RESEARCH ARTICLE

Promoter Polymorphisms Which Modulate BACE1Expression Are Associated With SporadicAlzheimer’s DiseaseShan Wang and Jianping Jia*Department of Neurology, Xuan Wu Hospital of the Capital Medical University, Beijing, China

Received 15 September 2008; Accepted 9 March 2009

Beta-site APP-cleaving enzyme 1 (BACE1) gene has been sug-

gested as a candidate gene for Alzheimer’s disease (AD). How-

ever, little is known regarding the effects of polymorphisms in

regulatory sequences of BACE1 on AD susceptibility. To evaluate

the relationship between polymorphisms in the BACE1 promot-

er and sporadic AD (SAD) genetically and functionally, we

performed a case-control study (429 cases and 346 controls of

Han Chinese descent) and functional characterization of the

polymorphisms in vitro using luciferase assay and electro-

phoretic mobility shift assay (EMSA). Two polymorphisms

(�918G/A, rs4938369; �2014T/C, rs3017608) were identified in

the BACE1 promoter. The results showed that the �918G/A

polymorphism was associated with SAD and the �918GG car-

riers had a 1.67-fold higher risk for SAD than the carriers with

�918AA and GA genotypes (OR¼ 1.667, 95% CI¼ 1.087–2.556,

P¼ 0.019). The haplotype�918G/�2014T may be a possible risk

factor for SAD (P¼ 0.016). Luciferase reporter assays showed the

�918G allele and its resultant haplotype �918G/�2014T in-

duced an increase of transcriptional activity. A more marked

increase in �918G/�2014T transcriptional activity was seen

when under hypoxia treatment. EMSA indicated that the

�918G allele bound nuclear factors more strongly than

�918A allele did. Our findings suggest that the BACE1 promoter

polymorphisms which regulate BACE1 expression may contrib-

ute to SAD susceptibility. Further independent studies are

required to verify our findings. � 2009 Wiley-Liss, Inc.

Key words: genetics; single nucleotide polymorphism; func-

tional assay; transcriptional activity

INTRODUCTION

Alzheimer’s disease (AD) is characterized by senile plaques com-

posed of b-amyloid (Ab) peptide [Masters et al., 1985]. The

amyloid hypothesis of AD proposes that this plaque is the primary

cause of the disease [Hardy and Selkoe, 2002]. Ab peptide is

generated following the sequential cleavage of the amyloid precur-

sor protein (APP) byb- and g-secretase [Vassar, 2004]. First, APP is

cut by b-secretase to produce the secreted BACE1-cleaved APP

ectodomain (APPsb) and the membrane-bound C-terminal frag-

ment C99. Next, C99 is cleaved by g-secretase, which releases Ab.

The b-secretase, b-site amyloid precursor protein-cleaving enzyme

1 (BACE1), is the key rate-limiting enzyme for the generation of Ab[Lin et al., 2000; Cole and Vassar, 2008]. In addition to proteolysis,

it was shown in different studies that Ab production depended on

the existence and amount of BACE1 available. For instance, siRNA

suppression of BACE1 reduced Ab production in neurons derived

from both wild-type and the Swedish APP mutant transgenic mice

[Kao et al., 2004]. BACE1 knockout mice, without developmental

deficits, have abolished Ab generation [McConlogue et al., 2007].

Several studies have shown that both BACE1 mRNA and protein

expression are elevated in SAD brains and the elevation of BACE1

enzymatic activity is correlated with brain Ab1-x where x cor-

responds to Ab fragments assayed by the 4G8/6E10 ELISA as

previously reported by Li et al. and Ab1–42 production

[Fukumoto et al., 2002; Yang et al., 2003; Li et al., 2004]. It is

Grant sponsor: National Key Technology R&D Program in the Eleventh

Five-year Plan Period; Grant number: 2006BAI02B01; Grant sponsor:

National Basic Research 973 Program; Grant number: 2006CB500700;

Grant sponsor: National Natural Science Key Foundation; Grant number:

30830045; Grant sponsor: Beijing Natural Science Key Foundation; Grant

number: 7071004; Grant sponsor: Funding Project for Academic Human

Resources Development in Institutions of Higher Learning Under the

Jurisdiction of Beijing Municipality; Grant sponsor: Key

Neurodegenerative Lab of Ministry of Education of the People’s

Republic of China.

*Correspondence to:

Jianping Jia, Department of Neurology, Xuan Wu Hospital of the Capital

Medical University, Beijing 100053, PR China; Key Neurodegenerative

Laboratory of Ministry of Education of the People’s Republic of China,

Beijing, PR China. E-mail: jiaxuanwu@126.com

Published online 13 May 2009 in Wiley InterScience

(www.interscience.wiley.com)

DOI 10.1002/ajmg.b.30968

How to Cite this Article:Wang S, Jia J. 2010. Promoter Polymorphisms

Which Modulate BACE1 Expression Are

Associated With Sporadic Alzheimer’s

Disease.

Am J Med Genet Part B 153B:159–166.

� 2009 Wiley-Liss, Inc. 159

Neuropsychiatric Genetics

conceivable that up-regulation of BACE1 expression may contrib-

ute to the development of AD. BACE1 regulation is therefore likely

to play an important role in the pathogenesis of AD.

