Proceedings National Academy of Sciences - Microsoft · VOLUME 84 NUMBER 10 National Academy of...
Transcript of Proceedings National Academy of Sciences - Microsoft · VOLUME 84 NUMBER 10 National Academy of...
~l l>h.::>bt>A • ~ NU.l O 1 ~b 7
. C1 - --- - - -- ~v: ~~~oL UUUO l : ~~0~g ~U1Nb~ OF TH~
J T_ UN AL ACAb~M I 0 ~
Proceedings OF THE
. . MAY 1987
VOLUME 84
NUMBER 10
National Academy of Sciences ()f 'I H~~ UNI1 ED STATES OF AMERICA
PFIZER EX. 1032 Page 1
t (
Proceedings OF THE
National Academy of Sciences OF THE UNITED STATES OF AMERICA
Officers of the Academy
Editorial Board of the Proceedings
-----~----------~-- --- - ---------- -- -- --
FRANK PRESS, President JAMES D. EBERT, Vice President BRYCE CRAWFORD, JR., /lome Secretary WILLIAM E. GoRDON, Foreign Secretary ELKAN R. BLOUT, Treasurer
ROBERT H. ABELES GORDON /\.. BA YM WILLIAM F. BRACE RONALD BRESLOW MICHAEL J. CHAMBERLIN
MAXINE F. SINGER, Chairman MARY-DELL CIIILTON EDWARD E. DAVID, JR. STUART 11.. KoRNFELD DANIEL E. KosHLAND, JR. PETER D. LAX DANIEL NATIIANS
Mana~:ing Editor: FRANCES R. ZWANZIG Senior Associate Editor: GARY T. CocKs Associate Editor: CAY Bun.ER Associate Editor: JoliN M. MALLOY t1ssociate Editor: MARILYN J. MASON A~·sociate Editor: JANET L. MoRGAN Associate Editor: T. PEARSON Associate l:..aitor: DoROTHY P. SMITH Associate Editor: Cou;NE WALDEN
HERBERT E. SCARF SoLoMoN H. SNYDER HAROLD V ARM US THOMAS /\.. WALDMANN FRANK II. WESTIIEIMER
Assistant Managing Editor: JoANNE D'AMICO
Senior Production Editor: LYNN II.. WASSYNG Production Editors: BARBARA II.. BACON, RUTII E. CROSSGROVE, ScotT C. HERMAN,
MARGARET M. MADELEINE, JANET L. OVERTON, KATIILEEN RUBY, DoN C. TIPI'MAN, DEBORAH J. WEINER
Administrative Assistants: DELORES DANKS, CYNDY MATHEWS Manuscript Coordinators: EVELYN JARMON, JACQUELINE PERRY Circulation: JULIA LITTLE, VIRGINIA TREADWAY
Editorial correspondence: PROCEEDINGS OF TilE NATIONAL 1\.CADEMY OF SCIENCES, 2101 Con~titution /\.venue, Washington, DC 20418.
Business correspondence: Circulation Office of the PROCEEDINGS, Nationalll.cadcmy of Sciences, 2101 Constitution Avenue, Washington, DC 20418.
Information for Contributors: See issue Number 1, January 1987.
Copyright: The National Academy of Sciences has copyrighted this journal as a collective work and does not own copyrights for individual articles. Requests for permission to reproduce parts of individual articles or for reprints of individual articles should be addressed to the authors. Microforms of complete volumes arc available to regular sub~cribcrs only and may be obtained from University Microfilms, Xerox Corporation, Ann Arbor, MI 48103.
Subscriptions: 11.11 correspondence concerning subscriptions should be addressed to the Circulation Office of the PROCEEDINGS. Subscriptions are entered on a calendar year basis only. For 1987, subscription rates arc as follows-in the United States; student/postdoctoral, $65; personal, $185; institutional, $215; elsewhere; student/postdoctoral, $100; personal, $220; institutional, $250. Information regarding air mail postage rates is available from the Circulation Office. Subscribers are requested to notify the Circulation Office of the PROCEEDINGS 6 weeks in advance of any change of address; also the local postmaster. The Academy is not responsible for nonreceipt of issues because of an improper address unless a change of address is on file. The notice of address change should list both the old and new addresses. Claims for replacement cop~es will not be honored more than 60 days after the issue date for domestic subscribers and not more than 90 days after the 1ssuc date for foreign subscribers.
Back /~sues: Volumes 79-83, January 1982 and thereafter, arc available from the Circulation Office of the PROCEEDINGS. The pnce of a single issue is $13.00.
Second class postage paid at Wa.rhington, DC, and ill additional mailing offices. PRINTED IN TilE USA
~ROCEEDI~GS OF TilE NATIONAL 1\.CADEMY OF SCIENCES OF THE UNITED STATES OF /\.MERICA (ISSN-0027-8424) is published semunonth/y by THE NATIONAL ACADEMY OF SCIENCES, 2101 Constitution Avenue, Washington, DC 20418.
iD 1987 by THE NATIONAL ACADEMY OF SCIENCES OF TilE UNITED STATES OF /\.MERICA.
POSTMASTER: Send address changes to: PROCEEDINGS OF TilE NATIONAL ACADEMY oF SCIENCES OF TilE UNITED STATES OF AMERICA, 2101 Constitution Ave., Washington, DC 20418.
