R

Pr

AGRa

b

a

ARRA

KPPSIS

1

te

rrLsc

Af

0h

Veterinary Immunology and Immunopathology 147 (2012) 170– 179

Contents lists available at SciVerse ScienceDirect

Veterinary Immunology and Immunopathology

j o ur nal ho me p age: w ww.elsev ier .com/ locate /vet imm

esearch paper

rolactin-releasing peptide is a potent mediator of the innate immuneesponse in leukocytes from Salmo salar

lex Romeroa,∗, René Manríqueza, Claudio Alvareza, Cristina Gajardoa, Jorge Vásqueza,udrun Kauselb, Mónica Monrása, Víctor H. Olavarríab, Alejandro Yánezb,icardo Enríqueza, Jaime Figueroab

Laboratory of Biotechnology and Aquatic Pathology, Faculty of Veterinary Science, Universidad Austral, Campus Isla Teja, Valdivia, ChileDepartment of Biochemistry and Microbiology, Faculty of Science, Universidad Austral, Campus Isla Teja, Valdivia, Chile

r t i c l e i n f o

rticle history:eceived 16 January 2012eceived in revised form 10 April 2012ccepted 12 April 2012

eywords:rolactin-releasing peptiderolactinalmo salarnterleukinHK-1 cells

a b s t r a c t

Prolactin (PRL)-releasing peptide (PrRP) is a strong candidate stimulator of pituitary PRLtranscription and secretion in teleosts. However, the role in control of extrapituitary PRLexpression or its effects on innate immunity are unclear even in mammals. To study thepossible presence of PrRP in peripheral organs, PrRP expression patterns and their effect oninnate immunity were characterised in SHK-1 cells and head kidney (HK) leukocytes puri-fied from the salmonid, Salmo salar. We detected immunoreactive cells in leukocytes fromblood and HK of S. salar and found that PrRP mRNA was abundantly expressed in these cells.We have recently reported that physiological concentrations of native PRL, downstream ofneuropeptide PrRP were able to induce expression of pro-inflammatory cytokines and theproduction of reactive oxygen species (ROS) in HK leukocytes and macrophages from S.

salar and Sparus aurata. It is of interest to note that in this work we have revealed thatsynthetic PrRP was able to induce expression of pro-inflammatory cytokines (interleukins)IL-1�, IL-6, IL-8, IL-12 and PRL. We also show here that PrRP increased both (ROS) produc-tion and phagocytosis. Taken together, our results demonstrate for the first time that PrRPmay be a local modulator of innate immune responses in leukocytes from S. salar.

. Introduction

Neuropeptides and their receptors are widely dis-ributed in the peripheral and central nervous systems,ndocrine organs, and central and peripheral lymphoid

Abbreviations: DPI, dibenziodolium chloride; PRL, prolactin; ROS,eactive oxygen species; PKC, protein kinase C; PRL, prolactin; PRLR, PRLeceptor; IL, interleukin; HK, head kidney; Jak2, Janus kinase 2; TLR, Tollike Receptor; PMA, phorbol myristate acetate; NF-�B, a eukaryotic tran-cription factor, nuclear factor kappa-light-chain-enhancer of activated Bells; LPS, lipopolysaccharide; NPY, neuropeptide Y.∗ Corresponding author at: Instituto de Patología Animal, Universidadustral de Chile, Casilla 567, Valdivia, Chile. Tel.: +56 63 293253;

ax: +56 63 293253.E-mail address: alexromero@uach.cl (A. Romero).

165-2427/$ – see front matter © 2012 Elsevier B.V. All rights reserved.ttp://dx.doi.org/10.1016/j.vetimm.2012.04.014

© 2012 Elsevier B.V. All rights reserved.

organs. Neuropeptides released within the lymphoidmicroenvironment and the corresponding neuropeptidereceptors of immune cells represent the frameworkfor neuropeptide-mediating neuroimmune interactions.In mammals, there are 30 neuropeptides that haveimmunomodulatory properties, although further researchmay reveal that there are more (Carpio et al., 2008).Despite this, a limited number of neuropeptides withimmunological functions have been described in fish(Carpio et al., 2008; Mohamed and Khan, 2006; Sakaiet al., 2001; Watanuki et al., 2003). Prolactin (PRL) isa pituitary peptide hormone that shares many proper-

ties with cytokines (a homologous receptor structure,similar signal-transduction pathway and immunomodu-latory action) (Kooijman et al., 1996; Yu-Lee, 2002). Inmammals, PRL mediates its effects on target cells partly

