ARTHRITIS & RHEUMATISMVol. 60, No. 2, February 2009, pp 513–523DOI 10.1002/art.24258© 2009, American College of Rheumatology

Prostaglandin E2 and Its Cognate EP Receptors ControlHuman Adult Articular Cartilage Homeostasis and

Are Linked to the Pathophysiology of Osteoarthritis

Xin Li,1 Michael Ellman,1 Prasuna Muddasani,1 James H.-C. Wang,2 Gabriella Cs-Szabo,1

Andre J. van Wijnen,3 and Hee-Jeong Im4

Objective. To elucidate the pathophysiologiclinks between prostaglandin E2 (PGE2) and osteoarth-ritis (OA) by characterizing the catabolic effects ofPGE2 and its unique receptors in human adult articularchondrocytes.

Methods. Human adult articular chondrocyteswere cultured in monolayer or alginate beads with andwithout PGE2 and/or agonists of EP receptors, antago-nists of EP receptors, and cytokines. Cell survival,proliferation, and total proteoglycan synthesis andaccumulation were measured in alginate beads.Chondrocyte-related gene expression and phosphatidyl-inositol 3-kinase/Akt signaling were assessed by real-time reverse transcription–polymerase chain reactionand Western blotting, respectively, using a monolayercell culture model.

Results. Stimulation of human articular chondro-cytes with PGE2 through the EP2 receptor suppressedproteoglycan accumulation and synthesis, suppressedaggrecan gene expression, did not appreciably affectexpression of matrix-degrading enzymes, and decreasedthe type II collagen:type I collagen ratio. EP2 and EP4receptors were expressed at higher levels in knee carti-lage than in ankle cartilage and in a grade-dependent

manner. PGE2 titration combined with interleukin-1(IL-1) synergistically accelerated expression of pain-associated molecules such as inducible nitric oxide syn-thase and IL-6. Finally, stimulation with exogenousPGE2 or an EP2 receptor–specific agonist inhibitedactivation of Akt that was induced by insulin-like growthfactor 1.

Conclusion. PGE2 exerts an antianabolic effecton human adult articular cartilage in vitro, and EP2and EP4 receptor antagonists may represent effectivetherapeutic agents for the treatment of OA.

Osteoarthritis (OA) is a disabling disease that ishighly prevalent in elderly patients (1). It is a complexprocess involving a combination of cartilage degrada-tion, repair, and inflammation, and its pathogenesis isnot yet fully understood. Normal articular chondrocytesmaintain a dynamic equilibrium between synthesis anddegradation of extracellular matrix (ECM) components,which includes type II collagen fibrils surrounding andrestraining large, hydrated aggregates of the proteogly-can aggrecan, allowing normal cartilage to functionas a natural “shock absorber” and withstand compressiveloads (2). However, in OA, there is a disruption of thematrix equilibrium leading to progressive loss of carti-lage tissue. Chondrocyte metabolism is unbalanced dueto excessive production of catabolic factors, includingmatrix metalloproteinases (MMPs), aggrecanases(ADAMTS), and other cytokines and growth factorsreleased by chondrocytes that aid in the destruction ofproteoglycans and the ECM (3–6). Recently, synovialinflammation has been found to contribute to the patho-genesis of OA via the release of catabolic and proinflam-matory mediators that alter matrix homeostasis (7).Some studies have shown increased expression of pro-inflammatory proteins in human OA joint cartilage

Supported by the Falk Foundation. Dr. Im’s work was sup-ported by a grant from the NIH (R01-AR-053220).

1Xin Li, MD, PhD, Michael Ellman, MD, Prasuna Mud-dasani, PhD, Gabriella Cs-Szabo, PhD: Rush University MedicalCenter, Chicago, Illinois; 2James H.-C. Wang, PhD: University ofPittsburgh, Pittsburgh, Pennsylvania; 3Andre J. van Wijnen, PhD:University of Massachusetts Medical School, Worcester; 4Hee-JeongIm, PhD: Rush University Medical Center, Chicago, Illinois, andUniversity of Illinois at Chicago.

Address correspondence and reprint requests to Hee-JeongIm, PhD, Rush University Medical Center, Cohn Research BD 516,1735 West Harrison Street, Chicago, IL 60612. E-mail: Hee-Jeong_Sampen@rush.edu.

Submitted for publication May 1, 2008; accepted in revisedform October 17, 2008.

513

compared with normal cartilage (8), and others haverevealed a correlation between increased expression ofinflammatory mediators and degradation of cartilagematrix macromolecules (9).

Prostaglandins are proinflammatory lipid media-tors that are locally increased in the synovial membraneand synovial fluid of patients with OA (8). The role ofprostaglandins in the metabolism of articular cartilageis still a matter of debate. Some reports indicate thatprostaglandins participate in the destruction of articularcartilage by degrading cartilage ECM (10,11), whileothers show that they promote chondrogenesis andterminal differentiation (12,13). The opposing biologicroles attributed to these compounds is a direct reflectionof the molecular complexity of prostaglandins and theirunique cognate receptors (14).

Prostaglandin E2 (PGE2) is one of the majorcatabolic mediators involved in cartilage degradationand the progression of OA (15–17). PGE2 is a prosta-noid derived from arachidonic acid that is released frommembranes by phospholipase A2. In the initial step inprostaglandin biosynthesis, arachidonic acid is metabo-lized by cyclooxygenase activity to form PGH2, which issubsequently metabolized by prostaglandin E synthaseto form PGE2 (18). Previous studies have shown thatPGE2 is involved in inflammation, apoptosis, and angio-genesis (19,20). However, the precise biologic role ofPGE2 in articular cartilage is still unclear. PGE2 hasbeen associated with structural changes seen in OAtissues (21) and has been characterized as a catabolicmediator in cartilage homeostasis (10,15–17). In contrast,others have demonstrated an anabolic effect of PGE2 inarticular cartilage (22,23). The PGE2-mediated signal istransduced by 4 different EP receptor subtypes (EP1–EP4) that cause distinct and sometimes opposing effectson cell metabolism, depending on the cell/tissue types(23), and at this point, it is not clear which of these EPreceptor subtypes contribute to the pathogenesis of OA.

In this study, we demonstrated the pathophysio-logic links between PGE2 and OA. We also identifiedwhich specific EP receptors may be responsible for thebiologic effect of PGE2 in human articular cartilage, andwe elucidated which of these receptors may contributeto the generation of OA symptoms via stimulation ofnociceptive pathways in arthritic joints.