PFIZER EX. 1032 Page 2
Proceedings OF THE
National Academy of Sciences
OF THE UNITED STATES OF AMERICA
May 1987 Volume 84, Number 10 pp. 3081-3536
Table of Contents
AUTHOR INDEX
Physical Sciences
CHEMISTRY
Phytotoxins from the pathogenic fungi Drechslera maydis and Drechslera sorghicola
Accessible surface areas as a measure of the thermodynamic parameters of hydration of peptides
Discrete wave mechanics: Multidimensional systems
MATHEMATICS
Algebraic K-theory of discrete subgroups of Lie groups
Biological Sciences
BIOCHEMISTRY
Specific inhibition of Trypanosoma cruzi neuraminidase by the human plasma glycoprotein "cruzin"
Regulation of actomyosin ATPase activity by troponin-tropomyosin: Effect of the binding of the myosin subfragmcnt 1 (S-l)·ATP complex
F. Sugawara, G. Strobel, R. N. Strange, J. N. Siedow, G. D. VanDuyne, and J. Clardy
Tatsuo Ooi, Motohisa Oobatake, George Nemethy, and Harold A. Scheraga
Frederick T. Wall
F. T. Farrell and L. E. Jones
R. P. Prioli, I. Rosenberg, and M. E. A. Pereira
Lois E. Greene, David L. Williams, Jr., and Evan Eisenberg
vii
3081
3086
3091
3095
3097
3102
-------------------------------------------------------------------------- ----- -
PFIZER EX. 1032 Page 3
Contents
Deduced amino acid sequence of bovine retinal Goa: Similarities to other guanine nucleotide-binding proteins
Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358
Sequences from a prokaryotic genome or the mouse dihydrofolate reductase gene can restore the import of a truncated precursor protein into yeast mitochondria
Thyroid hormone regulates expression of a transfected a-myosin heavy-chain fusion gene in fetal heart cells
Properties of the duplex DNA-dependent ATPase activity of Escherichia coli RecA protein and its role in branch migration
Crystal structure of a snake venom cardiotoxin
Insulin stimulates phosphorylation of a 120-kDa glycoprotein substrate (pp120) for the receptor-associated protein kinase in intact H-35 hepatoma cells
Properties of a genetically engineered G domain of elongation factor Tu
Secretin stimulates cyclic AMP and inositol trisphosphate production in rat pancreatic acinar tissue by two fully independent mechanisms
Synchrotron x-ray diffraction studies of actin structure during polymerization
Cotranslational insertion of selenocysteine into formate dehydrogenase from Escherichia coli directed by a UGA codon
Temporal and tissue-specific expression of mouse ets genes
Apparent lack of discrimination in the reading of certain codons in Mycoplasma mycoides
Aberrant splicing events that are induced by proviral integration: Implications for myb oncogene activation
Reaction of argininosuccinase with bromomesaconic acid: Role of an essential lysine in the active site
A nonsense mutation causes hereditary goitre in the Afrikander cattle and unmasks alternative splicing of thyroglobulin transcripts
Role of DNA topoisomerase I in the transcription of supercoiled rRNA gene
Endonuclease IV of Escherichia coli is induced by paraquat
Identification and synthesis of a recognition signal for the attachment of glycosaminoglycans to proteins
lac repressor blocks in vivo transcription of lac control region DNA
RNA from an immediate early region of the type 1 herpes simplex virus genome is present in the trigeminal ganglia of latently infected mice
Rat ce.llular retinol-binding protein: eDNA sequence and rapid retmol-dependent accumulation of mRNA
Purification, properties, and immunocytochemical localization of human liver peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase
Isolation of a cytochrome aa3 gene from Bradyrhizobium japonicum
ii
Krisa P. Van Meurs, C. William Angus, Sukadev Lavu, Hsiang-Fu Kung, Susanne K. Czarnecki, Joel Moss, and Martha Vaughan
Hugh G. Griffin, Timothy J. Foster, Simon Silver, and Tapan K. Misra
Alison Baker and Gottfried Schatz
Thomas A. Gustafson, Bruce E. Markham, Joseph J. Bah!, and Eugene Markin
Stephen C. Kowalczykowski, Jennifer Claw, and Renee A. Krupp
B. Rees, J.P. Samama, J. C. Thierry, M. Gilibert, J. Fischer, H. Schweitz, M. Lazdunski, and D. Moras
Nicola Perrotti, Domenico Accili, Bernice Marcus-Samuels, Robert W. Rees-Jones, and Simeon I. Taylor
Andrea Parmeggiani, Guido W. M. Swart, Kim K. Mortensen, Michael Jensen, Brian F. C. Clark, Luciana Dente, and Riccardo Cortese
E. R. Trimble, R. Bruzzone, T. J. Biden, C. J. Meehan, D. Andreu, and R. B. Merrifield
Paul Matsudaira, Joan Bordas, and M. H. J. Koch
F. Zinoni, A. Birkmann, W. Leinfelder, and A. Bock
Narayan K. Bhat, Robert J. Fisher, Shigeyoshi Fujiwara, Richard Ascione, and Takis S. Papas
Tore Samuelsson, Youssef S. Guindy, Florentyna Lustig, Tomas Boren, and Ulf Lagerkvist
Dan Rosson, Debbie Dugan, and E. Premkumar Reddy
C. J. Lusty and S. Ratner
M. H. Ricketts, M. J. Simons, J. Parma, L. Mercken, Q. Dong, and G. Vassart
Lalit C. Garg, Susan DiAngelo, and Samson T. Jacob
Emily Chan and Bernard Weiss
Mario A. Bourdon, Tom Krusius, Steven Campbell, Nancy B. Schwartz, and Erkki Ruoslahti
Marguerite A. Sellitti, Pamela A. Pavco, and Deborah A. Steege
Anne M. Deatly, Jordan G. Spivack, Ehud Lavi, and Nigel W. Fraser
David R. Sherman, R. Stephen Lloyd, and Frank Chytil
M. Kumudavalli Reddy, Nobuteru Usuda, M. Narahari Reddy, Edward R. Kuczmarski, M. Sambasiva Rao, and Janardan K. Reddy
Mark R. O'Brian and Robert J. Maier
3107
3112
3117
3122
3127
3132
3137
3141
3146
3151
3156
3161
3166
3171
3176
3181
3185
3189
3194
3199
3204
3209
3214
3219
PFIZER EX. 1032 Page 4
Contents
Partial amino acid sequence of apolipoprotein(a) shows that it is homologous to plasminogen
BIOPHYSICS
Single acetylcholine receptor channel currents recorded at high hydrostatic pressures
CELL BIOLOGY
Expression of p21"" in normal and malignant human tissues: Lack of association with proliferation and malignancy
The very late antigen family of heterodimers is part of a superfamily of molecules involved in adhesion and embryogenesis
Immunoglobulin A stimulates growth of the extrahepatic bile duct in BALB/c mice
Cytoskeletal association of human a-interferon-receptor complexes in interferon-sensitive and -resistant lymphoblastoid cells
An insulin-like growth factor (IGF) binding protein enhances the biologic response to IGF-1
Periodic crosslinking of microtubules by cytoplasmic microtubule-associated and microtubule-corset proteins from a trypanosomatid
Firefly luciferasc is targeted to peroxisomes in mammalian cells
Functional epithelial cell line cloned from rat parathyroid glands
Differential regulation of colony-stimulating factors and interleukin 2 production by cyclosporin A
Coinduction of glucose-regulated proteins and doxorubicin resistance in Chinese hamster cells
Growth factor(s) produced during infection with an adenovirus variant stimulates proliferation of nonestablished epithelial cells
Protein import into chloroplasts requires a chloroplast ATPase
A high molecular weight component of the human tumor necrosis factor receptor is associated with cytotoxicity