Over the past 10 years, most studies have focused on genetic

variants in the BACE1-coding region, leading to the suggestion that a

silent mutation C/G (rs638405) in exon 5 of BACE1 might be

associated with AD risk. However, functional consequence of this

polymorphism remains unclear. To date, little reports have paid

attentiontothegene regulatory region.Two laboratories have recently

characterized the genomic organization, structure, and function of

the 50-flanking region of BACE1 [Christensen et al., 2004; Samba-

murti et al., 2004]. The BACE1 promoter contains a number of

putative transcription factor binding sites (TFBSs) for regulatory

transcription factors and BACE1 expression can be induced by a

variety of agents including hypoxia [Zhang et al., 2007], heat shock

[Lahiri et al., 2006a], disrupted intracellular calcium [Cho et al.,

2008], and cytokines [Bourne et al., 2007; Cho et al., 2007]. Variants in

the promoters and regulatory regions of certain genes may be relevant

in the pathogenesis of AD by altering transcriptional activity [Lahiri

et al., 2005; Theuns et al., 2006]. It is reasonable to examine genetic

variants in these sequences so as to further explore the pathogenesis of

SAD. In the current study we aimed to systematically screen the

BACE1 promoter, to detect potential variants, and then to determine

whether these variants are associated with SAD, genetically and

functionally. The possible association of the variants in BACE1

promoter and the exon 5 C/G polymorphism was also investigated.

MATERIALS AND METHODS

SubjectsFour hundred twenty-nine SAD patients (61% females; mean age

at onset¼ 71.3 years; SD¼ 7.2; ranging from 55 to 94) and 346

sex- and age-matched healthy controls (63% females; mean

age¼ 72.5 years; SD¼ 8.1; ranging from 56 to 96) were enrolled

in this study. All patients and controls were Han Chinese whose

families must have resided for at least three generations in the same

area of Northern China (here defined as north to the Yellow River).

Patients with SAD were recruited from Xuan Wu Hospital of the

Capital Medical University, the Beijing Senile Hospital and several

other hospitals in Beijing City. Probable AD was diagnosed clini-

cally according to the criteria of National Institute of Neurological

and Communication Disorders and Stroke and the Alzheimer’s

Disease and Related Disorders Associations (NINCDS–ADRDA)

[Mckhann et al., 1984]. None of these patients reported a family

history of AD. Control subjects were obtained from the examina-

tion center of Xuan Wu Hospital in Beijing who underwent regular

health examinations, and were confirmed healthy and neurologi-

cally normal by Mini-Mental Status Examination (MMSE), Revised

Hasegawa Dementia Scale (HDS-R) and general examinations.

Informed consent was obtained for each subject, either directly or

from his or her guardian, and the protocol of this study was

approved by the Institute Ethical Committee.

Sequencing of the BACE1 PromoterSystematic screening of BACE1 promoter was performed using

standard PCR and direct sequencing in 20 randomly selected

controls and 20 SAD patients. Forty samples (20 SAD and 20

controls, 80 alleles) were used to identify the polymorphisms and

the approach has>95% power for the detection of polymorphisms

that are present at a frequency of �5%. Three overlapping primer

sets cover the 3393 bp from �2548 to þ845 relative to the

transcription start site (TSS) as shown in Table I. The sequence

of the 3393 bp region is available in http://www.ensembl.org/

(ENSG00000186318 range¼ chr11:116691568–116694960). TSS

is located 691 bp upstream from the translation start site

[Christensen et al., 2004].

TABLE I. Primer and Enzyme Designed for Genotyping and for Amplification of the Promoter Fragments for Subsequent

Ligation Into Reporter Plasmid

Locus Primer sequence Length (bp) EnzymeForward: AGCCTCAAGGGCACAAACAG 1241Reverse: CGGGCTCTTCGTCGGTCT

Promoter (sequencing) Forward: CAACAGTTTTTGAATAATGCGTCC 1437Reverse: TCACGAGCAGAGATTGAGGGAGForward: TACAATATGCTGGACACCATTCT 1167Reverse: TATCTCTACTCTTATCCTACACGG

�918G/A Forward: TTTCCTTTCCAAAGCCTGCCT 162 Eco130IReverse: CTCAAGTGATCCGCCCACCT

�2014T/C Forward: AGTGAGCTGAGATGAAGCCAGTGC 159 Alw44IExon 5 C/G Reverse: TCAGAAGTATTCCAATACCACCAGTGTT

Forward: AGGCACCTATGGTAAACTTGG 769Reverse: GACTGTTCTAGGCTCAACTTCC

Promoter (reporter plasmid) Forward: (GGGGTACC)TACAATATGCTGGACACCATTCT 3076 Kpn IReverse: (GAAGATCT)CTGTGGAGAGCGGTCAGGG Bgl II

Mismatched sites were underlined. Added restriction enzyme recognition sites were shown in brackets.

160 AMERICAN JOURNAL OF MEDICAL GENETICS PART B

GenotypingPolymorphisms in BACE1 promoter were genotyped by restriction

enzyme digestion of the PCR products amplified from genomic

DNA (Table I). PCR reactions were performed using 50 ng of

genomic DNA in 25 ml of reaction mixture consisting of 0.25 mmol

of each primer, 0.2 mM dNTPs, 12.5 ml GC buffer (2�) and 1 unit

LA Taq DNA polymerase (TaKaRa BIOINC, Shiga Japan). The

cycling was performed with an initial denaturation for 5 min at

95�C, followed by 35 cycles at 95�C for 30 sec, annealing for 30 sec, at

72�C for 30 sec with a final extension to 72�C for 7 min. For

restriction enzyme digestion, 6 ml of the PCR product was digested

by 5 units of the required enzyme in the presence of the accompa-

nying buffer, incubated at 37�C for overnight. Fragments were

separated on a 2.5% agarose gel and visualized on an ultraviolet

trans-illuminator after ethidium bromide straining. To validate the

genotyping results, 10% of the samples were chosen randomly to be

re-genotyped by direct DNA sequencing. All results were found to

be concordant. The exon 5 polymorphism genotyping was per-

formed by direct sequencing. APOE genotyping was performed

according to protocols already described [Hixson and Vernier,

1990].