MATERIALS AND METHODS

Synovial fluid analysis. Human synovial fluid wasaspirated within 24 hours of death from the knee joints of 9asymptomatic human organ donors with no history of joint

diseases (ages 45–60 years, with grade 0/1 degeneration) usingapproved institutional protocols (Gift of Hope Organ andTissue Donor Network, Elmhurst, IL). Synovial fluid was alsoobtained with appropriate consent from 8 OA patients (ages50–65 years, with advanced OA requiring surgery) and 18patients with rheumatoid arthritis (RA) (ages 50–65 years)from the Rush University Section of Rheumatology who wereundergoing diagnostic or therapeutic arthrocentesis. The levelof PGE2 was measured by enzyme-linked immunosorbentassay (ELISA; R&D Systems, Minneapolis, MN) in standardcurve units of pg/ml following the instructions provided by themanufacturer.

Chondrocyte isolation and culture. Human articularcartilage from knee or ankle was obtained from tissue donorsthrough the Gift of Hope Organ and Tissue Donor Network.Each donor specimen was graded for gross degenerativechanges based on a modified version of the 5-point scale ofCollins (24). The cells were released by enzymatic digestion aspreviously described (25,26). Alginate beads and monolayerswere made for long-term and short-term analysis, respectively.For alginate bead culture, grade 0 or 1 knee chondrocytes wereisolated and resuspended in 1.2% alginate, and beads wereformed using a CaCl2 solution, as previously described (27).Cells were treated with PGE2 (Sigma, St. Louis, MO), EP2receptor–specific agonist (Butaprost; Cayman Chemical, AnnArbor, MI), EP3 receptor–specific agonist (Sulprostone;Sigma), and interleukin-1 (IL-1; Amgen, Thousand Oaks, CA),a well-known catabolic cytokine used for control.

For monolayer culture, isolated chondrocytes werecounted and plated onto 12-well plates at 8 � 105/cm2 aspreviously described (5,25). Cells were treated with PGE2,basic fibroblast growth factor (bFGF), insulin-like growthfactor 1 (IGF-1; Austral Biologicals, San Ramon, CA), EP2receptor–specific agonist, EP3 receptor–specific agonist, EP1/2antagonist AH6809 (Sigma), EP1 antagonist SC19220 (Sigma),EP4 antagonist AH23848 (Sigma), and IL-1. Cells were har-vested at different time points and subjected to Westernblotting as described below. Cells were treated for 24 hoursbefore total RNA harvesting.

Real-time reverse transcription–polymerase chain re-action (RT-PCR). Total RNA was isolated using TRIzolreagent (Invitrogen, Carlsbad, CA) following the instructionsprovided by the manufacturer. RT was carried out with 1 �gtotal RNA using the ThermoScript RT-PCR system (Invitro-gen) for first-strand complementary DNA (cDNA) synthesis.For real-time RT-PCR, cDNA was amplified using the MyiQReal-Time PCR Detection System (Bio-Rad, Hercules, CA).Relative messenger RNA (mRNA) expression was determinedusing the ��Ct method, as detailed by the manufacturer(Bio-Rad). GAPDH was used as internal control. The devia-tions in samples represent 3 different donors in 3 separateexperiments. The primer sequences and their conditions foruse are summarized in Table 1.

Dimethylmethylene blue (DMMB) assay for proteogly-can production and DNA assay for cell numbers. On day 21 ofculture, the alginate beads were collected and processed forproteoglycan assays using the DMMB assay, as previouslydescribed (27). The proteoglycan levels measured in the cell-associated matrix were quantified per DNA to give the totalamount of proteoglycans produced and retained in the alginatebeads per cell (25). Using PicoGreen (Molecular Probes,

514 LI ET AL

Carlsbad, CA), cell numbers were determined by assay of totalDNA in the cell pellets, as previously described (25).

35S-sulfate incorporation into newly synthesized pro-teoglycans. On day 7 of culture in alginate, the medium wasremoved and replaced by fresh medium. One hour later, thismedium was replaced with fresh medium containing 35S-sulfate at 20 �Ci/ml (Amersham, Arlington Heights, IL). After4 hours of incubation, the labeling medium was removed, andbeads were rinsed and dissolved to separate out the cell-associated matrix and digested with papain (20 �g/ml in 0.1Msodium acetate, 0.05M EDTA, pH 5.53). Sulfate incorporationinto proteoglycans was measured using the Alcian blue precip-itation method (28). All samples were analyzed in duplicateand normalized for DNA content using Hoechst 33258 aspreviously described (28).

Western blotting. Cell and tissue lysates were preparedusing modified radioimmunoprecipitation assay buffer as pre-viously described (6). Protein was resolved by 10% sodiumdodecyl sulfate–polyacrylamide gels and transferred to nitro-cellulose membrane for Western blot analyses as previouslydescribed (5).

Statistical analysis. Analysis of variance was per-formed using StatView 5.0 software (SAS Institute, Cary, NC).P values less than 0.05 were considered significant.

RESULTS

PGE2 is up-regulated in arthritic joints andsuppresses proteoglycan in human articular chondro-cytes via inhibition of aggrecan gene expression. Syno-vial fluid collected from knee joints of asymptomatic(normal) donors or from RA or OA patients wassubjected to ELISA to assess endogenous levels of PGE2

(Figure 1A). Compared with normal joints, the levels ofPGE2 were at least 2 times higher in patients with OAand RA, with a greater effect seen in OA synovial fluid,suggesting a pathologic role of PGE2 in human kneejoints.

To assess the biologic impact of PGE2 on humanarticular cartilage, chondrocytes isolated from knee car-tilage (grade 0/1) were encapsulated in 3-dimensional(3-D) alginate beads in the presence or absence of PGE2

and analyzed for proteoglycan accumulation and synthe-sis (Figure 1B). In our initial studies (data not shown),�100 nM PGE2 significantly decreased (P � 0.05) theamount of proteoglycan accumulation per cell without

Table 1. Primer sequences for reverse transcription–polymerase chain reaction

Gene Primer sequence, 5� to 3� Size, bpAnnealing

temperature, °CEMBL

accession no.