Chemical carcinogen-induced decreases in genomic 5-methyldeoxycytidine content of normal human bronchial epithelial cells
DEVELOPMENTAL BIOLOGY
Cell patterning in pigment-chimeric eyes in Xenopus: Germinal cell transplants and their contributions to growth of the pigmented retinal epithelium
EVOLUTION
A molecular phylogeny of the hominoid primates as indicated by two-dimensional protein electrophoresis
Geographic dialects in blind mole rats: Role of vocal communication in active speciation
iii
Dan L. Eaton, Gunther M. Fless, William J. Kohr, John W. McLean, Qin-Tu Xu, Chad G. Miller, Richard M. Lawn, and Angelo M. Scanu
S. H. Heinemann, W. Stiihmer, and F. Conti
Pilar Garin Chesa, Wolfgang J. Rettig, Myron R. Melamed, Lloyd J. Old, and Henry L. Niman
Y oshikazu Takada, Jack L. Strominger, and Martin E. Hemler
Sheila Fallon-Friedlander, Jeffrey R. Boscamp, Rachel Morecki, Frank Lilly, MarshallS. Horwitz, and Joy H. Glaser
Lawrence M. Pfeffer, Nowell Stebbing, and David B. Donner
R. G. Elgin, W. H. Busby, Jr., and D. R. Clemmons
Gregory T. Bramblett, Sulie Chang, and Martin Flavin
Gilbert-Andre Keller, Stephen Gould, Marlene Deluca, and Suresh Subramani
Kazushige Sakaguchi, Arthur Santora, Mark Zimering, Francesco Curcio, Gerald D. Aurbach, and Maria Luisa Brandi
M. Bickel, H. Tsuda, P. Amstad, V. Evequoz, S. E. Mergenhagen, S. M. Wahl, and D. H. Pluznik
J. Shen, C. Hughes, C. Chao, J. Cai, C. Bartels, T. Gessner, and J. Subjeck
Margaret P. Quinlan, Neil Sullivan, and Terri Grodzicker
Debkumar Pain and Gunter Blobel
Abla A. Creasey, Ralph Yamamoto, and Charles R. Vitt
Vincent L. Wilson, Ruth A. Smith, Jim Longoria, Mary Anne Liotta, Cynthia M. Harper, and Curtis C. Harris
R. Kevin Hunt, Jerry S. Cohen, and Barbra J. Mason
David Goldman, P. Rathna Giri, and Stephen J. O'Brien
Eviatar Nevo, Giora Heth, Avigdor Beiles, and Eliezer Frankenberg
3224
3229
3234
3239
3244
3249
3254
3259
3264
3269
3274
3278
3283
3288
3293
3298
3302
3307
3312
PFIZER EX. 1032 Page 5
Contents
GENETICS
Homology between the DNA-binding domain of the GCN4 regulatory protein of yeast and the carboxyl-terminal region of a protein coded for by the oncogene jun
A family of short, interspersed repeats is associated with tandemly repetitive DNA in the human genome
Random cloning of genes from mouse chromosome 17
Structure and expression of human dihydropteridine reductase
Gene tandem-mediated selection of coliphage >..-receptive Agrobacterium, Pseudomonas, and Rhizobium strains
Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique
Expression of retrovirally transduced genes in primary cultures of adult rat hepatocytes
Comparative anatomy of the human APRT gene and enzyme: Nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement
Sequence analysis of spontaneous mutations in a shuttle vector gene integrated into mammalian chromosomal DNA
Molecular cloning and characterization of esterase-6, a serine hydrolase of Drosophila
Measurement of low levels of x-ray mutagenesis in relation to human disease (Correction)
IMMUNOLOGY
Molec~la; cloning of the CD2 antigen, the T-cell erythrocyte receptor, by a rap1d 1mmunoselection procedure
Biosynthesis: gl~cosylation, and partial N-terminal amino acid sequence of the T-cell-actlvatmg protein TAP
Resistance of cytotoxic T lymphocytes to lysis by a clone of cytotoxic T lymphocytes
Regulation of murine class I genes by interferons is controlled by regions located both 5' and 3' to the transcription initiation site
1a,25-Dihydroxyvitamin D3 inhibits y-interferon synthesis by normal human peripheral blood lymphocytes
Co~plete supp.ression of in vivo growth of human leukemia cells by specific 1mmunotoxms: Nude mouse models
Lymphocyte major histocompatibility complex-encoded class II structures may act as sperm receptors
Working principles in the immune system implied by the "peptidic self' model
MEDICAL SCIENCES
Interferon 'Y induces lung colonization by intravenously inoculated 816 melanoma cells in parallel with enhanced expression of class I major histocompatibility complex antigens
iv
Peter K. Vogt, Timothy J. Bos, and Russell F. Doolittle
Brion Mermer, Mark Colb, and Theodore G. Krontiris
Masanori Kasahara, Felipe Figueroa, and Jan Klein
Jean Lockyer, Richard G. Cook, Sheldon Milstien, Seymour Kaufman, Savio L. C. Woo, and Fred D. Ledley
Robert A. Ludwig
Walter W. Noll and Mary Collins
Jon A. Wolff, Jiing-Kuan Yee, Harold F. Skelly, Jane C. Moores, James G. Respess, Theodore Friedmann, and Hyam Leffert
Thomas P. Broderick, Dennis A. Schaff, Amy M. Bertino, Michael K. Dush, Jay A. Tischfield, and Peter J. Stambrook
Charles R. Ashman and Richard L. Davidson
J. G. Oakeshott, C. Collet, R. W. Phillis, K. M. Nielsen, R. J. Russell, G. K. Chambers, V. Ross, and R. C. Richmond
Charles Waldren, Laura Correll, Marguerite A. Sognier, and Theodore T. Puck
Brian Seed and Alejandro Aruffo
Hans Reiser, John Coligan, Baruj Benacerraf, and Kenneth L. Rock
David M. Kranz and HermanN. Eisen
Bette Korber, Leroy Hood, and Iwona Stroynowski
Helmut Reichel, H. Phillip Koeffler, Andreas Tobler, and Anthony W. Norman
Hideki Hara and Ben K. Seon
Ellyn R. Ashida and Virginia L. Scofield
Philippe Kourilsky, Gerard Chaouat, Chantal Rabourdin-Combe, and Jean-Michel Claverie
K. Taniguchi, M. Petersson, P. Hoglund, R. Kiessling, G. Klein, and K. Kiirre
3316
3320
3325
3329
3334
3339
3344
3349
3354
3359
3364
3365
3370
3375
3380
3385
3390
3395
3400
3405
PFIZER EX. 1032 Page 6
Contents
Recognition of tau epitopes by anti-neurofilament antibodies that bind to Alzheimer neurofibrillary tangles
Recognition of Alzheimer paired helical filaments by monoclonal neurofilament antibodies is due to crossreaction with tau protein
Purification and characterization of rat liver nuclear thyroid hormone receptors
Development of a monoclonal antibody specifically reactive to gastrointestinal goblet cells
Linkage of the Wiskott-Aldrich syndrome with polymorphic DNA sequences from the human X chromosome
Glucagon-like peptide I stimulates insulin gene expression and increases cyclic AMP levels in a rat islet cell line
Chimeric mouse-human IgG1 antibody that can mediate lysis of cancer cells
Androstenedione may organize or activate sex-reversed traits in female spotted hyenas
Monoclonal antibodies to the human insulin receptor that activate glucose transport but not insulin receptor kinase activity
Epstein-Barr virus nuclear antigen 2 specifically induces expression of the B-cell activation antigen CD23
Tis~ue distribution and clearance kinetics of non-transferrin-bound iron in the hypotransferrinemic mouse: A rodent model for hemochromatosis
MICROBIOLOGY
Isolation and characterization of the a-sialyl-{3-2,3-galactosyl-specific adhesin from fimbriated Escherichia coli
NEUROBIOLOGY
Cholinergic phosphatidylinositol modulation of inhibitory, G protein-linked, neurotransmitter actions: Electrophysiological studies in rat hippocampus