Construction of Reporter PlasmidsThe 3076 bp promoter fragment (from �2548 to þ528 relative

to the TSS) was amplified from templates corresponding to

homozygotes for each allele of both sites of polymorphism

using primers (Table I) into which Kpn I and Bgl II restriction

sites were introduced. The PCR products from individuals who

were homozygous for the �918G/�2014T and �918A/�2014C

haplotypes were directionally inserted upstream the firefly lucifer-

ase gene in the pGL3-Basic vector (Promega, Madison, WI).

Because the �918A/�2014T haplotype was heterozygous in all

subjects of our study group, luciferase reporter plasmid contain-

ing the �918A/�2014T haplotype was constructed using a

QuickChange� Site-Directed Mutagenesis Kit (Stratagene, La Jolla,

CA). Negative and positive control were pGL3-Basic (Promega),

lacking any promoter sequences, and pGL3-Control (Promega),

containing the SV40 promoter and enhancer sequence. A pRL-TK

expression plasmid (Promega) containing the herpes simplex virus

thymidine kinase promoter upstream of the renilla luciferase gene

(Promega) was used as internal reference.

Cell Culture, Transient Transfection, andTreatment of Cells With Different AgentsHuman neuroblastoma SH-SY5Y cells and HeLa cells were propa-

gated in RPMI 1640 medium, 15% fetal bovine serum, 200 IU/ml

penicillin, and 200 g/ml streptomycin (Invitrogen, Carlsbad, CA).

All cells were maintained at 37�C in an incubator containing 5%

CO2. For transient transfection, SH-SY5Y and HeLa cells were

seeded in 96-well culture dishes at 2� 104 and 1� 104 cells/well,

respectively, and allowed to recover for 24 hr. Cells were co-

transfected with 3 ng of pRL-TK plasmid and 150 ng of either one

of the BACE1 promoter constructs or one of the control plasmids,

using Lipofectamine 2000 (Invitrogen). Empty pGL3-Basic vector

was used as a negative control and pGL3-Control vector as a positive

control. Following transfection for 24 hr, Ab25–35 was added into

the normal 1640 medium at 0.015 mM concentration to model

pathology of AD; serum deprivation that serum-free 1640 substi-

tuted the normal 1640 produced energy starvation and apoptosis.

Here we use Ab25–35, a toxic antigenic fragment which exhibits all

the biological activity of the full length Ab and has been earlier used

by other researchers to study the neuronal toxicity and oxidative

vulnerability [Jesudason et al., 2008]. Ab25–35 is a convenient tool

for the investigation of neurotoxic mechanisms involved in AD

[Frozza et al., 2009]. For hypoxic treatment, Na2S2O4 was added

into the normal 1640 medium at 1 mM concentration [Lv et al.,

2008]. Transfected cells were treated with these agents for 24 hr

before they were lysed and assayed by Dual-Luciferase reporter

assay system.

Relative Luciferase Activity MeasuresTransfected cells were cultured for 48 hr, washed with 200 ml of

phosphate-buffered saline, and lysed with 20 ml passive lysis buffer

(Promega). Luciferase activities of firefly (LAF) and luciferase

activities of renilla (LAR) were measured sequentially using a

Dual-Luciferase reporter assay system (Promega) and a model

GloMax� 96 Microplate Luminometer (Promega). To take ac-

count of variations in transfection efficiency for different reporter

gene constructs, the relative luciferase activity (RLA) was calculated

as: RLA¼ LAF/LAR.

Electrophoretic Mobility Shift Assay (EMSA)The double-stranded oligonucleotide probes 50-CATTTTGG-

GAGGCCGACGTGGGCGGATCA and 50-CATTTTGGGAGGC-

CAACGTGGGCGGATCA (the polymorphic site was both

underlined and in bold) corresponding to the �918G or �918A

sequence from the BACE1 promoter region were synthesized and

end-labeled with biotin. Electrophoretic mobility shift assays were

performed by using the LightShift� Chemiluminescent EMSA Kit

(Pierce, Rockford, IL). For each binding reaction (10 ml), a total of

100 fmol biotin-labeled probe was combined with 10 mg nuclear

extract prepared from SH-SY5Y and HeLa cells, 1mg poly(dI� dC),

and binding buffer. For competition assays, a 50- or 100-fold molar

excess of unlabeled �918G or �918A probe was pre-incubated for

20 min at room temperature with nuclear extracts before the

addition of the labeled probe. Protein–DNA complexes were ana-

lyzed by electrophoresis on non-denaturing 6.5% polyacrylamide

gels in 0.25�TBE and were visualized using chemiluminescent

Nucleic Acid Detection Module (Pierce).

Statistical AnalysisHardy–Weinberg equilibrium was checked using Haploview ver-

sion 3.32 [Barrett et al., 2005]. Statistical analysis of genotype

distributions and allele frequencies was performed by Chi-square

test (SPSS for Windows16.0). Logistic regression analysis including

three BACE1 polymorphisms, age, gender, and APOE e4 allele

carrier status into one model was performed to obtain adjusted

WANG AND JIA 161

odds ratios (OR) estimates. Interrelations were analyzed by strati-

fication. Linkage disequilibrium (LD) was checked using EH

program. LD values (D0 and r2) and estimation of haplotypes were

performed in http://analysis.bio-x.cn/myAnalysis.php. The associ-

ation of haplotypes with AD was assessed by Chi-square test. OR

and 95% confidence intervals (95% CIs) were calculated as esti-

mates of the strength of association between genotypes or haplo-

types and SAD. The transcriptional activity of the BACE1 promoter

was measured by RLA. The two-tailed Student’s t-test was used to

test the RLA produced by two different promoter constructs, as well

as during basal condition and under different agents.

