PROPERTIES OF AN INTERGENIC TERMINATOR AND START ...

PROPERTIES OF AN INTERGENIC TERMINATOR AND START

SITE SWITCHING THAT REGULATES IMD2 TRANSCRIPTION IN

YEAST

M. Harley Jenks#, Thomas W. O’Rourke

#, and Daniel Reines*

Department of Biochemistry, Emory University School of Medicine

Atlanta, GA 30322

Word count: Materials & Methods-948

Word count: Intro, Results, Discussion-4,718

Running Title: regulated start site selection and termination

#These authors contributed equally to this work.

*Corresponding author

Phone: 404-727-3361

FAX 404-727-2538

Email: [email protected]

ACCEPTED

Copyright © 2008, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Mol. Cell. Biol. doi:10.1128/MCB.00380-08 MCB Accepts, published online ahead of print on 21 April 2008

on April 11, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

2

SUMMARY

The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine

nucleotides. Regulation is exerted through the choice of alternative transcription start sites that

results in synthesis of either an unstable short transcript terminating upstream of the start codon

or a full length productive IMD2 mRNA. Start site selection is dictated by the intracellular

guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream,

unstable short transcripts that form a heterogeneous family of RNAs of …200 nt. The switch

from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II.

The enzyme’s ability to locate the downstream initiation site decreased exponentially as the start

was moved downstream from the TATA box. This suggests that RNA polymerase II’s pincer

grip is important as it slides on DNA in search of a start site. Exosome degradation of the

upstream transcripts was highly dependent upon the distance between the terminator and the

promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the

promoter. These findings extend the emerging concept that distinct modes of termination by

RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its

sequence, is important for the pathway chosen. ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

3

INTRODUCTION

A large number of short RNAs that do not code for proteins have been identified in

eukaryotic cells. In Saccharomyces cerevisiae many of these are found between conventional

mRNA-encoding transcription units; some of these play a regulatory function in controlling

adjacent gene activity (Martens et al., 2004; Davis and Ares, 2006; Steinmetz et al., 2006b).

IMD2 encodes IMP dehydrogenase, an enzyme important for de novo synthesis of guanine

nucleotides. Its transcription is strongly induced when intracellular guanine nucleotide pools are

depleted by drugs such as mycophenolate and 6-azauracil (Shaw and Reines, 2000; Escobar-

Henriques and Daignan-Fornier, 2001; Hyle et al., 2003). This response enables cells to

maintain adequate guanine nucleotide pools and survive drug exposure. A transcription unit

upstream of IMD2 that generates a short, unstable, non-coding RNA was discovered following

inactivation of an RNA degradation system known as the nuclear exosome (Davis and Ares,

2006). The presence of a transcriptional terminator between the upstream transcription unit and

the downstream unit encoding IMD2 mRNA was inferred in a genome-wide analysis of RNA

polymerase II density on yeast chromosomes (Steinmetz et al., 2006b). Comparison of wildtype

and sen1 mutant strains revealed a downstream shift in RNA polymerase II density toward the

IMD2 ORF, suggestive of terminator readthrough (Steinmetz et al., 2006b) since SEN1 encodes

an essential helicase known to be involved in transcription termination (Steinmetz and Brow,

1996; Rasmussen and Culbertson, 1998; Steinmetz et al., 2001; Steinmetz et al., 2006a; Kim et

al., 2006). Furthermore, there is a regulated shift from a set of upstream transcription start sites

(Fig. 1, thin arrows) to a single downstream adenine start site (Fig. 1, thick arrow) when levels of

intracellular guanine nucleotides become depleted (Davis and Ares, 2006; Steinmetz et al.,

2006b; Kuehner and Brow, manuscript submitted). Under guanine-replete conditions, the

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

4

upstream start predominates and transcription terminates before the IMD2 ORF is reached,

resulting in production of a short, non-coding RNA. This ‘intergenic’ transcript is rapidly

degraded in an exosome-dependent manner (Davis and Ares, 2006). Under guanine-depleted

conditions, the start site downstream of the termination region is used resulting in full length

IMD2 mRNA encoding IMP dehydrogenase. Deletion or mutation of the terminator region

(previously referred to at the Repressive Element; underlined in Fig. 1) was shown to de-repress

IMD2 expression enabling its transcription even when guanine is plentiful (Shaw et al., 2001;

Escobar-Henriques-Henriques and Daignan-Fornier, 2001). As well, the terminator region

possesses autonomous terminator function when placed downstream of a promoter where it can

generate polyadenylated transcripts (Kopcewicz et al., 2007). This terminator is unusual in that

it overlaps the transcription start site employed when IMD2 transcription is induced by low

guanine nucleotide levels (Fig. 1). This explains why it is required to maintain the repressed

state of the IMD2 ORF since when this DNA is deleted or mutated, transcription reads into the

IMD2 ORF from the upstream start events that are normally aborted by termination when

guanine levels are adequate. Here we will refer to this novel terminator as the intergenic-IMD2

terminator (IT) because it is responsible for the formation of a discrete intergenic transcript.

Termination by RNA polymerase II is poorly understood. For conventional terminators

at the end of mRNA transcription units, RNA polymerase II ceases elongation and disengages

from chromatin in a manner coupled to the processing of the 3’-end of the RNA; i.e. cleavage of

the primary transcript and its polyadenylation (reviewed in Buratowski, 2005; Rosonina et al.,

2006). Recent evidence suggests there is more than one mechanism of transcription termination

by RNA polymerase II, depending upon the gene being transcribed. Small nuclear (sn) and

nucleolar (sno) RNAs which are relatively short and are not polyadenylated in their mature form,

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

5

employ an alternative system that involves the Sen1 helicase and the Nrd1 and Nab3 RNA

binding proteins (Steinmetz et al., 2001; Kim et al., 2006; Steinmetz et al., 2006a). An

additional set of components appears to be shared by the two termination/processing systems

including Pcf11, Rna14, Rna15, and Ssu72 (Steinmetz and Brow, 2003; Rosonina et al., 2006;

Arigo et al., 2006; Kim et al., 2006; Lykke-Anderson and Jensen, 2007). One determinant of the

termination mechanism to be employed is the distance between the termination region from the

transcription start site (Steinmetz et al., 2006a; Kopciewicz et al., 2007).

Recent evidence indicates that termination of one group of short non-coding RNAs is

coupled to their rapid degradation by the exosome (Arigo et al., 2006; Thiebaut et al., 2006;

Vasiljeva and Buratowski, 2006). The terminator at the end of the transcription unit upstream of

IMD2 appears to fall into this class (Davis and Ares, 2006; Steinmetz et al., 2006b; Kopciewicz

et al., 2007). Previous results suggested that Nrd1-dependent termination is most active at a

short distance from the transcription start site; whereas conventional cleavage and

polyadenylation operate at more distal downstream sites such as those at the end of protein-

encoding mRNAs (Steinmetz et al., 2006a).

Here we explore the requirements for termination at the intergenic-IMD2 terminator and

compare it with the canonical terminator/polyadenylation site found at the end of the CYC1 gene.

The RNA generated by the intergenic-IMD2 terminator is rapidly degraded by the nuclear

exosome, a phenomenon seen only when the sequence is placed close to a promoter. In contrast,

the CYC1 terminator yields a stable RNA even when close to the promoter. As well, the

intergenic-IMD2 terminator is highly Sen1-dependent compared to the CYC1 terminator.

Grafting a portion of the intergenic-IMD2 terminator containing a Nab3 consensus site onto the

CYC1 terminator enhanced its exosome-sensitivity. Increasing the distance between the

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

6

upstream start sites and the terminator resulted in longer intergenic terminated transcripts and

prevented use of the downstream start site, consistent with a model in which RNA polymerase II

scans along DNA for a start site. Furthermore, the guanine regulated shift from the upstream to

downstream start sites was highly dependent upon the Rpb9 subunit of RNA polymerase II,

accounting for the extreme drug-sensitivity of cells lacking this RNA polymerase II subunit and

emphasizing the importance of RNA polymerase II’s “jaw” in grasping DNA during

translocation.

