Articleshttps://doi.org/10.1038/s41565-020-0720-7

Programming multi-protein assembly by gene-brush patterns and two-dimensional compartment geometryOhad Vonshak   1,4, Yiftach Divon   1,4, Stefanie Förste   2, David Garenne3, Vincent Noireaux   3, Reinhard Lipowsky   2, Sophia Rudorf   2, Shirley S. Daube   1 ✉ and Roy H. Bar-Ziv   1 ✉

1Department of Chemical and Biological Physics, The Weizmann Institute of Science, Rehovot, Israel. 2Max Planck Institute of Colloids and Interfaces, Potsdam, Germany. 3School of Physics and Astronomy, University of Minnesota, Minneapolis, MN, USA. 4These authors contributed equally: Ohad Vonshak, Yiftach Divon. ✉e-mail: Shirley.Daube@weizmann.ac.il; Roy.Bar-Ziv@weizmann.ac.il

SUPPLEMENTARY INFORMATION

In the format provided by the authors and unedited.

NatuRe NaNOtecHNOLOGY | www.nature.com/naturenanotechnology

Programming multi-protein assembly by gene-brush patterns and

2D compartment geometry

Ohad Vonshak†1, Yiftach Divon†1, Stefanie Förste2, David Garenne3, Vincent Noireaux3, Reinhard Lipowsky2, Sophia Rudorf2, Shirley S. Daube*1 and Roy H. Bar-Ziv*1

Supplementary information

Supplementary information on computational modeling In our computational model, we analyze the assembly of protein complexes consisting of two

different types of proteins, protein A (gp10) and protein B (gp7) and their binding to traps

(gp11). We refer to the regions, in which proteins A and B are synthesized, by source A and

source B. Source positions and sizes may be adjusted for each individual simulation, see Table

2. Initially, all traps are free and there are no proteins A and B. After single proteins A and B

are synthesized by their respective sources at production rates α" and α#, respectively, they

either diffuse freely with diffusion constant D" and D#, respectively, or bind to each other in

solution with binding rate constant κsol to form protein complexes AB [gp10-7] as is shown in

Fig. 2b. After formation, protein complexes AB diffuse likewise with the diffusion constant

D"# or bind to free traps on the surface with binding rate constant κ&'(),"# (solution assembled

protein complex Trap(AB) [gp11-(10-7)]; Fig. 2b). An alternative pathway for protein complex

formation is scaffold assembly. Here, protein A binds at first to a free trap with binding rate

constant κ&'()," (trapped protein A - TrapA [(gp11-10)]). A trapped protein A cannot diffuse

but is still able to participate in protein complex formation by binding to a freely diffusing

protein B with binding rate constant κsurf. This way, a new protein complex is formed via

scaffold assembly (scaffold-assembled (TrapA)B [(gp11-10)-7]). In the simulation, we can

distinguish between solution- and scaffold-assembled protein complexes and trace their

assembly pathways by taking all mentioned species and their combinations into account. The

time-evolution of the concentrations of the seven distinct species introduced above can be

described by a system of seven time-dependent first-order differential equations, see

Supplementary Fig. 11. These differential equations are solved numerically using the time-

discrete Euler method, which is a numerical method that uses a fixed discretization step size

Δt for the time. In addition, we spatially discretized the system with N bins of size Δx.

Supplementary Fig. 1. Experimental scheme. a, Outline of chip fabrication. A side view of part of a silicon wafer (step 1) that is etched to produce 2 µm deep compartments with 50 µm deep channels on each side (step 2). The surface is coated with SiO2 and with a photosensitive monolayer (yellow, step 3). The surface is photo-activated with the desired pattern using laser UV lithography (red marks, step 4). After biotinylation at the lithographed patterns (blue marks, step 5), fluorescently labelled (FL) DNA is applied on the surface as discrete spots, each spot may have a different gene combination (step 6). Biotinylated antibodies are then applied and cover the entire surface surrounding the DNA brushes (step 7). Cell-free extract or PURE is introduced (step 8). After 2 hours of incubation, the chip is washed and assembly on the antibodies is monitored (colored circles on antibodies, step 9). b, Outline of on-chip spotting of DNA-streptavidin conjugates. A solution of FL DNA-streptavidin conjugates (1) is deposited on the surface of a coated chip using a micro capillary connected to piezoelectric element (2) spotting 10-20 pL drops with a diameter of ~100 µm (3). The DNA attaches to patterned biotins (yellow) and not to protected regions (green) (4).