RESULTS

BACE1 Promoter PolymorphismsThe DNA sequencing of BACE1 promoter region in 40 individuals

allowed us to identify two single nucleotide polymorphisms (SNPs)

which were �918G/A and �2014T/C (rs4938369 and rs3017608,

respectively). The genotype and allele distributions of the promoter

SNPs and the exon 5 SNP in SAD and control samples were reported

in Table II. The distribution of BACE1 genotypes was in Hardy-

–Weinberg equilibrium in the two groups analyzed. There were

significant differences in genotype and allele frequencies for

�918G/A between SAD and control (genotype P¼ 0.011, allele

P¼ 0.004). Stratification according to APOE e4 allele status re-

vealed the tendency that these differences might be confined to

APOE e4 non-carriers. (Due to the low number of controls in the

group of APOE e4 allele carriers: n¼ 33, statistical power might not

be sufficient and thus these data were not shown). Multivariate

logistic regression analysis revealed that an increased risk of SAD

was associated with the GG genotypes compared with the GA þAA

genotype (OR¼ 1.667, 95% CI¼ 1.087–2.556, P¼ 0.019)

(Table III). Our findings suggested that the �918G/A polymor-

phism in BACE1 promoter might be associated with SAD. We did

not find any significant difference of genotype and allele frequencies

for �2014T/C between SAD and control before and after they were

stratified by APOE e4. In our sample, the allele and genotype

frequencies of BACE1 exon 5 C/G polymorphism were not signifi-

cantly different between SAD and control even after stratification by

APOE e4 allele status.

LD between alleles at these loci was studied and we found the

�918 G/A and the �2014T/C in BACE1 promoter were in LD

(D0 ¼ 0.802, r2¼ 0.533) (Table IV). The�918G/�2014T haplotype

was over-represented in SAD versus control, suggesting it could be a

possible risk factor for SAD (OR¼ 1.320, 95% CI¼ 1.054–1.652,

P¼ 0.016). There is also a protective �918A/�2014C haplotype

which was underrepresented in SAD versus control (OR¼ 0.725,

95% CI¼ 0.558–0.942, P¼ 0.016).

Transcriptional Activity of BACE1Promoter PolymorphismsAccording to the results of haplotype analysis, we constructed two

luciferase reporter plasmids containing the �918G/�2014T hap-

lotype (named pGL-GT) and the �918A/�2014C haplotype

(named pGL-AC) whose frequencies were significantly different

between SAD and control. In addition, to investigate the effect of the

�918G/A site on the transcriptional activity, we also cloned

the fragment which was homozygotes of �918A/�2014T

(named pGL-AT) into upstream of the luciferase reporter gene

(pGL3-Basic). They were transfected into SH-SY5Y cells and HeLa

cells which represent central nervous cells and peripheral epithelial

TABLE II. Genotypic and Allelic Distribution of BACE1 Polymorphisms in SAD Patients and Controls

�918

Genotype Allele

Total GG (%) GA (%) AA (%) P-value G (%) A (%) P-valueAD 429 285 (66.4) 134 (31.2) 10 (2.3) 0.011 704 (82.1) 154 (17.9) 0.004Control 346 195 (56.4) 136 (39.3) 15 (4.3) 526 (76.0) 166 (24.0)

�2014

Genotype Allele

Total TT (%) TC (%) CC (%) P-value T (%) C (%) P-valueAD 429 256 (59.7) 157 (36.6) 16 (3.7) 0.143 669 (78.0) 189 (22.0) 0.058Control 346 183 (52.9) 145 (41.9) 18 (5.2) 511 (73.8) 181 (26.2)

Exon 5

Genotype Allele

Total CC (%) CG (%) GG (%) P-value C (%) G (%) P-valueAD 426 146 (34.3) 208 (48.8) 72 (16.9) 0.609 500 (58.7) 352 (41.3) 0.509Control 343 120 (35.0) 174 (50.7) 49 (14.3) 414 (60.3) 272 (39.7)

Frequencies are shown in parentheses. P-values< 0.05 are indicated in bold.

162 AMERICAN JOURNAL OF MEDICAL GENETICS PART B

cells. As shown in Figure 1, reporter gene assay of transient trans-

fected HeLa cells showed a significant (P< 0.001) 1.5-fold increase

in transcriptional activity for pGL-GT compared with pGL-AT and

pGL-AC. In SH-SY5Y cells, the more striking 1.7-fold increase in

transcriptional activity was observed for pGL-GT versus pGL-AT

and pGL-AC. However, there was no significant difference in

transcriptional activity between pGL-AT and pGL-AC in either

cell line. The relative activities of all these BACE1 promoters were

higher in SH-SY5Y cells than in HeLa cells.

To further explore gene–environmental interactions, following

transfection for 24 hr, cells were exposed to different agents for an

additional 24 hr. RLA of different promoter constructs under basal

and stimulated condition was indicated in Figure 2. Comparing

RLA among different agents, we found that under hypoxia treat-

ment, the BACE1 transcriptional activity of pGL-GT was higher

than that during basal condition in both cell lines and the tran-

scriptional activities of pGL-AC and pGL-AT were up-regulated

only in SH-SY5Y cells. In SH-SY5Y cells, the increased level of

transcriptional activity was greater with the pGL-GT (2.07-fold

with hypoxia) than with the pGL-AC and pGL-AT (1.31-fold with

hypoxia and 1.28-fold with hypoxia). We failed to detect any

difference in transcriptional activities under Ab25–35 treatment and

serum deprivation treatment in either cell line.