Neurofilament gene expression: A major determinant of axonal caliber
Calcium-dependent effect of the thymic polypeptide thymopoietin on the desensitization of the nicotinic acetylcholine receptor
Monoclonal antibody analysis of keratin expression in the central nervous system
Multiple neuropeptides in cholinergic motor neurons of Aplysia: Evidence for modulation intrinsic to the motor circuit
Quinolinic acid phosphoribosyltransferase: Preferential glial localization in the rat brain visualized by immunocytochemistry
Activation of a potassium current by rapid photochemically generated step increases of intracellular calcium in rat sympathetic neurons
v
Hanna Ksiezak-Reding, Dennis W. Dickson, Peter Davies, and Shu-Hui Yen
Nobuyuki Nukina, Kenneth S. Kosik, and Dennis J. Selkoe
Kazuo Ichikawa and Leslie J. DeGroot
M. Vecchi, S. Sakamaki, B. Diamond, A. B. Novikoff, P. M. Novikoff, and K. M. Das
Monica Peacocke and Katherine A. Siminovitch
Daniel J. Drucker, Jacques Philippe, Svetlana Mojsov, William L. Chick, and Joel F. Habener
Alvin Y. Liu, Randy R. Robinson, Karl Erik Hellstrom, E. David Murray, Jr., C. Paul Chang, and lngegerd Hellstrom
Stephen E. Glickman, Laurence G. Frank, Julian M. Davidson, Erla R. Smith, and P. K. Siiteri
John R. Forsayeth, Jose F. Caro, Madhur K. Sinha, Betty A. Maddux, and Ira D. Goldfine
F. Wang, C. D. Gregory, M. Rowe, A. B. Rickinson, D. Wang, M. Birkenbach, H. Kikutani, T. Kishimoto, and E. Kieff
C. M. Craven, J. Alexander, M. Eldridge, J. P. Kushner, S. Bernstein, and J. Kaplan
Thomas Moch, Heinz Hoschiitzky, Jorg Hacker, Klaus-D. Kroncke, and Klaus Jann
Paul F. Worley, Jay M. Baraban, Madeline McCarren, Solomon H. Snyder, and Bradley E. Alger
Paul N. Hoffman, Don W. Cleveland, John W. Griffin, Phillip W. Landes, Nicholas J. Cowan, and Donald L. Price
Frederic Revah, Christophe Mulle, Christian Pinset, Tapan Audhya, Gideon Goldstein, and Jean-Pierre Changeux
Maryellen C. Franko, Clarence J. Gibbs, Jr., Dorothy A. Rhoades, and D. Carleton G~dusek
Elizabeth C. Cropper, Philip E. Lloyd, William Reed, Renata Tenenbaum, Irving Kupfermann, and Klaudiusz R. Weiss
Christer Kohler, Etsuo Okuno, Per R. Flood, and Robert Schwarcz
Alison M. Gurney, Roger Y. Tsien, and Henry A. Lester
3410
3415
3420
3425
3430
3434
3439
3444
3448
3452
3457
3462
3467
3472
3477
3482
3486
3491
3496
PFIZER EX. 1032 Page 7
Contents
y-Aminobutyric acid exerts a local inhibitory action on the axon terminal of bipolar cells: Evidence for negative feedback from amacrine cells
Identification and purification of an irreversible presynaptic neurotoxin from the venom of the spider llololena curta
Neuropeptide Y-like immunoreactivity in rat cranial parasympathetic neurons: Coexistence with vasoactive intestinal peptide and choline acetyltransferase
Cloning and sequence analysis of eDNA for the canine neurotensin/neuromedin N precursor
Correlation of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine neurotoxicity with blood-brain barrier monoamine oxidase activity
Human immunodeficiency virus can productively infect cultured human glial cells
Social Sciences
PSYCHOLOGY
Initial localization of the acoustic conditioned stimulus projection system to the cerebellum essential for classical eyelid conditioning
vi
Masao Tachibana and Akimichi Kaneko
Chauncey W. Bowers, Heidi S. Phillips, Pamela Lee, Yuh Nung Jan, and Lily Y. Jan
Gabrielle G. Leblanc, Barry A. Trimmer, and Story C. Landis
Paul R. Dobner, Diane L. Barber, Lydia Villa-Komaroff, and Colleen McKiernan
Rajesh N. Kalaria, Mary Jo Mitchell, and Sami I. Harik
Cecilia Cheng-Mayer, James T. Rutka, Mark L. Rosenblum, Thomas McHugh, Daniel P. Stites, and Jay A. Levy
Joseph E. Steinmetz, Christine G. Logan, Daniel J. Rosen, Judith K. Thompson, David G. Lavond, and Richard F. Thompson
3501
3506
3511
3516
3521
3526
3531
PFIZER EX. 1032 Page 8
Proc. Nat/. Acad. Sci. USA Vol. 84, pp. 3439-3443, May 1987 Medical Sciences
1 Chimeric mouse-human JgG 1 antibody that can mediate lysis of cancer cells, ', · -
/-
(immunoglobulin domain eDNA/DNA transfection/tumor antigen/complement-dependent cytolysis/antibody-dependent cellular cytotoxicity)
ALVIN Y. Lru*t, RANDY R. ROBINSON*, KARL ERIK HELLSTROM:j:§, E. DAVID MURRAY, JR.*~, c. PAUL CHANG*, AND INGEGERD HELLSTROM:j:ll
*International Genetic Engineering, Inc., 1545 17th Street, Santa Monica, CA 90404; toncogen, 3005 First Avenue, Seattle, WA 98121; and Departments of §Pathology and IIMicrobiology, University of Washington Medical School, Seattle, WA 98195
Communicated by Paul D. Boyer, January 28, 1987 (received for review December 22, 1986)
ABSTRACT , A chimeric mouse-human antibody has been created that recognizes an antigen found on the surface of cells from many carcinomas. Immunoglobulin constant (C) domains of the mouse monoclonal antibody L6, Cy2a and CK, were substituted by the human Cyt and CK by recombining eDNA modules encoding variable or C domains. The eDNA constructs were transfected into lymphoid cells for antibody production. The chimeric antibody and mouse L6 antibody bound to carcinoma cells with equal affinity and mediated complementdependent cytolysis. In the presence of human effector cells, the chimeric antibody gave antibody-dependent cellular cytotoxicity at 100 times lower concentration than that needed for the mouse L6 antibody. The chimeric antibody, but not the mouse L6 antibody, is effective against a melanoma line expressing small amounts of the L6 antigen. The findings point to the usefulness of the chimeric antibody approach for obtaining agents with strong antitumor activity for possible therapeutic usc in man. '>
The presence of tumor-associated antigens at the cell surface is a characteristic of many cancers. Since these antigens are either absent or found in much lower amounts in normal cells, it should be possible to use antibodies for targeting of tumors. A sizeable collection of relatively tumor-specific monoclonal antibodies (mAb) of mouse origin is available (1). Some of these mAb possess tumoricidal activity in the presence of human effector cells [antibody-dependent cellular cytotoxicity (ADCC)] or serum [complement-dependent cytotoxicity (CDC)] (2, 3). It has been shown (4) that partial tumor regression can be achieved when mAb possessing such functional activity are given to patients. One complication preventing repeated use of mouse mAb in man is that they are immunogenic. Furthermore, mouse mAb may interact less efficiently with human effector cells to mediate tumor destruction.
A method made possible by recombinant DNA technology was chosen to generate chimeric mouse-human antibodies. It entails the replacement of the mouse constant (C) domain regions with the corresponding human equivalents (5-7). In principle, antibody molecules obtained by this approach should retain their specificity for antigen and thus their usefulness for targeting, be much less immunogenic to man, and perhaps have increased antitumor activity.