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

7

MATERIALS AND METHODS

Plasmid Construction: The plasmids pGAlLuc, pREFXba-Luc, pRERXba-Luc, pREFBstEII-Luc

and pRERBstEII-Luc have been previously described by our lab (Shaw et al., 2001; Kopcewicz

2007). The lambda insertion family of plasmids were derived from pRS316-IMD2-BsiWImut

which was made by mutagenesis using mismatch oligonucleotides 5’-

gcttacattttacctcgtacgctgggaacc-3’ and 5’-ggttcccagcgtacgaggtaaaatgtataagc-3’ to introduce a

BsiWI restriction site … 180 bp upstream of the start codon in plasmid pRS316-IMD2 (Hyle et

al., 2003). pRS316-IMD2-24bpn, pRS316-IMD2-36bpn, pRS316-IMD2-45bpn, pRS316-

IMD2-103bpn, pRS316-IMD2-153bpn, and pRS316-IMD2-218bpn were made by inserting

HaeIII or BstUI digested lambda DNA of less than 250 bp into pRS316-IMD2-BsiWImut cut

with BstWI and filled in with DNA polymerase. A distribution of clones with increasing insert

sizes were selected for confirmation by sequencing.

A DNA duplex encoding the 5’ end of the IT and the CYC1 transcription terminator was

cut with XbaI and inserted into similarly cut pGalLuc to create pChimera1-F-XbaLuc. This

chimeric piece of DNA was made by annealing 5’-

agctcatctagattccgtattctattctattccttgccttacttttcttattattttctatttatttttt-3’ and

gatcgatctagagtataatgttacatgcgtacacgcgtctgtacagaaaaaaaagaaaaatttgaaatataaataacgttcttaatactaacata

actataaaaaaataaata-3’ and extending each primer via mutually primed synthesis with T4 DNA

polymerase. The same product in the opposite orientation was also inserted into pGalLuc to

form pChimera1-R-XbaLuc. The plasmid pCYC1TT-F-XbaLuc was made by inserting an XbaI

digested PCR product encoding the CYC1 transcription terminator region into XbaI cut pGalLuc.

The PCR product was generated from pYES2 (Invitrogen) using the primers 5’-

agctcatctagagacaacctgaagtctagg-3 ’ and 5’-gatcgatctagagtataatgttacatgcgt-3’. A similar BsiWI-

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

8

digested PCR product was generated from pCYC1TT-F-XbaLuc using the oligonucleotides 5’-

agctcacgtacggacaacctgaagtctagg-3’ and 5’-gatcgacgtacggtataatgttacatgcgt-3’ for insertion of the

CYC1 terminator into the BsiWI site of pGalLuc to form pCYC1TT-F-BsiLuc. The plasmid

pChimera-F-BsiLuc was assembled by inserting a BsiWI-digested PCR product made off

pChimera1-F-XbaLuc with primers 5’-agctcacgtacgttccgtattctattctat-3’ and 5’-

gatcgacgtacggtataatgttacatgcgt-3’.

The plasmid pGalNabMutXba-F-Luc was made by inserting into XbaI-digested pGalLuc

an XbaI-digested PCR product with the IT containing a site directed mutation of the putative

Nab3 site. This PCR product was generated from plasmid pREFXbaLuc using 5’-

agctcatctagattccgtattctattctattccttgccttactttagttattattttc-3’ which contains the mutation and 5’-

gatcgatctagaaacaaaatgcgtttatgacag-3’.

Strains: Strains DY682-DY689 were made by transforming wildtype and sen1E1597K

strains (46a

and sen1E1597K

; D. Brow, U. Wisconsin, Madison) with the plasmids pREFXbaLuc,

pRERXbaLuc, pREFBstLuc, and pRERBstLuc as indicated in Table I. DY695 was constructed

by transforming Open Biosystems’ FRRP6 yeast strain (YSC1021-551682) with the IMD2 gene

disruption cassette from pUC19-IMD2KO (Hyle et al., 2003). Integration of the IMD2 knockout

was confirmed by sequencing of PCR products. Strains DY1701-1708 were made by

transformation of DY695 with the indicated plasmids (Table I) using the lithium acetate method

(Gietz et al., 1992). DY1562 and DY1563 were made by transforming the plasmid

pGalNabMutXba-F-Luc into BY4741 and YSC1021-551682, respectively.

PolyA analysis: To identify the polyA addition sites we used a derivative of the rapid

amplification of cDNA ends-polyA test (RACE-PAT) assay (Salles et al., 1999). Total RNA

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

9

from the rrp6F-strain YSC1021-551682 (Open Biosystems, Inc.) was reverse transcribed with

Moloney murine leukemia virus reverse transcriptase and the oligo-dT-anchor oligonucleotide,

5’-gggaattcgacctcgtcttgcaccttgaagttttcctgttttttttttttttt-3. After heat inactivation of the enzyme, this

cDNA was amplified by PCR using an anchor oligonucleotide 5’-gggaattcgacctcgtcttgcacc-3’,

and an IT-specific oligonucleotide 5’-cgggatccttccgtattctattctattccttgc-3’, digested with EcoRI

and BamHI, ligated into similarly cut pBluescript-KS (Stratagene, Inc.), and transformed into E.

coli. Plasmid was prepared from insert-containing transformants and sequenced.

RNA and Northern blots: Cells were grown in liquid media, collected in the logarithmic growth

phase, washed once with water, and frozen. Total RNA was isolated from thawed cell pellets by

hot acid phenol extraction and quantified by measuring absorbance at 260 nm. Total RNA (15-

30 µg) was resolved on a 1% (w/v) agarose-formaldehyde gel and blotted onto Zeta-probe GT

nylon (Bio-Rad) or Hybond XL (Amersham). Filters were baked at 85°C for 2 h and then pre-

hybridized for a minimum of 3h at 42°C in 5x SSC (1x SSC = 0.15 M NaCl, 0.015 M sodium

citrate), 5X Denhardt's solution, 50% (v/v) formamide, 1% (w/v) SDS, and 100 µg/ml salmon

sperm DNA. Filters were hybridized under the same conditions with 50 oCi of 32

P-labeled DNA

probe for 4h at 30°. Filters were washed at least twice at 42°C in 2x SSC/0.1% SDS for 15 min

each. Washed filters were exposed to Kodak X-Omat or Pierce CL–Xposure film or for

quantification, a phosphorimager screen read by a Fujix BAS1000. Probes were labeled with

Klenow DNA polymerase (NEB), random hexamer primers, and [c/32P]-dATP (Amersham

Biosciences or Perkin-Elmer). For probing transcripts from the GAL1 promoter-terminator

plasmids, a promoter proximal PCR probe was generated from pGalLuc (Shaw et al., 2001)

using the primers 5'-atactttaacgtcaaggagaaaaaacc-3' and 5'-tgttcacctcgatatgtgcatctgtaa-3'. The

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

10

SED1 probe was prepared by PCR from yeast genomic DNA using 5’-

ccgaattccactgattgctccacgtcat-3’ and 5’-ccggatccttacacgcaacgcgtaagaa-3’. To probe northern

blots for the transcripts from IMD2-containing plasmids and chromosomes (Figs. 5 and 6), the

‘upstream’ probe from the IMD2 locus was generated by PCR using 5’-

gactagtgcggccgcatcggttgagcgcgatatta-3’ and 5’-ctgatcaggatccggccattgcttttgctactt-3’ and yeast

genomic DNA. The ‘downstream’ probe was a PCR product made from yeast genomic DNA

using 5’-gtggtatgttggccggtactaccg-3’ and 5’-tcagttatgtaaacgcttttcgta-3’ as described previously

(Kopcewicz et al., 2007).