gy and Im

A. Romero et al. / Veterinary Immunolo

through activation of Janus kinase 2 (Jak2) and differentStat proteins, including Stat1 and Stat5 proteins (Schindlerand Darnell, 1995). Activated Stat proteins are translo-cated into the nucleus and subsequently upregulate thetranscription of target promoters that mediate the dif-ferentiative or mitogenic effects of PRL (Li and Rosen,1995; Russell et al., 1996; Wang and Yu-Lee, 1996).We have recently demonstrated, in fish, the capacity ofPRL to promote, through the Jak/Stat5 and NF-�B sig-nalling pathways, the polarization of fish macrophagesto a pro-inflammatory M1/classically-activated pheno-type characterised by the production of pro-inflammatorycytokines (Olavarria et al., 2010). We have also demon-strated, in fish, that protein kinase C (PKC) is required forregulation of the PRL-mediated phosphorylation of NADPHoxidase subunit p47phox, for activation of the NADPH oxi-dase complex and for production of ROS by macrophages.Collectively, our data have identified PRL as a key regu-lator of the activation of fish professional phagocytes andhave demonstrated that cross-talk occurs between TLR/NF-�B, PRLR/Jak/Stat and PKC signalling pathways (Olavarriaet al., 2012, 2010). Although PRL is historically knownas a pituitary hormone, the control of extrapituitary PRLexpression is still poorly understood, at both transcrip-tional and secretory levels (Goffin et al., 2002). In fact, todate, the connection between prolactin-releasing peptide(PrRP) and PRL or a putative extrapituitary PrRP-PRL axisremains unclear. PrRP is a peptide that was initially namedCarassius RFamide (C-RFa), a hypothalamic neuropeptideisolated from the Japanese crucian carp (Carassius auratuslangsdorfii) (Fujimoto et al., 1998). PrRP has been iso-lated from chum salmon (Oncorhynchus keta), Atlanticsalmon (S. salar), tilapia (Oreochromis mossambicus) and seabream (Sparus sarba) (Kwong and Woo, 2008; Montefusco-Siegmund et al., 2006; Moriyama et al., 2002; Seale et al.,2002). The cDNA encoding the prepropeptide encodes fora putative bioactive peptide of 20 amino acids, identicalin all teleost species studied and having a 65% similar-ity to orthologous bovine PrRP20. Immunoreactive fibresfor PrRP have been found in close proximity to PRL cellsin the rostral pars distalis (RPD) of rainbow trout pitu-itary (Moriyama et al., 2002). The peptide was also ableto specifically stimulate PRL release in vitro in tilapia andboth in vivo and in vitro in rainbow trout, which suggeststhat PrRP behaves as a specific prolactin-releasing factor inteleost fish (Fujimoto et al., 2006; Moriyama et al., 2002;Seale et al., 2002). Until now, the PrRP peptide of fish hasbeen associated with increased expression and releasing ofprolactin and the osmotic balance of fresh water (Fujimotoet al., 2006; Moriyama et al., 2002; Seale et al., 2002). Inothers words, there is currently no scientific evidence tosupport the fact that PrRP alone can modulate the immuneresponse, so it would be assumed that the final effect ismediated by PRL.

In this study, we have immunodetected expression ofPrRP in cells localised in HK and peripheral blood of S. salar.The immunoreaction observed was strong in cytoplasm of

neutrophils and monocytes. The synthetic PrRP increasedROS production in a dose-dependent way in HK leukocytesand pre-stimulation with PrRP of SHK-1 macrophage cellsproduced an increase in phagocytosis and in expression of

munopathology 147 (2012) 170– 179 171

interleukins and prolactin. The in vitro effect of the peptidewas also observed in vivo. An intraperitoneal (i.p.) injectionof the peptide increased the mRNA of interleukins IL-12and IL-8 in HK and spleen and of prolactin in HK. Our col-lective results provide the first evidence that PrRP may be apotent mediator of the innate immune response and a localmodulator of extrapituitary PRL expression in S. salar.

2. Materials and methods

2.1. Animals

Atlantic salmon (S. salar) of 25–30 g were supplied andmaintained by SGS Chile Laboratory, Puerto Montt, Chilein a recirculation unit supplied with freshwater at 9–10 ◦Cin shaded tanks. They were fed commercial pellets, of lowlipid content, once every 2 days. Thirty fish were used.Each was given a one-time intraperitoneal injection of syn-thetic PrRP (GenScript Corporation) 250 ng/g body weightor a PBS vehicle. Following peptide administration, the fishwere anaesthetised and decapitated and HK and spleensamples were collected at 2, 8, 24, 48 and 72 h.

2.2. Immunohistochemistry

Immunohistochemistry methods were carried out asdescribed by Montefusco-Siegmund et al. (2006), inimprints made from HK and peripheral blood. An anti-synthetic PrRP rabbit serum was used for the assays. Thisantiserum was raised against C-terminal PrRP decapeptide(GRGVRPIGRF) (Wang et al., 2000). Note that these aminoacids are included in the 20 amino acid residues of thebioactive PrRP, which is 100% conserved in all fish speciesstudied so far (Watanabe and Kaneko, 2010).

2.3. Isolation of leukocytes from S. salar

Briefly, the head kidney (HK; ca 0.5 g) was removedand placed in 500 �l of Leibovitz L-15 Medium sup-plemented with bovine serum and 10 U/ml of heparin(Sigma–Aldrich). The HK was dissociated with forceps andfiltered with a nylon mesh (37 �m). Dissociated cells wereplaced on 34%/51% Percoll cushions and centrifuged to3000 × g for 30 min. The leukocyte band was harvested,washed with phosphate-buffered saline (pH 7.6) and sus-pended in L-15 Medium containing 10% bovine serum.Viable leukocytes were counted by Trypan blue dye exclu-sion (viability > 95%). Leukocytes were used for the analysisof O2

− production as described below.

2.4. Respiratory-burst assays

Production of the ROS from HK leukocytes was deter-mined by the reduction of nitroblue tetrazolium (NBT) asdescribed previously by Sakai et al. (1996). Cell numberswere adjusted to 2.5 × 106 cells ml−1 in L-15 Medium sup-plemented with 10% bovine serum. A volume of 100 �l

of this suspension was seeded into a 96-well microtitreplate (Nunc, USA). After 16 h at 20 ◦C, unattached cellswere washed off with culture medium. The cell monolay-ers were incubated in 100 �l of L-15 Medium PrRP (10 nM,

1 gy and Im

1icitwtctow(wcsaas

2

tEtmpbTqwotr

2

m(ob212owia

2

SItm1uf(

72 A. Romero et al. / Veterinary Immunolo

00 nM and 1 �M), lipopolysaccharide (LPS: 50 �g/ml) andncubated for 120 min at 20 ◦C. DPI (Sigma–Aldrich) at aoncentration of 10 �M was used as an NADPH oxidasenhibitor. SHK-1 cells were cultured under the same condi-ions as those for HK leukocytes and the cellular monolayeras treated with PrRP and LPS as described below. After

he PrRP incubation, 100 �l of fresh medium was addedontaining 1 mg/ml NBT and 1 �g/ml PMA. The NBT reduc-ion was halted by the addition of methanol, after removalf the medium from the cells. The formazan in each wellas dissolved in 120 �l of 2 M KOH and 140 �l of DMSO

Sigma–Aldrich), and the OD620 of this solution was readith an ELISA reader (Sakai et al., 1996). A well without

ells was used as a blank. It was incubated with the NBTolution and subjected to the exact same fixing, washingnd solubilisation steps. Triplicates were used for each vari-ble analysed and repeated with at least two independentamples.