Supplementary Fig. 2. T4 wedge assembly line and tagging of wedge proteins in off-chip cell-free expression (CFE) reactions. a, T4 wedge assembly line, gp11 is the only protein that binds non-sequentially. Wedge proteins 6, 7, 8, 10, and 11 bind in a 2:1:2:3:3 stoichiometry. Adapted from27,28. b, Scheme, site-specific incorporation of FL unnatural amino acid. Supplementing the CFE reaction with a gene coding for the AUG stop codon, as the second amino acid, and with tRNA of the anti-codon AUC, charged with FL unnatural amino acid, results in a FL-protein. c, d, N-terminus FL or C-terminus HA tag variants of wedge proteins separately expressed in solution and resolved by 4-20% gradient denaturing PAGE. (1) FL-gp11, (2) gp11 HA, (3) FL-gp10, (4) gp10 HA, (5) FL-gp7, (6) gp7 HA, (7) FL-gp8, (8) gp8 HA, (9) FL-gp6, (10) gp6 HA, and FL-gp53. c, A fluorescent scan of the gel. d, Anti-HA western blot of the gel using ATTO488 labeled antibodies (Methods). e, CFE reaction of gp11:gp10; gp7; gp8; gp6HIS and FL-gp53 purified using Ni2+ agarose and resolved by SDS-PAGE (Methods). Fluorescent scan of the gel and commassie staining of all proteins part of the purified complex.

Supplementary Fig. 3. On-chip wedge assembly as a function of gene fraction. Dose response curves of total wedges (FL-gp53), occupied sites (complement of FL-gp10), pre-wedges (FL-gp6) and pre-wedges normalized by number of occupied sites, all at different gene fractions (all wedge proteins other than the designated kept constant). a-d, Individual data points of Fig. 1e. Dose response for gene-10 (a), gene-7 (b), gene-8 (c), gene-6 (d). e, f, Additional dose response experiments for gene-8 (e) and gene-6 (f), carried out in different conditions than c, d. Gene compositions of all experiments shown in Supplementary Table 3. The number of samples for each data point (a-f) is listed in Supplementary Table 4.

Supplementary Fig. 4. Wedge assembly yield. Calculated wedge assembly yield (based on data in Supplementary Fig. 3d) defined as the fraction of pre-wedges converted to wedges from pre-wedges in experiments lacking gene-6. Error bars represent calculated error (Methods). Full gene composition of all experiments shown in Supplementary Table 3. The number of samples for each data point is listed in Supplementary Table 4.

Supplementary Fig. 5. Synthesis and assembly of gp10-7 complexes in 1D layouts. a, two additional experiments similar to Fig. 2c with DNA brush doublets of gene-10 (left circles) and of gene-7 (right) patterned at a distance of 300 µm. Scale bar 100 µm. b, 1D profiles of gp10-7 complexes with genes in separate DNA brushes, 200 µm (top) or 400 µm (bottom) apart. Data are presented as the mean, error bars are +s.d. Simulation of scaffolded and solution assembly profiles at the designated distance. Integrated signal shown in Fig. 2e. c, All the 1D profiles averaged in Fig. 2d. d, 1D profiles of gp10-7 complexes of an additional set of experiments at conditions slightly different than of c. Detailed gene composition of all experiments shown in Supplementary Table 3. The number of samples for each data point (a, b, c, d) is listed in Supplementary Table 4.

Supplementary Fig. 6. 1D profiles of T4 wedge assembly. a, Images of four compartments, part of the experiments in Fig. 3a. Designated genes and distances as in Fig. 3a. Scale bar 100 µm. b, All 1D profiles averaged in Fig. 3b. Profiles are of gp10-7 complex (red), pre-wedges (blue) and wedges (green) for mixed (i, ii, iii) separated (iv, v, vi) and spread-out (vii, viii, ix) layouts. Detailed gene composition of all experiments shown in Supplementary Table 3. The number of samples for each data point (a, b) is listed in Supplementary Table 4.

Supplementary Fig. 7. Effect of brush layout on assembly yield. a, Normalized total gp10-7 complexes (Supplementary Fig. 6b, red curves) formed in the absence and presence of gene-8 (layouts (i), (iv), (vii), and (ii), (v), (viii), respectively). b, Normalized total pre-wedges (Supplementary Fig. 6b, blue curves) formed in the absence and presence of gene-6 (layouts (ii), (v), (viii), and (iii), (vi), (ix), respectively). In a and b the mean value is shown and error bars representing ± s.d. Normalization methodology is described in Methods. c, The effect of gene-8 and gene-6 displacement on wedge formation, showing 400 µm (top) and 500 µm (bottom) displacement. Integrated signal shown in Fig. 3e. d, Individual data points of 1D profiles that appear in Fig. 3d and in c. Data (c, d) are presented as mean and error bars are +s.d. Detailed gene composition of all experiments shown in Supplementary Table 3. The number of samples for each data point (a, b, c, d) is listed in Supplementary Table 4.

Supplementary Fig. 8. E. coli RNAP assembly and activity in 2D compartments. a, GFP expression dynamics in a 200 µm radius compartment (top left) either under T7 promoter (squares), or cascaded under P70 promoter, with RNAP genes under T7 promoter (circles). Fluorescent images (bottom) of P70-GFP in a representative compartment at different time points and the corresponding radial profiles (top right). Scale bar 100 µm. b, Deletion assay for RNAP genes in the brush and representative images. Scale bar 100 µm. c, Total signal of P70-GFP expressed by nascent RNAP in the presence of increasing fraction of active DNA in the brush. DNA brush content kept constant with passive DNA (Methods). Data are presented as mean and error bars represent ± s.d. Detailed gene composition of all experiments shown in Supplementary Table 3. The number of samples for each data point (a, b, c) is listed in Supplementary Table 4.

