PRIMA-1met Induces Apoptosis in Waldenström's … · 2019. 3. 12. · Treatment of WM cells with...
Transcript of PRIMA-1met Induces Apoptosis in Waldenström's … · 2019. 3. 12. · Treatment of WM cells with...
-
PRIMA-1met Induces Apoptosis in Waldenström's
Macroglobulinemia Independent of p53, alone and in
Combination with Bortezomib
By:
Mona Sobhani
A thesis submitted in conformity with the requirements for the degree of
Masters of Science
Department of Laboratory Medicine and Pathobiology
University of Toronto
© Copyright by Mona Sobhani 2015
-
ii
PRIMA-1met Induces Apoptosis in Waldenström's
Macroglobulinemia Independent of p53, alone and in
Combination with BortezomibMona Sobhani
Master of Science
Department of Laboratory Medicine and Pathobiology
University of Toronto
2015
Abstract:
PRIMA-1met has shown promising preclinical activity in various cancer types. However, its
effect on Waldenström’s Macroglobulinemia (WM) as well as its exact mechanism of action is
still elusive. In this study, we evaluated the anti- tumor activity of PRIMA-1met alone and in
combination with dexamethasone or bortezomib in WM cell line and primary samples.
Treatment of WM cells with PRIMA-1met resulted in induction of apoptosis, inhibition of
migration and colony formation. Upon PRIMA-1met treatment, p73 was upregulated and Bcl-xL
was downregulated while no significant change in expression of p53 was observed. siRNA
knockdown of p53 in WM cell line did not influence the PRIMA-1met-induced apoptotic
response whereas silencing of p73 inhibited latter response in WM cells. Combined treatment
with PRIMA-1met and dexamethasone or bortezomib induced synergistic reduction in cell
survival in WM cells. Our study provides the rationale for PRIMA-1met’s clinical evaluation in
patients with WM.
-
iii
Acknowledgements
I would like to extend my sincerest thanks and regards to all those who supported and
encouraged me during my Master’s study.
First, I would like to express my special gratitude to my supervisors Dr. Hong Chang whose
expert guidance, support, patience and encouragement made my Master’s studies a productive
experience. I am grateful to have had the opportunity to train in a diverse learning environment
with admirable individuals, particularly Manujhandra Saha, Yijun Yang and Yan Chen, whose
proficiency and expertise in the lab have been immeasurably helpful to me. I would also like to
express my special thanks to my committee members Dr. Donald Branch and Dr Chen Wang for
their valuable and constructive comments.
My deep gratitude is expressed to my mother and father whose love, inspiration and endless
encouragement made my years of studies an enjoyable and unforgettable experience. They
deserve special and heartfelt thanks.
-
iv
Table of Contents
Abstract…………………………………………………………………………………………….i
Acknowledgments...........................................................................................................................ii
List of Tables ..................................................................................................................................v
List of Figures ................................................................................................................................vi
List of Abbreviations ................................................................................................................... vii
Chapter 1: Introduction ...............................................................................................................1
1.1. Waldenström's Macroglobulinemia..........................................................................................1
1.1.1Waldenström's Macroglobulinemia.................................................................................1
1.1.2. Incidences, Demographics, and Etiology........................................................................2
1.1.3.Diagnosis……...…………………...................................................................................3
1.1.4. Clinical Features………………………………………………………………...……...4
1.1.5. Laboratory and Pathological Findings……………………………………..…………...7
1.1.6. Molecular Pathology.......…………….............................................................................9
1.1.6.1. Genetics…………..…………………………………………………………....9
1.1.6.2. Epigenetics……………………...…………………………………………….13
1.1.6.3. Microenvironment…...………………………………………………………..14
1.1.7.WM Current Treatments………………….…………….……………………………...15
1.2. PRIMA-1met……………………………………………………………………………....21
1.2.1. P53 and Apoptosis……………………………………………………………………...21
1.2.2. PRIMA-1met………...………………………………………………………………...25
1.3. Rationale, Hypothesis, and Experimental Aims…………………………………………….30
-
v
Chapter 2: PRIMA-1met Induces Apoptosis in Waldenström’s Macroglobulinemia
Independent of p53:.……………………………………………………………………………32
2.2. Introduction ...........................................................................................................................32
2.3. Results …................................................................................................................................34
2.4. Discussion… ..........................................................................................................................42
2.5. Materials and Method……………………………………………………………………….44
2.6. References…………………………………………………………………………………...46
Chapter 3: Discussion……………….………………………………………………………….50
Chapter 4: Conclusions and Future Directions………………………………………………56
References .....................................................................................................................................61
-
vi
List of Table
Table 1: p53- activating small molecule drugs utilized in hematological malignancies………………………24
-
vii
List of Figures
Figure1: B cell maturation in WM……………………………………………………………...5
Figure2: Clinical features of WM……………………………………………………………….7
Figure3:MYD88L265 activation of NF-κB pathway…………………………………………11
Figure4: Mechanism of p53 driven intrinsic apoptotic pathway…………………………….22
Figure5: PRIMA-1met structure and mode of action……………………………………...28
Figure 6: Proposed mechanism linking PRIMA-1met induced P73 and ROS production..60
Paper Figures:
Figure1: The effect of PRIMA-1met on viability of WM cell lines and patient samples..…36
Figure 2: The apoptotic effect of PRIMA-1met in WM cell line.............................................37
Figure3: The effect of PRIMA-1met on apoptotic signaling in BCWM-1 cells………………….37
Figure 4: Anti-tumor activities of PRIMA-1met in WM cells…………………………………………..38
Figure5: Effects of PRIMA-1met in combination with current WM therapeutics……………39