.5. Phagocytosis assay

Phagocytotic activity of SHK-1 cells was measured withhe Vybrant Phagocytosis Assay Kit (Molecular Probes,ugene, OR, USA) according to the manufacturer’s instruc-ions. Briefly, 1 × 105 cells were seeded into 96-well

icroplates and incubated in L-15 medium for 1 h in theresence or absence of 100 nM and 1 �M of PrRP, followedy 2 h incubation with fluorescein-labelled Escherichia coli.he fluorescence from non-internalised E. coli was thenuenched by the addition of Trypan blue and the samplesere read with an ELISA reader. LPS at a concentration

f 50 �g/ml (Sigma–Aldrich), was used as a positive con-rol. In all cases, each assay was performed in triplicate andepeated with at least two independent samples.

.6. Cell cultures and treatments

SHK-1 cells were cultured in L-15 Medium supple-ented with 10% bovine serum at 20 ◦C in 75 cm2 flasks

Costar, Fisher Scientific, Ottawa, ON, Canada) with-ut antibiotics. Cells used in this study were passagedetween 61 and 63 times. SHK-1 cells were seeded in5 cm2 flasks (Costar, Fisher Scientific) at approximately

× 106 cells/flask, 72 h before stimulation, and cultured at0 ◦C. Medium was then removed from each flask and 5 mlf fresh medium, containing 100 nM PrRP, was added: cellsere then incubated at 20 ◦C for 2, 4, 8 and 12 h. The cells

ncubated with medium and dilution buffer were only useds controls. Each treatment was performed in triplicate.

.7. Analysis of gene expression

Following stimulation, total RNA was isolated fromHK-1 cells or HK of S. salar using the SV Total RNAsolation System (Promega) according to the manufac-urer’s instructions. RNA concentrations were estimated by

easuring the absorbance at 260 nm (conversion factor:

OD = 40 �g RNA/ml) and samples were stored at −80 ◦Cntil ready for reverse transcription. cDNA was synthesisedrom 5 �g of total RNA by M-MLV Reverse TranscriptaseM-MLV RT: Promega) according to the manufacturer’s

munopathology 147 (2012) 170– 179

instructions, with Oligo(dT) 12–18 primer (Promega) andused as a template for PCR. Amplifications were performedusing a LightCycler rapid thermal cycler (Roche Diagnos-tics). Reactions (20 �l) included 2 �l of template cDNA,0.5 �M primers and components provided by LightCyclerFastStart DNA Master SYBR Green (Roche). Templates forstandard curves were prepared as described. Primers forreal-time q-PCR of �-actin, which was used as a referencegene and IL-1�, IL-6, IL-8, IL-12 and PRL were as describedin Table 1, and based on previously published Atlanticsalmon sequences. The PCR products of each primer pairwere purified and sequenced, and used as standards forreal-time q-PCR. Cycle conditions were for 5 min at 95 ◦C,followed by 40 cycles including denaturation for 10 s at95 ◦C, annealing for 10 s at 60 ◦C and extension for 30 s at72 ◦C. Ten-fold dilutions of the standards (between 1 and10−5 ng) and a blank that did not contain cDNA were run ineach real-time q-PCR, along with the triplicate samples. Therelationship between the threshold cycle (Ct) and log (RNA)was linear (−3.18 < slope < −3.02) for all reactions. Meltingcurve analysis of amplification products was performed atthe end of each PCR to confirm that only one PCR productwas amplified and detected. The expression level of ILs wasanalysed using the comparative threshold cycle method(2−��CT) with �-actin as the control. For PrRP mRNA detec-tion, specific primers were used to confirm expression ofthe peptide in HK according to the method described byMontefusco-Siegmund et al. (2006). In addition, specificprimers were designed for the putative receptor of S. salarPrRP (accession number NM 001123593.1: Table 2). In allcases, each PCR was performed in triplicate and repeatedwith at least two independent samples.

2.8. Statistical analysis

All data are shown as means ± SE. Differences wereevaluated using ANOVA, followed by the Student’s t-test.Statistical significance was defined as p < 0.05.

3. Results

3.1. Immunodetection of PrRP in immune cells

We have immunodetected PrRP expression in cellslocalised in HK and in peripheral blood of S. salar. Theimmunoreaction was strong in the cytoplasm of variouscells located in the HK, mainly neutrophils and mono-cytes (Fig. 1A and B). We observe that not all cells wereimmunoreactive for the peptide in this organ, indicative ofa differential expression of PrRP (Fig. 1C and D). The pep-tide was also strongly immunodetected in the cytoplasmof neutrophils and monocyte cells in blood (Fig. 2A, B, Dand E). No staining was observed in the same cells whenthe antibody was pre-absorbed with excess synthetic PrRPpeptide prior to immunoreaction (Fig. 2C and F). The HKexpression of PrRP was confirmed by specific RT-PCR usingHK total RNA from two fish. The RT-PCR product originated

for PrRP (200 bp), supports the presence of the PrRP tran-script in HK of S. salar (Fig. 1E). Expression of PrRP in HKsuggests that its receptor and prolactin are present in cellsof this tissue. This was confirmed by RT-PCR. The specific

A. Romero et al. / Veterinary Immunology and Immunopathology 147 (2012) 170– 179 173

Table 1Real time qRT-PCR primer sequences.

Gene Accession number GenBank Primer Sequence (5′-3′)

IL-1� NM 001123582.1 Forward CAAGCTGCCTCAGGGTCTReverse CGCCACCCTTTAACCTCTCC

IL-6 FR715329.1 Forward GGAGGAGTTTCAGAAGCCCGReverse TGGTGGTGGAGCAAAGAGTCT

IL-8 HM162835 Forward TACGTAGCTCCCTCCGGCTGReverse CTTATGGCTGCACCTTTAAC

IL-12/p40 BT049114.1 Forward CTTATGGCTGCACCTTTAACReverse GTTCAAACTCCAACCCTCCA

Prolactin NM 001123668 Forward CCCTCCTCCCAGTACATTTCTTReverse CATGTTTCTGGTCGCATTTTGG

�-Actin NM 001123525.1 Forward GCCGGGTTCGCTGGAGATGAReverse GCGTGGGGCAGAGCGTAACC

Table 2Convectional RT-PCR primer sequences.