Allele-Specific Transcription-Factor BindingUsing EMSA, we examined whether the�918G/A polymorphic site

affecting BACE1 expression interfered with the specific recognition

of the BACE1 promoter by nuclear factors extracted from SH-SY5Y

cells and HeLa cells. We observed that SH-SY5Y nuclear extracts

contained nuclear proteins binding specifically to the �918 site

surrounding 29 bp sequence, which resulted in the formation of one

major complex (Fig. 3). There were clear differences in binding

affinity for the major complex, which preferentially bound to the G

allele. Also, pre-incubation with a 100-fold excess of the unlabeled

�918G probes completely abolished the formation of the complex

that bound to the biotin-labeled �918A probes, while competition

with the same amount of the unlabeled �918A probes did not

completely inhibit binding of the complex to the �918G allele. We

got the same results by using nuclear proteins extracted from HeLa

cells. Taken together, these results support the hypothesis of higher

binding affinity of this complex for the G allele.

DISCUSSION

Increasingly, reports indicate that BACE1 expression is tightly

regulated at both the transcriptional and translational level

[Rossner et al., 2006]. Insight into the regulation of BACE1 expres-

sion may aid identification of mechanisms that lead to disease,

illuminate the role of BACE1 in normal biology, and suggest

approaches to inhibit BACE1 therapeutically. Moreover, polymor-

phic variability within a gene promoter can affect gene expression

and has previously been associated with age-related neurodegen-

eration [Lambert et al., 2001; Belbin et al., 2007; Guyant-Mar�echal

et al., 2007; Rodr�ıguez-Rodr�ıguez et al., 2007]. Genetic variants in

the BACE1 promoter region are therefore appropriate for study to

elucidate mechanisms of AD.

In the present study, the promoter region of BACE1 is perhaps

firstly screened systematically for variants. We have detected two

polymorphisms (�918G/A, �2014T/C) in Chinese Han popula-

tion and examined the genetic and functional characters of the

polymorphisms. The �918G/A polymorphism was significantly

associated with SAD susceptibility before and after we stratified

gender, age and APOE e4 via logistic regression. No statistically

significant differences in genotype frequencies were observed for

�2014T/C between SAD patients and controls. These two poly-

morphisms were in moderate LD and the �918G/�2014T haplo-

type conferred a higher risk of developing SAD. Previous genetic

association studies of BACE1-coding region have yielded conflict-

ing results. Several reports suggested that an exon 5 C/G polymor-

phism in BACE1 might be associated with the risk of AD [Kirschling

et al., 2003; Shi et al., 2004; Cai et al., 2005; Kan et al., 2005]. In

addition, a high-resolution genome screen revealed that certain

gene or genes on 11q25, not far from the BACE1, were in linkage

with AD [Blacker et al., 2003]. Thus, it can be speculated the variants

in BACE1 promoter region may be in LD with the exon 5 polymor-

phism or other functional variants in another gene nearby, which

TABLE III. The Correlation Analysis Between BACE1

Polymorphisms and SAD Risk

Wald P-value OR (95% CI)�918GG vs. GA þ AA 5.494 0.019 1.667 (1.087–2.556)�2014TT vs. TC þ CC 0.006 0.937 0.983 (0.642–1.505)Exon 5 CC vs. CGþ GG 0.561 0.454 0.881 (0.631–1.228)

Data were calculated by logistic regression, adjusting for age, gender and APOE e4 status.OR, odds ratio; CI, confidence interval.P-value <0.05 is indicated in bold.

TABLE IV. Distribution of Haplotype in SAD Patients and Controls

Haplotype SAD, n (%) Control, n (%) xx2 P-value OR (95% CI)�918G/�2014T 647 (75.5) 484 (70.0) 5.852 0.016 1.320 (1.054–1.652)�918G/�2014C 57 (6.6) 42 (6.0) 0.198 0.657 1.098 (0.727–1.660)�918A/�2014C 132 (15.4) 139 (20.1) 5.807 0.016 0.725 (0.558–0.942)�918A/�2014T 22 (2.5) 27 (3.9) 2.341 0.126 0.640 (0.359–1.139)

OR, odds ratio; CI, confidence interval.P-values <0.05 are indicated in bold.

WANG AND JIA 163

influences the risk of SAD. To investigate the possible association of

the loci in BACE1 promoter and the exon 5 C/G polymorphism, we

determined the SNP in the present sample. We failed to find any

association between the exon 5 C/G polymorphism and SAD even

after statistical adjustment for age, gender and APOE e4 allele status.

Our results were in agreement with two recent studies [Jo et al.,

2008; Todd et al., 2008]. LD between the promoter polymorphisms

and the exon 5 C/G polymorphism was also analyzed. The degree of

LD between the �918G/A and the exon 5 C/G polymorphism was

relatively weak (D0 ¼ 0.491, r2¼ 0.092). Taken together, these data

suggest that the variants in BACE1 promoter may be involved in the

SAD risk, independent of the exon 5 C/G polymorphism effect.

To further elucidate the association between these polymor-

phisms with SAD, we performed functional analyses as well. In the

luciferase assay system, we found that the �918G/�2014T haplo-

type displayed a strikingly higher transcriptional activity compared

with the �918A/�2014C haplotype in both the neural and non-

neural cell lines. This suggests that the BACE1 promoter with

�918G/�2014T may possess higher transcriptional activity and

thus over-express BACE1, which plays a pivotal role in the devel-

opment of AD. Regarding the �918 G/A polymorphism, we

detected a significant difference in transcriptional activity between

the �918G/�2014T haplotype and the �918A/�2014T haplotype,

suggesting the G/A variant might have an effect on BACE1 tran-

scriptional activity. One possible explanation for the functional

significance of the �918 G/A polymorphism is that the polymor-

phism may locate in the key region necessary for promoter activity.

There is some evidence obtained from a deletion mapping of the

BACE1 regulatory region. The deletion analysis showed that

the fragment between �932 and �896, containing the �918 site,

harbored an important up-regulatory cis-acting element and de-

leting the fragment resulted in a drastic loss of BACE1 promoter

activity in both neural and non-neural cells [Christensen et al.,

2004].