GAPDH Forward: TCGACAGTCAGCCGCATCTTCTTT 148 55 NM_002046Reverse: GCCCAATACGACCAAATCCGTTGA

Aggrecan Forward: TCTTGGAGAAGGGAGTCCAACTCT 89 55 NM_013227Reverse: ACAGCTGCAGTGATGACCCTCAGA

MMP-13 Forward: AGTTTGCAGAGCGCTACCTGAGAT 145 55 NM_002427Reverse: TCGTCAAGTTTGCCAGTCACCTCT

MMP-14 Forward: TCAAGGCCAATGTTCGAAGGAAGC 125 55 NM_004995Reverse: AATGGCCTCGTATGTGGCATACTC

MMP-1 Forward: AGTGACTGGGAAACCAGATGCTGA 162 55 NM_002421Reverse: GCTCTTGGCAAATCTGGCGTGTAA

MMP-3 Forward: GCGTGGATGCCGCATATGAAGTTA 127 55 NM_002422Reverse: AAACCTAGGGTGTGGATGCCTCTT

EP1 Forward: TTGTCGGTATCATGGTGGTGTCGT 160 67 NM_000955Reverse: ATGTACACCCAAGGGTCCAGGAT

EP2 Forward: TATCATGACCATCACCTTCGCCGT 105 57 NM_000956Reverse: TCTAAGAGCTTGGAGGTCCCACTT

EP3 Forward: TGGATCCTTGGGTTTACCTGCTGT 96 57 NM_198712Reverse: AGGTGGAGCTGGATGCATAGTTGT

EP4 Forward: TGGTCATCTTACTCATCGCCACCT 154 67 NM_000958Reverse: TTCACAGAAGCAATTCGGATGGCC

ADAMTS-4 Forward: CTTCTTCTTGGAGCCAATGATGCG 134 55 NM_005099Reverse: ACTGGGCTACTACTATGTGCTGGA

ADAMTS-5 Forward: CTGTGACGGCATCATTGGCTCAAA 139 55 NM_007038Reverse: TTCAGGAATCCTCACCACGTCAGT

IL-6 Forward: AAGCCAGAGCTGTGCAGATGAGTA 117 55 NM_000600Reverse: TTCGTCAGCAGGCTGGCATTTGT

Type I collagen Forward: GGCAGACCTTGCAATCCATTGTGT 180 55 NM_000089Reverse: GGCAAACATGGAAACCGTGGTGAA

Type II collagen Forward: TGCTGTTCTTGCAGTGGTAGGTGA 193 65 NM_033150Reverse: AGAAGAACTGGTGGAGCAGCAAGA

PGE2 AND EP RECEPTORS IN OA 515

noticeable changes in cellular proliferation and survival.Therefore, PGE2 was used at a concentration of 1 �M insubsequent in vitro studies to maximize the biologiceffect (Figure 1B, top). Further, to determine whetherthe reduction in proteoglycan accumulation was medi-ated by PGE2-dependent inhibition of synthesis, theincorporation of 35S-sulfate by articular chondrocytesinto proteoglycans was quantified. Proteoglycan synthe-sis was indeed suppressed in the presence of PGE2(Figure 1B, bottom), suggesting that PGE2 contributesto imbalanced cartilage homeostasis.

Using real-time RT-PCR, we investigatedwhether PGE2 suppresses aggrecan gene expression(Figure 1C) and/or increases matrix-degrading enzymeexpression (Figure 1D), thereby accelerating proteogly-can depletion. IL-1 and bFGF were used in parallel ascatabolic experimental controls (5). Compared withuntreated (control) chondrocytes, treatment of chondro-cytes with 1 �M PGE2 significantly decreased the aggre-can mRNA level by 60% (Figure 1C), and this suppres-sion was similar to that seen after treatment with IL-1and bFGF. Surprisingly, the presence of PGE2 failed toup-regulate matrix-degrading enzymes, includingMMP-1, MMP-3, MMP-13, MMP-14, ADAMTS-4, andADAMTS-5 (29) (Figure 1D), while stimulation withboth bFGF (100 ng/ml) and IL-1 (10 ng/ml), which are

well-known stimulators of cartilage-degrading enzymeexpression (5,6), significantly increased expression ofthese genes. Taken together, these results demonstratethat PGE2 inhibits proteoglycan production mainly bydown-regulating the expression of matrix components(e.g., aggrecan), with minimal effects on the expressionof cartilage-degrading enzymes.

Expression of EP receptors in human adult ar-ticular cartilage. To identify which of the 4 EP receptorsare expressed in normal human articular cartilage, weperformed real-time RT-PCR experiments using totalRNA extracted from grade-matched (0 or 1) and age-matched (25–40 years) knee and ankle articular carti-lage. The EP2 and EP4 receptors were most prominentlyexpressed in both knee and ankle cartilage (Figure 2A),and knee cartilage expressed strikingly higher mRNAlevels of the EP2 and EP4 receptors compared withankle cartilage. Based on these findings, we investigatedthe pathogenic links of EP2 and EP4 receptors in theprogression of OA by monitoring their expression pat-terns in progressively degenerated (grades 0/1, 2, and 3)or OA cartilage (Figure 2B). Age-matched (25–40 years)ankle cartilage (grades 0/1, 2, and 3) and knee cartilage(grade 1 and OA) were analyzed by real-time RT-PCR.In ankle cartilage, grade 2 tissue exhibited a �2-foldincrease in the basal expression of EP2 and EP4 recep-

Figure 1. Up-regulated prostaglandin E2 (PGE2) expression in human arthritic joints, and suppression of proteoglycan accumulation and synthesisvia inhibition of aggrecan expression. A, The concentration of PGE2 was measured by enzyme-linked immunosorbent assay in synovial fluid samplesobtained from asymptomatic donors (normal) or from patients with osteoarthritis (OA) or rheumatoid arthritis (RA). B, Top, Chondrocytes werecultured in alginate beads. The amount of proteoglycan in the cell-associated matrix was measured by dimethylmethylene blue (DMMB) assay andnormalized to cell numbers as determined by assay of total DNA in the cell pellets after 21 days of culture. Bottom, Proteoglycan synthesis wasmeasured during the last 4 hours of culture using 35S-sulfate incorporation on day 7 of culture and was normalized to cell numbers by DNA assay(cpm/DNA). Results are expressed as the percentage of control. C and D, Human adult articular chondrocytes were treated with or without 1 �MPGE2, 100 ng/ml basic fibroblast growth factor (bFGF), or 10 ng/ml interleukin-1 (IL-1). After 24 hours of treatment, total RNA was extracted toperform real-time reverse transcription–polymerase chain reaction. Genes for aggrecan (C) and for matrix metalloproteinases (MMPs) 1, 3, 13, and14 and ADAMTS-4 and ADAMTS-5 (D) were detected. Values are the mean and SEM. � � P � 0.05; �� � P � 0.01 versus normal or versus control,by analysis of variance.

516 LI ET AL

tors compared with grade 0/1 cartilage, and this induc-tion was grade dependent, since grade 3 cartilage exhib-ited a �10-fold increase in both EP2 and EP4 receptorexpression compared with control (Figure 2B, top).Similar grade-dependent results were obtained usingknee cartilage (Figure 2B, bottom). Western blot analy-sis (Figure 2C) corroborated these observations, reveal-ing increased EP2 and EP4 receptor protein expressionin OA compared with grade 0/1 knee cartilage.