Gene Accession number GenBank Primer Sequence (5′-3′)

PrRP receptor NM 001123593.1 Forward GCATCCTCTGAAGAAGCGACCReverse ATGTCACGCAGTACGTTGAACACG

PrRP NM 001123641

RT-PCR products originated for the PrRP receptor (417 bp)and for prolactin (179 bp) were detected in HK purifiedleukocytes and SHK-1 cells, demonstrating expression ofmRNA in these cells (Fig. 3).

3.2. PrRP activates the respiratory burst of S. salar

leukocytes

Having demonstrated the presence of PrRP in our studymodel, we next examined the respiratory burst (ROS

Fig. 1. Teleost PrRP is expressed in head kidney (HK) of S. salar. (A and B) Immunorkidney (B, white arrows). (C and D) Controls with antibody pre-absorbed with synRT-PCR showing PrRP mRNA expression in HK of S. salar (HK, head kidney from fiDNA standard.

Forward CGACAACAGAAGTCCAGACATAGReverse GCCAGTCTGCGTCCTCCCCTC

production) in leukocytes stimulated with the peptide. Pro-duction of the ROS in S. salar leukocyte cells treated with thepeptide increased significantly compared to cells withoutthe peptide (first point), which received only PMA (Fig. 4A).Incubation with 10 nM and 100 nM of PrRP significantlyincreased ROS production although the highest level of

stimulation was seen in leukocytes treated with 1000 nMPrRP. We also found that PrRP increased production of ROSin the SHK-1 cell line (Fig. 4 B). In addition, the leukocytesand SHK-1 significantly increased the ROS production in

eaction of PrRP in the cytoplasm of monocytes and neutrophils from headthetic PrRP peptide. (E) Amplification product (200 bp) of a representativesh 1 and 2; (+) positive control; (−) absence of reverse transcriptase; St,

174 A. Romero et al. / Veterinary Immunology and Immunopathology 147 (2012) 170– 179

F tive moni with sy

rotipTm

3

PSiflp(wl

F(

ig. 2. PrRP is expressed in blood cells of S. salar. (A and E) Immunoreacmmunopositive for PrRP. (C and F) Controls with antibody pre-absorbed

esponse to classical stimulator as LPS and DPI, a NADPHxidase inhibitor, decreased the ROS production in both cellypes (Fig. 4C. Therefore, in both cases, PrRP significantlyncreased the basal ROS production (Fig. 4A and B), and inurified leukocytes (Fig. 4A), a dose effect was detected.hese results clearly demonstrate that the peptide has aodulator effect on the activity of these cells.

.3. PrRP induces phagocytosis in S. salar leukocytes

The above results prompted us to examine whetherrRP was also able to induce phagocytic activity in theHK-1 cell line. Incubation with 100 mM peptide resultedn a significant increase in phagocytic activity of theuorescein-labelled E. coli compared to control without

eptide. This result is similar to that obtained with LPSpositive control). It is worth noting that incubation of cellsith 1000 nM peptide had no effect on this innate immuno-

ogical parameter (Fig. 5).

ig. 3. Prolactin and PrRP receptor are expressed in SHK-1 cells and HK leukoc179 bp), PrRP receptor (417 bp) and �-actin mRNA expression in SHK-1 cells and

ocytes for PrRP. (D) Higher magnification of square in A. (B) Neutrophilnthetic PrRP peptide.

3.4. PrRP-induced interleukins (ILs) gene expression

In order to identify the role of PrRP in interleukin (IL)gene expression, SHK-1 cells were incubated with 100 nMof the peptide for 2, 6, 8 and 12 h. Transcripts of IL-1�, IL-6,IL-8 and IL-12 were determined by RT-PCR. Transcript of�-actin was amplified as an endogenous reference gene.These ILs were found to be constitutively expressed inthis cell line and a significant increase with respect to thecontrol occurred of IL-1beta, IL-6 and IL-8 mRNA expres-sion within the first 4 h post-stimulation with the peptide(Fig. 6A, B, C). In parallel, we performed a time-course geneexpression study of IL-8 and IL-12, 0, 2, 8, 24, 48 and 72 hpost-injection with PrRP. The results revealed that the pep-tide showed no effect on IL-8 expression, which depicteda low level of expression in both organs (Figs. 7A and 8A).

The results of IL-12 expression showed significant increaseof mRNA expression, with a peak at 2 h with 10- and 40-fold increase in HK and spleen respectively (Figs. 7B and8B). Finally, Figs. 7 and 8 showed that IL-12 and IL-8 were

ytes of S. salar. Electrophoretic analysis of RT-PCR products of prolactin HK leukocytes. St, DNA standard.

A. Romero et al. / Veterinary Immunology and Immunopathology 147 (2012) 170– 179 175

Fig. 4. PrRP enhances the superoxide anion in HK leukocytes of S. salar (A) and SHK-1 cell line (B). The cells were incubated with 0, 10, 100 and 1000 nMe tetrar HK le

*p < 0.05

synthetic PrRP and the ROS were measured as the reduction of nitroblureduction after 90 min of incubation. **p < 0.005 vs. 0 (PMA alone), n = 4 foand 10 �M DPI were used as positive and negative control respectively. *

significantly stimulated by LPS treatment in kidney, at lev-els above those observed for PrRP and in a tissue specific

manner. The tissue specific pattern of IL-12 expression inresponse to LPS treatment might reflect specific situationsin vivo, similar to observation of IL-12 mRNA expressionresponse to infection in sea bass (Nascimento et al., 2007).

Fig. 5. PrRP pre-stimulation enhances phagocytosis of SHK-1, the cellline incubated with fluorescein-labelled E. coli for 2 h. The quantitativephagocytosis assay was performed in the presence or absence of 100 and1000 nM PrRP. Extracellular fluorescence was quenched with Trypan bluetreatment. LPS at 50 �g/ml was used as a positive control. Averages (n = 3)and SE are given. **p < 0.05 vs. medium.

zolium (NBT). Values are mean ± SE at 620 nm above spontaneous NBTukocytes and n = 8 for SHK-1 cells. (C) Cells treatment with 50 �g/ml LPS

vs. medium (PMA alone).