Supplementary Fig. 9. Effect of compartment dimensions on GFP expression. a-c, Individual data points and means of σ70 gene dose response of shown in Fig. 5b, at 2 µm (a, c) and 20 µm (b). Core RNAP expressed from gene brushes (a,b) or added in purified form to the solution (c). d, Additional set of experiments as in c, showing similar results. e, GFP signal density and f, integrated GFP signal over the entire compartment as a function of compartment radius. Data correspond to Fig. 5c. g, Individual data points and mean of the integral of HA-GFP signal over entire compartment surface, at variable compartment radii and depth, shown in Fig. 5c. Data was collected from 3 different sets of experiments containing compartments with radii varying from 100 µm to 300 µm. The compartments in experiment set 1 and 2 were 2 µm deep, and the compartments in experiment set 3 were 20 µm deep. Line is a guide to the eye. Data are presented as mean and error bars represent ± s.d. Detailed gene composition of all experiments shown in Supplementary Table 3. The number of samples for each data point (a, b, c, d, e, f, g) is listed in Supplementary Table 4.

Supplementary Fig. 10. Spatial control of gene-expression. a, Scheme and representative images of 5 different configurations of DNA-brushes in a compartment. Each RNAP subunit gene brush (designated colors, top) at a fixed location, reporter P70-GFP (green) at variable locations. b, Total GFP signal in each of the five configurations. Data are presented as mean and error bars represent ± s.d. Detailed gene composition of all experiments shown in Supplementary Table 3. The number of samples for each data point (a, b) is listed in Supplementary Table 4.

Figure 11. Differential equations for concentration time-evolution of the seven distinct

species modeled. Time-evolution of the concentration 𝐶,,- of all seven species X = A, B,…

introduced above where i=1,…N indicates the discrete spatial position (bin) and the Iverson

bracket i=iprodX =1 if bin i is a source for species X and 0 otherwise.

dCi,A(t)

dt=

DA

�x2(Ci+1,A(t) + Ci�1,A(t)� 2Ci,A(t))� solCi,A(t) · Ci,B(t)� Trap,ACi,A(t) · Ci,Trap(t) + ↵A [i = iprodA] ,

dCi,B(t)

dt=

DB

�x2(Ci+1,B(t) + Ci�1,B(t)� 2Ci,B(t))� solCi,A(t) · Ci,B(t)� surfCi,TrapA(t) · Ci,B(t) + ↵B [i = iprodB] ,

dCi,AB(t)

dt=

DAB

�x2(Ci+1,AB(t) + Ci�1,AB(t)� 2Ci,AB(t)) + solCi,A(t) · Ci,B(t)� Trap,ABCi,Trap(t) · Ci,AB(t)

for i = 2, ..., N � 1, and

dC1,A(t)

dt=

DA

�x2(C2,A(t)� C1,A(t))� solC1,A(t) · C1,B(t)� Trap,AC1,A(t) · C1,Trap(t) + ↵A [1 = iprodA] ,

dCN,A(t)

dt=

DA

�x2(CN�1,A(t)� CN,A(t))� solCN,A(t) · CN,B(t)� Trap,ACN,A(t) · CN,Trap(t) + ↵A [N = iprodA] ,

dC1,B(t)

dt=

DB

�x2(C2,B(t)� C1,B(t))� solC1,A(t) · C1,B(t)� surfC1,TrapA(t) · C1,B(t) + ↵B [1 = iprodB] ,

dCN,B(t)

dt=

DB

�x2(CN�1,B(t)� CN,B(t))� solCN,A(t) · CN,B(t)� surfCN,TrapA(t) · CN,B(t) + ↵B [N = iprodB] ,

dC1,AB(t)

dt=

DAB

�x2(C2,AB(t)� C1,AB(t)) + solC1,A(t) · C1,B(t)� Trap,ABC1,Trap(t) · C1,AB(t) ,

dCN,AB(t)

dt=

DAB

�x2(CN�1,AB(t)� CN,AB(t)) + solCN,A(t) · CN,B(t)� Trap,ABCN,Trap(t) · CN,AB(t) ,

dCi,Trap(t)

dt= �Trap,ACi,A(t) · Ci,Trap(t)� Trap,ABCi,Trap(t) · Ci,AB(t) for i = 1, ..., N ,

dCi,TrapA(t)

dt= Trap,ACi,A(t) · Ci,Trap(t)� surfCi,TrapA(t) · Ci,B(t) for i = 1, ..., N ,

dCi,(TrapA)B(t)

dt= surfCi,TrapA(t) · Ci,B(t) for i = 1, ..., N ,

dCi,Trap(AB)(t)