The mouse mAb L6 [IgG2a(K)] binds to a carbohydrate antigen found at the surface of cells from human carcinomas of the lung, breast, colon, and ovary (8). L6 can mediate CDC with human complement or ADCC with human effector cells (2). mAb L6 may thus be of use for tumor targeting, either in its native form or after conjugation of anticancer agents.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
3439
In this study we have generated a mouse-human chimeric L6 antibody in which the mouse constant domains Cy2a and C" are substituted by the human C.,1 and C". First, the cDNAs encoding the immunoglobulin genes were isolated. Next, restriction enzyme recognition sites were created in the eDNA sequences at the V /C junction (where V stands for variable) (9) by in vitro mutagenesis using oligodeoxyribonucleotides (10). The chimeric cDNAs thus constructed were then introduced into lymphoid cells by DNA transfection. The chimeric antibody isolated from the transfectants was compared with the mouse L6 for effector functions.
MATERIALS AND METHODS
DNA Transfection of Mouse Sp2/0 Lymphoid Cells. Expression plasmid piNG2114 (50 f.Lg), linearized at a unique site (Aat II) in the nonessential bacterial region (see Fig. 3A), was transfected into 107 mouse Sp2/0 cells (CRL 1581, ATCC) by electroporation (11, 12). Transformants were selected in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% (vol/vol) fetal bovine serum (HyClone, Log~n, UT) and G418 at 0.8 mg/ml (GIBCO). The transfectwn frequency was between w-5 and 10-4• Human antibody in the medium was detected by ELISA (13).
Isolation of Chimeric Antibody. Antibody-producing ~ells were grown to a density of 106 cells per ml and then shtfted to serum-free DMEM 24 hr before harvest. Antibody secreted by the cells was concentrated by ultrafiltration, then chromatographed on a DEAE-cellulose column equilibrated in 40 mM NaCl/10 mM sodium phosphate, pH 8.0. The antibody in the flow-through was further purified to ap~arent homogeneity on protein A-Sepharose (14). For production of ascites fluid 106 cells were injected into pristane-primed BALB/c mi~e. The chimeric antibody was purified by antihuman IgG-Sepharose chromatography (14).
Functional Tests of the Chimeric L6 Antibody. The following tests were included: (i) measurement of antibody binding to target cells, either positive or negative for reactivity with the mouse L6; (ii) competitive inhibition of binding of L6 to these cells; (iii) assays for CDC and ADCC. The binding tests were performed using a Coulter model EPIC-C cell sorter (8). The assays for CDC and ADCC were carried out on 51Crlabeled target cells (2, 3) that were exposed to antibodies and human serum or peripheral blood leukocytes over a 4-hr period.
Abbreviations: V, variable; C, constant; J ,joining; mAb, monoclonal antibody(ies); CDC, complement-dependent cytolysis; ADCC, antibody-dependent cellular cytotoxicity; SV40, simian virus 40; H, heavy. tTo whom reprint requests should be addressed. ~Present address: Department of Biochemistry, University of California, Riverside, CA 92521.
PFIZER EX. 1032 Page 9
3440 Medical Sciences: Liu et al. Proc. Nat!. A cad. Sci. USA 84 ( 1987)
A Lb Vn
met asp tro leu C2JAGTTTG'l'CTTAAGGCACCACTGAGCCCAAGTCTTAGACA'l'CATG GAT TGG CTG
BAL31del.
G'l'CGACTCT Aft If
Sail leader pept1de IFR1 trp asn leu leu phe leu met ala ala ala gln ser ala gln ala qln 'l'GG AAC TTG CTA T'l'C C'l'G ATG GCA GC'l' GCC Cl\l, AG'l' GCC Cl1l\ GCJ\ Cl\G
ile gln leu val gln s~r gYy p~o gYu l~u l~s l~s p~o gly qYu thr l\TC Cl\G 'I"l'G G'l'G Cl\G TCT GGA CCT GAG C'I'G 1\l\G Al1G CC'l' GG!1 GM; 1\Cl\
val lys ile ser cys lys ala ser qly tyr thr rohe t~R;1c~~~~ tyr qly GTC 1\l\G l\TC TCC TGC AAG GCT TCT GGG TAT ACC TTC 1\C!\ J,f,C T/\T c;r;r,
Bgl II
CDR11FR2 Ff121 met asn trp val lys gln ala pro qly lys gly leu lys trp met qly ATG AAC TGG G'l'G AAG CAG GCT CCI\ GGJ\ 1\l\G GGT TT!1 AM; TCr; l\TG c;r;c
Aha Ill
CDR2 trp ile asn thr tyr thr gly gln pro thr tyr ala asp asD rohe lys TGG ATA AAC ACC TAC ACT GGA CAG CCA ACA TAT GCT GAT GAC TTC AAG
Nde I
CDR21FR3 gly ara phe ala Dhe ser leu glu thr ser ala tyr thr ala tyr leu GGA CGG TTT GCC TTC TCT TTG GAA ACC TCT GCC TAC ACT GCC TAT TTG
gln ile asn asn leu lys asn glu aso met ala thr tyr ohe cys ala Cl,G l\'l'C 1\l\C 1\l\C CTC 1\l,l\ l\1\'l' GAG GAC ATG GCT l1Cl1 Tl\'1' TTC TG'I' CCI\
FR31CDR3 CDR31FR4 arq phe ser tyr gly asn ser arg tyr ser asro tyr tro qly qln gly AGA 'l'T'l' AGC 'l'A'l' GG'l' !1/\C TCA CG'l' TAC 'l'CT r;r,c 'l'AC TGG GGC Cl\!1 c;r~c
Dsp2,2
---------------JH2
thr thr leu thr val ser ser ala lys thr thr ala pro ser l\CC l\C'l' CTC ACA G'I'C 'l'CC 'l'CA GCC l\!1!. 1\Cl'. 1\C!, GCC CC!1 TCG-------
----------------- GC -----Ac;- G -----MJH2 Apo I
B L6 Vr:
leader pcpt1de met asp phe qln val gln ile ohe ser nhe leu leu
CgCCCCl\l\Gl\Cl\1\l\l\'l'G GAT TTT CAl\ GTG CAG ATT TTC AGC TTC CTG CTA
---eTc------------------ s· Sol 1
ile ser ala ser val ile met ser arg qlyl~ln ile val leu ser qln ATC AGT GCT 'I'CA G1'C l\1'/\ ATG 'I'CC 1\Gl\ GG!1 CM, A'l'T G'I"l' C'I'C 'I'CC C!1C
ser pro ala ile leu ser ala ser pro gly glu l~s vgl t~r l2u thr TCT CCI\ GCA A'l'C C'l'G 'I'CT GCA TC'I' CCI\ GGC GAG AN; r;Tc T1Cl\ 'l"l'r; AC'I'
~RliCD§l o o o o o o o C9,R11FR3 0
o cys arg ala ser ser ser val ser phe met asn trp tyr qln gln l~s TGC AGG GCC AGC 'l'CA AGT G'l'A ACT TTC ATG AAC TGG TAC ~AC CAG AAG
Kpn I
P~o gly ser ser pro lys pro trp ile :;:1~0l~ thr ser asn leu ala CCI\ GGA 'I'CC 'I'CC CCC AAA CCC TGG A'I''I' TAT CCC ACA TCC AAT TTG GC'l'
Bam HI
CDR21FR3 ser glu phe pro gly arg phe ser gly glu trn ser gly thr ser tyr 'l'C'I' GAG TTC CCT GG'l' CGC 'I"l'C AGT CCC GAG 1~G 'l'CT GGG ACC TCT TAC
ser leu ala ile ser arg val qlu ala glu a~o ala aYa t~r t~r t;r 'l'CT CTC GCA ATC AGC AGA G'!'G GAG GC'l' GAA GAT GCT GCC ACT '!'AT TAC
----------------------------JK5-FR31CDR3 o 0 0 CDR31FR4 c~s gin gln t~p asn s~r a~n pro l3u thr phe gly ala gly thr lys TGC CAG CAG TGG AAT AGT AAC CCI\ CTC ACG TTC GGT GC'l' GGG l\CC AAC
leu qlu leu lys C'l'G GAG C'l'G /\All-------------------------------------------
FIG. 1. Nucleotide sequence~ and predicted amino acid sequences of the L6 V11 (A) and V. (B). The framework CFR) and complementarity determining region (CDR) segments arc indicated. The diversity (0) segment in V11 is underlined. Circles above the amino acid residues indicate that these residues matched to those obtained from peptide sequencing. The V 11 sequence is present in plasmid pH3-6a. The C23 at the 5' end was removed by BAL-31 nuclease digestion. The resultant DNA sequence at the 5' end h shown below the first line. An Apa I site was introduced by the oligo~uckotide primer MJH2Apal. The V. ~equence IS present in plasmid pL3-12a. The Cn at the 5' end was removed by oligonucleotide-mediated mutagenesis. A //indlll site was introduced by the oligonucleotide primer J KHindlll.