3.5. PrRP-induced PRL gene expression

We next examined the role of PrRP on PRL expressionby incubating SHK-1 cells with PrRP or by injecting S. salarwith the peptide, in a time-course expression study asdescribed above. Notably, stimulation of SHK-1 cells withPrRP resulted in a strong expression of PRL, at 2 and 4 h,showing a 20- and 60-fold increase respectively (Fig. 9A).It is of interest to note that treatment of S. salar with PrRPstimuli induced a lower level of PRL expression, only abouta 3-fold increase at 24 h (Fig. 9B).

Taken as a whole, these results demonstrate that PrRPis able to modulate interleukin and PRL mRNA expressionin S. salar leukocytes and strongly suggest that the pep-tide functions as a local modulator of the innate immuneresponse.

4. Discussion

Interactions between the endocrine and immune sys-tems via hormones and cytokines are important foradjusting defence mechanisms in both mammals andfish (Gonzalez-Rey, 2010; Yada and Nakanishi, 2002).More than 20 different neuroendocrine hormones and/or

mRNA for hormones, including ACTH, thyroid stimulat-ing hormone (TSH), GH, CRH and PRL are expressed bylymphocytes and/or monocytes (Blalock, 1994). Our ownstudy has investigated the particular effects of PRL in fish

176 A. Romero et al. / Veterinary Immunology and Immunopathology 147 (2012) 170– 179

Fig. 6. PrRP induces expression of interleukins in SHK-1 cells. Gene expression of IL-1 (A), IL-8 (B), IL-6 (C) and IL-12 (D) is shown. Cultured SHK-1 cells wereincubated with 100 nM PrRP and gene expression was determined 2, 4, 8 and 12 h after treatment. Data are shown as an x-fold increase of mRNA expressionc le and sa

lnltmA(co(aUtp2tccppbPbn

ompared to non-stimulated control cells incubated with only PrRP vehicnd SE are given. **p < 0.05.

eukocytes, from the standpoint of immunity and its sig-alling pathways. We are the first to show evidence that

inks PRL with an immunological process: the ROS produc-ion and expression of pro-inflammatory cytokines, both

ediated by Jak/Stat, NF-�B and PKC signalling pathways. major source of ROS in phagocytes is NADPH oxidase

el Benna et al., 1994). The NADPH oxidase of phago-ytic cells has a membrane component that is composedf a 22 kDa a-subunit (p22phox) and a 91 kDa b-subunitgp91phox). Cytosolic components are p40phox, p47phox,nd p67phox and Rac, a small molecular weight G-protein.sing pharmacological inhibitors of Jak and PKC, we found

hat PRL increased NADPH oxidase activity in sea breamhagocytes via the Jak/Stat/PKC pathway (Olavarria et al.,010). We also demonstrated that PRL was not only ableo prime the respiratory burst of sea bream phagocytes butould also elicit expression of two major pro-inflammatoryytokines, IL-1� and TNF-�, in macrophages, a cellularhenomenon mediated by Jak/Stat and NF-�B signallingathways (Olavarria et al., 2012, 2010). Therefore, to the

est of our knowledge, this is the first demonstration thatRL modulates activation of phagocytes through cross-talketween TLR/NF-�B, PRLR/Jak/Stat and PRLR/Jak/PKC sig-alling pathways. In this study, we evaluated the effect of

tandardised for the endogenous reference gene �-actin. Averages (n = 3)

PrRP on innate immunity in S. salar. This peptide, classicallylocated in the hypothalamus and pituitary, was detected inthe cytoplasm of blood and HK leukocytes in S. salar byimmunohistochemical assays. Concomitant to tissue pep-tide localisation, we demonstrated peptide expression inHK with RT-PCR analysis using specific primers describedfor PrRP identification in hypothalamus and pituitary of S.salar (Montefusco-Siegmund et al., 2006) (Figs. 1, 2 and 3).Previous studies have described the extra-CNS expressionof this peptide in the intestine, kidney, ovary, liver, gilland liver (Akiyoshi et al., 2005; Kwong and Woo, 2008;Sakamoto et al., 2005). Our finding in leukocytes is thusof the utmost interest, as these cells play a pivotal role ininnate immunity in fish. Our conclusion that PrRP is syn-thesised in Atlantic salmon leukocytes suggest that PrRPbehaves as a modulator of the immune response. To gainsome insight into the role played by PrRP in activationof professional phagocytes in fish, we stimulated S. salarleukocytes and SHK-1 cells with different concentrationsof synthetic S. salar PrRP. We analysed the time course

of ROS production in HK leukocytes treated with PrRPdoses of between 10 and 1000 nM. These were doses pre-viously used to study the hypophysiotropic activity of thepeptide in trout and tilapia (Moriyama et al., 2002; Seale

A. Romero et al. / Veterinary Immunology and Immunopathology 147 (2012) 170– 179 177

Fig. 7. Effect of intraperitoneal (i.p.) PrRP injection on IL-8 (A) and IL-12 (B) gene expression in head kidney of S. salar. Fish were injected i.p.with 250 ng PrRP/g body weight and 10 �g LPS/g body weight and geneexpression was determined 2, 8, 24, 48 and 72 h post-injection. Messenger Fig. 8. Effect of i.p. PrRP injection on IL-8 (A) and IL-12 (B) gene expression

in spleen of S. salar. Fish were injected i.p. with 250 ng PrRP/g body weightand 10 �g LPS/g body weight and gene expression were determined 2, 8,24, 48 and 72 h post-injection. Messenger RNA expression is shown as an

RNA expression is shown as an x-fold increase compared to non-treatedcontrol animals at time 0 and is standardised for the endogenous referencegene �-actin. Averages (n = 3) and SE are given. **p < 0.05.