Primer extension: 5’-32

P labeled, HPLC-purified oligonucleotide (1.5 pmol;

gcgtttatgacagttaaaaag) was mixed with 20 µg of total RNA from the indicated yeast strains,

dried, dissolved in 10 ol of 2 mM Tris, pH 8.1, 0.2 mM EDTA, and 250 mM KCl and annealed

at 65°C for 5 min followed by a 1 hr incubation at 45 °C. Twenty five ol of 55 mM Tris-HCl,

pH 8.1, 9 mM MgCl, 1 mM dithiothreitol, and 500 µM of each dNTP were added to annealing

reactions. The primers were extended with 200 units of M-MLV reverse transcriptase

(Invitrogen) at 37°C. Samples were ethanol precipitated, dissolved in 5 µl of 90 mM Tris borate,

pH 8, 2 mM EDTA, 80% (v/v) formamide, heated to 95°C, and resolved on an 8%

polyacrylamide-7M urea gel.

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

11

RESULTS

Mapping the 3’-ends of the upstream non-coding RNA

To understand the complexity of the IMD2 promoter we set out to define the beginning

and end of the short intergenic transcripts resulting from transcription termination at the

intergenic-IMD2 terminator. While initiation sites have been mapped, the sites at which polyA+

tails are added are unknown. Using reverse transcription from a poly dT primer and a primer

specific for sequences upstream of IMD2, we obtained cDNAs from an RRP6 deletion strain of

S. cerevisiae. Deletion of RRP6 stabilizes short, intergenic non-coding RNAs that would

otherwise be degraded by the exosome (Davis and Ares, 2006). Sequencing of eleven clones

identified sites at which the RNA was polyadenylated (Fig. 1, circled bases). PolyA tails varied

from 11 to 50 bases and the set of addition sites extended over a 78 base interval. All polyA tails

were added at positions downstream of the “low guanine” start site (thick arrow), and almost all

addition sites were at UA or CA dinucleotides as is common in yeast (Graber et al., 2002). The

terminator region contains the four sequence elements present in many yeast termination/polyA

signals and scored highly in a polyA site prediction algorithm (data not shown; Graber et al.,

2002). These 3’-map positions, combined with the spectrum of upstream guanine initiation sites

(Steinmetz et al., 2006b), means that under guanine-replete conditions, short transcripts of 75 to

211 bases (exclusive of polyA) can be synthesized depending upon which pair of initiation and

polyadenylation sites are used (Fig. 1). This range is consistent with the short transcripts

observed earlier on northern blots (Davis and Ares, 2006; Steinmetz et al., 2006b).

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

12

Comparison of the IMD2 intergenic terminator and the CYC1 transcription terminator.

We previously developed a reporter assay for the termination activity of the intergenic-

IMD2 terminator (previously referred to as Repressive Element [RE], referred to here as IT; Fig.

1, underlined) based on its ability to generate short polyA+ transcripts when it was placed

downstream of the GAL1 promoter (Kopciewicz et al., 2007). We used this assay to compare the

IT to a well-characterized conventional terminator derived from the end of the CYC1 gene (Zaret

and Sherman, 1982; Osborne and Guarente, 1989). As described before, when located 120 bp

downstream of the GAL1 start site, the IT efficiently stopped transcription and prevented full

length transcript accumulation following galactose induction (Kopcewicz et al., 2007; Fig. 2;

lanes 1-3). The terminated transcript only became detectable when RRP6 was deleted (Fig. 2;

lanes 4-6). In contrast, when transcription was driven into the CYC1 termination element, a

prominent terminated RNA was detected regardless of RRP6 status (Fig. 2, lanes 7-9 vs 10-12).

Control full length transcripts were also unaffected by deletion of RRP6 (lanes 13-15 vs 16-18).

A similar result was obtained when both elements were inserted 15 bp closer to the promoter

(data not shown). When the IT is moved 110 bp further downstream, however, the terminated

transcript is stable even in the presence of RRP6 (Kopciewicz et al., 2007). Thus, the distance

from the promoter is important for stability of the terminated transcript generated from the IT but

not the CYC1 terminator. This suggests that both distance from the promoter and specific

sequences at the terminator are determinants of transcript handling by the nuclear exosome.

To test the sequence requirement, we grafted 49 bp of the IT (approximately the 5’-half;

Fig. 1, double underline) onto the minimal CYC1 terminator and placed that under GAL1 control.

This piece of the IT is known to be insufficient for termination (Kopcewicz et al., 2007). The

chimeric element efficiently terminated transcription (Fig. 3A; lanes 1-6). The RRP6-

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

13

dependence of the RNAs generated by termination due to the IT, CYC1, and chimeric

terminators, was quantified by phosphorimaging at the 90 min induction time point and

normalizing to a constitutive reference transcript (SED1). Transcripts terminated by the IT in

wildtype strains were 9% as abundant as when the Rrp6 exosome subunit was deleted (lanes 13-

15 vs 16-18 ). This is in striking contrast to the CYC1 terminator in which almost all of the RNA

was stable when the exosome was intact (87% RRP6+ vs Frrp6; lanes 7-9 vs 10-12). The

upstream portion of the IT endowed the CYC1 terminated transcript with increased sensitivity to

the exosome (RRP6+ 39% of rrp6F; lanes 1-3 vs 4-6) when grafted onto its 5’-end, rendering the

transcript more like that generated by the IT than the CYC1 terminator. When the chimeric

construct was moved downstream an additional 110 bp, to a position in which even the IT is

immune to exosome degradation (Kopcewicz et al., 2007), the chimera was also relatively Rrp6-

independent (Fig. 3B; lanes 1-3 vs 4-6) as was the CYC1 terminator (lanes 7-9 vs 10-12).

The Nab3 RNA binding protein has been implicated in termination and degradation of

small RNAs in yeast (Steinmetz et al., 2001; Arigo et al., 2006; Vasiljeva and Buratowski, 2006;

Thiebaut et al., 2006; Kim et al., 2006). The IT has a consensus Nab3 binding site (UCUU).

This site was contained in the portion of the IT grafted to the CYC1 (Fig. 1) and could be part of

the signals for termination and turnover of the non-coding small transcript. We mutated this site

to AGUU in the reporter plasmid in which it is placed downstream of the GAL1 promoter. The

plasmid was introduced into RRP6+ and Frrp6 strains and transcription was induced with

galactose. Mutation of this putative Nab3 site strongly stabilized (5.8 fold) the terminated short

RNA in cells containing an intact exosome (RRP6; Fig. 3C). Interestingly, the mutation did not

improve readthrough, i.e. it did not reduce termination efficiency of the IT. This contrasts with a

point mutation 10 bp downstream of UCUU that essentially abrogates termination giving rise to

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

14

a stable full length RNA (Kopcewicz et al., 2007). Thus, separate sequences in the IT provide

for the termination and RNA degradation functions. There is a slight increase in abundance of

the terminated transcript in a Frrp6 strain (1.4 fold), suggesting that the transcript may be

degraded by residual activity of the Rrp6-depleted nuclear exosome or another nuclease pathway

(Frrp6; Fig. 3C). These results are consistent with experiments in a nab3 mutant strain that also

suggests a role for this protein in IT function (Kuehner and Brow, manuscript submitted).

Position-dependence of Sen1-mediated termination.

Sen1 is strongly implicated in termination at the IT (Steinmetz et al., 2006b). We tested

its role directly by transcribing the reporter construct in a strain bearing the temperature sensitive

sen1E1597K

allele. In a strain wildtype for SEN1, the IT promoted termination and yielded trace

levels of an unstable transcript (Fig. 4A; lanes 1-4, solid arrow). In contrast, the sen1 mutation

rendered the terminator significantly less effective at both the permissive and restrictive

temperatures (lanes 5-8). Presumably these longer transcripts escape exosome attack thereby

explaining their higher level of accumulation compared to terminated RNAs in lanes 1-6. If the

Sen1 termination mechanism operates preferentially on short transcripts in concert with the

exosome, then moving the IT downstream should abrogate the ability of the sen1E1597K

mutation

to cause readthrough of the terminator. Indeed the IT shows strong termination when positioned

680 bp downstream from the start site regardless of the status of SEN1 (lanes 9-12 vs 13-16).