dt= Trap,ABCi,Trap(t) · Ci,AB(t) for i = 1, ..., N ,

Supplementary Table 1. List of primers used to clone bacteriophage T4 and RNAP

genes into pIVEX vectors. Shown only the sequence corresponding to the amplified genes. Gene Forward Reverse gp11 ATGAGTTTACTTAATAATAAAGCG TGCTGTTCTCTCAAAATGATAAAATACTGTAGG gp10 ATGAAACAAAATATTAATATCGGTAATGTTG TGCAATCCTTATCCAACGATAAAC gp7 ATGACAGTAAAAGCACCTTCAGTCAC TTCATCTATTTTAACCTGTGTTGGATTTTCAGG gp8 ATGAATGATTCAAGTGTTATCTATCG AAATGTAAACAGAATATTGATTTCTTCTG gp6 ATGGCAAATACCCCTGTAAATTATC TTGTGATATAGGCTCCAAATCGATAG

gp53 ATGCTCTTTACATTTTTTGATCCGATTG CTTATCATTTCCATAAGATTTCTCC α ATGCAGGGTTCTGTGACAGAGTTTC CTCGTCAGCGATGCTTGCC β ATGGTTTACTCCTATACCGAGAAAAAACG CTCGTCTTCCAGTTCGATGTTG β’ ATGAAAGATTTATTAAAGTTTCTGAAAGCGC CTCGTTATCAGAACCGCCCAG ω ATGGCACGCGTAACTGTTCAGGACG ACGACGACCTTCAGCAATAGCGGTAACG σ70 ATGGAGCAAAACCCGCAGTCAC ATCGTCCAGGAAGCTACGCAGC

Supplementary Table 2: Parameter values for the simulations presented in Fig. 2 d, e, f and in Supplementary Fig. 5b.

The concentrations are dimensionless (“number concentrations”), such that production rates

and binding rate constants are all given in units of 1/s. N is the dimensionless total number of

bins chosen for spatial discretization (suchthatN·Δx = 1 mm); source positions iprodA and

iprodB are given in units of Δx = 10 µm. The time step was set to Δt = 0.18𝑠.

i prodA i prodB αA αB κTrap ,A κ sol κ surf κTrap ,AB N D A∆x 2

D B∆x 2

D AB∆x 2

[1/s ] [1/s ] [1/s ] [1/s ] [1/s ] [1/s ] [1/s ] [1/s ] [1/s ]

Fig. 2 d,eMix 7-14 7-14 833· 10− 6 833· 10− 6 111· 10− 4 111· 10− 3 111· 10− 4 111· 10− 5 100 0.2 0.2 0.2

Distance7-14 17-24 833· 10− 6 833· 10− 6 111· 10− 4 111· 10− 4 111· 10− 4 111· 10− 5 100 0.2 0.2 0.27-14 37-44 833· 10− 6 833· 10− 6 111· 10− 4 111· 10− 4 111· 10− 4 111· 10− 5 100 0.2 0.2 0.27-14 57-64 833· 10− 6 833· 10− 6 111· 10− 4 111· 10− 4 111· 10− 4 111· 10− 5 100 0.2 0.2 0.2

Fig. 2 f Mix 7-14 7-14 111· 10− 5 556· 10− 6 111· 10− 4 111· 10− 3 111· 10− 4 111· 10− 5 100 0.2 0.2 0.27-14 7-14 167· 10− 5 556· 10− 6 111· 10− 4 111· 10− 3 111· 10− 4 111· 10− 5 100 0.2 0.2 0.2

Distance 7-14 57-64 556· 10− 6 556· 10− 6 111· 10− 4 111· 10− 4 111· 10− 4 111· 10− 5 100 0.2 0.2 0.27-14 57-64 167· 10− 5 556· 10− 6 111· 10− 4 111· 10− 4 111· 10− 4 111· 10− 5 100 0.2 0.2 0.2

Supplementary Fig. 5b Distance 7-14 27-34 833· 10− 6 833· 10− 6 111· 10− 4 111· 10− 4 111· 10− 4 111· 10− 5 100 0.2 0.2 0.27-14 47-54 833· 10− 6 833· 10− 6 111· 10− 4 111· 10− 4 111· 10− 4 111· 10− 5 100 0.2 0.2 0.2

Supplementary Table 3: Detailed gene composition and experimental parameters.

Figure Gene composition Comments Fig. 1c (gene-10, gene-7, gene-8, gene-6, Passive DNA), (0-10%, 10%, 10%, 10%,

70%-60%) Representative images from the experiment shown in Fig. 1e (gene-10)

Fig. 1e (gene-10) (gene-10, gene-7, gene-8, gene-6, Passive DNA), (0-70%, 10%, 10%, 10%, 70%-0%)

CFE carried out for 1.5 hours

Fig. 1e (gene-7) (gene-10, gene-7, gene-8, gene-6, Passive DNA), (5%, 0-75%, 10%, 10%, 75%-0%)

CFE carried out for 1.5 hours

Fig. 1e (gene-8) (gene-10, gene-7, gene-8, gene-6, Passive DNA), (5%, 10%, 0-55%, 10%, 75%-20%)