et al., 2002). As shown in Fig. 4, PrRP gradually increasedthe amount of ROS triggered by PMA, though PrRP wasunable to trigger the respiratory burst of S. salar leukocyteswithout PMA (data not shown). To confirm the involve-ment of NADPH oxidase, we examined the effect of DPI,a flavin-containing enzyme inhibitor. The PrRP-mediatedROS increase observed at 1.5 h was completely inhibited by10 �M DPI (Fig. 4A and B). This finding is consistent withour hypothesis that ROS production in S. salar leukocytesis induced by PrRP. However, we are unsure as to whetherNADPH oxidase activation and ROS production is a director an indirect effect of PrRP. In mammals, signal transduc-tion pathways for the PrRP receptor stimulate extracellularsignal-related kinases (ERKs) and protein kinase C (PKC)(Kimura et al., 2000), kinases that are required for phospho-rylation of p47phox (Dewas et al., 2000; Park et al., 2001;Waite et al., 1997). Several other studies have also shownthat PKC isforms, mainly PKC�, �II and �, are present inneutrophils and can phosphorylate p47phox (Chen et al.,2003; el Benna et al., 1994). The observation that PMA canstimulate p47phox phosphorylation reinforces the notionthat PKC promotes assembly of the NADPH oxidase com-plex. However, if we assume that PrRP stimulates thesynthesis and release of PRL, we could imagine an indi-rect effect. We believe that the in vitro effect of PrPR on

expression of ILs, phagocytosis and ROS in leukocytes maybe mediated by prolactin, the eventual release of whichmay be triggered by PrRP. However a demonstration ofthis hypothesis is not the focus of this paper. Our aim here

x-fold increase compared to non-treated control animals at time 0 and isstandardised for the endogenous reference gene �-actin. Averages (n = 3)and SE are given. **p < 0.05.

is to examine the effects of PrPR on these immunologicalparameters in salmon.

We next examined whether phagocytosis offluorescence-labelled E. coli is subjected to modula-tion by this peptide. A low dose (100 nM) of PrRP increasedphagocytosis of E. coli, concomitant with the respiratoryburst. At a higher PrRP concentration (1 �M), phagocytosislevels did not increase to more than control levels, but therespiratory burst was augmented. A similar effect was seenfor the neuropeptide Y (NPY) in mammalian neutrophils,which could be related to the presence of different NPYreceptors in these cells (Bedoui et al., 2008). However,for mammals and fish, only one PrRP receptor has beendescribed. This suggests that for PrRP present at low doses,the pathogen is taken up and intracellular mechanisms arein charge of its elimination.

Finally, we examined whether PrRP was also able toinduce expression of interleukins secreted by activatedmonocytes and macrophages: IL-1�, IL-6, IL-8 and IL12.Incubation of SHK-1 with the peptide (100 nM), signifi-cantly increased IL-12 and IL-8 expression at 2 h and IL-1� and IL-6 expression at 4 h after stimulation (Fig. 6).These pro-inflammatory mediators are important because

they activate recruitment of neutrophils and monocytesand thus activation of the adaptive immune response. Webelieve that this ILs expression may be mediated by PrRPbinding to its cellular receptor, a mechanism that has been

178 A. Romero et al. / Veterinary Immunology and Im

Fig. 9. (A) PrRP increases PRL gene expression in cultured SHK-1 cells. Thiscell line was incubated with 100 nM PrRP and PRL expression was deter-mined 2, 4, 8 and 12 h after treatment. Data are shown as an x-fold increaseof mRNA expression compared to non-stimulated control cells incubatedwith only PrRP vehicle and standardised for the endogenous referencegene �-actin. Averages (n = 3) and SE are given. **p < 0.05. (B) Effect of i.p.PrRP injection on PRL gene expression in HK of S. salar. Fish were injectedi.p. with 250 ng PrRP/g body weight and 10 �g LPS/g body weight and geneexpression was determined 2, 8, 24, 48 and 72 h post-injection. MessengerRNA expression is shown as an x-fold increase compared to non-treatedcg

dtKsitositmmPPHssepih

The effect of prolactin on fanning behavior in the male three-

ontrol animals at time 0 and is standardised for the endogenous referenceene �-actin. Averages (n = 3) and SE are given. **p < 0.05.

escribed in tilapia. Detection by RT-PCR of PrRP recep-or mRNA in kidney and spleen in tilapia (Watanabe andaneko, 2010) and in HK leukocytes and SHK-1 cells (Fig. 3),uggests the presence of this ligand-receptor system in thennate immune response of fish. While our results suggesthat the peptide would be directly involved as a regulatorf the immune response in fish, this study also demon-trated its effect on prolactin expression using in vitro andn vivo RT-PCR assays. This is, in fact, the first time thathe potential effect of PrRP on extra-pituitary prolactin

RNA expression has been demonstrated in fish. This isost interesting if we consider a possible indirect role of

rRP on immune cell activity mediated by the hormoneRL. Increased mRNA levels of prolactin in SHK-1 cells andK (Fig. 9) were concomitant with an increased expres-

ion of interleukins in cultured cells and extracted fish cells,uggesting a direct and/or indirect action of PrRP in param-ters of the immune response in teleosts. Various are the

hysiological functions that have been attributed to PRL

n fish, such as a synergism with the production of steroidormones in the gonads (de Ruiter et al., 1986), pigment

munopathology 147 (2012) 170– 179

dispersion in the tegumentary chromatophores (Kitta et al.,1993), and in reproduction (Cavaco et al., 2003). This hor-mone is also known to enhance immune functions in fish asit does in mammals (Harris and Bird, 2000). The phagocyticactivity of fish leukocytes is stimulated by administra-tion of PRL (Harris and Bird, 2000). PRL was also foundto enhance the mitotic activity of leukocytes in the chumsalmon (Oncorhynchus keta) and it is required for mainte-nance of circulating levels of immunoglobulin M (IgM) inthe rainbow trout (Oncorhynchus mykiss) (Sakai et al., 1996;Yada et al., 1999). In addition, in mammals, physiologicalconcentrations of PRL are able to induce production of sev-eral cytokines in macrophages, including IL-1�, IL-12, andIFN-g and PRL hormone has also been described to be anactivator of IL-1� and ROS production in phagocytes viaJak/Stat and NF-�B signalling pathways, as in vertebrates(Olavarria et al., 2010), making it possible that PrRP has anindirect effect on the activity of immune cells and tissuesin teleost fish.