PFIZER EX. 1032 Page 10
Medical Sciences: Liu et a/.
RESULTS Isolation of Mouse eDNA. A eDNA library was generated
from the L6 hybridoma cells by priming poly(A)+ RNA with oligo(dT) as described (9, 15). The probes used to screen the library were a JK5 oligonucleotide, d(GGTCCCAGCACCGAACG), for the light chain and a JH2 oligonucleotide, d(TGGCTGAGGAGACTGTGAGAG) for the heavy chain (where J stands for joining and H stands for heavy). Two methods (16, 17) were used to determine that the L6 K mRNA contains JKS sequences and that the L6 -y2a mRNA contains J 112 sequences.
Preparation of Mouse V-Region eDNA Modules. Restricti~n enzyme sites were engineered into the immunoglobulin eDNA around the V /C border for recombining mouse V regions to human C modules. The oligonucleotide MJH2Apai [d(ATGGGCCCTTTGTGCTGGCTGAGGAGACTGT) (with the restriction enzyme site underlined)] was used for mutagenesis of the V11 eDNA; and the oligonucleotide JKHindlll [d(CTCAAGCTTGGTCCC)] for that of the V K
eDNA. Restriction sites on the 5' side of the ATG codon were also created. The oligonucleotide d(GAAAATCCATTTTGTCGACGGG) was used to generate a Sal I site eight residues on the 5' side of the V K ATG codon. By cleaving with Sal I the oligo[d(GC)] segment on the 5' side of the eDNA insert was removed. To remove the oligo[d(GC)] segment on the 5' side of the V11 eDNA, the nuclease BAL-31 (18) was used. The digested products were inserted into the vector M13mp19 (19) in such a way that the Ml3 Sal I site became a convenient site on the 5' side of the ATG codon. The DNA sequences of V H and V K arc shown in Fig. 1.
Human C-Region eDNA Modules. Human C-region cDNAs were isolated from libraries generated from the mRNA from two human lymphoblastoid cell lines, GM1500 and GM2146 (Human Genetic Mutant Cell Repository). The human Cyt
module has been described (9). The eDNA clone pGMH6 contains an Apa I site 16 nucleotide residues on the 3' side of the V /C border (Fig. 2).
The human CK module is a composite of two K cDN~s isolated from the GM1500 and GM2146 libraries. In plasmid pGML60, the 3'-untranslated region was derived from the K
mRNA of GM2146 while the coding region was from that of GM1500. The J KHindiii oligonucleotide described above was used to engineer a l/indlll recognition site at a position of the human J K segment analogous to that in the mouse J K
segment. Chimeric L6 Heavy- and Light-Chain Expression Plasmids.
The eDNA constructs were inserted into the vector sequences of plasmid piNG2012E (9). Directionality of insertion was achieved by using a Sal I-BamHI bracket. piNG2012E contains regulatory sequences derived from plasmid pLl (20) that furnished the early promoter and splice donor-acceptor of simian virus 40 (SV40); and from plasmid pSV2neo (21) that furnished the transcription termination/ polyadenylylation signals of SV40. We added the mouse immunoglobulin heavy-chain gene transcription enhancer,
pGMl!6 humiln Cyl module
Proc. Nat/. A cad. Sci. USA 84 ( 1987) 3441
placed upstream of the SV40 promoter (9). The selectable marker is the Tn5 neogene that confers resistance to the drug 0418.
The heavy-chain plasmid piNG2111 was constructed by first joining the mouse VH eDNA module in a Sal 1-Apa I DNA fragment with the human Cy1 eDNA module in an Apa I-BamHI DNA fragment. The ligated fragments were then inserted into piNG2012E cleaved by Sal 1-BamHI. The light-chain plasmid piNG2119 was constructed by joining the mouse VK eDNA module in a Sal I-Hindlll DNA fragment with the human CK eDNA module in a Hindiii-BamHI DNA fragment. The same vector fragment was used (Fig. 3A). In both plasmids the eDNA gene is placed 11 nucleotide residues downstream of the SV 40 19S 3' -splice acceptor (9). The eDNA ends in a segment approximately A70G2o, where it is joined to the SV 40 transcription-termination/polyadenylylation sequences. Fig. 3B shows the incident nucleotide sequence changes made at the V /Cjunction as a result of the gene construction.
A two-gene plasmid, piNG2114, was constructed fro~ piNG2111 and piNG2119 in which the light- and heav~-chat.n gene transcription units are in tandem (Fig. 3A). By usm~ this plasmid, we introduced an equal ratio of heavy- and lightchain genes into recipient cells. Unexpectedly, we observed that there was a consistently higher expression of heavy than of light chain in all transfected cell lines examined (dat~ not shown). The two transcription units differ in that the ltghtchain gene is about 700 base pairs shorter than the heavychain gene, and the CK gene segment has a higher A+ T content. This imbalance was reduced by introducing more light-chain gene copies carried on a second plasmid with a different selectable marker [plNG2121a, an Eco-gpt (22) version of plNG2119].
Two initial Sp2/0 transformants, D7 and 3E3, obtained by transfection with piNG2114 were cultured for the isolation of chimeric antibody. D7 secretes 10% of the antibody produced by 3E3-K (17 J.Lg/liter) and y (77 J.Lg/liter) chains for D7 compared to K (100 J.Lg/liter) and y (700 J.Lg/liter) chains for 3E3.