The sen1E1597K

mutation had no effect on readthrough even at the restrictive temperature when

the IT was in this location (lanes 13-16). Overall RNA abundance was also higher when the IT

was this far downstream since the transcripts were not diverted to the exosome degradation

pathway (lanes 10, 12, 14, 16). This demonstrates a strong position-dependence to Sen1’s

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

15

termination function. The CYC1 terminator is also dependent upon the Sen1 pathway (Steinmetz

et al., 2006b). It is a canonical polyA-signal/termination site found at the end of the ORF. The

CYC1 terminator was 77% effective as a terminator in a SEN1+ strain at either permissive or

restrictive temperatures when located close (120 bp) to the transcription start site (Fig. 4B, lanes

1-6). The sen1E1597K

mutation reduced termination efficiency (short transcripts divided by total

transcripts) to 43% and 28% at the permissive and restrictive temperatures, respectively (Fig. 4B,

lanes 7-9 and 10-12) in a manner similar to the mutation’s effect on the IT and as seen before in

another reporter system (Steinmetz et al., 2006b). These results confirm that Sen1 influences

terminator function for both terminators but only IMD2’s IT renders terminated RNA sensitive to

exosome degradation. Therefore, termination and degradation of short transcripts are not

obligatorily coupled.

Effect of distance upon RNA polymerase II’s ability to switch initiation sites.

We next asked if the distance between the two types of initiation sites (Fig. 1, the

upstream Gs vs the downstream A) was important for their regulated selection, for example if

RNA polymerase slides between them when making its initiation decision. To test this, we

introduced a BsiWI restriction site (Fig. 1; targeted sequence is boxed) between the initiation

sites for high guanine and the low guanine start into which we inserted random pieces of DNA

from lambda phage of varying size (24, 36, 45, 103, 153, and 218 bp). Plasmids with these

‘lengthened’ versions of IMD2 were introduced into a yeast strain deleted for chromosomal

IMD2 and the transcription start site patterns of the lengthened constructs were analyzed. Start

site mapping by primer extension revealed that the normal high guanine start sites were still used

when cells were grown in guanine (Fig. 5A; odd numbered lanes). (Although more complex

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

16

initiation patterns are apparent for the two largest inserts.) In contrast, when the cells were

grown in mycophenolic acid, RNA polymerase II’s ability to start from the normal downstream

A-residue was gradually compromised with increasing distance (Fig. 5A; ‘low G (MPA) start’ in

even numbered lanes, and graph). These results suggest that either RNA polymerase II abandons

its search for a start site or finds alternative start sites before the IT. In the latter case, transcripts

started upstream of the IT would terminate, be degraded, and fail to produce any protein-

encoding IMD2 mRNA. To examine this, we performed northern analysis on the transcripts

produced from these constructs in RRP6-deletion strains, using a probe that detects the upstream

short transcript and full length downstream transcripts (Fig. 5B, upper panel) or just the

downstream transcripts containing approximately the 3’-half of the IMD2 ORF (lower panel).

As expected, long transcripts were produced at the expense of short RNAs from wildtype IMD2,

as well as from the IMD2 in which we engineered a new restriction site (upper panel, lanes 1 vs 3

and 4 vs 6). The addition of 24 bp of lambda DNA between the upstream and downstream

initiation sites did not influence this pattern (lanes 7-9). When larger pieces of DNA were

inserted, MPA-induction of full length RNAs detected by either probe was reduced (36 bp, lane

12) or virtually absent (45, 103, 153, 218 bp; lanes 15, 18, 21 and 24, respectively). Thus, RNA

synthesis from any start site was curtailed when RNA polymerase II was unable to find the

favored downstream A-start site in the presence of MPA. The lack of short or long RNA

production in the presence of MPA (lanes 15, 18, 21, and 24) also strongly suggests that no other

start sites are found as alternatives, either up or downstream of the natural initiation site unless

such aberrant RNAs are degraded by a nuclease system other than that requiring RRP6.

Since IMD2 expression is required for growth in the presence of MPA, the absence of full

length IMD2-encoding mRNA in these strains should render them MPA-sensitive. This was

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

17

indeed the case, as growth was proportional to expression of full length IMD2 mRNA where the

36 bp insert allowed some growth but larger inserts did not support any (Fig. 5C). Hence, the

regulated switch from transcription of the upstream short RNA to the downstream biologically

active IMD2 mRNA can be disrupted by perturbing the choice of transcription initiation site.

The role of the Rpb9 subunit of RNA polymerase II in IMD2 start site selection.

To further examine the start site shift, we studied initiation in a strain of yeast deleted for

RPB9. This small subunit of RNA polymerase II is not essential but its loss shifts transcription

start sites upstream and impairs elongation more generally (Furter-Graves et al., 1994; Hull et

al., 1995; Sun et al., 1996; Awrey et al., 1997; Hemming et al., 2000). It also renders cells

extremely MPA-sensitive as well as defective in IMD2 induction (Shaw et al., 2001). This

suggested that RNA polymerase lacking this subunit might have a start site switch problem on

IMD2 during induction. Primer extension (Fig. 6A) and northern blotting (Fig. 6B) showed no

detectable IMD2 transcripts in an RPB9-null strain following MPA treatment (Fig. 6A, lanes 7-9;

Fig. 6B, lanes 4-6). As seen before, when RRP6 was deleted in order to stabilize the small

intergenic transcripts, the upstream guanine initiation sites were detectable by primer extension

in a strain with intact RPB9 (Fig. 6A, lane 4). When challenged with MPA, the downstream

‘low-guanine’ start was observed (Fig. 6A, lane 6). When RRP6 was deleted in order to stabilize

the intergenic transcripts in the RPB9-deletant, we found that RNA polymerase II could employ

the ‘high-guanine’ starts (Fig. 6A, lanes 1 and 2) but they were shifted upstream relative to

RPB9. More importantly, the RPB9-deletants were not capable of utilizing the downstream

initiation site normally induced by MPA (Fig. 6A, lane 3 vs lane 6). This is a likely explanation

for why an RPB9 deletion strain is so sensitive to MPA. Northern blotting of the Frpb9 Frrp6

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

18

double deletant (Fig. 6B) confirmed this start site shift defect since short intergenic transcripts

were synthesized normally, but full length mRNA could not be induced (lane 1 vs lane 7 and

lane 3 vs lane 9).

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

19

DISCUSSION

Regulation of IMD2 employs an unusual mechanism involving a non-coding transcript

arising from upstream of the productive transcription start site. This non-coding RNA is

degraded since its synthesis is not as important as the fact that polymerase molecules

preferentially initiate at an upstream site when GTP is available and terminate at the IT, thereby

preventing use of a downstream start that would otherwise produce IMD2 coding mRNA. Brow

and co-workers have shown that start site selection is governed by RNA polymerase’s choice of

GTP vs ATP as the initiating nucleotide, with the upstream G-starts preferred when guanine

nucleotide pools are adequate and the alternate downstream start site employed when GTP is

limiting (Steinmetz et al., 2006b, Kuehner and Brow, manuscript submitted; Fig. 1). This

preference probably explains why the region has evolved an unusual sequence bias of only 13%

G between the TATA box and initiation codon whereas the IMD2 ORF is 23% G and all ORFs

average 21% G. The 97 bp terminator element itself, in which the low-G adenine start site lies,

is a strikingly low 6% G. Under this scenario, the productive downstream start site is not

accessed unless GTP levels are low enough that the upstream starts can not be employed because

RNA polymerase II is essentially starved for that nucleotide at those positions. Thus, the option

of two start sites appears to be largely a mutually exclusive choice.