To predict whether the �918G/A polymorphism significantly

altered one or more TFBS in BACE1 promoter, sequences of 29 bp

length, each corresponding to adjoining sequences of the �918

polymorphic sites, were analyzed by the MatInspector software

(http://www.genomatix.de/products/MatInspector/). As a result,

the �918A variant was predicted to lose putative binding sites,

specifically camp-responsive element binding protein (CREB) and

one of two hypoxia inducible factor-1 (HIF-1), while gaining a

predicted RXR heterodimer binding site (RXR) when compared to

the �918G variant. The BACE1 promoter over 4.1 kb of length

contains 20 potential CREB sites which may have implications in

APP regulation [Lahiri et al., 2006b]. Mutation of CREB site

abolished transcriptional activity of the PSEN-2 promoter

[Wang et al., 2006]. The allele-specific effect on BACE1 transcrip-

tion may be mediated by CREB binding. HIF-1 is the principal

FIG. 1. Transcriptional activity of the BACE1 promoters in two cell

lines. The figure shows a 1.5 to 1.7-fold increase in

transcriptional activity for pGL-GT compared with pGL-AC and AT,

and relative activities of BACE1 promoters were obviously higher

in SH-SY5Y cells than in HeLa cells. Bars represent firefly/renilla

luciferase ratio for the different constructs. RLA, relative

luciferase activity.

FIG. 2. Transcriptional activity of the BACE1 promoters under basal

and stimulated condition. Bars represent firefly/renilla

luciferase ratio for the different constructs. RLA, relative

luciferase activity; (A) HeLa cell; (B) SH-SY5Ycell.

164 AMERICAN JOURNAL OF MEDICAL GENETICS PART B

molecule regulating oxygen homeostasis [Huang et al., 1999].

When oxygen is in short supply, HIF-1 binds to HRE in promoters

or enhancers, thereby activating a broad range of genes involved in

angiogenesis, erythropoiesis, cell death, and energy metabolism

[Sharp and Bernaudin, 2004]. Loss of function is usually associated

with recessive rather than dominant effects. EMSA demonstrated

that the�918 G/A polymorphism that influences BACE1 transcrip-

tional activity showed allele-specific binding affinities. It will,

however, be necessary to determine whether these particular TFBSs

are active elements that, if altered by the polymorphism, increase

BACE1 expression.

The sporadic nature of most AD cases strongly argues for an

environmental link that may drive AD pathogenesis. To assess

whether the specific BACE1 promoter sequence might exert an

impact on transcriptional activity in different stress environments

and thus altered AD susceptibility, the transfected cells were treated

with hypoxia, serum deprivation (low energy stress) and Ab25–35

(model pathology of AD). We failed to detect any changes in

transcriptional activity of these three BACE1 promoters under

serum deprivation and Ab25–35. It is possible that these agents may

not alter the BACE1 expression at the transcriptional level. Perhaps

the effect of these polymorphisms could not be observed in vitro

because of absence of other necessary regulatory elements outside

the cloned promoter fragment. Hypoxia treatment markedly in-

creased the three BACE1 promoters’ activities and stimulated

higher activity with the �918G/�2014T BACE1 promoter than

with two other constructs in SH-SY5Y cell, suggesting hypoxia

better facilitates over-expression of BACE1 in subjects possessing

the �918G/�2014T haplotype than two other haplotype carriers.

In the systematic screen of BACE1 promoter region we identified

two polymorphisms, one of which (�918G/A) was associated with

increased risk for SAD and showed allele-specific binding of nuclear

factors. Both polymorphisms were in LD allowing the identification

of a risk haplotype (�918G/�2014T). In short the polymorphisms

in BACE1 promoter, which modulate gene expression, may be

involved in the onset of SAD.

ACKNOWLEDGMENTS

This work was supported by National Key Technology R&D

Program in the Eleventh Five-year Plan Period (2006BAI02B01),

the National Basic Research 973 Program (2006CB500700),

National Natural Science Key Foundation (30830045), Beijing

Natural Science Key Foundation (7071004), and Funding Project

for Academic Human Resources Development in Institutions of

Higher Learning Under the Jurisdiction of Beijing Municipality.

This work was also supported by and partially conducted in the Key

Neurodegenerative Lab of Ministry of Education of the People’s

Republic of China.

REFERENCES

Barrett JC, Fry B, Maller J, Daly MJ. 2005. Haploview: Analysis andvisualization of LD and haplotype maps. Bioinformatics 21(2):263–265.

Belbin O, Dunn JL, Ling Y, Morgan L, Chappell S, Beaumont H, Warden D,Smith DA, Kalsheker N, Morgan K. 2007. Regulatory region singlenucleotide polymorphisms of the apolipoprotein E gene and the rate ofcognitive decline in Alzheimer’s disease. Hum Mol Genet 16(18):2199–2208.

Blacker D, Bertram L, Saunders AJ, Moscarillo TJ, Albert MS, Wiener H,Perry RT, Collins JS, Harrell LE, Go RC, Mahoney A, Beaty T, Fallin MD,Avramopoulos D, Chase GA, Folstein MF, McInnis MG, Bassett SS,Doheny KJ, Pugh EW, Tanzi RE, NIMH Genetics Initiative Alzheimer’sDisease Study Group. 2003. Results of a high-resolution genome screen of437 Alzheimer’s disease families. Hum Mol Genet 12(1):23–32.

Bourne KZ, Ferrari DC, Lange-Dohna C, Rossner S, Wood TG, Perez-PoloJR. 2007. Differential regulation of BACE1 promoter activity by nuclearfactor-kappaB in neurons and glia upon exposure to beta-amyloidpeptides. J Neurosci Res 85(6):1194–1204.