The biologic effects of PGE2 are mediated byactivation of the EP2 receptor. In arthritic joints (both inOA and in RA), expression of catabolic factors such asPGE2 (see Figure 1A), bFGF (4), and IL-1 (30) issignificantly increased. Therefore, we determined whichof the 4 EP receptors were most responsive to theseexogenous stimuli in human articular chondrocytes.Cells (grade 1) from the knee in monolayer were chal-lenged with PGE2 (1 �M), bFGF (100 ng/ml), or IL-1(10 ng/ml) for 24 hours, and the stimulatory effects onexpression of EP receptors were analyzed by real-timeRT-PCR (Figure 3A). The EP2 and EP4 receptors werethe most responsive to all exogenous catabolic stimuli.More specifically, the presence of PGE2, bFGF, andIL-1 stimulated EP2 receptor expression 2-, 3.5-, and

4.8-fold, respectively, while EP4 receptor expression wasincreased 3-, 5-, and 3-fold, respectively, compared withuntreated controls. In contrast, changes in the expres-sion of the EP1 or EP3 receptor were negligible.

Based on these observations, we further analyzedthe contribution of the EP2 receptor to proteoglycanaccumulation (Figure 3B), aggrecan gene expression(Figure 3C), and collagen production (Figure 3D). Hu-man adult articular chondrocytes encapsulated in 3-Dalginate beads were cultured for 21 days in the presenceor absence of Butaprost (an EP2 receptor–specific ago-nist), Sulprostone (an EP3 receptor–specific agonist),or IL-1 (positive control). Treatment of cells with Buta-prost (1 �M) significantly decreased (P � 0.05) theamount of proteoglycan accumulation per cell without anoticeable change in cellular proliferation and survival(data not shown), and this suppressive effect was similarto that seen after stimulation with PGE2 and IL-1(Figure 3B). In contrast, activation of EP3 receptor bySulprostone had no significant effect on proteoglycanaccumulation. Further, real-time RT-PCR results dem-onstrated that treatment of chondrocytes with Butaprostled to a dose-dependent decrease in aggrecan geneexpression (Figure 3C). Together, these results suggest

Figure 2. Expression of EP receptors in human adult articular cartilage. Human articular cartilage total RNA from the knee and ankle was isolatedand analyzed for basal levels of the 4 EP receptors in each type of cartilage using real-time reverse transcription–polymerase chain reaction.A, Age-matched grade 0 or 1 (G:0/1) ankle and knee tissues were compared. B, Increasing grades of age-matched ankle (top) and knee (bottom)tissues were also compared (error bar represents 3 different donors). Values in A and B are the mean � SEM. C, Total protein from grade 0 or 1knee cartilage (from 2 donors ages 50–60 years) and osteoarthritic (OA) cartilage (results representative of 3 donors ages 50–65 years; OA tissueobtained at surgery) was isolated and analyzed for EP2 and EP4 receptor protein expression by Western blotting.

PGE2 AND EP RECEPTORS IN OA 517

that the PGE2-mediated suppression of proteoglycanproduction and aggrecan gene expression occurs via theEP2 receptor, and this receptor may be an importantinitiator of the PGE2 signaling pathway in human artic-ular cartilage.

The ratio of type II collagen to type I collagen isan important factor for the proper function of maturearticular cartilage. In this study, we investigated whetherPGE2 and activation of EP receptors have a biologicinfluence on modulating this ratio. Our real-time RT-PCR results showed that both PGE2 and Butaprostdecreased levels of type I collagen and type II collagen(data not shown) compared with untreated controls.Interestingly, the ratio of expression of type II collagento type I collagen was decreased by Butaprost and to alesser extent by PGE2 (Figure 3D), suggesting a dualrole for PGE2 activation of the EP2 receptor suppres-sion of proteoglycan synthesis/production coupled with adecrease in the type II collagen:type I collagen ratio.

Synergistic effect of the combination of PGE2

and IL-1 on expression of IL-6 and inducible nitricoxide synthase (iNOS). Both NO and IL-6 are known toplay an important role in cartilage metabolism and maymediate pain signaling (31–33). We therefore examinedthe relationship between PGE2, IL-6, and iNOS, a generesponsible for the production of NO, in human articu-lar chondrocytes (grade 1) from the knee. After costimu-

lation with PGE2 and IL-1, the induction of IL-6 mRNAlevels was dramatic, showing synergistic up-regulationby a factor of 33 compared with untreated controlchondrocytes, significantly higher than that with stimu-lation with either factor alone (Figure 4A). Synergisticaugmentation of iNOS was also observed when cellswere stimulated with a combination of PGE2 and IL-1,despite a modest reduction in iNOS mRNA expressionafter treatment with PGE2 alone (Figure 4B). Thesestriking results demonstrate a robust biologic correlationbetween PGE2 and the pain mediators IL-6 and NO thatmay reflect regulatory interplay between PGE2 and painpathways in articular cartilage.

PGE2 suppresses the phosphatidylinositol3-kinase (PI 3-kinase)/Akt pathway via the EP2 recep-tor. To characterize the intracellular signaling pathwaysthat modulate proteoglycan expression in response toPGE2, we determined the effects of PGE2 on Akt phos-phorylation at serine residue 473, since stimulation ofthe PI 3-kinase/Akt pathway is required for productionof proteoglycan by chondrocytes in response to IGF-1.When given exogenous PGE2, various cell types havedifferent effects on the PI 3-kinase/Akt pathway througheither an up-regulation (34,35) or a down-regulation(36,37) of Akt phosphorylation. Thus, we exploredwhether the PGE2-mediated proteoglycan loss was asso-ciated with inhibition of the PI 3-kinase/Akt pathway

Figure 3. Biologic effects of PGE2 mediated by EP2 receptor activation. A, Human adult articular chondrocytes were treated with or without 1 �MPGE2, 100 ng/ml bFGF, or 10 ng/ml IL-1 for 24 hours. EP receptor gene expression was analyzed using real-time reverse transcription–polymerasechain reaction (RT-PCR). B, Cells were cultured in alginate beads for 21 days either in serum-free medium with mini-ITS� (insulin–transferrin–selenium) or in control medium plus 1 �M Butaprost (EP2 receptor–specific agonist), 1 �M Sulprostone (EP3 receptor–specific agonist), 1 �MPGE2, or 1 ng/ml of IL-1. The amount of proteoglycan in the cell-associated matrix was measured by DMMB assay and normalized to cell numbers,as determined by assay of total DNA in the cell pellets after 21 days of culture. Samples were expressed as the percentage of the day 21 control.Error bars represent 3 different donors in 3 separate experiments. C, Cells were treated with 1 �M PGE2 and 1 or 2 �M Butaprost for 24 hours.Aggrecan mRNA gene expression was analyzed by real-time RT-PCR. D, Real-time RT-PCR was performed to analyze the expression of type Icollagen and type II collagen after stimulation with 1 �M PGE2 or 2 �M Butaprost. The type II collagen:type I collagen expression ratio wasanalyzed. Values are the mean and SEM. � � P � 0.05; �� � P � 0.01 versus control, by analysis of variance. See Figure 1 for other definitions.