Here we delineate the intergenic transcripts’ boundaries by identifying their 3’-ends. The

short transcripts are a family of polyA+ RNAs potentially ranging from 75 nucleotides to slightly

over 200 nucleotides. The polyA-addition sites all fall downstream of the adenine start site that

generates IMD2 mRNA and which is centrally located in the terminator (Fig. 1). Hence, at the

MPA-induced start site, RNA polymerase initiates inside the terminator and can not transcribe

the full set of sequences required for termination at the IT. By mapping RNA polymerase II

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

20

density using a chromatin immunoprecipitation-microarray (ChIP-chip) assay, readthrough of the

IT in a sen1 mutant strain was observed (Steinmetz et al., 2006). Here we show directly that the

IT’s activity is Sen1-dependent. As predicted from work on short transcript termination

(Steinmetz et al., 2001; Kim et al., 2006; Thiebaut et al., 2006; Arigo et al., 2006; Steinmetz et

al., 2006b), we also observed that the role of Sen1 in termination is strongly distance dependent;

it failed to affect termination when the IT was 680 bp from the start site (Fig. 4A). Termination

was nevertheless efficient and therefore has been subsumed by an alternative termination

mechanism. The IT terminator functioned autonomously to yield a transcript that was very

sensitive to degradation by the exosome, but again only when it was positioned close to an

initiation site. This was unique to the IMD2 IT since transcripts generated by the canonical

CYC1 terminator were not susceptible to degradation at that distance but could be made so by

transferring a piece of the IT upstream of the CYC1 terminator. Therefore, a sequence

determinant as well as distance influences the fate of the terminated transcript. A good candidate

for the relevant sequence is a Nab3 consensus site found in the region (Fig. 3C and Kuehner and

Brow, manuscript submitted). These findings also fit with a model in which different classes of

RNA polymerase II transcripts are terminated by different systems. One system employs the

RNA binding proteins Nab3 and Nrd1 along with the Sen1 helicase (Steinmetz et al., 2001;

Steinmetz and Brow, 2003; Carroll et al., 2004; Steinmetz et al., 2006b; Vasiljeva and

Buratowski, 2006; Kim et al., 2006). Short transcripts, such as non-coding regulatory RNAs and

snRNA/snoRNAs use this system. Handling of the former set of transcripts is also coupled to

rapid degradation by the exosome, as observed here (Davis and Ares, 2006; Arigo et al., 2006;

Thiebaut et al., 2006).

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

21

What could account for the strong distance dependence of Sen1 activity and exosome

stimulating activity we observed for this terminator? An obvious candidate is the

phosphorylation state of the carboxyl terminal domain (CTD) of the large subunit of RNA

polymerase II. Since the phosphorylation pattern changes as a function of where in the

transcription cycle polymerase is, it is attractive to consider that the transcribing enzyme matures

over the transcription unit with respect to phosphorylation and loading of the Sen1 termination

machinery onto the elongation complex. Serine 5 phosphorylation of the CTD repeat is enriched

in the 5’-end of transcription units whereas serine 2 phosphorylation is enriched at the 3’-end

(Phatnani and Greenleaf, 2006). It has been postulated that these markings are signals for the

different co-transcriptional events that process primary transcripts into mature mRNA

(Komarnitsky et al., 2000). Once a transition point has been reached, Sen1 can no longer gain

access to the complex and the window of opportunity for that termination system to operate has

passed. A role for Nrd1 and Nab3 in engaging the complex early after initiation is attractive as

these proteins are known to associate with each other and Nrd1 binds the CTD (Conrad et al.,

2000; Carroll et al., 2007). As well, the CTD kinase CTK1 has been linked to the

Sen1/Nrd1/Nab3 termination system (Conrad et al., 2000). Recent work has shown that Nrd1

recognizes Ser-5 phosphorylated RNA polymerase II and phosphorylation at serine-7 has

recently been identified that is specific for snRNA synthesis (Egloff et al., 2007; Vasiljeva et al.,

2008). Hence, there is enough variety in the modification of an elongation complex to provide

signals to distinct termination machineries over the course of transcription.

Our results in modifying the spacing between the upstream and downstream start sites

reveal an exponential decay in the ability of RNA polymerase II to recognize an initiation site

that is progressively more distant from the TATA box (Fig. 5A). These data are consistent with

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

22

a scanning model for RNA polymerase II in which the enzyme enters chromatin through

recognition of the pre-initiation complex, melts DNA, and tracks on the template until it finds a

satisfactory initiation site (Giardina and Lis, 1993; Leuther et al., 1996; Kuehner and Brow,

2006). Given the regulatory role of guanine nucleotide concentration in this case, and the unique

nature of the high guanine start sites (rare tandem GG dinucleotides, Kuehner and Brow,

manuscript submitted), sliding between start sites would likely take place without chain

initiation. However, the possibility that small oligonucleotides such as abortive transcripts are

made and released during this search, cannot be excluded. The distance effect may also

represent the difficulty RNA polymerase has in making contact with proteins that reside

upstream such as TFIID. With respect to the start site decision at IMD2, it will be interesting to

examine the role of TFIIB in this process since it is part of the measuring device that positions

start sites at a fixed point downstream of the TATA box (Pinto et al., 1992; Pinto et al., 1994; Li

et al., 1994; Leuther et al., 1996; Chen and Hampsey, 2004; Bushnell et al., 2004). In the case

of IMD2, start site selection is a regulated variable so for this unusual promoter there is plasticity

in this feature.

Our experiments with strains lacking the Rpb9 subunit help elucidate why those cells are

so sensitive to MPA and why they fail to induce IMD2. RNA polymerase II without this subunit

initiates at the upstream site but cannot initiate from the A-start downstream. This makes sense

since Rpb9 is known to play a role in start site positioning generally and is a significant

component of one of the pincers of the enzyme’s jaws that contacts downstream duplex DNA

(Furter-Graves et al., 1994; Hull et al., 1995; Hemming et al., 2000; Cramer et al., 2001).

Absence of the subunit may result in a structural deficit, such as a loose grip on DNA, that

hampers controlled translocation of the enzyme. This could also explain the importance of Rpb9

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

23

in: 1) general elongation, 2) the RNA cleavage activity of the enzyme, which involves reverse

translocation, and 3) proofreading, which in turn relies on RNA cleavage and translocation

(Awrey et al., 1997; Hemming et al., 2000; Nesser et al., 2006; Koyama et al., 2007). If RNA

polymerase II deficient in Rpb9 slides on DNA between these two possible start sites, it will be

interesting to know if it is released from the upstream transcription unit following its failure to

find the downstream start site, or remains bound to DNA.

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

24

ACKNOWLEDGEMENTS

We thank Dr. D. Brow for materials and information prior to publication, Dr. J. Boss for

a critical reading of the manuscript, and Katrina Kopcewicz for contributing to early portions of

this study. This work was supported by NIH grant GM46331.

REFERENCES

Arigo, J.T., D.E. Eyler, K.L. Carroll, and J.L. Corden. 2006. Termination of cryptic unstable

transcripts is directed by yeast RNA-binding proteins Nrd1 and Nab3. Mol Cell. 23:841-851.

Awrey, D.E., R.G. Weilbaecher, S.A. Hemming, S.M. Orlicky, C. M. Kane, and A. M. Edwards. 1997.

Transcription elongation through DNA arrest sites. A multistep process involving both RNA polymerase

II subunit RPB9 and TFIIS. J Biol Chem. 272:14747-14754.

Buratowski, S. 2005 Connections between mRNA 3' end processing and transcription termination. Curr

Opin Cell Biol. 17:257-261.

Bushnell, D.A., K. D. Westover, R. E. Davis, and R. D. Kornberg. 2004. Structural basis of

transcription: an RNA polymerase II-TFIIB cocrystal at 4.5 Angstroms. Science 303:983-988.

Carroll, K.L., D. A. Pradhan, J. A. Granek, N. D. Clarke, and J. L. Corden. 2004. Identification of cis

elements directing termination of yeast nonpolyadenylated snoRNA transcripts. Mol Cell Biol. 24:6241-

6252.