CFE carried out for 1.5 hours

Fig. 1e (gene-6) (gene-10, gene-7, gene-8, gene-6, Passive DNA), (5%, 10%, 10%, 0-75%, 75%-0%)

CFE carried out for 1.5 hours

Fig. 1f (GFP) (GFP, Active DNA), (0.0001-0.05, 0.9999-0.95)

Fig. 1f (Wedge) (gene-10, gene-7, gene-8, gene-6, Active DNA), (0.0005-0.05, 0.003-0.3, 0.001-0.1, 0.001-0.1, 0.9945-0.45)

Fig. 2c Brush 1 = (gene-10, Passive DNA), (25%, 75%) Brush 2 = 100% gene-7

Fig. 2d, e (mix) (gene-10, gene-7), (25%, 75%) Fig. 2d, e (100-500 µm) Brush 1 = (gene-10, Passive DNA), (25%, 75%)

Brush 2 = 100% gene-7

Fig. 3a (left) Brush 1: 100% gene-10. Brush 2: 100% gene-7 Fig. 3a (middle) Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8 Fig. 3a (right) Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8.

Brush 4: 100% gene-6

Fig. 3b (i) (gene-10, gene-7, Passive DNA), (12.5%, 37.5%, 50%) Fig. 3b (ii) (gene-10, gene-7, gene-8, Passive DNA), (12.5%, 37.5%, 12.5%, 37.5%) Fig. 3b (iii) (gene-10, gene-7, gene-8, gene-6, Passive DNA), (12.5%, 37.5%, 12.5%,

12.5%, 25%)

Fig. 3b (iv), (vii) Brush 1: 100% gene-10. Brush 2: 100% gene-7 Fig. 3b (v), (viii)

Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8

Fig. 3b (vi), (ix) Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8. Brush 4: 100% gene-6

Fig. 3c, d Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8. Brush 4: 100% gene-6

Fig. 4a, b Brush 1: 100% HA tagged protein. Brush 2: 33% from each of the non-FL or tagged proteins. Brush 3: 100% FL protein

Concentration of FL proteins DNA incubated solution was 200 nM.

Fig. 4c, d Brush 1: 100% gene-11HA. Brush 2: 100% gene-10/FL-gene-10. Brush 3: 100% gene-7. Brush 4: 100% FL-gene-8/gene-8. Brush 5: 100% gene-6

gene-11 HA brushes were patterned 200 µm away from gene-10 brushes. Other brushes were pattered at 100 µm distance. Concentration of FL proteins DNA incubated solution was 300 nM.

Fig. 5b (2µm) (α, β, β', ω, σ70, P70-HA-GFP, Passive DNA), (6%, 3%, 3%, 3%, 0-25%, 60%, 25%-0)

CFE carried out for 3 hours

Fig. 5b (20µm) (α, β, β', ω, σ70, P70-HA-GFP, Passive DNA), (6%, 3%, 3%, 3%, 0-25%, 60%, 25%-0)

CFE carried out for 3 hours

Fig. 5b (core in solution) (σ70, P70-HA-GFP, Passive DNA), (0-40%, 60%, 40%-0) Purified RNAP core enzyme was a part of the CFE solution. CFE carried out for 3 hours

Fig. 5c (α, β, β', ω, σ70, P70-HA-GFP, Passive DNA) , (6%, 3%, 3%, 3%, 3%, 60%, 22%)

Fig. 6a Mixed = (α, β, β', ω, σ70, P70-HA-GFP, Passive DNA) , (6%, 3%, 3%, 3%, 3%, 60%, 22%) Spread-out & Separate = (α/β/β'/ω/σ70, P70-HA-GFP), (50%, 50%)

CFE time of configuration (i) was 2 hours, while in configurations (ii) and (iii) 2µm and 20µm it was 1.5 hours. Normalization

methodology is detailed in Methods

Fig. 6b (α/β/β'/ω/σ70, P70-HA-GFP), (50%, 50%) CFE carried out for 1.5 hours

Fig. 6d 5 identical brushes= (α, β, β', ω, σ70, P70-HA-GFP, Passive DNA) , (6%, 3%, 3%, 3%, 3%, 60%, 22%) 1 brush = 100% Passive/Active DNA

CFE carried out for 1.5 hours

Extended Data Fig. 1b (gene-10, gene-7, Active DNA), (0-40%, 20%, 80%-40%) CFE carried out for 1.5 hours

Supplementary Fig. 3a (gene-10, gene-7, gene-8, gene-6, Passive DNA), (0-70%, 10%, 10%, 10%, 70%-0%)

CFE carried out for 1.5 hours

Supplementary Fig. 3b (gene-10, gene-7, gene-8, gene-6, Passive DNA), (5%, 0-75%, 10%, 10%, 75%-0%)

CFE carried out for 1.5 hours

Supplementary Fig. 3c (gene-10, gene-7, gene-8, gene-6, Passive DNA), (5%, 10%, 0-55%, 10%, 75%-20%)

CFE carried out for 1.5 hours

Supplementary Fig. 3d (gene-10, gene-7, gene-8, gene-6, Passive DNA), (5%, 10%, 10%, 0-75%, 75%-0%)