Figure 6: PRIMA-1met cytotoxicity is P53-independent……………………………………………………40
Figure7: PRIMA-1met effect on BCWM-1 survival is P73-dependent…….………………………..41
-
viii
List of Abbreviations
AML Acute Myeloid Leukemia
aCGH Array-based Genomic Hybridization
Apaf-1 Apoptotic protease activating factor 1
ASCT Autologous Stem Cell Transplants
AS-PCR Allele Specific Polymerase Chain Reaction
Bax Bcl-2 associated x protein
Bcl-xL B-cell lymphoma-extra Large
Bcl-2 B-cell lymphoma 2
BMNC Blood Mononuclear Cell
BMSC Bone Marrow Stromal Cells
BTK Bruton's Tyrosine Kinase
CAD Caspase-Activated DNase
CAN Chromosomal Numerical Abnormalities
CXCR4 C-X-C Receptor type 4
CR Complete Remission
GLS2 Glutaminase
G6PD Glucose-6-Phosphate Dehydrogenase
HSP70 Heat Shock Protein 70
IAP Inhibitors of Apoptosis Protein
Ig Immunoglobulin
IPSSWM
International Prognostic Staging System for Waldenstrom’s
Macroglobulinemia
IRAK Interleukin-1 Receptor-Associated Kinase
MDM2 Mouse Double Minute 2
MGUS Monoclonal Gammopathy of Undetermined Significance
MM Multiple Myeloma
MPT Mitochondrial Permeability Transition
MQ Methylene quinuclidinone
-
ix
MR Minor remission
MYD88 Myeloid Differentiation Primary response gene 88
NADPH Nicotinamide Adenine Dinucleotide Phosphate
ORR Overall Response Rate
PBMNC Peripheral Blood Mononuclear Cell
PRIMA-1 P53- dependent reactivation and induction of massive apoptosis
PRDM1 PR Domain Zinc Finger Protein 1
Puma P53 upregulated modulator of apoptosis
REAL Revised European-American Lymphoma
ROS Reactive Oxygen Species
SDF-1 Stromal Cell-Derived Factor-1
SCID Sever Combine Immunodeficient
Smac/DIABLO Second Mitochondria-derived Activator of Caspases/ Direct
IAP- Binding protein with Low PI
TNF Tumor Necrosis Factor
TNFAIP3 Tumor Necrosis Factor Alpha-Induced Protein 3
VGPR Very Good Partial Remissions
WM Waldenström's Macroglobulinemia
WHO World Health Organization
XBP1 X-box Binding Protein 1
-
1
Chapter 1
Introduction
1.1. Waldenström's Macroglobulinemia
1.1.1. What is Waldenström's Macroglobulinemia?
Waldenström's Macroglobulinemia (WM) is a chronic B-cell lymphoproliferative
malignancy (Gertz,2012).It was first described by Dr. Jan Gösta Waldenström, a
Swedish internist, in two patients who presented oronasal bleeding, anemia,
lymphadenopathy, hypergammaglobulinemia, an elevated sedimentation rate,
hyperviscosity, normal bone survey, cytopenias, and a predominantly lymphoid
involvement of the bone marrow (Shaheen et al. , 2012). Today, the World Health
Organization (WHO) defines WM as a lymphoplasmacytic lymphoma
characterized by plasmacytic infiltration of bone marrow and immunoglobulin M
(IgM) monoclonal gammopathy (Shaheen et al., 2012). Malignant cells in WM
are quite various cytologically ranging from small lymphocyte to plasmacytoid
lymphocytes and plasma cells (Naderi and Yang, 2013). These cells originate late
in B cell development after somatic hypermutation but before final differentiation
to plasma cells (Jenz, 2013). Common symptoms of WM includes: fatigue due to
anemia, thrombocytopenia, hyperviscosity symptoms and in more severe cases of
the disease; organomegaly, neuropathy and symptoms associated with Ig
deposition (Treon, 2013).
Historically, any type of lymphoma with high levels of Igs was associated with
WM; therefore, it was popular to consider WM as a clinical syndrome that is
associated with various lymphoma types instead of a separate disease (Shaheen et
al., 2012). Until a few years ago, differential diagnosis of WM was quite difficult
for hematopathologists both due to inefficient definitions of the disease and lack
of proper diagnostic tools. In 1994, the Revised European-American Lymphoma
(REAL) classification defined Lymphoplasmacytic Lymphoma (LPL) as “a
-
2
diffuse proliferation of small lymphocytes, plasmacytoid lymphocytes and plasma
cells, with or without Dutcher bodies” (Harris et al., 1994). This definition
included most cases of WM but most hematopathologists considered it to be too
broad and not helping with differentiating LPL from the newly recognized
marginal zone B-cell lymphoma. WHO’s 2001 definition of WM was even more
confusing since it categorized it as a “neoplasm of small B cells, plasmacytoid
lymphocytes, and plasma cells, usually involving the bone marrow, lymph nodes,
and spleen, and commonly associated with hyperviscosity symptoms and with Ig
levels beyond 3g/dL” (Berger et al. 2001). This definition allowed the monoclonal
protein to be IgG and IgA as well as IgM and did not address the issue of low
levels of Ig in initial stages of WM or the fact that diagnosis based on Ig levels
makes differentiation of WM from non malignant Monoclonal Gammopathy of
Undetermined Significance (MGUS) impossible (Shaheen et al., 2012). Based on
the work done by clinicians at the second international workshop on WM, the
most recent definition of the disease published by WHO in 2008 is: “an LPL
involving the bone marrow and associated with any level of IgM which involves
the bone marrow in an intertrabecular pattern and typically has a mature B-cell
immunophenotype therefore lacking CD5 and CD10 on the cell surface”(
Swerdlow et al. 2008). New technological advances in genetic testing such as
Allele Specific Polymerase Chain Reaction (AS-PCR) in combination with recent
findings linking Myeloid Differentiation Primary response gene 88 (MYD88)
mutations and WM, which we will be more fully discussed later on in this
chapter, have helped with a more accurate means to diagnose WM patients today.
1.1.2. Incidences, Demographics, and Etiology
WM is a rare incurable disease with 1500 new cases per year in USA which is
equal to 3-5 persons per million per year ( Swerdlow et al. , 2008). It accounts for
1% to 2% of all non-Hodgkins lymphomas ( Fonesca and Hayman, 2007). The
median age of incidence is late sixties to early seventies and is more common
among males than females with a ratio of 1.2 up to 2 reported in different studies
(Swerdlow et al. , 2008; Fonesca and Hayman, 2007) . Caucasians seem to be
-
3
more prone to WM compared to their African-American counterparts (Swerdlow
et al., 2008). Reports indicate an increase in WM incidence in the past two
decades (Wang et al., 2012). The annual percentage-change for this population is
1.01% per year. However, significant annual percentage-change increases were
seen in the group aged 70 – 79 at 1.24% per year (Wang et al., 2012). WM overall
survival was initially reported to be 5 years but the more accurate representative
of WM population is the disease-specific survival which is 11 years (Dimopoulos
et al., 1999; Ghobrial et al., 2006).
The etiology of WM is largely unknown. Although some studies reported
autoimmunity and hepatitis C viral infections to increase the incidence of WM,
others have rejected these claims; therefore, no definite links between any
environmental or habit-related factors and WM have been drawn so far
(Kristinsson et al., 2009; Pozzato et al., 1994). Most cases of WM are sporadic
and only 20% of the cases are familial. Patients with MGUS have 200-fold higher
chances of developing WM; hence, MGUS is considered a precursor for WM
(Kyle et al., 2011; Treon et al., 2006)
1.1.3. Diagnosis
To establish the diagnosis of WM, both high levels of IgM and histological
evidence for lymphoplasmacytic involvement of the bone marrow is required
(Buske et al., 2013). Therefore, detection of IgM without the histopathological
evidence or vice versa does not fulfill the criteria for WM. Presence of IgM
hyperviscosity is confirmed by immunofixation and its level is measured either by
densitometry or serum nephelometry (Ansell et al. 2010). Lymphoplasmacytic
cells should be documented through bone marrow aspirations and
immunophenotyped for presence of CD19, CD20, CD22 and CD79a (Gertz,
2012). Detection of MYD88 L265P mutation is also an additional tool to
differentiate WM from rare cases of IgM multiple myeloma, MGUS, and splenic
marginal zone lymphoma (Treon and Hunter, 2013).
-
4
1.1.4. Clinical Features
The clinical features of WM are quite variable. Around 30% of WM population
have what is called “smoldering WM”, meaning, they do not have any signs or
clinical symptoms (Figure 1) (Treon, 2013). This group does have higher than
normal IgM levels and bone marrow neoplastic involvement but neither of these
lead to any organ damage or symptoms. The remaining 70% are symptomatic
patients but their symptoms ranges quite variously (Figure 2). Some only have
non-specific symptoms such as weight loss, fatigue and or anorexia. The rest will
have symptoms resulting from one of the following four mechanisms: 1) tissue
infiltration by lymphoma, 2) serum hyperviscosity, 3) autoantibodies, and 4) IgM
deposition in tissues (Shaheen et al, 2012).