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

25

Carroll, K.L., R. Ghirlando, J. M. Ames, and J. L. Corden. 2007. Interaction of yeast RNA-binding

proteins Nrd1 and Nab3 with RNA polymerase II terminator elements. RNA 13:361-373.

Chen, B.S. and M. Hampsey. 2004. Functional interaction between TFIIB and the Rpb2 subunit of RNA

polymerase II: implications for the mechanism of transcription initiation. Mol Cell Biol. 24:3983-91.

Conrad, N.K., S. M. Wilson, E. J. Steinmetz, M. Patturajan, D. A. Brow, M. S. Swanson, and J. L>

Corden. 2000. A yeast heterogeneous nuclear ribonucleoprotein complex associated with RNA

polymerase II. Genetics 154:557-571

Cramer, P., D. A. Bushnell, and R. D. Kornberg. 2001. Structural basis of transcription: RNA

polymerase II at 2.8 angstrom resolution. Science 292:1863-1876.

Davis, C. A. and M. Ares, Jr. 2006. Accumulation of unstable promoter-associated transcripts upon loss

of the nuclear exosome subunit Rrp6p in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A

103:3262-3267.

Egloff, S., D. O'Reilly, R. D. Chapman, A. Taylor, K. Tanzhaus, L. Pitts, D. Eick, and S. Murphy. 2007.

Serine-7 of the RNA polymerase II CTD is specifically required for snRNA gene expression. Science

318:1777-1779.

Escobar-Henriques, M. and B. Daignan-Fornier 2001. Transcriptional regulation of the yeast

GMP synthesis pathway by its end products. J Biol Chem 276:1523-1530.

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

26

Escobar-Henriques, M., B. Daignan-Fornier, and M. A. Collart. 2003. The critical cis-acting

element required for IMD2 feedback regulation by GDP is a TATA box located 202 nucleotides

upstream of the transcription start site. Mol Cell Biol. 23:6267-6278.

Furter-Graves, E.M., B. D. Hall, B.D., and R. Furter. 1994. Role of a small RNA pol II subunit

in TATA to transcription start site spacing. Nucleic Acids Res. 22:4932-4936.

Giardina, C. and J. T. Lis. 1993. DNA melting on yeast RNA polymerase II promoters. Science

261: 759-762.

Gietz, D., A. St Jean, R. A. Woods, and R. H. Schiestl. 1992. Improved method for high

efficiency transformation of intact yeast cells. Nucleic Acids Res. 20:1425.

Graber, J.H., G. D. McAllister, and T. F. Smith. 2002. Probabilistic prediction of Saccharomyces

cerevisiae mRNA 3'-processing sites. Nucleic Acids Res. 30:1851-1858.

Hemming, S.A., D. B. Jansma, P. F. Macgregor, A. Goryachev, J. D. Friesen, and A. M.

Edwards. 2000. RNA polymerase II subunit Rpb9 regulates transcription elongation in vivo. J

Biol Chem. 275:35506-35511.

Hull, M.W., K. McKune, , and N. A. Woychik. 1995. RNA polymerase II subunit RPB9 is

required for accurate start site selection. Genes Dev. 9:481-490.

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

27

Hyle, J. W., R. J. Shaw, and D. Reines. 2003. Functional distinctions between IMP

dehydrogenase genes in providing mycophenolate resistance and guanine prototrophy to yeast. J

Biol Chem 278: 28470-28478

Kim, M., L. Vasiljeva, O.J. Rando, A. Zhelkovsky, C. Moore, and S. Buratowski. 2006. Distinct

pathways for snoRNA and mRNA termination. Mol Cell. 24:723-734.

Kuehner, J.N., and D. A. Brow. 2006. Quantitative analysis of in vivo initiator selection by yeast

RNA polymerase II supports a scanning model. J Biol Chem. 281:14119-14128

Komarnitsky, P., Cho, E.J., and S. Buratowski. 2000. Different phosphorylated forms of RNA

polymerase II and associated mRNA processing factors during transcription. Genes Dev.

14:2452-2460.

Kopcewicz, K.A., T. W. O'Rourke, and D. Reines. 2007. Metabolic regulation of IMD2

transcription and an unusual DNA element that generates short transcripts. Mol Cell Biol.

27:2821-2829.

Koyama, H., T. Ito, T. Nakanishi, and K. Sekimizu. 2007. Stimulation of RNA polymerase II

transcript cleavage activity contributes to maintain transcriptional fidelity in yeast. Genes Cells

12:547-559

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

28

Leuther, K.K., D. A. Bushnell, and R. D. Kornberg. 1996. Two-dimensional crystallography of

TFIIB- and IIE-RNA polymerase II complexes: implications for start site selection and initiation

complex formation. Cell 85:773-779.

Li, Y., P. M. Flanagan, H. Tschochner, and R. D. Kornberg. 1994. RNA polymerase II initiation

factor interactions and transcription start site selection. Science 263:805-807.

Lykke-Andersen, S. and T.H. Jensen. 2007. Overlapping pathways dictate termination of RNA

polymerase II transcription. Biochimie 89:1177-1182.

Martens, J. A., L. Laprade, and F. Winston. 2004. Intergenic transcription is required to repress the

Saccharomyces cerevisiae SER3 gene. Nature 429: 571-574.

Nesser, N.K., D. O. Peterson, and D. K. Hawley. 2006. RNA polymerase II subunit Rpb9 is important

for transcriptional fidelity in vivo. Proc Natl Acad Sci U S A 103:3268-3273.

Osborne, B.I. and L. Guarente. 1989. Mutational analysis of a yeast transcriptional terminator.

Proc Natl Acad Sci U S A. 86:4097-4101.

Phatnani, H.P. and A. L. Greenleaf. 2006. Phosphorylation and functions of the RNA polymerase

II CTD. Genes Dev. 20:2922-2936.

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

29

Pinto, I., D. E. Ware, and M. Hampsey. 1992. The yeast SUA7 gene encodes a homolog of

human transcription factor TFIIB and is required for normal start site selection in vivo. Cell

68:977-988.

Pinto, I., W. H. Wu, J. G. Na, and M. Hampsey. 1994. Characterization of sua7 mutations defines a

domain of TFIIB involved in transcription start site selection in yeast. J Biol Chem. 269:30569-30573.

Rasmussen, T.P. and M.R. Culbertson. 1998. The putative nucleic acid helicase Sen1p is required for

formation and stability of termini and for maximal rates of synthesis and levels of accumulation of small

nucleolar RNAs in Saccharomyces cerevisiae. Mol Cell Biol.18:6885-6896.

Rosonina, E., S. Kaneko, and J. L. Manley. 2006. Terminating the transcript: breaking up is hard to do.

Genes Dev. 20:1050-6.

Sallés, F.J., W. G. Richards, and S. Strickland. 1999. Assaying the polyadenylation state of mRNAs.

Methods 17:38-45.

Shaw, R. J. and D. Reines 2000. Saccharomyces cerevisiae transcription elongation mutants are

defective in PUR5 induction in response to nucleotide depletion. Mol Cell Biol 20: 7427-7437.

Shaw, R. J., J. L. Wilson, K. T. Smith, and D. Reines. 2001. Regulation of an IMP

dehydrogenase gene and its overexpression in drug-sensitive transcription elongation mutants of

yeast. J Biol Chem 276:32905-32916.

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

30

Steinmetz, E.J. and D.A. Brow. 1996. Repression of gene expression by an exogenous sequence

element acting in concert with a heterogeneous nuclear ribonucleoprotein-like protein, Nrd1, and

the putative helicase Sen1. Mol Cell Biol. 16:6993-7003

Steinmetz, E.J. and D.A. Brow. 2003. Ssu72 protein mediates both poly(A)-coupled and

poly(A)-independent termination of RNA polymerase II transcription. Mol Cell Biol. 23:6339-

6349.

