia co/f 0167 strains. FEMS Microbial. Lett.

148:265-272.

198. Scotland, S. M., S. Knutton, B. Said, and B. Rowe. 1994. Adherence to Caco-2

cells of Vero cytotoxin-producing strains of Escherichia coli belonging to

serogroups other than O157, p. 257–260. In M. A. Karmali and A. G. Goglio (ed.),

Recent advances in verocytotoxin-producing Escherichia coli infections. Elsevier

Science B.V., Amsterdam, The Netherlands.

199. Shaw R. K., K. Smollett, J. Cleary, J. Garmendia, A. Straatman-Iwanowska, G.

Frankel, and S. Knutton. 2005. Enteropathogenic Escherichia coli type III

effectors EspG and EspG2 disrupt the microtubule network of intestinal epithelial

cells. Infect. Immun. 73:4385-4390.

200. Shaw, R. K., S. Daniell, F. Ebel, G. Frankel, and S. Knutton. 2001. EspA

filament-mediated protein translocation into red blood cells. Cell. Microbiol. 3:213-

222.

201. Shevchenko, A., M. Wilm, O. Vorm, and M. Mann. 1996. Mass spectrometric

sequencing of proteins from silver-stained polyacrylamide gels. Anal. Chem.

68:850-858.

202. Shimizu, T., K. Shima, K. Yoshino, K. Yonezawa, T. Shimizu, and H. Hayashi.

2002. Proteome and transcriptome analysis of the virulence genes regulated by the

VirR/VirS system in Clostridium perfringens. J. Bacteriol. 184:2587-2594.

203. Siegler, R. L., P. M. Griffin, T. J. Barrett, and N. A. Strockbine. 1993.

Recurrent hemolytic uremic syndrome secondary to Escherichia coli O157:H7

infection. Pediatrics 91:666-668.

204. Siegler, R. L. 1995. The hemolytic uremic syndrome. Pediatr. Clin. North. Am.

42:1505-1529.

205. Sohel, I., J. L. Puente, S. W. Ramer, D. Bieber, C. Y. Wu, and G. K. Schoolnik.

1996. Enteropathogenic Escherichia coli: identification of a gene cluster coding for

bundle-forming pilus morphogenesis. J. Bacteriol. 178:2613-2628.

206. Stein, M., B. Kenny, M. A. Stein, and B. B. Finlay. 1996. Characterization of

EspC, a 110-kilodalton protein secreted by enteropathogenic Escherichia coli which

159

is homologous to members of the immunoglobulin A protease-like family of

secreted proteins. J. Bacteriol. 178:6546-6554.

207. Stone, K. D., H. Z. Zhang, L. K. Carlson, and M. S. Donnenberg. 1996. A

cluster of fourteen genes from enteropathogenic Escherichia coli is sufficient for

the biogenesis of a type IV pilus. Mol. Microbiol. 20:325-337.

208. Tacket, C. O., M. B. Sztein, G. Losonsky, A. Abe, B. B. Finlay, B. P.

McNamara, G. T. Fantry, S. P. James, J. P. Nataro, M. M. Levine, and M. S.

Donnenberg, 2000. Role of EspB in experimental human enteropathogenic

Escherichia coli infection. Infect. Immun. 68:3689-3695.

209. Tampakaki, A., V. Fadouloglou, A. Gazi, N. Panopoulos, and M. Kokkinidis.

2004. Conserved features of type III secretion. Cell. Microbiol. 6:805-816.

210. Taylor, C. J., A. Hart, R. M. Batt, C. McDougall, and L. McLean. 1986.

Ultrastructural and biochemical changes in human jejunal mucosa associated with

enteropathogenic Escherichia coli (O111) infection. J. Pediatr. Gastroenterol. Nutr.

5:70-73.

211. Taylor, K. A., C. B. O’Connell, P. W. Luther, and M. S. Donnenberg. 1998.

The EspB protein of enteropathogenic Escherichia coli is targeted to the cytoplasm

of infected HeLa cells. Infect. Immun. 66:5501-5507.

212. Thomas, N.A., W. Deng , J. L. Puente, E. A. Frey, C. K. Yip, N. C. Strynadka,

and B. B. Finlay. 2005. CesT is a multi-effector chaperone and recruitment factor

required for the efficient type III secretion of both LEE- and non-LEE-encoded

effectors of enteropathogenic Escherichia coli. Mol Microbiol. 57:1762-1779.

213. Tobe, T., and C. Sasakawa. 2002. Species-specific cell adhesion of

enteropathogenic Escherichia coli is mediated by type IV bundle-forming pili. Cell.

Microbiol. 4:29-42.

214. Tomson, F.L., V. K. Viswanathan, K. J. Kanack, R. P. Kanteti, K. V. Straub,

M. Menet, J. B. Kaper, and G. Hecht. 2005. Enteropathogenic Escherichia coli

EspG disrupts microtubules and in conjunction with Orf3 enhances perturbation of

the tight junction barrier. Mol. Microbiol. 56:447-464.

215. Torres, A. G., and S. M. Payne. 1997. Haem iron-transport system in

enterohaemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 23:825-833.

160

216. Totten, P. A., J. C. Lara, and S. Lory. 1990. The rpoNrpoN gene product of

Pseudomonas is required for expression of diverse genes, including the flagellin

gene. J. Bacteriol. 172:389-396.

217. Tu, X., I. Nisan, C. Yona, E. Hanski, and I. Rosenshine. 2003. EspH, a new

cytoskeleton-modulating effector of enterohaemorrhagic and enteropathogenic

Escherichia coli. Mol. Microbiol. 47:595-606.