Symptoms resulting from tissue invasion by tumor cells are diverse and based on
the affected tissue. The bone marrow is always involved by lymphoplasmacytic
cells. In 50% of cases WM cells contain Dutcher bodies and usually invade the
bone marrow in an interstitial/nodular pattern without causing any lytic bone
lesions (Buske et al., 2013). Tumor infiltration in the bone marrow generally
results in anemia. Other factors such as deregulated interleukin-6 (IL-6) and
increased plasma volume are also involved in causing normocytic and
normochromatic anemia (Ansell et al., 2010). In few cases thrombocytopenia or
leucopenia also occur as a result of extensive bone marrow take over by WM.
15% to 20% of WM patients develop lymphadenopathy with paracortical and
hilar infiltrations as well as moderate involvement of marginal sinuses (Shahin et
al., 2014). Hepatomegaly and splenomegaly occur in approximately 10% of
patients; and a very small subset of patients develop other extranodal sites of
disease such as lungs, bowels and stomach (Treon et al., 2014b). At the time of
relapse, organomegalies such as lymphadenopathy and hepatosplenomegaly
become very common, in up to 50% of WM patients (Shaheen et al., 2012)
-
5
Figure1: B cell maturation in WM. WM cells originate late in B cell
development after somatic hypermutation but before final differentiation to
plasma cells.
About 10% of patients show symptoms of hyperviscosity (Lin and Medeiros,
2005). IgM pentamers are secreted by WM cells in to the blood and these
macromolecules block the small vasculature leading to the rupture in unsupported
veins and vascular infarcts (Shaheen et- al., 2012). Symptoms of hyperviscosity
occur at serum viscosity above 3cp and its clinical presentation includes mucosal
bleeding, loss of visual acuity due to retinal bleeding, and cerebrovascular
accidents (Gertz, 2013). Owing to the unique physicochemical characteristics of
paraproteins, patients with the same IgM levels can have remarkably different
viscosities and symptoms; consequently, serum viscosity is not an accurate
predictor of the severity of the disease (Shaheen et al., 2012)
IgM paraprotein can also act as an autoantibody leading to severe anemia and
neurological manifestations. IgM paraprotein can bind to a number of neuronal
antigens such as myelin-associated proteins and cell surface glycolipids and
glycoproteins (Janz, 2013). Approximately, 50% of patients develop peripheral
-
6
neuropathy that is sensory and distal, while 10% develop autoantibody related
encephalopathy (Janz, 2013). IgM paraprotein can also bind to red blood cells
causing hemolytic anemia. Another reason for mucosal bleeding in WM is the
excess IgM attacking the platelets and von Willebrand factor that are involved in
coagulation process (Dimopoulos et al., 2000). IgM paraprotein can rarely bind to
basement membranes resulting in glomerulonephritis and retinitis leading to renal
failure and loss of vision acuity. There have been also reports of peptic ulcer or
protein losing enteropathy in WM patients which is believed to be due to
paraprotein binding to gastric parietal cells (Fonesca and Hayman, 2007).
Cryoglobulins and cold agglutinin disease in WM patients are two other
symptoms resulting from paraprotein binding to self (Stone, 2011)
Figure2: Clinical features of WM. WM patients are quite various in their
clinical presentation. Some are asymptomatic and the rest have a range of
different symptoms resulting from tissue infiltration by lymphoma, serum
hyperviscosity, autoantibodies, and IgM deposition in tissues. (Adapted from
Treon, 2013)
-
7
IgM deposition in tissue is the least common indication of WM. Amyloidosis,
skin plaques, diarrhea and proteinuria are only some of the consequences of IgM
deposits (Shaheen et al., 2012).
1.1.5. Laboratory and Pathological Findings
Characterizing the paraprotein is quite essential in the lab workup of WM
patients. A serum protein electrophoresis should visualize an M spike in
gammaglobulin region (Gertz, 2012). As mentioned before, serum IgM level
above 5g/dl as well as viscosity beyond 3cp are required for the diagnosis of WM
(Ansell et al., 2010). Up to 80% of patients with WM have monoclonal
immunoglobulin light chains (Bence-Jones proteins) in their urine (Morel and
Merlini, 2012). Laboratory evaluations should also include β2 microglobulin
measurements since its increased level has been associated with poor prognosis
(Anagnostopoulos et al., 2006). In general, the following features are proposed to
be adversely affecting prognosis in WM patients: age >65 years, hemoglobin
7 g/dL (Morel et al., 2009). These factors are usually
considered for risk stratification of the patients and treatment planning.
Complete blood count in WM patients usually indicates leukocytosis,
thrombocytopenia, and anemia (Treon, 2014b). In addition to cytopenia, WM
patients’ blood smear usually exhibit a purplish blue background due to the excess
paraprotein in serum taking up the Giemsa staining. Erythrocytes also form
clusters as the result of their sticky surfaces due to their surfaces being coated by
the paraprotein (Shaheen et al., 2012). Bone marrow smears on the other hand can
be either normal in respect to number of cells or overly crowded with virtually all
nucleated cells being lymphocytes (Shahin et al., 2014). As mentioned earlier,
bone marrow invasion patterns by neoplastic cells is either intertrabecular or
interstitial. Both cytoplasmic (Russell bodies) and nuclear (Dutcher) inclusions
are commonly detected in these neoplastic cells. Lymphocytes can present a range
of cytological variations in WM, ranging from small lymphocytes to plasmacytoid
-
8
lymphocytes or even cells resembling mature plasma cells (Remstein etal., 2003).
These plasma cell-like cells are usually few in number unless the disease is
transforming to a more aggressive form of lymphoma. As expected, a correlation
between IgM levels in the blood and neoplastic plasma cell numbers in the bone
marrow was observed in WM (Ansell et al., 2010). Various proportion of each of
these three types of B-cells has been reported by different pathologists and can
potentially be an indication of differences in disease aggressiveness; however, the
prognostic value of these differences has not yet been proven (Shaheen et al.,
2012)
In the lymph nodes, the pattern of involvement is quite variable but they never
show any evidence for marginal zone involvement. Cytologically, the neoplastic
cells in the lymph nodes show the same cytologic spectrum that is observed in the
bone marrow and Dutcher bodies can be numerous (Sewerdlow et al., 2008). The
patterns of invasion in extramedullary regions include around the portal tracts in
the liver and surrounding the white pulp nodules in the spleen. Extranodal regions
such as skin, gastrointestinal tract and lungs can also be involved and it is usually
an indication of disease progression or relapse (Lin et al., 2003)
1.1.6. Molecular Pathology
Despite recent efforts to clarify the molecular mechanism of WM pathogenesis,
the molecular basis of WM initiation and progression is not quite understood.
Attempts to illuminate the molecular pathology of WM can be categorized in 3
groups: genetics, epigenetic, and microenvironment.
1.1.6.1. Genetics
Historically, WM cells’ slow proliferating nature was one of the main challenges
for the scientific study of the genetic basis of the disease. This obstacle was
overcome through the technological advances of sequencing in the past century
(Binachi et al., 2013). Recent whole-genome sequencing techniques such as
Array-based Genomic Hybridization (aCGH) and massively parallel DNA
-
9
sequencing are two of the techniques used for high resolution analysis of WM
patients’ genome without the need for tumor cell division. In a recent array-based
comparative genomic hybridization study, 83% of newly diagnosed WM patients
showed altered genome with a median of 4 Chromosomal Numerical
Abnormalities (CNA) per case (Poulain et al., 2013a). Low prevalence of biallelic
deletions and high-level amplifications has allowed experts in the field to
categorize WM as a simple cancer that genetically is more closely related to
Chronic Lymphocytic Leukemia (CLL) than to Multiple Myeloma (MM) (Poulain
et al., 2013a; Chng et al., 2006). CNAs were found to be more frequent in
symptomatic WM patients in comparison to smoldering patients. Gain of 4q and
deletion of 13q are two abnormalities that were also more frequent in
symptomatic cases (Poulain et al., 2013a). Furthermore, a genome-wide linkage
analysis between WM and IgM MGUS patients identified a high linkage on 4q33-
q34, denoting both linkage and common susceptibility factors in both diseases
(Kyle et al., 2011). Based on the latest findings, two of the most frequently
mutated genes identified in WM are MYD88 and C-X-C Receptor type
4 (CXCR4) (Binachi et al., 2013).