Cai L, Tang G, Chen L, Zhang B, Jiang S, Ren D. 2005. Genetic studies ofA2M and BACE1 genes in Chinese Han Alzheimer’s disease patients.Neuroreport 16(9):1023–1026.

Cho HJ, Kim SK, Jin SM, Hwang EM, Kim YS, Huh K, Mook-Jung I. 2007.IFN-gamma-induced BACE1 expression is mediated by activation ofJAK2 and ERK1/2 signaling pathways and direct binding of STAT1 toBACE1 promoter in astrocytes. Glia 55(3):253–262.

Cho HJ, Jin SM, Youn HD, Huh K, Mook-Jung I. 2008. Disruptedintracellular calcium regulates BACE1 gene expression via nuclear factorof activated T cells 1 (NFAT 1) signaling. Aging Cell 7(2):137–147.

Christensen MA, Zhou W, Qing H, Lehman A, Philipsen S, Song W. 2004Transcriptional regulation of BACE1, the beta-amyloid precursor pro-tein beta-secretase, by Sp1. Mol Cell Biol 24(2):865–874.

Cole SL, Vassar R. 2008. BACE1 structure and function in health andAlzheimer’s disease. Curr Alzheimer Res 5(2):100–120.

Frozza RL, Horn AP, Hoppe JB, Sim~ao F, Gerhardt D, Comiran RA, SalbegoCG. 2009. A Comparative Study of beta-Amyloid Peptides Abeta 1-42

FIG. 3. EMSA with biotin-labeled 29-bp oligonucleotides containing

the �918G or �918A allele and nuclear extracts from SH-

SY5Ycells. Lanes 1 and 6 show the mobilities of the labeled

probes without nuclear extracts. Lanes 2 and 7 present the

mobilities of the labeled probes with nuclear extracts in the

absence of competitor. In competition experiments, 50-fold

excess of unlabeled probes (lanes 3 and 8) and 100-fold excess

of unlabeled probes(lanes 4 and 9) were added before the

addition of the labeled probes; pre-incubation with 100-fold

excess of unlabeled probes containing the A allele did not

completely block binding of the complex to the-918G allele

(lane 5), while 100-fold excess of unlabeled probes containing

the G allele completely inhibited the binding of biotin-labeled -

918A probes to factors in SH-SY5Y nuclear extract (lane10).

WANG AND JIA 165

and Abeta 25-35 Toxicity in Organotypic Hippocampal Slice Cultures.Neurochem Res 34(2):295–303.

Fukumoto H, Cheung BS, Hyman BT, Irizarry MC. 2002. Beta-secretaseprotein and activity are increased in the neocortex in Alzheimer disease.Arch Neurol 59(9):1381–1389.

Fukumoto H, Cheung BS, Hyman BT, Irizarry MC. 2002. Beta-secretaseprotein and activity are increased in the neocortex in Alzheimer disease.Arch Neurol 59(9):1381–1389.

Guyant-Mar�echal L, Rovelet-Lecrux A, Goumidi L, Cousin E, HannequinD, Raux G, Penet C, Ricard S, Mac�e S, Amouyel P, Deleuze JF, Frebourg T,Brice A, Lambert JC, Campion D. 2007. Variations in the APP genepromoter region and risk of Alzheimer disease. Neurology 68(9):684–687.

Hardy J, Selkoe DJ. 2002. The amyloid hypothesis of Alzheimer’s disease:Progress and problems on the road to therapeutics. Science 297:353–356.

Hixson JE, Vernier DT. 1990. Restriction isotyping of human apolipopro-tein E by gene amplification and cleavage with HhaI. J Lipid Res31(3):545–548.

Huang LE, Willmore WG, Gu J, Goldberg MA, Bunn HF. 1999. Inhibitionof hypoxia-inducible factor 1 activation by carbon monoxide and nitricoxide. Implications for oxygen sensing and signaling. J Biol Chem274(13):9038–9044.

Jesudason EP, Masilamoni JG, Ashok BS, Baben B, Arul V, Jesudoss KS,Jebaraj WC, Dhandayuthapani S, Vignesh S, Jayakumar R. 2008. Inhibi-tory effects of short-term administration of DL-alpha-lipoic acid onoxidative vulnerability induced by Abeta amyloid fibrils (25–35) in mice.Mol Cell Biochem 311:145–156.

Jo SA, Ahn K, Kim E, Kim HS, Jo I, Kim DK, Han C, Park MH. 2008.Association of BACE1 gene polymorphism with Alzheimer’s disease inAsian populations: Meta-analysis including Korean samples. DementGeriatr Cogn Disord 25(2):165–169.

Kan R, Wang B, Zhang C, Jin F, Yang Z, Ji S, Lu Z, Zheng C, Wang L. 2005.Genetic association of BACE1 gene polymorphism C786G with late-onset Alzheimer’s disease in Chinese. J Mol Neurosci 25(2):127–131.

Kao SC, Krichevsky AM, Kosik KS, Tsai LH. 2004. BACE1 Suppression byRNA interference in primary cortical neurons. J Biol Chem 279(3):1942–1949.

Kirschling CM, K€olsch H, Frahnert C, Rao ML, Maier W, Heun R. 2003.Polymorphism in the BACE gene influences the risk for Alzheimer’sdisease. Neuroreport 14(9):1243–1246.

Lahiri DK, Ge YW, Maloney B, Wavrant-De Vri�eze F, Hardy J. 2005.Characterization of two APP gene promoter polymorphisms that appearto influence risk of late onset Alzheimer’s disease. Neurobiol Aging26(10):1329–1341.

Lahiri DK, Maloney B, Ge YW. 2006a. BACE1 gene promoter is differen-tially regulated: Detection of a novel promoter region for its cell type-specific regulation. J Mol Neurosci 28(2):193–210.