518 LI ET AL

and, if so, whether the EP2 receptor was responsible forthe biologic consequences.

Our Western blot results showed that PGE2

inhibited Akt phosphorylation in �5 minutes withoutaffecting total Akt levels (Figure 5A). Stimulation of theEP2 receptor (with Butaprost), but not the EP3 receptor

Figure 4. Synergistic effect of the combination of PGE2 and IL-1 on gene expression of IL-6 and inducible nitric oxide synthase (iNOS). Humanadult articular chondrocytes were treated with or without PGE2 (10 nM), IL-1 (1 ng/ml), or PGE2 plus IL-1 for 24 hours. Relative expression of IL-6(A) and iNOS (B) mRNA levels was analyzed using real-time reverse transcription–polymerase chain reaction. Values are the mean and SEM.�� � P � 0.01 versus control, by analysis of variance. See Figure 1 for other definitions.

Figure 5. Prostaglandin E2 (PGE2) suppression of the phosphatidylinositol 3-kinase/Akt pathway. A, Human adult articular chondrocytes werestimulated with PGE2 for 5, 15, 30, or 60 minutes, and phospho-Akt and total Akt protein were assessed by Western blotting (exposure time 10minutes). B, Cells were stimulated for 15 minutes (exposure time 10 minutes) with 1 �M PGE2, 1 �M Butaprost (EP2 receptor–specific agonist),or 1 �M Sulprostone (EP3 receptor–specific agonist), or with 1 �M PGE2 plus 10 �M AH6809 (EP1/2 antagonist), 1 �M PGE2 plus 10 �M SC19220(EP1 antagonist), or 1 �M PGE2 plus 10 �M AH23848 (EP4 antagonist). C, Cells were stimulated for 15 minutes with 1 ng/ml of insulin-like growthfactor 1 (IGF-1) or with 1 ng/ml of IGF-1 plus 1 or 5 �M PGE2, and the cell lysates were analyzed by Western blotting with anti–phospho-Akt atserine residue 473 and anti–total Akt antibodies (exposure time 1 second).

PGE2 AND EP RECEPTORS IN OA 519

(with Sulprostone), also decreased phosphorylation ofthe Akt pathway (Figure 5B). A combination of PGE2

with an EP1/2 antagonist, but not with an EP1 antago-nist or an EP4 antagonist, rescued the PGE2-inducedsuppression of the Akt pathway (Figure 5B). Further,coincubation of cells with PGE2 in the presence ofIGF-1 revealed that PGE2 inhibited not only basal levelsof Akt, but also the IGF-1–activated Akt pathway whichis required for chondrocytic anabolism by IGF-1 (38).This PGE2-mediated attenuation of the IGF-1–inducedAkt pathway was dose dependent (Figure 5C). Collec-tively, these results suggest that PGE2-mediated sup-pression of the PI 3-kinase/Akt pathway occurs via theEP2 receptor and may play a role in the suppression ofproteoglycan production.

DISCUSSION

This study reveals a significant correlation be-tween arthritic joint diseases and PGE2-responsive sig-naling pathways in human articular cartilage. We dem-onstrated that PGE2 functions antianabolically in articularcartilage by suppressing aggrecan synthesis and totalproteoglycan accumulation, while only minimally stimu-lating the expression of cartilage-degrading enzymes(MMPs, ADAMTS). Equally important, this study pro-vides the first evidence that the EP2 receptor is a majormediator of PGE2-induced suppression of proteoglycanaccumulation in human adult articular chondrocytes.Signaling through the EP2 receptor also decreased thetype II collagen:type I collagen ratio to render the ECMless chondrocytic and more fibroblast-like. Further-more, PGE2 suppressed PI 3-kinase/Akt signaling viathe EP2 receptor, which may be associated with PGE2-dependent suppression of aggrecan expression. We alsoprovide support for the novel mechanistic concept thatPGE2 may modulate pain generation in arthritic jointsby up-regulating IL-6 and iNOS expression in humanarticular cartilage.

The biologic activities of PGE2 in articular carti-lage have sparked controversy over its precise role inmatrix metabolism. Depending on the experimentalsystem tested and the receptors utilized, PGE2 has beenfound to exert both anabolic and catabolic effects onarticular cartilage. For example, PGE2 was shown toexert chondroprotective effects in resting zone chondro-cytes (13), human synovial fibroblasts (22), and at lowconcentrations in human OA explants (39) and has beenfound to down-regulate matrix-degrading enzymes(MMP-1) in human chondrocytes (40). In contrast, otherstudies suggest that PGE2 elicits a major catabolic

response that perturbs cartilage homeostasis (10,15,16).During inflammatory states, elevated production ofPGE2 causes cartilage resorption by decreasing cellularproliferation, inhibiting aggrecan synthesis, and potentiat-ing the effects of other inflammatory factors, such as IL-1(9,16,41). PGE2 has also been correlated with increasedMMP production in various tissues, including humanarticular chondrocytes (42) and OA cartilage explants(43).

The results from our study suggest an anti-anabolic role of PGE2 in human adult articular chon-drocytes in vitro via down-regulation of aggrecan geneexpression and proteoglycan accumulation and synthe-sis, which support the findings of Hardy and colleagues,who reported that PGE2 production from human syno-vial tissue corresponds to decreased proteoglycan accu-mulation (15). In addition, we suggest that PGE2 doesnot modulate the expression of representative cartilage-degrading enzymes (e.g., MMPs 1, 3, 13, and 14 as well asADAMTS-4 and ADAMTS-5) and that, instead, it exertsits effects primarily by inhibiting aggrecan biosynthesis.

The actions of PGE2 depend on the expression ofseveral distinct EP receptor subtypes on the cell surface,eliciting either catabolic or anabolic effects on cartilagehomeostasis (44). EP1 receptors have been found toincrease differentiation in growth plate chondrocytes(45), while EP2 and EP4 receptors have been associatedwith both anabolic and catabolic effects in cartilage(44,46). Aoyama and colleagues reported that EP2 andEP3 are highly expressed in human and mouse articularchondrocytes, and PGE2 signals through EP2 to pro-mote cell growth (14). However, based on our results, weconclude that EP2 and EP4, rather than EP3, are mostabundantly expressed in human articular cartilage. Thisdifference may perhaps be attributed to age variationsbetween cartilage samples, since we used adult cartilagesamples from normal and degenerative articular carti-lage, while Aoyoma and colleagues studied normal carti-lage from 4 individuals of various ages (6, 10, 39, and 69years). Thus, while EP2 and EP4 were highly expressedin our cartilage samples, EP3 was only minimally ex-pressed but may be more prevalent in cartilage of ayounger age.