Steinmetz, E.J., N. K. Conrad, D. A. Brow, and J. L. Corden. 2001. RNA-binding protein Nrd1

directs poly(A)-independent 3'-end formation of RNA polymerase II transcripts. Nature 41:327-

331.

Steinmetz, E. J., S. B. Ng, J. P. Cloute, D. A. Brow. 2006a. cis- and trans-Acting determinants of

transcription termination by yeast RNA polymerase II. Mol Cell Biol 26: 2688-2696.

Steinmetz, E.J., C. L. Warren, J. N. Kuehner, B. Panbehi, A. Z. Ansari, and D. A. Brow. 2006b.

Genome-wide distribution of yeast RNA polymerase II and its control by Sen1 helicase. Mol

Cell. 24:735-746.

Sun, Z.W., A. Tessmer, and M. Hampsey. 1996. Functional interaction between TFIIB and the

Rpb9 (Ssu73) subunit of RNA polymerase II in Saccharomyces cerevisiae. Nucleic Acids Res.

24:2560-2566.

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

31

Thiebaut, M., E. Kisseleva-Romanova, M. Rougemaille, J. Boulay, and D. Libri. 2006.

Transcription termination and nuclear degradation of cryptic unstable transcripts: a role for the

nrd1-nab3 pathway in genome surveillance. Mol Cell. 23:853-864.

Vasiljeva L., and S. Buratowski. 2006. Nrd1 interacts with the nuclear exosome for 3' processing

of RNA polymerase II transcripts. Mol Cell. 21:239-248.

Vasiljeva, L., M. Kim, N. Terzi, L. M. Soares, and S. Buratowski. 2008. Transcription

Termination and RNA Degradation Contribute to Silencing of RNA Polymerase II Transcription

within Heterochromatin. Mol Cell. 29:313-323.

Zaret, K.S. and F. Sherman. 1982. DNA sequence required for efficient transcription

termination in yeast. Cell 28:563-573.

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

32

FIGURE LEGENDS

Figure 1- Sequence of the IMD2 promoter region. Initiation sites in the presence of guanine are

indicated with thin bent arrows. The initiation site when guanine is limiting is depicted with the

thick bent arrow (Steinmetz et al., 2006b). Map positions at which polyA is added to IT-

terminated, intergenic RNAs are circled. The TATA box (per Escobar-Henriques et al., 2003)

and start codon are shown in large type. The IT is identified with a solid underline (single and

double). The portion of the IT used to create a chimeric terminator is doubly underlined. The

hexamer mutagenized to a BsiWI site (AGTATG å CGTACG) is boxed. The consensus Nab3

binding site is in a shaded box.

Figure 2- Exosome sensitivity of the IT and CYC terminated transcripts. RNA was prepared for

northern analysis from yeast strains wildtype or deleted for RRP6 and bearing a plasmid

containing the GAL1 promoter and either the CYC1 or IMD2 intergenic terminator (IT) inserted

downstream of the promter (indicated schematically at the bottom of the figure). [Strains were,

from left to right, DY1038, DY1403, DY1532, DY 1534, DY1035, and DY1400.] Cells were

induced with 2% galactose for 0, 30, or 90 min and probed with the GAL1 or the SED1 (as a

loading control) probes, as indicated.

Figure 3- Exosome sensitivity of terminated transcripts. RNA was prepared for northern analysis

from yeast strains wildtype or deleted for RRP6 and bearing a plasmid containing the GAL1

promoter and either the CYC1 terminator, the IT, or a chimera between the CYC1 and IMD2-IT.

The chimera contained 49 bp of the IT (double underlined in Fig. 1) placed 5’ to 102 bp of the

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

33

CYC1 core terminator (there was a 4 bp overlap of common sequence between them).

Terminators were inserted at proximal (XbaI, panel A) or distal (BsiWI, panel B) positions

downstream of the promoter (indicated schematically at the bottom of the figure). [Strains were

DY1550 (part A, lanes 1-3), DY1551 (lanes 4-6), DY1532 (lanes 7-9), D1534 (lanes 10-12),

DY1038 (lanes 13-15), DY1403 (lanes 16-18) DY1554 (part B, lanes 1-3), DY1555 (lanes 4-6),

DY1558 (lanes 7-9) and DY1559 (lanes 10-12)]. Transcription was induced following galactose

exposure for the indicated times. Filters were probed with the GAL1 or SED1 probes as

indicated. Full length (IT in the reverse orientation in the XbaI site) marker RNA from

galactose-induced DY1552 was loaded in the lane marked M. In panel C, transcription through

an IT with a mutated consensus Nab3 binding site (AGUU) or an unaltered site (UCUU) was

analyzed by northern blotting as described in parts A and B.

Figure 4- SEN1-dependence of termination. RNA was prepared for northern analysis from

wildtype yeast and strains with the Sen1E1597K

mutation. Each strain contained plasmids with the

GAL1 promoter and either the CYC1 terminator or the IMD2 IT inserted downstream of the

promoter. Terminators were inserted at promoter proximal (XbaI) or distal (BstEII) positions.

[Strains used for panel A were DY682 (lanes 1-4), DY686 (lanes 5-8), DY684 (lanes 9-12), and

DY688 (13-16). Those for panel B were DY2900 (SEN1) and DY2902 (sen1E1597K

).] Strains

were grown at the indicated temperatures after 0 or 90 min of galactose induction and filters

were probed with the GAL1 or SED1 probes as indicated.

Figure 5- The effect of spacing upon start site selection. A) Start site mapping of IMD2 with

increasing spacing between the ‘high-guanine’ and ‘low-guanine’ (MPA) starts. An rrp6F strain

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

34

was transformed with a family of plasmids containing increasing amounts of lambda DNA

inserted into the engineered BsiWI site (boxed in Fig. 1) between the high G and low G start

sites. Each derived strain was grown in the presence of 0.5 mM guanine for 30 min or 15 og/ml

MPA for 2 h before RNA was prepared and subjected to 5’-end mapping by primer extension.

[Strains used were DY1701 (lanes 1 & 2), DY1702 (lanes 3 & 4), DY1703 (lanes 5 & 6),

DY1704 (lanes 7 & 8), DY1706 (lanes 9 & 10), DY1707 (lanes 11 & 12), and DY1708 (lanes 13

& 14).] Extension products representing the low-guanine/downstream and high

guanine/upstream starts are indicated. Phosphorimaging was used to quantify the extension

product corresponding to the MPA-induced start and plotted as a function of the length of DNA

inserted between the two starts. Prism 4.0 (GraphPad Software, Inc.) was used for curve fitting.

B) Northern blot of IMD2 transcripts with increasing spacing between the ‘high-guanine’ and

‘low-guanine’ starts. The RNAs from strains described in part A were analyzed by northern

blotting. Strains DY1700 (lanes 1-3), DY1701 (lanes 4-6), DY1702 (lanes 7-9), DY1703 (10-

12), DY1704 (lanes 13-15), DY1706 (lanes 16-18), DY1707 (lanes 19-21), and DY1708 (lanes

22-24) were grown in SC-ura with 0.5 mM guanine and 15 og/ml MPA for 2 h before RNA was

prepared. Filters were probed with the ‘upstream’ or ‘downstream’ probes described in

Materials & Methods. C) Cultures from the strains in part B were set to an O.D.600nm of 0.01,

serially diluted in four-fold increments, and 5 ol of each dilution was spotted onto SC–ura and

SC–ura containing 15 og/ml MPA and grown at 30ºC.