CFE carried out for 1.5 hours

Supplementary Fig. 3e (gene-10, gene-7, gene-8, gene-6, Passive DNA), (5%, 30%, 0-55%, 10%, 55%-0%)

CFE carried out for 1.5 hours

Supplementary Fig. 3f (gene-10, gene-7, gene-8, gene-6, Passive DNA), (5%, 30%, 10%, 0-55%, 55%-0%)

CFE carried out for 1.5 hours

Supplementary Fig. 4 (gene-10, gene-7, gene-8, gene-6, Passive DNA), (5%, 10%, 10%, 0-75%, 75%-0%)

CFE carried out for 1.5 hours

Supplementary Fig. 5a Brush 1:25% gene-10:75% Passive DNA Brush 2: 100% gene-7

Supplementary Fig. 5c (Mix)

25% gene-10:75% gene-7

Supplementary Fig. 5c (100-500 µm)

Brush 1:25% gene-10 – 75% Passive DNA. Brush 2: 100% gene-7

Supplementary Fig. 5d (Mix)

Brush 1: 25% gene-10:75% gene-7 Brush 2: 25% gene-10:75% gene-7

Supplementary Fig. 5d (Mix 2)

Brush 1: 50% gene-10:50% gene-7

Supplementary Fig. 5d (100-500 µm)

Brush 1: 25% gene-10:75% Passive DNA Brush 2: 100% gene-7

Supplementary Fig. 6a (left) Brush 1: 100% gene-10. Brush 2: 100% gene-7 Supplementary Fig. 6a (middle)

Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8

Supplementary Fig. 6a (right)

Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8. Brush 4: 100% gene-6

Supplementary Fig. 6b (i) (gene-10, gene-7, Passive DNA), (12.5%, 37.5%, 50%) Supplementary Fig. 6b (ii) (gene-10, gene-7, gene-8, Passive DNA), (12.5%, 37.5%, 12.5%, 37.5%) Supplementary Fig. 6b (iii) (gene-10, gene-7, gene-8, gene-6, Passive DNA), (12.5%, 37.5%, 12.5%,

12.5%, 25%)

Supplementary Fig. 6b (iv), (vii)

Brush 1: 100% gene-10. Brush 2: 100% gene-7

Supplementary Fig. 6b (v), (viii)

Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8

Supplementary Fig. 6b (vi), (ix)

Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8. Brush 4: 100% gene-6

Supplementary Fig. 7a (i) (gene-10, gene-7, Passive DNA), (12.5%, 37.5%, 50%) Supplementary Fig. 7a (ii) (gene-10, gene-7, gene-8, Passive DNA), (12.5%, 37.5%, 12.5%, 37.5%) Supplementary Fig. 7a (iv), (vii)

Brush 1: 100% gene-10. Brush 2: 100% gene-7

Supplementary Fig. 7a (v), (viii)

Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8

Supplementary Fig. 7b (ii) (gene-10, gene-7, gene-8, Passive DNA), (12.5%, 37.5%, 12.5%, 37.5%) Supplementary Fig. 7b (iii) (gene-10, gene-7, gene-8, gene-6, Passive DNA), (12.5%, 37.5%, 12.5%,

12.5%, 25%)

Supplementary Fig. 7b (v), (viii)

Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8

Supplementary Fig. 7b (vi), (ix)

Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8. Brush 4: 100% gene-6

Supplementary Fig. 7c, d Brush 1: 100% gene-10. Brush 2: 100% gene-7. Brush 3: 100% gene-8. Brush 4: 100% gene-6

Supplementary Fig. 8a (P70-GFP)

(α, β, β', ω, σ70, P70-HA-GFP, Passive DNA) , (6%, 3%, 3%, 3%, 3%, 60%, 22%)

Supplementary Fig. 8a (T7-GFP)

(T7-GFP, Passive DNA), (0.5%, 99.5%)

Supplementary Fig. 8b (all) (α, β, β', ω, σ70, P70-HA-GFP, Passive DNA) , (6%, 3%, 3%, 3%, 6%, 60%, 19%)

CFE carried out for 3 hours

Supplementary Fig. 8b (Deletions)

(α, β, β', ω, σ70, P70-HA-GFP, Passive DNA) , (6%, 3%, 3%, 3%, 3%, 60%, 22%) In each deletion 1 gene was removed and complemented by Passive DNA

CFE carried out for 3 hours

Supplementary Fig. 8c (6:3:3:3:6:60:0-22:22-0), (α,β,β',ω,σ70,p70-HA-GFP,Passive DNA,DHFR) (α, β, β', ω, σ70, P70-HA-GFP, Passive DNA, Active DNA) , (6%, 3%, 3%, 3%, 3%, 60%, 22-0%, 0-22%)

Supplementary Fig. 9a (α, β, β', ω, σ70, P70-HA-GFP, Passive DNA), (6%, 3%, 3%, 3%, 0-25%, 60%, 25%-0)