Another intriguing finding of our study is that theEP2 receptor plays a pivotal biologic role in articularcartilage homeostasis. EP2, which functions in an auto-crine and/or paracrine manner, transduces the PGE2signal to suppress aggrecan expression in human articu-lar chondrocytes. In addition, this receptor is involvedin the PGE2-mediated decrease in the type II collagen:type I collagen ratio in human cartilage. During the

520 LI ET AL

progression of OA in arthritic tissues, a decrease in thisratio is linked to perturbations in cartilage homeostasis(47), indicating a pathogenic role for ECM replacementthrough type I collagen. This idea is consistent with find-ings suggesting that bFGF stimulates cell proliferation incartilage tissue and decreases the type II collagen:type Icollagen expression ratio (Im HJ: unpublished data).Replacement of type II collagen by type I collagen maylead to the formation of fibrocartilage rather than thestronger, more durable hyaline cartilage of a healthyjoint. Our current results indicate that inhibition ofPGE2/EP2 receptor signaling may be beneficial fortherapy by antagonizing the suppression of aggrecanproduction and avoiding collagen substitution, therebypreserving stronger hyaline cartilage and mitigating itsdegeneration.

Our data reveal striking differences in both basaland PGE2-induced expression of the EP2 and EP4 re-ceptors between knee and ankle cartilage (age and gradematched). Because of the longstanding clinical observa-tions that some joints (e.g., knee) are more susceptibleto OA than others (e.g., ankle) (1) and that EP2 andEP4 are more abundant in the knee than in the ankle,we suggest that the PGE2/EP2 and/or PGE2/EP4 signal-ing pathways may be clinically involved in the onset andprogression of OA. Further, we suggest that the cata-bolic activity of PGE2 in articular cartilage may bebiologically linked to pain symptoms associated with OAin human joints. Pain pathways have been linked toincreased levels of IL-6 and NO in mammalian kneejoints (32,33). Indeed, our studies show that the expres-sion of both IL-6 and iNOS is synergistically increased byPGE2 and IL-1. Thus, our results indicate that PGE2may participate in the generation of pain symptoms inhuman OA via activation of its cognate EP2 and EP4receptors, leading to up-regulation of both IL-6 and iNOS.

We have also shown that stimulation of humanarticular chondrocytes with PGE2 suppresses Akt phos-phorylation, which may be associated with decreasedproteoglycan accumulation (38). Our data provide thefirst experimental evidence that exogenous PGE2 inhib-its the phosphorylation of Akt via the EP2 receptor inhuman articular chondrocytes. Taken together with thefindings of Starkman and colleagues (38), we suggest thatPGE2-mediated activation of the EP2 receptor blocksAkt phosphorylation and subsequently suppresses pro-teoglycan synthesis. This inhibition can be effectivelyreversed by an EP2 antagonist, revealing the potentialuse of EP2 antagonists in the prevention of proteoglycandepletion found in arthritic cartilage.

One important limitation of this study must be

taken into account. The present study used concentra-tions of PGE2 in the micromolar range, and theseconcentrations are considerably higher than those foundin endogenous samples in vivo (nanomolar range). Forexample, the endogenous range of PGE2 concentrationsin synovial fluid measured in previous studies by ELISAvaries from 10 pg/ml to 700 pg/ml (20 nM) (48,49).However, for in vitro studies, we and others (35,40) usedPGE2 concentrations significantly higher than the re-ported physiologic concentrations. These differences sug-gest that the currently available in vitro cell cultureexperimental models for OA apparently cannot yetfaithfully recapitulate biologic responses with physio-logic doses of agents detected in synovial fluid. Severalparameters may contribute to the necessity to use agentsin vitro in excess of their physiologic concentrationsin vivo. For example, like cytokines and growth factors,PGE2 operates in concert with other factors to exert itsbiologic effects, and absence of these factors in vitro maydiminish its efficacy. Alternatively, the effects of PGE2may be masked in vitro by secreted inhibitory compo-nents that accumulate in the culture media. It is alsopossible that the specific activity of the exogenouslyadministered PGE2 is less than that of the same com-pound present endogenously in synovial fluid. Regard-less of these possibilities, however, the concentrationused in the current studies yielded informative resultsand permitted meaningful interpretations that increaseour understanding of the biologic effect of PGE2 and itscognate EP receptors in both in vitro and ex vivo cellculture systems.

In summary, we have defined the role of PGE2 asa potent antianabolic factor at a dose of 1 �M in humanadult articular cartilage via the suppression of proteo-glycan synthesis and aggrecan gene expression. EP2 andEP4 are the predominantly expressed receptors in hu-man articular chondrocytes and appear to be responsiveto exogenous stimuli, such as PGE2 and other cataboliccytokines, suggesting that these receptors may be impor-tant signaling initiators of the PGE2 signaling cascadesand may serve as a potential target for therapeutic regi-mens aimed at preventing progression of arthritis dis-ease in the future. Our findings also provide one plau-sible mechanism for why certain joints (knees) are moresusceptible to OA than others (ankles), since EP2 andEP4 receptors are highly up-regulated in knee cartilagecompared with ankle cartilage. We further propose thatPGE2 may mediate pain pathways in articular cartilagevia a synergistic stimulatory effect along with the pro-inflammatory cytokine IL-1 on both IL-6 and iNOSexpression. Further investigation should be pursued to

PGE2 AND EP RECEPTORS IN OA 521

help gain a better understanding of the specific signalingcascades governing the complex interactions betweenPGE2 and EP receptors in human articular chondrocytesboth in vitro and in vivo.

ACKNOWLEDGMENTS

We would like to thank the tissue donors, Dr. ArkadyMargulis, and the Gift of Hope Organ and Tissue DonorNetwork for tissue samples. We thank Dr. Joel Block (Sectionof Rheumatology, Rush University Medical Center) for syno-vial fluids obtained from OA and RA patients. We also thankthe National Cancer Institute for supporting this study byproviding bFGF.

AUTHOR CONTRIBUTIONS

Dr. Im had full access to all of the data in the study and takesresponsibility for the integrity of the data and the accuracy of the dataanalysis.Study design. Li, Im.Acquisition of data. Li, Ellman, Muddasani, Cs-Szabo, Im.Analysis and interpretation of data. Li, Ellman, Muddasani, Wang,Cs-Szabo, van Wijnen, Im.Manuscript preparation. Li, Ellman, van Wijnen, Im.Statistical analysis. Li, Ellman, Im.

REFERENCES

1. Buckwalter JA, Saltzman C, Brown T. The impact of osteoarthri-tis: implications for research. Clin Orthop Relat Res 2004;427Suppl:S6–15.