Treon and colleagues initially reported MYD88 mutation in high frequency in 30
WM patients which was later confirmed by many groups around the globe (Treon
et al., 2012; Poulain et al., 2013a; Xu et al., 2013). In this study, next generation
sequencing detected a MYD88 mutation that was a single nucleotide change,
T→C, leading to a leucine to proline switch at amino acid 265. The frequency of
the MYD88 L265P mutation among familial and sporadic cases was 100% and
86% respectively. Only 4 patients had acquired homozygous mutations and the
rest were heterozygous with the mutation expressing in both CD19+ and CD138+
cells (Treon et al., 2012). Knockdown and inhibition studies of MYD88 L265P
associates it with cell survival promotion by spontaneous assembly of Interleukin-
1 Receptor-Associated Kinase (IRAK) 1 and 4, leading to IRAK1
phosphorylation by IRAK4 and activation of NF-κB (Figure3) (Yang et al., 2013).
Bruton's Tyrosine Kinase (BTK) is another downstream target of MYD88 L265P
-
10
which was shown to activate the NF-κB independent of IRAK pathway.
Simultaneous inhibition of BTK and IRAK led to a stronger inhibition of NF-κB
Figure3:MYD88 mutation in WM. More than 90% of WM cases bear MYD88
L265P mutation which results in IRAK1 phosphorylation by IRAK4 and
activation of NF-κB..Given the frequent mutation in various members of NF-κB
pathway, NF-κB is considered to be a key player in WM pathology.
and synergistic killing in WM cells (Yang et al., 2013). Although MYD88 L265P
mutation has been correlated with higher levels of IgM and bone marrow
involvement in WM patient, no significant difference in response rates to
treatment and overall survival was noted (Treon et al., 2014a). AS-PCR studies
have demonstrated MYD88 L265P in 50-80% IgM MGUS cases which suggests
an early oncogenic role in WM pathogenesis for this mutation and that other
genomic events are required for WM disease progression (Landgren and Staudt,
2012)
-
11
Sanger sequencing identified CXCR4 mutations in 32% of WM patients and
associated it with drug resistance caused by ERK1/2 and AKT overactivation.
98% of CXCR mutant patients also exhibited the MYD88L265P mutation (Hunter
et al., 2014). In a very recent epidemiological study by Treon et al., in 175 WM
patients, MYD88 and CXCR4 status were linked to patient’s clinical presentation
and response to treatment. Patients with MYD88 L265P/ CXCR4 mutant
displayed higher marrow burden, elevated levels of serum IgM, and were more
likely to have symptomatic disease requiring therapy at initial diagnosis (Treon et
al., 2014a)
Similar to many other hematological malignancies, deletion of various regions of
6q was reported in WM, in more than 42% of cases (Schop et al., 2002). PR
Domain Zinc Finger Protein 1 (PRDM1) and Tumor Necrosis Factor Alpha-
Induced Protein 3 (TNFAIP3) are two of the candidate genes of these regions.
PRDM1 has been implicated in repression of cell proliferation and down-
regulation of Paired box Protein 5 (PAX5) and ER stress protein X-box Binding
Protein 1 (XBP1) (Bianchi et al., 2013). TNFAIP3 is a suppressor of NF-κB
pathway. 38% of WM cases have monoallelic while 5% have biallelic inactivation
of TNFAIP3 (Mitsiades, 203). Given all the mutations mentioned so far that target
the NF-κB pathway proteins, NF-κB pathway is believed to be one of the major
players in WM pathology.
1.1.6.2.Epigenetics
miRNAs are small, non-coding, 18-24 nucleotide RNAs, described for the first
time in the nematode Caenorhabditis elegans (Lee et al., 1993) . They play major
roles in regulating mRNA targets involved in development, cell differentiation,
apoptosis, and cell proliferation (He and Hannon, 2004). WM has a specific
miRNA signature that is different from that of their normal counterpart. In a
recent study miRNA-363*, -206, -494, -155, -184, -542-3p demonstrated
increased expression while miRNA-9* was decreased in WM patients (Hodge et
al., 2011)
-
12
miRNA-155 has been shown both in-vitro and in-vivo to play a pivotal role in the
pathology of WM (Roccaro et al., 2009) . Knock down study of miRNA-155 in
WM illustrated its role as a regulator of cell cycle. miRNA-155 knocked-down
cells had decreased percentage of S phase cells as the result of cyclin inhibition
and p53 overexpression. miRNA-155 silenced cells also exhibited significant
inhibition of migration and adhesion to fibronectin compared to control in WM,
denoting the crucial role of miRNA-155 in migration and expansion of the
malignant cells in the bone marrow (Roccaro et al., 2009).
miRNAs also interfere with the epigenetic machinery by regulating the expression
of DNA methylation enzymes or histone modification complexes (Sato et al.,
2011). Primary WM cells are already characterized by increased expression of
Histone Deacetylase (HDAC)-2, -4, -5, -6, -8, -9, and significant decrease in
expression of Histone Acetyl Transferase-1 (HAT-1) (Roccaro et- al., 2010). WM
cells transfected with pre-miRNA-9*- and anti-miRNA-206 displayed an
upregulated acetyl histone-H3 and H4 as a result of HDAC regulation that led to
reduction in cell proliferation and increase in cell toxicity in WM (Roccaro et al.,
2010).
1.1.6.3.Microenvironment
Bone marrow is the main tissue involved by WM. Bone marrow’s structure is
quite complex in that it contains cells from various lineages (e.g. stromal, mast,
and epithelial cells) and blood vessels that support and maintain the hematopoietic
lineage (Nagasawa, 2006). This microenvironment plays a pivotal role in B-cell
homing and expansion (Ghobrial and Witzig, 2004 ). Various components of
bone marrow microenvironment have been implicated in WM tumor growth,
survival and drug resistance by several studies (Ngo et al., 2008; Poulain et al.,
2009; Tournilhac et al., 2006).
-
13
WM cells co-cultured with stromal cells leads to resistance to therapeutic agents
such as bortezomib and other proteasome inhibitors (Ngo et al., 2008). Tournhilac
et al. demonstrated that WM co-cultured with mast cells leads to cell proliferation
and expansion (Tournilhac et al., 2006). Furthermore, WM patients have a 30-
40% increase in bone marrow vascular density and primary WM endothelial cells
present a higher expression of ephrin-B2, an important regulator of cell motility,
suggesting an important role for endothelial cells in WM pathology (Terpos et al.,
2009).