CFE carried out for 3 hours

Supplementary Fig. 9b (α, β, β', ω, σ70, P70-HA-GFP, Passive DNA), (6%, 3%, 3%, 3%, 0-25%, 60%, 25%-0)

CFE carried out for 3 hours

Supplementary Fig. 9c, d (σ70, P70-HA-GFP, Passive DNA), (0-40%, 60%, 40%-0) Purified RNAP core enzyme was a part of the CFE solution. CFE carried out for 3 hours

Supplementary Fig. 9e, f (α, β, β', ω, σ70, P70-HA-GFP, Passive DNA) , (6%, 3%, 3%, 3%, 3%, 60%, 22%)

Supplementary Fig. 9g (all experimental sets)

(α, β, β', ω, σ70, P70-HA-GFP, Passive DNA) , (6%, 3%, 3%, 3%, 3%, 60%, 22%)

Supplementary Fig. 10 Brushes of RNAP genes contained 100% of the respective gene and the P70-GFP brush contained 100% P70-GFP gene

CFE carried out for 1.5 hours

Supplementary Table 4: Statistics and Reproducibility

Figure Sample size (n) Comments

Fig. 1c

x = (0, 2.5, 5, 10) n = (6, 6, 4, 7)

Representative images from the experiment shown in 1e (gp10).

Each image has n repeats, as stated in the sample size column

Fig. 1e (gene-10) x = (0, 2.5, 5, 10, 20, 40, 55, 70) n = (6, 6, 4, 7, 5, 5, 4, 5)

Fig. 1e (gene-7) x = (0, 2.5, 5, 10, 30, 50, 75) n = (7, 7, 7, 5, 4, 6, 5)

Fig. 1e (gene-8) x = (0, 2.5, 5, 10, 20, 35, 55) n = (8, 7, 8, 7, 7, 7, 7)

A similar set of experiments with different conditions appears in Supplementary Fig. 3e

Fig. 1e (gene-6) x = (0, 2.5, 5, 10, 30, 50, 75) n = (5, 8, 8, 8, 7, 7, 7)

A similar set of experiments with different conditions appears in Supplementary Fig. 3f

Fig. 1f (GFP) x = (0.0001, 0.00025, 0.0005, 0.001, 0.0025, 0.005, 0.01, 0.05)

n = (6, 7, 6, 5, 6, 6, 6, 7)

Fig. 1f (Wedge) x = (0.0005, 0.0025, 0.005, 0.00875, 0.0125, 0.025, 0.05)

n = (3, 3, 4, 4, 3, 3, 4)

Fig. 2b 3 Two additional repeats appear in

Supplementary Fig. 5a Fig. 2c and d mix 5 Fig. 2c and d 100, 300, 500 µm 3

Fig. 2d and Supplementary Fig. 5b 200, 400 µm

3

Fig. 3a 5 Four additional repeats appear in Supplementary Fig. 6a

Fig. 3b (i)-(iii) 6 Fig. 3b (iv)- (vi) 5 Fig. 3b (vii) 5 Fig. 3b (viii), (ix) 4 Fig. 3c 4 Fig. 3d 4 Fig. 4a 4 Fig. 4b 4 (only FL-gp10, gp6-HA n=3) Fig. 4c

(All,∆gp10, ∆gp7, ∆gp6) (n=7,4,3,3) Repeated total of 7, 4, 3, 3 and 3 for All,∆gp10, ∆gp7, ∆FL-gp8 and ∆gp6 respectively.

Fig. 4d FL-gp10 (n=4) FL-gp8 (X=All,∆gp10, ∆gp7, ∆gp6)

(n=7,4,3,3)

Fig. 5b (assembly from chip - 2µm)

x = (0, 1.5, 3, 6, 12, 25) n = (9, 7, 10, 12, 8, 9)

Fig. 5b (assembly from chip - 20µm)

x = (0, 1.5, 3, 6, 12, 25) n = (12, 12, 12, 12, 12, 12)

Fig. 5b (core enzyme in solution)

x = (0, 1, 2.5, 5, 10, 20, 40) n = (5, 7, 7, 7, 7, 7, 6)

This set of experiments was repeated in Supplementary Fig. 9d

Fig. 5c x = (6.28e04, 9.82e04, 1.41e05, 2.51e05, 3.93e05, 5.65e05, 6.28e05, 9.82e05, 1.41e06,

2.51e06, 3.93e06, 5.65e06) n = (3, 4, 5, 5, 6, 4, 6, 5, 6, 4, 6, 6)

This set of experiments was repeated 3 more times in Supplementary Fig. 9g

Fig. 6a x = (i, ii, iii 2 µm, iii 20 µm) n = (10, 19, 9, 7)

3 sets of experiments were normalized as detailed in Methods. n

represents the combined experiments.

Fig. 6b x = (2µm, 20µm) n = (9, 4) Fig. 6c x = (i, ii, iii 2 µm, iii 20 µm)

n = (10, 19, 9, 7) Representative images of Fig. 6a.