In conclusion, we have shown here that PrRP isexpressed in leukocytes of HK and peripheral blood of S.salar and we have demonstrated that this peptide is able topromote ROS production in HK S. salar leukocytes in a dose-dependent manner. We also confirmed the effect of PrRP onphagocytosis of E. coli in SHK-1 cells, as well as showed asignificant increase of mRNA ILs and prolactin mRNAs inthe same cells. Finally, an intraperitoneal injection of PrRPin S. salar induced an increase in IL-12 expression, concomi-tant with the rise of PRL mRNA, suggesting that PrRP maybehave as a new immunomodulator in teleost fish.

Acknowledgements

This work was supported by Grant Fondecyt 1080571,Fondecyt 1070724 Chile and DID UACh. We appreciateall the support from Dr. Marc Muller from Laboratoire deBiologie Moleculaire et de Genie Genetique, Universite deLiege, Belgium.

References

Akiyoshi, H., Inoue, A., Fujimoto, M., 2005. Comparative immunohisto-chemical study of Carassius RFamide localization in teleost guts indifferent salinity habitats. Zoolog. Sci. 22, 57–63.

Bedoui, S., Kromer, A., Gebhardt, T., Jacobs, R., Raber, K., Dimitrijevic, M.,Heine, J., von Horsten, S., 2008. Neuropeptide Y receptor-specificallymodulates human neutrophil function. J. Neuroimmunol. 195, 88–95.

Blalock, J.E., 1994. Shared ligands and receptors as a molecular mecha-nism for communication between the immune and neuroendocrinesystems. Ann. N. Y. Acad. Sci. 741, 292–298.

Carpio, Y., Lugo, J.M., Leon, K., Morales, R., Estrada, M.P., 2008.Novel function of recombinant pituitary adenylate cyclase-activatingpolypeptide as stimulator of innate immunity in African catfish (Clar-ias gariepinus) fry. Fish Shellfish Immunol. 25, 439–445.

Cavaco, J.E., Santos, C.R., Ingleton, P.M., Canario, A.V., Power, D.M., 2003.Quantification of prolactin (PRL) and PRL receptor messenger RNAin gilthead seabream (Sparus aurata) after treatment with estradiol-17beta. Biol. Reprod. 68, 588–594.

Chen, Q., Powell, D.W., Rane, M.J., Singh, S., Butt, W., Klein, J.B., McLeish,K.R., 2003. Akt phosphorylates p47phox and mediates respiratoryburst activity in human neutrophils. J. Immunol. 170, 5302–5308.

de Ruiter, A.J., Wendelaar Bonga, S.E., Slijkhuis, H., Baggerman, B., 1986.

spined stickleback Gasterosteus aculeatus L. Gen. Comp. Endocrinol.64, 273–283.

Dewas, C., Fay, M., Gougerot-Pocidalo, M.A., El-Benna, J., 2000. Themitogen-activated protein kinase extracellular signal-regulated

gy and Im

A. Romero et al. / Veterinary Immunolo

kinase 1/2 pathway is involved in formyl-methionyl-leucyl-phenylalanine-induced p47phox phosphorylation in humanneutrophils. J. Immunol. 165, 5238–5244.

el Benna, J., Faust, L.P., Babior, B.M., 1994. The phosphorylation of therespiratory burst oxidase component p47phox during neutrophil acti-vation. Phosphorylation of sites recognized by protein kinase C and byproline-directed kinases. J. Biol. Chem. 269, 23431–23436.

Fujimoto, M., Sakamoto, T., Kanetoh, T., Osaka, M., Moriyama, S., 2006.Prolactin-releasing peptide is essential to maintain the prolactinlevel and osmotic balance in freshwater teleost fish. Peptides 27,1104–1109.

Fujimoto, M., Takeshita, K., Wang, X., Takabatake, I., Fujisawa, Y., Teranishi,H., Ohtani, M., Muneoka, Y., Ohta, S., 1998. Isolation and characteriza-tion of a novel bioactive peptide, Carassius RFamide (C-RFa), from thebrain of the Japanese crucian carp. Biochem. Biophys. Res. Commun.242, 436–440.

Goffin, V., Binart, N., Touraine, P., Kelly, P.A., 2002. Prolactin: the newbiology of an old hormone. Annu. Rev. Physiol. 64, 47–67.

Gonzalez-Rey, E., 2010. Keeping the balance between immune toleranceand pathogen immunity with endogenous neuropeptides. Neuroim-munomodulation 17, 161–164.

Harris, J., Bird, D.J., 2000. Modulation of the fish immune system by hor-mones. Vet. Immunol. Immunopathol. 77, 163–176.

Kimura, A., Ohmichi, M., Tasaka, K., Kanda, Y., Ikegami, H., Hayakawa, J.,Hisamoto, K., Morishige, K., Hinuma, S., Kurachi, H., Murata, Y., 2000.Prolactin-releasing peptide activation of the prolactin promoter is dif-ferentially mediated by extracellular signal-regulated protein kinaseand c-Jun N-terminal protein kinase. J. Biol. Chem. 275, 3667–3674.

Kitta, K., Makino, M., Oshima, N., Bern, H.A., 1993. Effects of prolactins onthe chromatophores of the tilapia Oreochromis niloticus. Gen. Comp.Endocrinol. 92, 355–365.

Kooijman, R., Hooghe-Peters, E.L., Hooghe, R., 1996. Prolactin, growth hor-mone, and insulin-like growth factor-I in the immune system. Adv.Immunol. 63, 377–454.

Kwong, A.K., Woo, N.Y., 2008. Prolactin-releasing peptide, a possible mod-ulator of prolactin in the euryhaline silver sea bream (Sparus sarba): amolecular study. Gen. Comp. Endocrinol. 158, 154–160.

Li, S., Rosen, J.M., 1995. Nuclear factor I and mammary gland factor (STAT5)play a critical role in regulating rat whey acidic protein gene expres-sion in transgenic mice. Mol. Cell. Biol. 15, 2063–2070.