2. Nakata K, Ono K, Miyazaki J, Olsen BR, Muragaki Y, Adachi E,et al. Osteoarthritis associated with mild chondrodysplasia intransgenic mice expressing �1(IX) collagen chains with a centraldeletion. Proc Natl Acad Sci U S A 1993;90:2870–4.

3. Martel-Pelletier J, Welsch DJ, Pelletier JP. Metalloproteases andinhibitors in arthritic diseases. Best Pract Res Clin Rheumatol2001;15:805–29.

4. Im HJ, Li X, Muddasani P, Kim GH, Davis F, Rangan J, et al.Basic fibroblast growth factor accelerates matrix degradation via aneuro-endocrine pathway in human adult articular chondrocytes.J Cell Physiol 2008;215:452–63.

5. Im HJ, Muddasani P, Natarajan V, Schmid TM, Block JA, DavisF, et al. Basic fibroblast growth factor stimulates matrix metallo-proteinase-13 via the molecular cross-talk between the mitogen-activated protein kinases and protein kinase C� pathways inhuman adult articular chondrocytes. J Biol Chem 2007;282:11110–21.

6. Muddasani P, Norman JC, Ellman M, van Wijnen AJ, Im HJ.Basic fibroblast growth factor activates the MAPK and NF�Bpathways that converge on Elk-1 to control production of matrixmetalloproteinase-13 by human adult articular chondrocytes.J Biol Chem 2007;282:31409–21.

7. Sutton S, Clutterbuck A, Harris P, Gent T, Freeman S, Foster N,et al. The contribution of the synovium, synovial derived inflam-matory cytokines and neuropeptides to the pathogenesis of osteo-arthritis. Vet J 2007. E-pub ahead of print.

8. Amin AR, Dave M, Attur M, Abramson SB. COX-2, NO, andcartilage damage and repair. Curr Rheumatol Rep 2000;2:447–53.

9. Kim HA, Cho ML, Choi HY, Yoon CS, Jhun JY, Oh HJ, et al. Thecatabolic pathway mediated by Toll-like receptors in humanosteoarthritic chondrocytes. Arthritis Rheum 2006;54:2152–63.

10. Fulkerson JP, Damiano P. Effect of prostaglandin E2 on adult pigarticular cartilage slices in culture. Clin Orthop Relat Res 1983:266–9.

11. Lippiello L, Yamamoto K, Robinson D, Mankin HJ. Involvementof prostaglandins from rheumatoid synovium in inhibition ofarticular cartilage metabolism. Arthritis Rheum 1978;21:909–17.

12. Clark CA, Schwarz EM, Zhang X, Ziran NM, Drissi H, O’KeefeRJ, et al. Differential regulation of EP receptor isoforms duringchondrogenesis and chondrocyte maturation. Biochem BiophysRes Commun 2005;328:764–76.

13. Miyamoto M, Ito H, Mukai S, Kobayashi T, Yamamoto H,Kobayashi M, et al. Simultaneous stimulation of EP2 and EP4 isessential to the effect of prostaglandin E2 in chondrocyte differ-entiation. Osteoarthritis Cartilage 2003;11:644–52.

14. Aoyama T, Liang B, Okamoto T, Matsusaki T, Nishijo K, Ishibe T,et al. PGE2 signal through EP2 promotes the growth of articularchondrocytes. J Bone Miner Res 2005;20:377–89.

15. Hardy MM, Seibert K, Manning PT, Currie MG, Woerner BM,Edwards D, et al. Cyclooxygenase 2–dependent prostaglandin E2modulates cartilage proteoglycan degradation in human osteo-arthritis explants. Arthritis Rheum 2002;46:1789–803.

16. Martel-Pelletier J, Pelletier JP, Fahmi H. Cyclooxygenase-2 andprostaglandins in articular tissues. Semin Arthritis Rheum 2003;33:155–67.

17. Mathy-Hartert M, Burton S, Deby-Dupont G, Devel P, ReginsterJY, Henrotin Y. Influence of oxygen tension on nitric oxide andprostaglandin E2 synthesis by bovine chondrocytes. OsteoarthritisCartilage 2005;13:74–9.

18. Smith WL, Garavito RM, DeWitt DL. Prostaglandin endoperox-ide H synthases (cyclooxygenases)-1 and -2. J Biol Chem 1996;271:33157–60.

19. Matsuoka T, Narumiya S. Prostaglandin receptor signaling indisease. ScientificWorldJournal 2007;7:1329–47.

20. Quinn JH, Bazan NG. Identification of prostaglandin E2 andleukotriene B4 in the synovial fluid of painful, dysfunctionaltemporomandibular joints. J Oral Maxillofac Surg 1990;48:968–71.

21. Laufer S. Role of eicosanoids in structural degradation in osteo-arthritis. Curr Opin Rheumatol 2003;15:623–7.

22. DiBattista JA, Martel-Pelletier J, Fujimoto N, Obata K, Zafa-rullah M, Pelletier JP. Prostaglandins E2 and E1 inhibit cytokine-induced metalloprotease expression in human synovial fibroblasts:mediation by cyclic-AMP signalling pathway. Lab Invest 1994;71:270–8.

23. Largo R, Diez-Ortego I, Sanchez-Pernaute O, Lopez-Armada MJ,Alvarez-Soria MA, Egido J, et al. EP2/EP4 signalling inhibitsmonocyte chemoattractant protein-1 production induced by inter-leukin 1� in synovial fibroblasts. Ann Rheum Dis 2004;63:1197–204.

24. Muehleman C, Bareither D, Huch K, Cole AA, Kuettner KE.Prevalence of degenerative morphological changes in the joints ofthe lower extremity. Osteoarthritis Cartilage 1997;5:23–37.

25. Im HJ, Pacione C, Chubinskaya S, van Wijnen AJ, Sun Y, LoeserRF. Inhibitory effects of insulin-like growth factor-1 and osteo-genic protein-1 on fibronectin fragment- and interleukin-1�-stimulated matrix metalloproteinase-13 expression in human chon-drocytes. J Biol Chem 2003;278:25386–94.

26. Loeser RF, Todd MD, Seely BL. Prolonged treatment of humanosteoarthritic chondrocytes with insulin-like growth factor-I stim-ulates proteoglycan synthesis but not proteoglycan matrix accumu-lation in alginate cultures. J Rheumatol 2003;30:1565–70.

27. Gruber HE, Hoelscher GL, Leslie K, Ingram JA, Hanley EN Jr.Three-dimensional culture of human disc cells within agarose ora collagen sponge: assessment of proteoglycan production. Bio-materials 2006;27:371–6.

28. Loeser RF, Shanker G, Carlson CS, Gardin JF, Shelton BJ,Sonntag WE. Reduction in the chondrocyte response to insulin-like growth factor 1 in aging and osteoarthritis: studies in a

522 LI ET AL

non-human primate model of naturally occurring disease. ArthritisRheum 2000;43:2110–20.