Fig. 6d x = (Active, Passive) n = (4, 5) Extended Data Fig.1b x = (0, 2.5, 5, 10, 20, 40)

n = (7, 5, 5, 5, 5, 5)

Supplementary Fig. 3a

x = (0, 2.5, 5, 10, 20, 40, 55, 70) n = (6, 6, 4, 7, 5, 5, 4, 5)

Individual data points of Fig. 1e (gene-10).

Supplementary Fig. 3b

x = (0, 2.5, 5, 10, 30, 50, 75) n = 7, 7, 7, 5, 4, 6, 5)

Individual data points of Fig. 1e (gene-7)

Supplementary Fig. 3c

x = (0, 2.5, 5, 10, 20, 35, 55) n = (8, 7, 8, 7, 7, 7, 7)

Individual data points of Fig. 1e (gene-8)

Supplementary Fig. 3d

x = (0, 2.5, 5, 10, 30, 50, 75) n = (5, 8, 8, 8, 7, 7, 7)

Individual data points of Fig. 1e (gene-6)

Supplementary Fig. 3e x = (0, 5, 10, 20, 35, 55)

n = (5, 5, 5, 5, 5, 4)

Additional set of experiments with similar conditions to the ones described in Supplementary Fig. 3c.

Supplementary Fig. 3f x = (0, 5, 10, 20, 35, 55)

n = (5, 2, 3, 3, 3, 3)

Additional set of experiments with similar conditions to the ones described in Supplementary Fig. 3d.

Supplementary Fig. 4 x = (0, 2.5, 5, 10, 30, 50, 75)

n = (5, 8, 8, 8, 7, 7, 7)

Error bars are calculated (Methods). The data points are calculated using the data from Supplementary Fig. 3d (dose response of gene-6).

Supplementary Fig. 5b 3

Supplementary Fig. 5c mix 5 Individual data points of Fig. 2d

Supplementary Fig. 5c 100-500 µm 3 Individual data points of Fig. 2d

Supplementary Fig. 5d 4

A similar set of experiments with different conditions to the ones described in Supplementary Fig. 5c

Supplementary Fig. 6b (i)-(iii)

6

Supplementary Fig. 6b (iv)-(vi)

5

Supplementary Fig. 6b (vii)

5

Supplementary Fig. 6b (viii), (ix)

4

Supplementary Fig. 7a

x = ((i), (ii), (iv), (v), (vii), (viii)) n = (6, 6, 5, 5, 5, 4)

Supplementary Fig. 7b

x = ((ii), (iii), (v), (vi), (viii), (ix)) n = (6, 6, 5, 5, 4, 4)

Supplementary Fig. 7c and d 4

Supplementary Fig. 8a

x = (T7-GFP, P70-GFP) n = (2, 5)

Supplementary Fig. 8b

x = (all, Δα, Δβ, Δβ' Δω, Δσ70) n = (12, 10, 10, 10, 10, 12)

Supplementary Fig. 8c

x = (0, 5, 10, 15, 22) n = (11, 9, 9, 11, 10)

Supplementary Fig. 9a

x = (0, 1.5, 3, 6, 12, 25) n = (9, 7, 10, 12, 8, 9)

Individual data points of Fig. 5b (assembly from chip - 2µm)

Supplementary Fig. 9b

x = (0, 1.5, 3, 6, 12, 25) n = (12, 12, 12, 12, 12, 12)

Individual data points of Fig. 5b (assembly from chip - 20µm)

Supplementary Fig. 9c

x = (0, 1, 2.5, 5, 10, 20, 40) n = (5, 7, 7, 7, 7, 7, 6)

Individual data points of Fig. 5b (core enzyme in solution)

Supplementary Fig. 9d x = (0, 1, 2.5, 5, 10, 20, 40)

n = (5, 7, 7, 7, 6, 7, 6)

Additional set of experiments with identical conditions to the one described in Supplementary Fig. 9c.

Supplementary Fig. 9e,f (2µm)

x = (100, 125, 150, 200, 250, 300) n = (3, 4, 5, 5, 6, 4)

Individual data points of Fig. 5c

Supplementary Fig. 9e,f (20µm)

x = (100, 125, 150, 200, 250, 300) n = (6, 5, 6, 4, 6, 6)

Individual data points of Fig. 5c

Supplementary Fig. 9g (experiment set 1) x = (150, 200, 250, 300, 350)

n = (14, 16, 15, 16, 15)

Additional set of experiments with identical conditions to the one described in Supplementary Fig. 9e,f (2µm).

Supplementary Fig. 9g (experiment set 2) x = (100, 125, 150, 200, 250, 300)

n= (10, 8, 5, 8, 8, 8)

Additional set of experiments with identical conditions to the one described in Supplementary Fig. 9e,f (2µm).

Supplementary Fig. 9g (experiment set 3) x = (100, 125, 150, 200, 250, 300)

n = (10, 8, 8, 7, 7, 7)

Additional set of experiments with identical conditions to the one described in Supplementary Fig. 9e,f (20µm).

Supplementary Fig. 10

x = (1, 2, 3, 4, 5) n = (6, 6, 5, 6, 7)