Binding Characteristics of Chimeric Versus Mouse ~6 Antibody. Table 1 shows that the chimeric L6 antibody bmds to cells from a human colon carcinoma (line C-3347) that express 5 x 105 molecules per cell of the antigen defined by the mouse L6 mAb (8). In a competition assay, 50% inh~biti~n of binding was achieved by the same amount of the chimer~c and mouse L6 (Fig. 4). Cells from a T-cellline, HSB-2, did not bind either mouse L6 or the chimeric antibody. Data on the melanoma line M-2669, clone 13 (3), are also included in Table 1 since this line, which expresses a low level of the L6-defi~ed antigen, was used for the functional studies (see below).
Chimeric L6 Antibody Mediates CDC and ADCC. Fig. 5 shows that both the chimeric and mouse L6 antibodies lysed tumor cells in the presence of human complement. The experiment further showed that the chimeric L6 gave higher CDC at all dilutions of the complement.
--- G 1 GTC Ace GTC TC'l' 'l'Cl\ I Gee ·rcc Ace l\l\G GGc cpA TCG G ------ost E II Apo I
FIG. 2. Human C-domain eDNA gene modules. The relevant sequences at the V /C junction of human Cy, and C. eDNA clones are shown. The Cyl clone contains a BstEII and an Apa I site that can be used to recombine with different V-domain eDNA genes. The c. clone does not contain a convenient recombination site; and an oligonucleotide containing a l/ind!II site was used to introduce this site into the eDNA. The C-domain eDNA modules are pGMH6 and pGML60.
pGML60 humiln CK module
--------JK4------------------------------------Gl\T Cl\'l' C'l'C CCT C'l'C l\CT 'l''l'C GGC GGl\ GGG l\CC l\7\G G'I'G Gl\G l\TG l\l\!1-
I Sau 3A I
----------:1- C-T-Hind Ill
PFIZER EX. 1032 Page 11
3442 Medical Sciences: Liu et al.
A
-CTC ACA GTC TCC T;;~ 1 ~~C AGC l\Cl\ l\1\G GGC CCI\ "1'-Apa I
mo hu
-ACC J'>!AG CTa) GAG ®TG AM CGI\ 1\CT ---Hlnd Ill
FIG. 3. (A) Expression plasmids. plNG2111 is the heavy-chain and p!NG2119 is the light-chain expression plasmid. They were used to construct piNG2114, a two-gene plasmid. Solid circles, mouse heavy-chain immunoglobulin gene enhancer; small arrows, SV40 early promoter; diamonds, bidirectional SV 40 transcription termination/polyadenylylation signals. (B) Nucleotide changes made in the V /C junction. Dotted residues in the V HCy1 junction were introduced by oligonucleotide-mediated mutagenesis. They are silent changes. Circled residues in the V .c. junction are residues contributed by the human eDNA module to the mouse V. gene.
Fig. 6 shows ADCC tests with cells from two cell lines. At a ratio of 100:1 human peripheral blood leukocytes to the colon carcinoma line C-3347 cells, the chimeric L6 killed a greater fraction of the target cells (a maximum of98% versus 63%) and gave 50% ADCC at 100 times lower concentration than the mouse L6 (0.01 p,g/ml versus 1 p,g/ml, Fig. 6A). Significant ADCC of C-3347 cells (24% as compared to 3% lysis with lymphocytes alone) was observed down to a 3:1 ratio of effector cells to target cells when the chimeric L6 (at 2.5 p,g/ml) was used (Fig. 6B). Cell killing was specific because ADCC was not observed with the following three cell lines lacking detectable L6 antigens: B-celllines DHL-10 (Fig. 6C) and T51 (data not shown) and the T-cellline HSB-2
100
c 80 0
::g 60
:.c ~ 40
~ 20
50% Inhibition : Mouse L6= 1.9)Jg/ml Chimeric L6 = 1.9 )Jg/ml
1 10
Inhibiting Antibody (j.Jg/ml) 100
FIG. 4. Comparison between chimeric and standard mouse L6 in antibody inhibition assays, performed by fluorescence-activated cell sorting. C-3347 cells were incubated with the blocking antibodies before fluorescein isothiocyanate-conjugated mouse L6 (3 !Lg/ml) was added.
Proc. Nat!. A cad. Sci. USA 84 ( 1987)
Table 1. Binding of chimeric L6 and mouse L6 antibodies to cell lines used as targets for functional assays
Antibody
Antibody concentration,
!Lg/ml
Human colon carcinoma line C-3347 Mouse L6 30
10 3
Chimeric L6 (ascites) 30 10 3
Chimeric L6 (cell culture) 30 10 3
Human melanoma line M-2669 (clone 13) Mouse L6 30
Chimeric L6 (cell culture)
Human T-cell line HSB-2 Mouse L6 Chimeric L6 (ascites) Chimeric L6 (cell culture)
10 3
30 10 3
10 10 10
Binding ratio*
GAM GAH
38 49 40
2 2
7 3 1
NT NT NT
4 4 3
108 84 42
105 86 44
NT NT NT
4 2
*The binding ratio is the number of times a test sample is brighter than a control sample when treated with GAM (fluorescein isothiocyanate-conjugated goat anti-mouse immunoglobulin) or with GAH (fluorescein isothiocyanate-conjugated goat anti-human immunoglobulin). For example, a ratio of 1 means that the test sample is as bright as the control; a ratio of2 means that the test sample is twice as bright as the control. NT, not tested.
(data not shown). Efficacy of the chimeric L6 was further demonstrated by its ability to lyse M-2669 melanoma cells (35% at 10 p,g/ml, 27% at 0.1 p,g/ml); the mouse L6 had no effect on these cells (9% at 10 p,g/ml, as compared to 10% lysis with lymphocytes alone, Lj: Table 1).
DISCUSSION
The mouse mAb L6 recognizes a carbohydrate antigen present in abundance in a variety of carcinomas. Normal tissues express only trace amounts of the antigen (8). Based on this specificity there is justification in considering L6 for cancer treatment with the mAb used either alone (2) or as a carrier of anticancer agents. However, the immunogenicity of mouse L6 mAb in man is a disadvantage for its sustained use in patients, and its functional activity (ADCC and CDC) may be insufficient to effect optimal tumor destruction at the
100
Z' 80 ·u ')< 60 0 0 -;:., 40 u ~
C-3347 Cells
(Chimeric L6
1:4 1:2 Undiluted
Dilution of Human Serum
FIG. 5. Titration of human serum (as a source of complement) in the presence of chimeric or mouse L6 at 2.5 iL£/ml.
PFIZER EX. 1032 Page 12
Medical Sciences: Liu et a/.