29. Iannone F, Lapadula G. The pathophysiology of osteoarthritis.Aging Clin Exp Res 2003;15:364–72.

30. De Isla NG, Yang JW, Huselstein C, Muller S, Stoltz JF. IL-1�synthesis by chondrocyte analyzed by 3D microscopy and flowcytometry: effect of Rhein. Biorheology 2006;43:595–601.

31. Burke JG, Watson RW, McCormack D, Dowling FE, Walsh MG,Fitzpatrick JM. Intervertebral discs which cause low back painsecrete high levels of proinflammatory mediators. J Bone JointSurg Br 2002;84:196–201.

32. Brenn D, Richter F, Schaible HG. Sensitization of unmyelinatedsensory fibers of the joint nerve to mechanical stimuli by interleu-kin-6 in the rat: an inflammatory mechanism of joint pain.Arthritis Rheum 2007;56:351–9.

33. Castro RR, Cunha FQ, Silva FS Jr, Rocha FA. A quantitativeapproach to measure joint pain in experimental osteoarthritis—evidence of a role for nitric oxide. Osteoarthritis Cartilage 2006;14:769–76.

34. Vassiliou E, Sharma V, Jing H, Sheibanie F, Ganea D. Prosta-glandin E2 promotes the survival of bone marrow-derived den-dritic cells. J Immunol 2004;173:6955–64.

35. Aoudjit L, Potapov A, Takano T. Prostaglandin E2 promotes cellsurvival of glomerular epithelial cells via the EP4 receptor. Am JPhysiol Renal Physiol 2006;290:F1534–42.

36. Lu J, Lu Z, Reinach P, Zhang J, Dai W, Lu L, et al. TGF-�2inhibits AKT activation and FGF-2-induced corneal endothelialcell proliferation. Exp Cell Res 2006;312:3631–40.

37. Meng ZX, Sun JX, Ling JJ, Lv JH, Zhu DY, Chen Q, et al.Prostaglandin E2 regulates Foxo activity via the Akt pathway:implications for pancreatic islet beta cell dysfunction. Diabetologia2006;49:2959–68.

38. Starkman BG, Cravero JD, Delcarlo M, Loeser RF. IGF-I stimu-lation of proteoglycan synthesis by chondrocytes requires activa-tion of the PI 3-kinase pathway but not ERK MAPK. Biochem J2005;389(Pt 3):723–9.

39. Tchetina EV, Di Battista JA, Zukor DJ, Antoniou J, Poole AR.Prostaglandin PGE2 at very low concentrations suppresses colla-gen cleavage in cultured human osteoarthritic articular cartilage:this involves a decrease in expression of proinflammatory genes,

collagenases and COL10A1, a gene linked to chondrocyte hyper-trophy. Arthritis Res Ther 2007;9:R75.

40. Fushimi K, Nakashima S, Banno Y, Akaike A, Takigawa M,Shimizu K. Implication of prostaglandin E2 in TNF-�-inducedrelease of m-calpain from HCS-2/8 chondrocytes: inhibition ofm-calpain release by NSAIDs. Osteoarthritis Cartilage 2004;12:895–903.

41. Martel-Pelletier J, Mineau F, Fahmi H, Laufer S, Reboul P,Boileau C, et al. Regulation of the expression of 5-lipoxygenase–activating protein/5-lipoxygenase and the synthesis of leukotrieneB4 in osteoarthritic chondrocytes: role of transforming growthfactor � and eicosanoids. Arthritis Rheum 2004;50:3925–33.

42. Bunning RA, Russell RG. The effect of tumor necrosis factor �and �-interferon on the resorption of human articular cartilageand on the production of prostaglandin E and of caseinase activityby human articular chondrocytes. Arthritis Rheum 1989;32:780–4.

43. Amin AR, Attur M, Patel RN, Thakker GD, Marshall PJ, RediskeJ, et al. Superinduction of cyclooxygenase-2 activity in humanosteoarthritis-affected cartilage: influence of nitric oxide. J ClinInvest 1997;99:1231–7.

44. Narumiya S, Sugimoto Y, Ushikubi F. Prostanoid receptors: struc-tures, properties, and functions. Physiol Rev 1999;79:1193–226.

45. Sylvia VL, Del Toro F Jr, Hardin RR, Dean DD, Boyan BD,Schwartz Z. Characterization of PGE2 receptors (EP) and theirrole as mediators of 1�,25-(OH)2D3 effects on growth zonechondrocytes. J Steroid Biochem Mol Biol 2001;78:261–74.

46. Zeng L, An S, Goetzl EJ. EP4/EP2 receptor-specific prostaglandinE2 regulation of interleukin-6 generation by human HSB.2 earlyT cells. J Pharmacol Exp Ther 1998;286:1420–6.

47. Miosge N, Hartmann M, Maelicke C, Herken R. Expression ofcollagen type I and type II in consecutive stages of humanosteoarthritis. Histochem Cell Biol 2004;122:229–36.

48. Duffy T, Belton O, Bresnihan B, FitzGerald O, FitzGerald D.Inhibition of PGE2 production by nimesulide compared withdiclofenac in the acutely inflamed joint of patients with arthritis.Drugs 2003;63 Suppl 1:31–6.

49. Kaneyama K, Segami N, Sato J, Fujimura K, Nagao T, YoshimuraH. Prognostic factors in arthrocentesis of the temporomandibularjoint: comparison of bradykinin, leukotriene B4, prostaglandin E2,and substance P level in synovial fluid between successful andunsuccessful cases. J Oral Maxillofac Surg 2007;65:242–7.

DOI 10.1002/art.24437Search for Next Editor, Arthritis & Rheumatism (2010–2015 Term)

The American College of Rheumatology Committee on Journal Publications announces the search for theposition of Editor, Arthritis & Rheumatism. The official term of the next Arthritis & Rheumatism editorship isJuly 1, 2010–June 30, 2015; however, some of the duties of the new Editor will begin during a transitionperiod starting April 1, 2010. ACR members who are considering applying should submit a nonbinding letterof intent by April 1, 2009 to the Managing Editor, Jane Diamond, at jdiamond@rheumatology.org, and arealso encouraged to contact the current Editor, Dr. Michael Lockshin, to discuss details; initial contact shouldbe made via e-mail to AREditor@hss.edu. Potential applicants should be aware that there is flexibilityregarding the model of interaction between the Editor’s institution and the ACR. Applications will be due June1, 2009 and will be reviewed during the summer of 2009. Application materials will be made available in early2009; an announcement will appear on the ACR home page when application materials have becomeavailable.

PGE2 AND EP RECEPTORS IN OA 523