Figure 6- Effect of Rpb9 subunit on initiation site selection. A) Start site mapping. RNA

transcribed from the native chromosomal loci was analyzed by northern blotting from strains

deleted for RRP6, RPB9, or both genes, as indicated in the figure. Strains DY1549 (lanes 1-3),

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

35

YSC1021-551682 (lanes 4-6), and BY4741-4437 (lanes 7-9) were grown in the presence of 0.5

mM guanine for 30 min or 15 og/ml mycophenolic acid for 2 h before RNA was isolated for

primer extension. In “-“ lanes cells received neither treatment. The fast moving band in all lanes

is a non-specific species in the probe preparation that serves as an internal standard. B)

Northern analysis. RNA from strains BY4741-4437 (lanes 1-3), YSC1021-551682 (lanes 4-6),

and DY1549 (lanes 7-9) were prepared as in part A and subjected to northern blotting. The

upper panel of the northern blot was probed with the ‘upstream’ probe described in Materials and

Methods and the lower panel with the SED1 probe as a loading control.

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

TABLE I. Yeast strains used in this study

Strain Genotype

46a1

MATa cup1F ura3 his3 trp1 lys2 ade2 leu2

BY47412

MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0

BY4741-

44372

MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 rpb9F0

DY682 MATa cup1F ura3 his3 trp1 lys2 ade2 leu2 [pREF-XbaLuc (URA3)]

DY684 MATa cup1F ura3 his3 trp1 lys2 ade2 leu2 [pREF-BstLuc (URA3)]

DY686 MATa cup1F ura3 his3 trp1 lys2 ade2 leu2 sen1E1597K [pREF-XbaLuc (URA3)]

DY688 MATa cup1F ura3 his3 trp1 lys2 ade2 leu2 sen1E1597K [pREF-BstLuc (URA3)]

DY1035 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 [pGalLuc (URA3)]

DY1038 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 [pGalREF-XbaLuc (URA3)]

DY1400 MATa his3Ä1 leu2Ä0 met15Ä0 rrp6Ä0 ura3Ä0 [pGalLuc (URA3)]

DY1403 MATa his3Ä1 leu2Ä0 met15Ä0 rrp6Ä0 ura3Ä0 [pGalREF-XbaLuc (URA3)]

DY1532 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 [pCYC1TT-F-XbaLuc (URA3)]

DY1534 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 rrp6Ä0 [pCYC1TT-F-XbaLuc (URA3)]

DY1549 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 rpb9F0 rrp6::URA3

DY1550 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 [pChimera1-F-XbaLuc (URA3)]

DY1551 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 rrp6Ä0 [pChimera1-F-XbaLuc (URA3)]

DY1552 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 [pChimera1-R-XbaLuc (URA3)]

DY1554 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 [pChimera-F-BsiLuc (URA3)]

DY1555 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 rrp6Ä0 [pChimera-F-BsiLuc (URA3)]DY1558 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 [pCYC1TT-F-BsiLuc (URA3)]

DY1559 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 rrp6Ä0 [pCYC1TT-F-BsiLuc (URA3)]

DY1562 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 [pGalNabMutXba-F-Luc]

DY1563 MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 rrp6Ä0 [pGalNabMutXba-F-Luc]

DY1700 MATa his3Ä1 leu2Ä0 met15F0 rrp6F0 ura3Ä0 imd2::LEU2 [pRS316-IMD2 (URA3)]

DY1701 MATa his3Ä1 leu2Ä0 met15F0 rrp6F0 ura3Ä0 imd2::LEU2 [pRS316-IMD2-BsiWImut(URA3)]

DY1702 MATa his3Ä1 leu2Ä0 met15F0 rrp6F0 ura3Ä0 imd2:: LEU2 [pRS316-IMD2-24bpn(URA3)]






DY2900 MATa cup1Ä ura3 his3 trp1 lys2 ade2 leu2 [pCYC1TTF-XbaLuc (URA3)]

DY2902 MATa cup1Ä ura3 his3 trp1 lys2 ade2 leu2 sen1E1597K [pCYC1TTF-XbaLuc (URA3)]

Sen1E1597K1

MATa cup1Ä ura3 his3 trp1 lys2 ade2 leu2 sen1E1597K

YSC1021-

5516823

MATa his3Ä1 leu2Ä0 met15Ä0 ura3Ä0 rrp6F0

1 from D. Brow (U. Wisconsin, Madison)

2 from Research Genetics, Inc.

3 from Open Biosystems, Inc.

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

ACCEPTED on A

pril 11, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

Frrp6 Frrp6 Frrp6

no insert

RRP6 RRP6 RRP6

IMD2-IT CYC-TT

0 30 90 0 30 90 0 30 90 0 30 90 0 30 90 0 30 90

GAL1

XbaI

IMD2-IT or CYC-TT

FULL

SED1

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

GAL1-IT

Galactose (min):

short RNA

ACCEPTED on A


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

SED1

Frrp6 Frrp6 Frrp6RRP6 RRP6 RRP6

IMD2-IT

0 30 90 0 30 90 0 30 90 0 30 90 0 30 90 0 30 90

CYC-TTchimeric IT-CYC

M

GAL1-IT

SED1

GAL1-IT

1 2 3 4 5 6 7 8 9 10 11 12

GAL1

XbaI

terminator

A

B

GAL1

BsiWI

terminator

Frrp6 Frrp6RRP6 RRP60 30 90 0 30 90 0 30 90 0 30 90

CYC-TTchimeric IT-CYC

FULL

Galactose (min):

Galactose (min):

short

short

BsiWI

XbaI

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

AGUUUCUU0 30 90 0 30 90 0 30 90 0 30 90 M

Frrp6RRP6

Galactose (min):

GAL1-IT

FULL

short

RNA sequence: AGUUUCUU

ACCEPTED on A


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

SEN1SEN1 sen1E1597Ksen1E1597K

25� 25� 25� 25�37� 37� 37� 37�

0galactose (min):

SED1

GAL1-IT

1 2 3 4 5 6 7 8 9 10 11 12 13 1415

GAL1

XbaI

IMD2-IT or

BstEII

IMD2-IT

FULL

16

0 00 0 0 0 090 90 90 90 90 90 90 90

ACCEPTED on A


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

SEN1 sen1E1597K

25� 25�37� 37�

Galactose:

SED1

GAL1-CYCTT

00 0 030 30 30 3090 90 90 90

1 2 3 4 5 6 7 8 9 10 11 12

GAL1

XbaI

CYC-TT

FULL

BstEII

ACCEPTED on A


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

upstream

starts

low G

(MPA) start

1 2 3 4 5 6 7 8 910 1112 1314

0 100 2000

5000

10000

15000

bp inserted DNA

MP

A in

itia

tio

n s

ite

(ph

osp

ho

rim

ag

er

un

its)

+ guanine:

+ MPA: ++-

-+

+-

-+

+-

-+

+-

-+

+-

-+

+-

-+

+-

-

bp inserted: 0 24 36 45 103 153 218

AG

GG

ACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

+ guanine:

+ MPA:

bp inserted: 0 (Bsi) 24 36 45 103 153 218

+- -+- - +- -+- - +- -+- - +- -+- -+- - +- - +- - +- -+- - +- -

0 (wt)

+- -+- -

upstreamprobe

downstreamprobe

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

FULL

FULL

short

short

ACCEPTED on A


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

SC-ura+15µg/ml MPASC-ura

IMD2 WT

IMD2 BsiWI

24 bp insert

36 bp insert

45 bp insert

103 bp insert

153 bp insert

218 bp insert

ACCEPTED on A


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

rpb9Frrp6F

RPB9

rrp6Frpb9FRRP6

[+

guanin

e

+guanin

e

+guanin

e

- - -

+M

PA

+M

PA

+M

PA

“low G” start

“high G” starts

1 2 3 4 5 6 7 8 9

AG

GGACCEPTED


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Frrp6 RPB9 RRP6 Frpb9 Frrp6 Frpb9

guanine:

MPA: +--

--+

-+-

-+

-- +-

SED1

IMD2 mRNA

1 2 3 4 5 6 7 8 9

+- -

shortACCEPTED on A


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

PROPERTIES OF AN INTERGENIC TERMINATOR AND START ...

Documents

Transcript of PROPERTIES OF AN INTERGENIC TERMINATOR AND START ...