Mohamed, J.S., Khan, I.A., 2006. Molecular cloning and differential expres-sion of three GnRH mRNAs in discrete brain areas and lymphocytes inred drum. J. Endocrinol. 188, 407–416.

Montefusco-Siegmund, R.A., Romero, A., Kausel, G., Muller, M., Fujimoto,M., Figueroa, J., 2006. Cloning of the prepro C-RFa gene and brainlocalization of the active peptide in Salmo salar. Cell Tissue Res. 325,277–285.

Moriyama, S., Ito, T., Takahashi, A., Amano, M., Sower, S.A., Hirano, T.,Yamamori, K., Kawauchi, H., 2002. A homolog of mammalian PRL-releasing peptide (fish arginyl-phenylalanyl-amide peptide) is a majorhypothalamic peptide of PRL release in teleost fish. Endocrinology 143,2071–2079.

Nascimento, D.S., do Vale, A., Tomas, A.M., Zou, J., Secombes, C.J.,dos Santos, N.M., 2007. Cloning, promoter analysis and expres-

sion in response to bacterial exposure of sea bass (Dicentrarchuslabrax L.) interleukin-12 p40 and p35 subunits. Mol. Immunol. 44,2277–2291.

Olavarria, V.H., Figueroa, J.E., Mulero, V., 2012. Prolactin-induced activa-tion of phagocyte NADPH oxidase in the teleost fish gilthead seabream

munopathology 147 (2012) 170– 179 179

involves the phosphorylation of p47phox by protein kinase C. Dev.Comp. Immunol. 36, 216–221.

Olavarria, V.H., Sepulcre, M.P., Figueroa, J.E., Mulero, V., 2010. Prolactin-induced production of reactive oxygen species and IL-1beta inleukocytes from the bony fish gilthead seabream involves Jak/Stat andNF-kappaB signaling pathways. J. Immunol. 185, 3873–3883.

Park, H.S., Lee, S.M., Lee, J.H., Kim, Y.S., Bae, Y.S., Park, J.W., 2001. Phospho-rylation of the leucocyte NADPH oxidase subunit p47(phox) by caseinkinase 2: conformation-dependent phosphorylation and modulationof oxidase activity. Biochem. J. 358, 783–790.

Russell, D.L., Norman, R.L., Dajee, M., Liu, X., Hennighausen, L., Richards,J.S., 1996. Prolactin-induced activation and binding of stat proteins tothe IL-6RE of the alpha 2-macroglobulin (alpha 2 M) promoter: rela-tion to the expression of alpha 2 M in the rat ovary. Biol. Reprod. 55,1029–1038.

Sakai, M., Kobayashi, M., Kawauchi, H., 1996. In vitro activation of fishphagocytic cells by GH, prolactin and somatolactin. J. Endocrinol. 151,113–118.

Sakai, M., Yamaguchi, T., Watanuki, H., Yasuda, A., Takahashi, A., 2001.Modulation of fish phagocytic cells by N-terminal peptides of proop-iomelanocortin (NPP). J. Exp. Zool. 290, 341–346.

Sakamoto, T., Amano, M., Hyodo, S., Moriyama, S., Takahashi, A., Kawauchi,H., Ando, M., 2005. Expression of prolactin-releasing peptide andprolactin in the euryhaline mudskippers (Periophthalmus modestus):prolactin-releasing peptide as a primary regulator of prolactin. J. Mol.Endocrinol. 34, 825–834.

Schindler, C., Darnell Jr., J.E., 1995. Transcriptional responses to polypep-tide ligands: the JAK-STAT pathway. Annu. Rev. Biochem. 64, 621–651.

Seale, A.P., Itoh, T., Moriyama, S., Takahashi, A., Kawauchi, H., Sakamoto,T., Fujimoto, M., Riley, L.G., Hirano, T., Grau, E.G., 2002. Isolation andcharacterization of a homologue of mammalian prolactin-releasingpeptide from the tilapia brain and its effect on prolactin release fromthe tilapia pituitary. Gen. Comp. Endocrinol. 125, 328–339.

Waite, K.A., Wallin, R., Qualliotine-Mann, D., McPhail, L.C., 1997. Phos-phatidic acid-mediated phosphorylation of the NADPH oxidasecomponent p47-phox. Evidence that phosphatidic acid may activatea novel protein kinase. J. Biol. Chem. 272, 15569–15578.

Wang, X., Morishita, F., Matsushima, O., Fujimoto, M., 2000. Immunohis-tochemical localization of C-RFamide, a FMRF-related peptide, in thebrain of the goldfish, Carassius auratus. Zoolog. Sci. 17, 1067–1074.

Wang, Y.F., Yu-Lee, L.Y., 1996. Multiple stat complexes interact at the inter-feron regulatory factor-1 interferon-gamma activation sequence inprolactin-stimulated Nb2 T cells. Mol. Cell. Endocrinol. 121, 19–28.

Watanabe, S., Kaneko, T., 2010. Prolactin-releasing peptide recep-tor expressed in the pituitary in Mozambique tilapia Oreochromismossambicus: An aspect of prolactin regulatory mechanisms. Gen.Comp. Endocrinol.

Watanuki, H., Sakai, M., Takahashi, A., 2003. Immunomodulatory effectsof alpha melanocyte stimulating hormone on common carp (Cyprinuscarpio L.). Vet. Immunol. Immunopathol. 91, 135–140.

Yada, T., Nagae, M., Moriyama, S., Azuma, T., 1999. Effects of prolactin andgrowth hormone on plasma immunoglobulin M levels of hypophysec-tomized rainbow trout Oncorhynchus mykiss. Gen. Comp. Endocrinol.115, 46–52.

Yada, T., Nakanishi, T., 2002. Interaction between endocrine and immunesystems in fish. Int. Rev. Cytol. 220, 35–92.

Yu-Lee, L.Y., 2002. Signal transduction by prolactin receptors. In: Rapaport,R., Matera, L. (Eds.), Growth and Lactogenic Hormones (NeuroimmuneBiology). Elsevier, Amsterdam, pp. 111–122.