218. Ueno, T., K. Oosawa, and S. Aizawa. 1994. Domain structures of the MS ring

component protein (FliF) of the flagellar basal body of Salmonella typhimurium. J.

Mol. Biol. 236:546-555.

219. Ulshen, M. H., and J. L. Rollo. 1980. Pathogenesis of Escherichia coli

gastroenteritis in man—another mechanism. N. Engl. J. Med. 302:99-101.

220. Vallance B. A., C. Chan, M. L. Robertson, and B. B. Finlay. 2002.

Enteropathogenic and enterohemorrhagic Escherichia coli infections: emerging

themes in pathogenesis and prevention. Can. J. Gastroenterol. 16:771-778.

221. Viljanen, M. K., T. Peltola, S. Y. T. Junnila, L. Olkkonen, H. Ja¨rvinen, M.

Kuistila, and P. Huovinen. 1990. Outbreak of diarrhoea due to Escherichia coli

O111:B4 in schoolchildren and adults: association of Vi antigen-like reactivity.

Lancet. 336:831-834.

222. Viswanathan, V. K., A. Koutsouris, S. Lukic, M. Pilkinton, I. Simonovic, M.

Simonovic, and G. Hecht. 2004. Comparative analysis of EspF from

enteropathogenic and enterohemorrhagic Escherichia coli in alteration of epithelial

barrier. Infect. Immun. 72:3218-3227.

223. Wachter, C., C. Beinke, M. Mattes, and M. A. Schmidt. 1999. Insertion of EspD

into epithelial target cell membranes by infecting enteropathogenic Escherichia coli.

Mol. Microbiol. 31:1695-1707.

224. Wai, S. N., A. Takade, and K. Amako. 1996. The hydrophobic surface protein

layer of enteroaggregative Escherichia coli strains. FEMS Microbiol. Lett. 135:17-

22.

225. Wainwright, L. A., and J. B. Kaper. 1998. EspB and EspD require a specific

chaperone for proper secretion from enteropathogenic Escherichia coli.

Mol. Microbiol. 27:1247-1260.

161

226. Waldor M. K., and J. J. Mekalanos. 1996. Lysogenic conversion by a filamentous

phage encoding cholera toxin. Science. 272:1910-1914.

227. Warawa, J., B. B. Finlay, and B. Kenny. 1999. Type III secretion-dependent

hemolytic activity of enteropathogenic Escherichia coli. Infect. Immun. 67: 5538-

5540.

228. Wolff, C., I. Nisan, E. Hanski, G. Frankel, and I. Rosenshine. 1998. Protein

translocation into host epithelial cells by infecting enteropathogenic Escherichia

coli. Mol. Microbiol. 28:143-155.

229. Wu, S. X., and R. Q. Peng. 1992. Studies on an outbreak of neonatal diarrhea

caused by EPEC O127:H6 with plasmid analysis restriction analysis and outer

membrane protein determination. Acta Paediatr. Scand. 81:217-221.

230. Yaron, S., G. L. Kolling, L. Simon, and K. R. Matthews. 2000. Vesicle-mediated

transfer of virulence genes from Escherichia coli O157:H7 to other enteric bacteria.

Appl. Environ. Microbiol. 66:4414-4420.

231. Yip, C. K., T. G. Kimbrough, H. B. Felise, M. Vuckovic, N. A. Thomas, R. A.

Pfuetzner, E. A. Frey, B. B. Finlay, S. I. Miller, and N. C. Strynadka. 2005.

Structural characterization of the molecular platform for type III secretion system

assembly. Nature. 435:702-707.

232. Yip, C. K., and N. C. Strynadka. 2006. New structural insights into the bacterial

type III secretion system. Trends. Biochem. Sci. 31:223-230.

233. Yona-Nadler, C., T. Umanski, S. Aizawa, D. Friedberg, and I. Rosenshine.

2003. Integration host factor (IHF) mediates repression of flagella in

enteropathogenic and enterohaemorrhagic Escherichia coli. Microbiology 149:877-

884.

234. Yoshioka, K, K. Yagi, N. Moriguchi. 1999. Clinical features and treatment of

children with hemolytic uremic syndrome caused by enterohemorrhagic

Escherichia coli O157:H7 infection: experience of an outbreak in Sakai City, 1996.

Pediatr. Int. 41:223-227.

235. Yu, J., and J. B. Kaper. 1992. Cloning and characterization of the eae gene of

enterohaemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 6:411-417.

162

236. Zhang, H. Z., S. Lory, and M. S. Donnenberg. 1994. A plasmid-encoded prepilin

peptidase gene from enteropathogenic Escherichia coli. J. Bacteriol. 176:6885-6891.

237. Zhang, H. Z., and M. S. Donnenberg. 1996. DsbA is required for stability of the

type IV pilin of enteropathogenic Escherichia coli. Mol. Microbiol. 21:787-797.

238. Zhou, X., J. A. Giron, A. G. Torres, J. A. Crawford, E. Negrete, S. N. Vogel,

and J. B. Kaper. 2003. Flagellin of enteropathogenic Escherichia coli stimulates

interleukin-8 production in T84 cells. Infect. Immun. 71:2120-2129.

239. Zhu, C., J. Harel, M. Jacques, C. Desautels, M. S. Donnenberg, M. Beaudry,

and J. M. Fairbrother. 1994. Virulence properties and attachingeffacing activity

of Escherichia coli O45 from swine postweaning diarrhea. Infect. Immun. 62:4153-

4159.