On the other hand, WM cells themselves have been shown to express high levels
of chemokines and adhesion receptors such as CXCR4. CXCR4 is essential for
the migration of WM cells and its knockdown leads to inhibition of migration,
transendothelial migration and adhesion of WM cells (Ngo et al., 2008). Stromal
Cell-Derived Factor-1 (SDF-1) is a CXCR4 ligand primarily produced by stromal
cells. The major biological effects of SDF-1 are related to the ability of this
chemokine to induce motility, adhesion, and secretion of angiopoietic factors
(Kucia et al., 2004). Similar to increased expression of CXCR4, SDF-1 levels in
the bone marrow of WM patients was significantly higher compared with that of
normal controls (Ngo et al., 2008). CXCR4/SDF-1 interaction promotes activation
of some very important signaling pathways such as focal adhesion kinases,
MAPK, ERK-1, PI3K, AKT, PKC, and NF-κB pathways (Kucia et al., 2004).
Proteomic studies have already demonstrated an increased Akt expression in WM
as well as elevated expression of ERK pathway proteins; taken together,
CXCR4/SDF-1 interaction seems to play a significant role in WM biology
(Mitsiades et al., 2003).
1.1.7.WM Current Treatments
The diversity in clinical presentations and lack of effective therapies for WM
patients has made planning the right treatment approach a challenging task for the
clinicians. Based on risk factors that we already discussed in section 1.1.5,
-
14
International Prognostic Staging System for Waldenström's Macroglobulinemia
(IPSSWM) categorizes WM patients in 3 groups with significantly different 5-
year survival rates: low risk (87%), mid risk (68%) and high risk (36%) (Morel et
al., 2009). These categorizations as well as the consideration of chronic nature of
the disease are helpful tools for deciding on the correct method of treatment.
Patients with smoldering WM are managed with a watch-and-wait approach and
do not require any therapies (Morel et al., 2009). In Garcia-Sanz et al. study, more
than 50% of smoldering cases did not require therapy for almost 3 years and 1 in
10 patients did not require therapy for 10 years (García-Sanz et al., 2001). Only
WM patients who show symptoms are administered treatments and in WM these
symptoms include : constitutional symptoms including fever, night sweats or
weight loss, lymphadenopathy or splenomegaly, hemoglobin
-
15
rituximab (FCR) regimen. The Overall Response Rate (ORR) associated with this
combination therapy was 79%, including 11.6% Complete Remission (CR) and
20.9% Very Good Partial Remissions (VGPR). Despite the favourable results,
myelosuppression in 45% of cases led to discontinuation of the treatment in most
patients (Tedeschi et al., 2012). Nucleoside-analogue treated WM cases have an
increased incidence of transformation to non-Hodgkin’s lymphomas and the
development of myelodysplasia which limits their use (Ansell et al., 2010). In
another combination therapy, combination s of dexamethasone, rituximab, and
cyclophosphamide (DRC) resulted in an ORR of 83% in previously untreated
WM patients, of which 7% were CR and only 9% of patients experienced grade 3
or 4 neutropenia (Dimopoulos et al., 2007). In a recent trial, 34 WM patients were
treated with rituximab, cyclophosphamide, doxorubicin hydrochloride,
vincristine sulfate, and prednisone (R-CHOP ) and 30 patients with CHOP with
no rituximab. Patients receiving R-CHOP exhibit a longer time of progression
compare to CHOP treated group and had a significantly higher ORR with no
major differences in general toxicity (Buske et al., 2009). There is a consensus
that an alternative rituximab and chemotherapy combination regimen should be
used if the relapse occurs within the first year, which means that if in the first
round rituximab was used in combination with a purine analogue, after the relapse
it should be used in combination with an alkylating agent or vise versa (Ansell et
al., 2010). Treon et al. reported an ORR of 83.3% in 30 relapsed WM patients
treated with bendamustine in combination with rituximab (BR). The only down
side of this combination was that it showed an increased myelosuppression in
patients who had previously been treated with nucleoside analogs as was expected
(Treon et al., 2011).
Bortezomib which is a first generation proteosome inhibitor is a novel WM
treatment that exerts its effect through inhibition of NF-κB pathway (Treon,
2013). As it was eluded to , NF-κB pathway plays an important role in WM
pathology, therefore, bortezomib single or combination treatments has been quite
effective in managing WM patients (Treon, 2013). In a clinical trial bortezomib,
-
16
dexamethasone, and rituximab (BDR) combination was administered to 23
previously untreated symptomatic WM patients, ORR was measured to be 96%
with 3 patients in CR, 2 near CR, 3 VGPR, 11 PR, and 3 MR. In this study, 30%
of patients exhibited grade 3 peripheral neuropathy (Treon et al., 2009b). A
separate study by Ghobrial et al. reported an ORR of 88% in a bortezomib and
rituximab (BR) combination on symptomatic WM. This study did not show any
grade 3 or 4 neuropathies and its most significant side effect was neutropenia
(Ghobrial et al., 2010a). In comparison to R-CHOP, BR treatment resulted in
fewer relapses, was better tolerated, and was associated with a longer progression
free survival, despite identical response rates. In another study, single agent
bortezomib in relapsed or refractory WM patients resulted in 78%-85% Minor
remission (MR) or greater in patients with relapsed or refractory WM (Chen et al.,
2009). The only down fall of bortezomib is its neurotoxicity which makes it
especially unsuitable for patients with pre-existing neuropathies making it an
unsuitable frontline treatment for low to mid risk WM patients ( Ansell et al.,
2010). Bortezomib is not myelotoxic, and long-term follow-up in Waldenström
patients did not show any risk of the disease developing to higher grade
malignancies as happens in nucleoside-based treatments (Treon, 2013).
Autologous Stem Cell Transplants (ASCT) is another option for WM treatment
that is only used on younger patients with aggressive cases who had not been
previously treated with nucleoside-based treatments. In a retrospective analysis of
158 WM patients who underwent ASCT, the overall survival was 68.5% and
nearly 50% of the patients remained progression free after 5 years. Non-relapse
mortality rate for this group was as low as3.8%, making ASCT a viable option for
WM treatment (Kyriakou et al., 2010a). Unlike ASCT, Allograft Stem Cell
Transplantation (alloSCT) was discovered to be quite risky and 30% of these WM
patients experience non-relapse mortality; therefore, its use has been limited to
clinical trial settings (Kyriakou et al., 2010b).
-
17
In light of recent molecular findings about WM pathogenesis, many novel
therapeutics are either being tested in clinical trials or are on their way to a
clinical trial. Next generation monoclonal antibodies and proteosome inhibitors,
immunomodulators, mTOR inhibitors, Bruton tyrosine kinase inhibitors, and
HDAC inhibitors are some examples of these novel therapies (Leblebjian et al.,
2013).
Ofatumumab (OFA) is a monoclonal antibody against both the large and small
extracellular loops of CD20. In OFA trials as a single-agent in 37 relapsed WM
patients, an ORR of 59% with a lower incidence of IgM ‘flare’ as compared to
rituximab was achieved and developing infections was its only side effect (Gupta
and Jewell, 2012).
Carfilzomib is a second generation proteosome inhibitor which is proven to be
non-neurotoxic. In a recent phase II trial, a combination of carfilzomib, rituximab
and dexamethasone was administered to 20 mostly untreated WM patients. The
ORRs and major response rates were 75% and 50% respectively, with 1 VGPR, 9
PR, and 5 MR. All drug related toxicities were reversible and, except in one
patient with a grade 2 peripheral neuropathy, there were no neuropathological side
effects (Treon et al., 2014b).
Thalidomide and lenalidomide, two immunemodulators, have also been studied
on WM in hopes to potentiate rituximab-mediated cytotoxicity. Despite 50-75%
ORRs, combining rituximab with both thalidomide and lenalidomide were
accompanied by severe toxicities (Treon et al., 2008; Treon et al., 2009a). In the
case of lenalidomide, the trial was stopped after almost all the patients developed
significant anemia (Treon et al., 2009a). It is believed that optimization of the
dose and protocol used are required for its future use in WM; therefore, phase I
trials of lenalidomide are underway (Leblebjian et al., 2013).