Lahiri DK, Ge YW, Rogers JT, Sambamurti K, Greig NH, Maloney B. 2006b.Taking down the unindicated co-conspirators of amyloid beta-peptide-mediated neuronal death: Shared gene regulation of BACE1 and APPgenes interacting with CREB, Fe65 and YY1 transcription factors. CurrAlzheimer Res 3(5):475–483.

Lambert JC, Mann DM, Harris JM, Chartier-Harlin MC, Cumming A,Coates J, Lemmon H, StClair D, Iwatsubo T, Lendon C. 2001. The -48 C/Tpolymorphism in the presenilin 1 promoter is associated with anincreased risk of developing Alzheimer’s disease and an increased Abetaload in brain. J Med Genet 38(6):353–355.

Li R, Lindholm K, Yang LB, Yue X, Citron M, Yan R, Beach T, Sue L,Sabbagh M, Cai H, Wong P, Price D, Shen Y. 2004. Amyloid beta peptideload is correlated with increased beta-secretase activity in sporadic

Alzheimer’s disease patients. Proc Natl Acad Sci USA 101(10):3632–3637.

Lin X, Koelsch G, Wu S, Downs D, Dashti A, Tang J. 2000. Human asparticprotease memapsin 2 cleaves the beta-secretase site of beta-amyloidprecursor protein. Proc Natl Acad Sci USA 97(4):1456–1460.

Lv H, Jia L, Jia J. 2008. Promoter polymorphisms which modulate APPexpression may increase susceptibility to Alzheimer’s disease. NeurobiolAging 29(2):194–202.

Masters CL, Simms G, Weinman NA, Multhaup G, McDonald BL,Beyreuther K. 1985. Amyloid plaque core protein in Alzheimer diseaseand Down syndrome. Proc Natl Acad Sci USA 82:4245–4249.

McConlogue L, Buttini M, Anderson JP, Brigham EF, Chen KS, FreedmanSB, Games D, Johnson-Wood K, Lee M, Zeller M, Liu W, Motter R, SinhaS. 2007. Partial reduction of BACE1 has dramatic effects on Alzheimerplaque and synaptic pathology in APP transgenic mice. J Biol Chem282(36):26326–26334.

Mckhann GM, Drachman D, Folstein M, Katzman R, Price D, Stadlan EM.1984. Clinical diagnosis of Alzheimer’s disease: Report of the NINCD-ADRDA work group under the auspices of the Department of Health andHuman Services Task Forces on Alzheimer’s disease. Neurology34:939–944.

Rodr�ıguez-Rodr�ıguez E, Mateo I, Llorca J, S�anchez-Quintana C, Infante J,Garc�ıa-Gorostiaga I, S�anchez-Juan P, Berciano J, Combarros O. 2007.Association of genetic variants of ABCA1 with Alzheimer’s disease risk.Am J Med Genet Part B 144B(7):964–968.

Rossner S, Sastre M, Bourne K, Lichtenthaler SF. 2006. Transcriptional andtranslational regulation of BACE1 expression-implications forAlzheimer’s disease. Prog Neurobiol 79(2):95–111.

Sambamurti K, Kinsey R, Maloney B, Ge YW, Lahiri DK. 2004. Genestructure and organization of the human beta-secretase (BACE) pro-moter. FASEB J 18(9):1034–1036.

Sharp FR, Bernaudin M. 2004. HIF1 and oxygen sensing in the brain. NatRev Neurosci 5(6):437–448.

Shi J, Zhang S, Tang M, Liu X, Li T, Wang Y, Han H, Guo Y, Hao Y, Zheng K,Kong X, Su Z, Tong Y, Ma C. 2004. The 1239G/C polymorphism in exon 5of BACE1 gene may be associated with sporadic Alzheimer’s disease inChinese Hans. Am J Med Genet Part B 124B:54–57.

Theuns J, Brouwers N, Engelborghs S, Sleegers K, Bogaerts V, Corsmit E, DePooter T, van Duijn CM, De Deyn PP, Van Broeckhoven C. 2006.Promoter mutations that increase amyloid precursor-protein expressionare associated with Alzheimer disease. Am J Hum Genet 78(6):936–946.

Todd S, McKnight AJ, Liu WW, Carson R, Heggarty S, McGuinness B,Irvine GB, Craig D, Passmore AP, Johnston JA. 2008. BACE1 poly-morphisms do not influence platelet membrane beta-secretase activity orgenetic susceptibility for Alzheimer’s disease in the Northern Irishpopulation. Neuromolecular Med 10(4):368–376.

Vassar R. 2004. BACE1: The beta-secretase enzyme in Alzheimer’s disease.J Mol Neurosci 23(1–2):105–114.

Wang R, Zhang YW, Sun P, Liu R, Zhang X, Zhang X, Xia K, Xia J, Xu H,Zhang Z. 2006. Transcriptional regulation of PEN-2, a key component ofthe gammasecretase complex, by CREB. Mol Cell Biol 26(4):1347–1354.

Yang LB, Lindholm K, Yan R, Citron M, Xia W, Yang XL, Beach T, Sue L,Wong P, Price D, Li R, Shen Y. 2003. Elevated beta-secretase expressionand enzymatic activity detected in sporadic Alzheimer disease. Nat Med9(1):3–4.

Zhang X, Zhou K, Wang R, Cui J, Lipton SA, Liao FF, Xu H, Zhang YW.2007. Hypoxia-inducible factor 1alpha (HIF-1alpha)-mediated hypoxiaincreases BACE1 expression and beta-amyloid generation. J Biol Chem282(15):10873–10880.

166 AMERICAN JOURNAL OF MEDICAL GENETICS PART B