A 100
80
.£ ·~ 60 0 0 8- <10
~
C·3347 Cells E/T,100/I
I
,/;;---___ _ P:/~Chimeric L6 (I)
0~~--~----~~----L-----~--~~--00001 0.001 0.01 0.1 1 10
B 100
.z:-80 ·u § 60
0 ;;.. 40 u
c 100
0
Antibody ( }Jg/ml)
rMouse L6
~--..,_ _ __,r_Ly:._mphocyles alone
20 40 60 80 100
Effector Cells per Target Cell
DHL-10 Cells EIT,100/I
(IF5
~L6 002 0.2 2
Antibody ( }Jg/ml)
FIG. 6. (A) Titration of chimeric and mouse L6 antibodies in ADCC assays with human peripheral blood leukocytes. E/T, effector-target cell ratio. Two preparations of chimeric L6 were used. <B) Titration of human peripheral blood leukocyte effector cells mediating ADCC in the presence of antibodies (2.5 J,Lg/ml). (C) Titration ofL6 (chimeric and mouse) in ADCC assays on the DHL-10 T-ccll line. 1F5 is a mouse mAb that recognizes the DHL-10 cells.
concentrations that can be attained in tumors after intravenous administration.
It is estimated that a mqjor immunogenic site resides in the Cu2 region (23) of the IgG molecule. As one approach to decrease this problem, one could generate chimeric mousehuman antibodies thereby replacing the immunogenic C domains of the mouse immunoglobulins with those of human immunoglobulins. We did this using eDNA rather than cloned genomic DNA (24, 25). We show here that this is a useful approach for producing chimeric antibody. In cell line 3E3 and its subclones close to 1 ttg/ml of IgGl protein was detected.
The chimeric antibody was found to bind to tumor cells as well as the mouse L6 antibody. The chimeric antibody was much more efficient than L6 in ADCC assays, killing a greater fraction of target cells at a concentration lower by a factor of 100. Furthermore, the chimeric L6 killed cells from a melanoma line that was refractory to ADCC by the mouse L6. In patients one may speculate that the chimeric L6 would remain longer in the circulation. This, in combination with
Proc. Nat/. Acad. Sci. USA 84 (1987) 3443
the functional attributes of chimeric L6, should make it a strong candidate for therapeutic trials. Some of the antibodies induced in man to mouse mAb were directed to idiotypic determinants (26, 27). It remains to be seen whether the immunogenicity of those determinants of the chimeric L6 will be different from that of the mouse L6.
The advantage of the eDNA approach lies in the ease with which immunoglobulin gene cDNAs can be isolated. The technology used for the present work should make it possible to convert many other mouse mAb to chimeric antibodies with improved antitumor activity via ADCC and CDC mechanisms. The chimeric antibodies will augment the relatively few human mAb currently used in the treatment of cancer (28).
We thank Cathy Shapiro, Phil Mack, Phil Mixter, Pam Smith, Susan Azemove, Grethe Lovold, and Pat McGowan for excellent technical assistance. We also thank Randy Wall for discussion, and Randy Wall, Carol Hersh, Arup Sen, Gary Wilcox, Perry Fell, Jeff Ledbetter, Peter Linsley, and Erik Milner for useful comments on the manuscript. The work was supported by INGENE and ONCOGEN.
1. Hellstrom, K. E. & Hellstrom, I. (1985) in Monoclonal Antibodies for Cancer Detection and 1!Jerapy, eds. Baldwin, R. S. & Byers, V. S. (Academic, New York), pp. 17-51.
2. Hellstrom, I., Beaumier, P. L. & Hellstrom, K. E. (1986) Proc. Nat/. Acad. Sci. USA 83, 7059-7063.
3. Hellstrom, I., Brankovan, V. & Hellstrom, K. E. (1985) Proc. Nat/. Acad. Sci. USA 82, 1499-1502.
4. Houghton, A. N., Mintzer, D., Cordon-Cardo, C., Welt, S., Fliegel, B., Vadhan, S., Carswell, E., Melamed, M. R., Oettgen, H. F. & Old, L. J. (1985) Proc. Nat/. Acad. Sci. USA 82, 1242-1246.
5. Morrison, S. L., Johnson, M. J., Herzenberg, L. A. & Oi, V. T. (1984) Proc. Nat/. Acad. Sci. USA 81, 6851-6855.
6. Boulianne, G. L., Hozumi, N. & Shulman, M. J. (1984) Nature (London) 312, 643-646.
7. Neuberger, M. S., Williams, G. T., Mitchell, E. B., Jouhal, S. S., Flanagan, J. G. & Rabbitts, T. H. (1985) Nature (London) 314, 268-270.
8. Hellstrom, I., Horn, D., Linsley, P., Brown, J.P., Brankovan, V. & Hellstrom, K. E. (1986) Cancer Res. 46, 3917-3923.
9. Liu, A. Y., Mack, P. W., Champion, C. I. & Robinson, R. R., Gene, in press.
10. Zoller, M. J. & Smith, M. (1982) Nucleic Acids Res. 10, 6487-6500. 11. Potter, H., Weir, L. & Leder, P. (1984) Proc. Nat/. Acad. Sci. USA
81, 7161-7165. 12. Toneguzzo, F., Hayday, A. C. & Keating, A. (1986) Mol. Cell.
Bioi. 6, 703-706. 13. Mixter, P. F., Wu, S. V., Studnicka, G. M. & Robinson, R. R.
(1986) J. Immunol. Methods 91, 195-203. 14. Johnstone, A. & Thorpe, R. (1982) Immunochemistry in Practice
(Blackwell Scientific, Oxford), pp. 27-76. 15. Gubler, U. & Hoffman, B. J. (1983) Gene 25, 263-269. 16. White, B. A. & Bancroft, F. C. (1982) J. Bioi. Chem. 257,
8569-8572. 17. Nobrega, F. G., Dieckmann, C. L. & Tzagoloff, A. (1983) Anal.
Biochem. 131, 141-145. 18. Legerski, R. J., Hodnett, J. L. & Gray, H. B., Jr. (1978) Nucleic
Acids Res. 5, 1445-1463. 19. Messing, J. (1983) Methods Enzymol. 101, 20-78. 20. Okayama, H. & Berg, P. (1983) Mol. Cell. Bioi. 3, 280-289. 21. Southern, P. J. & Berg, P. (1982) J. Mol. App/. Genet. I, 327-341. 22. Mulligan, R. C. & Berg, P. (1981) Proc. Nat/. Acad. Sci. USA 78,
2072-2076. 23. Novotny, J., Handschumacher, M. & Haber, E. (1986) J. Mol.
Bioi. 189, 715-721. 24. Sun, L. K., Curtis, P., Rakowicz-Szulczynska, E., Ghrayeb, J.,
Morrison, S. L., Chang, N. & Koprowski, H. (1986) Hybridoma 5 Suppl. 1, S17-S20.
25. Sahagan, B. G., Dorai, H., Saltzgaber-Muller, J., Toneguzzo, F., Guindon, C. A., Lilly, S. P., McDonald, K. W., Morrissey, D. V., Stone, B. A., Davis, G. L., Mcintosh, P. K. & Moore, G. P. (1986) J. Immuno/. 137, 1066-1074.
26. Goodman, G. E., Beaumier, P. L., Hellstrom, I., Fernyhough, B. & Hellstrom, K. E. (1985) J. Clin. Onco/. 3, 340-352.
27. Koprowski, H., Herlyn, D., Lubeck, M., DeFreitas, E. & Sears, H. F. (1984) !'roc. Nat/. Acad. Sci. USA 81, 216-219.
28. Irie, R. F. & Morton, D. L. (1986) !'roc. Nat/. Acad. Sci USA 83, 8694-8698.
PFIZER EX. 1032 Page 13