.
-
18
Considering the elevated levels of several proteins from the Akt/mTOR pathway
and their role in tumor survival in various hematological malignancies,
everolimus, an mTOR inhibitor has also been studied in 50 patients with relapsed
or refractory WM (Mitsiades et al., 2003). Everolimus ORR in WM was 70%
with PR of 40% and MR of 30%. The most important adverse effects observed
were cytopenias and pulmonary infections (Ghobrial et al., 2010b). In another
study, the combination of everolimus, bortezomib and rituximab was investigated
in relapsed/refractory patients and showed an ORR of 74% with 5%CR, 30%PR,
and 39% MR. The major side effects included 24% anemia, 15%
thrombocytopenia and 15% neutropenia (Ghobrial et al., 2011).
Finally, given the very recent discovery of MYD88 and BTK’s role in WM
pathology, ibrutinib, a BTK inhibitor, has become the subject of several clinical
trials. Ibrutinib was initially found efficacious in managing hematological
malignancies in a trial investigating its effect on a variety of B-cell malignancies
including WM (Advani et al., 2013). In a more recent phase II trial on 63 relapsed
WM patients with average 2 previous treatments, ibrutinib was able to induce
81% ORR with PR or better of 57.1% and a fast response time. No neurological
toxicity was observed and two of the more frequent side effects of the treatment
were thrombocytopenia (14.3%) and neutropenia (19.1%) (Treon et al., 2013).
Despite the significant advances in regards to WM therapeutics, studies have not
demonstrated any improvement in the patients’ outcome over the last 25 years
(Kristinsson et al., 2013). WM remains an incurable disease with currently
available therapy, and the quest for finding a more effective therapeutic approach
continues.
1.2. PRIMA-1met
1.2.1. p53 and Apoptosis
p53 is a transcription factor which takes part in various cellular processes such as
cell-cycle arrest, senescence, apoptosis and metabolism. As a stress sensor, p53
-
19
plays a pivotal role in transmitting stress-induced signals in order to restrict the
cell proliferation in the wake of DNA damage, oncogenesis, and hypoxia. In fact,
in order to divest the cell of its anti-tumoregenic effects, in approximately 50% of
human cancers, p53 gene is mutated and in the majority of the rest it is
deactivated through alternative mechanisms such as overactivating p53 inhibitors
or silencing its co-activators ( Bieging et al., 2014).
In normal conditions, p53 has a very short half life due to the activity of its E3
ligase Mouse Double Minute 2 (MDM2), leading to p53 proteosomal degradation.
p53 is activated by both external and internal stimuli that promote its nuclear
accumulation. p53 activation involves stabilization of the protein and
enhancement of its DNA binding (Yee and Vousden 2005) . The sum of the
pathways induced by p53 activation will determine whether the cell will undergo
growth arrest or apoptosis. The latter is shown to be crucial for p53 suppression of
tumors (Haupts et al., 2003).
Apoptosis is a recognized mechanism of programmed cell death. It is both a
homeostatic mechanism to maintain cell populations and a defense mechanism in
reaction to cell damage (Elmor, 2007). Apoptosis is a complex cascade of events
that primarily involves activation of a group of proteases called caspases. The
mechanism of apoptosis is very complex and is composed of two main pathways:
extrinsic or death receptor pathway and intrinsic or mitochondrial pathway
(Figure 4). These two pathways in the end converge and cleave caspases 3,7, and
6 resulting in DNA fragmentation, degradation of cytoskeleton, formation of
apoptotic bodies, and expression of cell surface ligands for phagocytic cell
(Haupts et al., 2003). Caspase 3 is the main executioner caspase which is
activated by all initiator caspases. It activates the endonuclease Caspase-Activated
DNase (CAD) which degrades chromosomal DNA. Caspase 3 also reorganizes
and disintegrates the cell into apoptotic bodies (Elmore, 2007).
-
20
The extrinsic pathway of apoptosis involves activation of death receptors that are
members of the Tumor Necrosis Factor (TNF) receptor superfamily. Upon TNF
activation a death-inducing signaling complex is formed leading to autolytic
activation of initiator caspase, caspase 8. Caspase 8 then goes on to catalyze the
activation of caspase 3 (Elmore, 2007). p53 can activate the extrinsic apoptotic
pathway through the induction of genes encoding receptors involved. For
example, p53 may enhance levels of Fas, a member of TNFR family, at the cell
surface by promoting its translocation to the membrane. This may allow p53 to
rapidly sensitize cells to Fas. The type of receptor overexpressed by p53 seems to
be cell type specific (Zilfou and Lowe, 2009).
Mechanism of intrinsic pathway of apoptosis is much more complex. The intrinsic
pathway of apoptosis is based on permeabilization of the mitochondria
membrane. Opening of the Mitochondrial Permeability Transition (MPT) pores
leads to loss of mitochondrial potential and release of pro-apoptotic proteins:
cytochrome c and Second Mitochondria-derived Activator of Caspases/ Direct
IAP-Binding protein with Low PI (Smac/DIABLO). Released cytochrome c
complexes with Apoptotic protease activating factor 1 (Apaf-1) and procaspase 9,
forming an “apoptosome” which activates caspase 9. Smac/DIABLO complex
promote apoptosis by inhibiting Inhibitors of Apoptosis Proteins (IAP) (Galluzzi
et al., 2011).
Mitochondrial membrane permeability is regulated through B-cell lymphoma 2
(Bcl-2) family of proteins. There are 25 genes identified in the Bcl-2 family that
are either pro-apoptotic or anti-apoptotic (Czabotar et al., 2014). Bcl-2 and B-cell
lymphoma-extra large (Bcl-xL) are two examples of anti-apoptotic members of
this family. Downregulation of both Bcl-2 and Bcl-xL in various cancer types has
led to induction of apoptosis or enhancement of chemosensitivity (Yamanaka et
al., 2006; McDonnell and Korsmeyer, 1991). Pro-apoptotic members of Bcl-2
family on the other hand, carry out their function either by neutralizing the anti-
-
21
apoptotic members or activating the pro-apoptotic effector Bcl-2 associated x
protein (Bax).
Figure4: Mechanism of apoptotic program cell death. Apoptosis is a complex
cascade of events that primarily involves activation of a group of proteases called
caspases. It is composed of two main pathways: extrinsic or death receptor
pathway and intrinsic or mitochondrial pathway. (Adapted from Elmore, 2007)
Bax exerts its effect through opening the mitochondrial membrane channels as
well as forming oligomeric pores (Czabotar et al., 2014). P53 upregulated
modulator of apoptosis (Puma) and Noxa are members of the Bcl-2 family that
-
22
are pro-apoptotsis. Puma was shown to change Bax conformation and promote its
translocation to the mitochondria (Yu et al., 2001).
Studies on Noxa indicate its interaction and disruption of anti-apoptotic Bcl-2
family members, resulting in the activation of caspase 9 (Oda et al., 2000). p53
has a pivotal role in regulating Bcl-2 family of proteins. Induction of apoptosis by
p53 involves both transcription-dependent and transcription-independent
functions of p53. p53 upregulates pro-apoptotic genes containing p53-responsive
elements such as Puma, Noxa and Bax while down regulating the anti-apoptotic
members Bcl-xL, Bcl-2 and Mcl-1 (Haupt et al., 2003). p53 also directly binds
and activates Bax and inactivates Bcl-xL without the need to regulate their genes(
Geng et al., 2010; Bharatham et al., 2011).
Table 1: p53 activating small molecule drugs
utilized in hematological malignancies. (Adapted from Saha et al., 2013b)
-
23
Given the tumors suppressive effects of p53, developing means to activate p53
has been subjected to intensive studying. Some of the potential approaches for
cancer therapeutics targeting p53pathway includes: p53 gene therapy, drugs
activating targets of p53, and small molecules activating p53 or disrupting p53
inhibitors (Table1) (Wang and Sun, 2010).
1.2.2. PRIMA-1met
P53- dependent reactivation and induction of massive apoptosis (PRIMA-1) is a
small molecule initially identified in a cell-based assay for screening of chemical
libraries searching the National Cancer Institute database. In this assay, PRIMA-1
was able to induce cell death in osteosarcoma cell line Saos-2 expressing p53
mutant His 273 under a tetracycline driven promoter (Bykov et al., 2002). A
methylated form of PRIMA-1, dubbed PRIMA-1met, was later discovered and
reported to be biologically more active than the original compound (Bykov et al.,
2005). Both compounds’ ability to induce cell death has been confirmed in
several solid tumors and hematological malignancies in-vitro, in-vivo, and ex-
vivo on primary samples (Aryee et al., 2013; Bao et al., 2011; Ali et al., 2011;
Nahi et al., 2008) .
In a break through study, Lambert and colleagues identified the kinetic and
chemical properties of PRIMA-1 and PRIMA-1met (Lamber et al., 2009). It was
reported that half of the starting material of both PRIMA-1 and PRIMA-1MET
was decomposed in 32.6 hr in-vitro. They also identified the decomposition rate
of PRIMA-1 in-vitro and in animal models to be 4h and 1h respectively. PRIMA-
1 was then uncovered to be rapidly excreted into the urine in their mouse model.
Methylene quinuclidinone (MQ) is one of the compounds derived from PRIMA-1
and PRIMA-1met during decomposition. MQ has a double bond which is highly
reactive and prone to nucleophilic additions (Lamber et al., 2009). Thiol groups
are favorable targets for MQ in this reaction. Further investigations confirmed that
production of MQ is essential for PRIMA-1 biological effects. The importance of
-
24
thiol modification in the apoptotic effects of PRIMA-1 was also proven using
inhibitors of thiol modification. Mutant p53 (mut p53) has many exposed thiol-
containing cysteine residues on its surface making it a suitable target for PRIMA-
1. Formation of disulfide bonds as the result of these exposed thiol groups can
potentially lock mut p53 in an unfolded conformation. Disruption of these
unwanted disulfide bonds by MQ can result in mut p53 proper folding and
efficient binding to DNA (Lamber et al., 2009). Wild-type p53 (wt p53) was also
shown to be able to form bonds with MQ depending on the degree of its unfolded
status (Lamber et al., 2009).
PRIMA-1met has shown great cytotoxicity towards various solid tumors and
hematological malignancies (Zandi et al., 2011; Zache et al., 2008; Ali et al.,
2011). Results from PRIMA-1met recent phase I/II clinical trial in prostate cancer
and several hematological malignancies have also been promising (Lehmann et
al., 2012). Most of PRIMA-1met’s adverse effects were reversible and mild ones
such as fatigue, dizziness, headache, and confusion. No bone marrow toxicity was
detected (Lehmann et al., 2012).
The exact molecular mechanism of PRIMA-1met effects is still elusive and seems
to be quite dependent on cellular context. As was mentioned before, PRIMA-1met
was initially discovered as a mut-p53 reactiving small molecule. Some studies on
breast, colon, and small cell lung cancer cell lines portrayed a mut p53-dependent
mechanism through knock down studies (Lambert et al., 2010; Zandi et al., 2011;
Lambert et al., 2009). Zandi et al. reported PRIMA-1met effects through
activating mut p53 and upregulating its downstream transcriptionally regulated
targets such as p21, MDM2, and Bax in small cell lung cancer (Zandi et al.,
2011). Others have reported nucleolar translocation of p53 and its stabilization by
Heat Shock Protein 70 (HSP70) (Rokaeus et al., 2007). PRIMA-1met also
activates mutant p53 through phosphorylation at its serine 15 and upregulates the
expression of p53 and its proapototic targets, Bax and puma in colorectal cell
lines (Lambert et al., 2010).
-
25
Despite previous reports of mut p53-dependent effect of PRIMA-1met, Ali and
colleagues described the cytotoxic effect for PRIMA-1met in Acute Myeloid
Leukemia (AML) primary samples to be independent of p53 status (Ali et al.,
2011). The same phenomenon was observed in melanoma cell lines when
PRIMA-1met did not show any significant difference in apoptosis between mut
p53 and wt p53 cell lines both in-vitro and in-vivo (Bao et al., 2011). Recently,
Saha et al. has taken this story one step further and demonstrated that PRIMA-
1met exerted its effect in a p53-independent manner in MM ( Saha et al., 2013a).
In this study, PRIMA-1met was denoted to activate p73 which led to induction of
apoptosis in a Noxa- dependent fashion (Saha et al., 2013a). A study conducted
by Tessoulin et al. confirms Saha et al.’s findings in regards to p53-independent
PRIMA-1met –induced apoptosis that is deiven by activation of Noxa (Tessoulin
et al., 2014).
Based on current knowledge of PRIMA-1met chemistry, theoretically, changes in
the activity of any protein containing a thiol group by PRIMA-1met is possible as
long as the structural and sterical context of the thiol group allows such reaction.
Therefore, activating other targets beside p53 that lead to cell death is quite
possible. As highlighted in the previous paragraph, one such possible target was
recently proposed to be p73 (Saha et al., 2013a). Thioredoxin Reductase 1 is
another target which was discovered to be inhibited and converted to an NADPH
oxidase enzyme independent of cell lines’ p53 status leading to an increase in
Reactive Oxygen Species (ROS) production in the cells and consequently their
apoptosis (Peng et al., 2013). Furthermore, Tessoulin and colleagues also
confirmed that disrupting the GSH/ROS balance through impairing glutathione
synthesis in MM plays an important role in PRIMA-1met -induced apoptosis
(Tessoulin et al., 2014). Taken all together, these findings provide an explanation
for the previously observed effects of PRIMA-1met on tumor cells lacking p53.
-
26
Figure5: PRIMA-1met structure and mode of action: Methylene
quinuclidinone (MQ) is one of the compounds derived from PRIMA-1met during
decomposition. PRIMA-1met was initially discovered in an screening for
compound activating mutp53. Wild-type p53 (wt p53) was also shown to be able
to form bond with MQ depending on the degree of its unfolded status.
-
27
1.3. Rationale, Hypothesis, and Experimental Aims
Molecular tools that take advantage of apoptotic effects of p53 to eradicate cancer
cells have been greatly researched in hematological malignancies both in the lab
and clinics. PRIMA-1met is one such compound that has shown great killing
abilities against various solid and hematological cancers. Despite the vast number
of studies, given the conflicting reports, we are still in the dark in regards to the
PRIMA-1met mechanism of action (Figure 5). It is therefore paramount that
separate functional and mechanistic studies are conducted for each cancer type
using specific and targeted tools.
On the one hand, current treatments are lacking in managing WM patients and
their side effects are greatly affecting patients’ quality of life. On the other hand,
PRIMA-1met has shown promising results in both pre-clinical and phase I/II
clinical studies in a number of haematological malignancies such as CLL and MM
that are closely related to WM in both clinical presentations and genetic makeup.
Therefore, we hypothesized that PRIMA-1met has anti-tumor activity against
WM cell lines and primary samples. This study is an attempt to provide the pre-
clinical framework for evaluation of PRIMA-1met either alone or in combination
with current therapies as a novel therapeutic approach for treatment of WM
patients.
The aims of this study are:
1) To investigate the anti-tumorigenic effects of PRIMA-1met on WM:
Explore whether PRIMA-1met induces cell death in WM cell line and primary
samples. Examine the mode of PRIMA-1met- induced cell death. Evaluate the
effect of PRIMA-1met on WM cell migration and colony formation.
2) To elucidate the signaling pathway affected by PRIMA-1met: Assess the
expression of apoptotic markers such as PARP and caspase cleavage, p53, and
MDM2 through western blot analysis of lysates from cells treated with PRIMA-
1met.
-
28
3) To examine the combinatory effect of PRIMA-1met and current WM
therapies: Using the correct concentration range found in Aim 1, determine what
type of drug interactions will PRIMA-1met show in combination with sub-
therapeutic doses of bortezomib or dexamethasone in WM cell line.
-
29
Chapter2:
PRIMA-1MET Induces Apoptosis in Waldenström's Macroglobulinemia
Independent of p53
Introduction:
Waldenström’s Macroglobulinemia (WM) is a low grade lymphoplasmacytic
lymphoma characterized by infiltration of bone marrow with malignant B cells
and IgM monoclonal gammopathy (Ansell et al., 2010). Reports show an increase
in WM’s incidence over the past 20 years (Gertz, 2012). In US, almost 1500 new
cases of WM are reported annually (Shaheen et al., 2012). WM patients are quite
heterogeneous with respect to clinical presentation, varying from an
asymptomatic to highly aggressive disease, and their responses to treatment.
Given current therapies, WM remains incurable, and most patients eventually
relapse (Gertz, 2013).
P53 is a well-known tumour suppressor protein responding to cellular stresses
through regulating cell cycle, DNA damage repair mechanism and inducing
senescence and apoptosis (Vousden and Prives, 2009; Green and Kroemer, 2009).
At steady state, p53 level is kept substantially low through a tight feedback
regulation by negative regulators such as MDM2 (Choek et al., 2011). Over the
past decade, more than 150 trials exploiting p53 have been conducted taking
advantage of its pro-apoptotic effects on tumor cells (Choek et al., 2011). PRIMA-
1met is a small molecule initially identified as a mutant p53 activator in cellular
screen of a small molecular library (Bykov et al., 2002). PRIMA-1met has shown
promising results in in-vitro and xenograft models of several solid tumours such
as breast, hepatic and colon cancer as well as haematological malignancies closely
related to WM such as CLL (Zandi et al., 2011; Bao et al., 2011; Liang et al.,
2009; Nahi et al., 2008). A recent phase I/II clinical trial of PRIMA-1met in
prostate cancer and AML also demonstrated promising results in terms of toxicity
-
30
and general tolerance, making it a good candidate for further exploration in other
neoplasias (Lehman et al., 2012). Although initially thought to act through
inducing apoptosis by restoring the wild type conformation to mutant p53(
Lamber et al., 2009), recent evidence points towards its ability to induce apoptosis
irrespective of p53 status or even in a p53-independent manner; therefore, the
exact pathway affected by PRIMA-1met is highly controversial and seems to be
cell type specific (Nahi et al., 2004; Supiot et al., 2008; Ali et al., 2011; Saha et
al., 2013).
To date, the effects of PRIMA-1met in WM have not been explored at either
preclinical or clinical levels. The purpose of the current study is to examine the
anti-tumour effects of PRIMA-1met in WM cells and explore the underlying
mechanism.
Materials and Methods
Patient samples and cell lines
Bone marrow samples were collected from WM patients during routine diagnostic
procedures. This study received written approval from the University Health
Network Research Ethics Board, Toronto, in accordance with the Declaration of
Helsinki. WM cell line, BCWM-1 (Ditzel Santoz et al., 2007), was kindly
provided by Dr. Treon’s lab. This cell line was maintained for no more than 3
months in standard culture medium RPMI 1640 medium containing 10% fetal
bovine serum, 2 mM L-glutamine, 50U/ml penicillin, and 50 µg/mL streptomycin
at 37°C in a 5% CO incubator. Freshly isolated primary WM cells were separated
by Ficoll Hypaque density gradient (Sigma Aldrich, St. Louis, MO, US). To
separate the cells with Ficoll Hypaque, the blood samples were diluted in PBS and
EDTA buffer with 2 in 1 ratio of blood to buffer. 35 ml of this diluted cell
suspension was then carefully layered on 15ml of Ficoll Hypaque and centrifuged
-
31
at 400×g for 30 minutes at 20˚C. Lymphocyte located at the interface layer were
carefully pipetted out and transferred to a new tube for washing. Then, 3 volume
of buffer used in the first step was added and mixed with the cells by gently
pipetting. The mixture was centrifuged at 100×g for 10 min at 20˚C and the
supernatant was removed. The lymphocyte pellet was again re-suspended in 6ml
buffer and centrifuged at 100×g for 10 min at 20˚C.The pelleted primary WM
cells were re-suspended in above mentioned culture medium and incubated at
37°C in a 5% CO incubator and used the next day for experimentation.
Drug treatment
PRIMA-1metwas purchased from Cayman Chemical and dissolved in dimethyl
sulfoxide (DMSO) to make a 10 mM stock solution and stored at -200 C. In each
experiment, the final DMSO concentration was kept constant and did not exceed
0.05% (v/v). In some experiments, cells were simultaneously exposed to PRIMA-
1met and dexamethasone (Cayman Chemical, Ann Arbor, MI,US) or bortezomib
(Orthobiotech, Horsham, PA,US) . After drug treatment, cells were harvested and
subjected to further analysis as described below.
Cell viability, apoptosis, colony formation and migration assays
Cell viability was assessed by MTT ((3-[4,5-dimethilthiazol-2yl]-2,5-diphenyl
tetrazolium bromide)) (mention the company and address). Briefly, cells were
cultured in 96-well micro-titer plates with different concentrations of the drugs for
48 h. To assess the effect of PRIMA-1met on cell viability and proliferation of
primary samples, 20 × 104 cells/ml and for BCWM-1 cell line, 30 × 104 cells/ml
were cultured in 96-well plates and then treated with the drug for 48 h. After
incubation, MTT (0.5 mg/ml) was added and the cells were further incubated for
an additional 4 h. This was followed by the addition of acidified isopropanol to
the wells and overnight incubation at 37°C to solubilize the dye crystals.
Following incubation, the optical density of the wells was read with a microplate
-
32
reader set at a test wavelength of 570 nm and a reference wavelength of 630 nm.
In combination treatments both drugs were added to the wells simultaneously and
the treated cells were incubated for 72h. To examine apoptotic cell death, WM
cells were treated with various concentrations of PRIMA-1met for 48h and then
harvested, washed twice with PBS to get rid of PRIMA-1met and stained with
Annexin V-FITC (Abcam, MA,US) and propidium iodide (Sigma-Aldrich, St.
Louis, MO) using the companies protocols for flowcytometric analysis. Becton
Dickinson Canto II FCF 8 color analyzer was used for flowcytometry. Data were
analyzed using FlowJo software. The extent of apoptosis was quantified as
percentage of Annexin-V positive cells. For colony formation assays, WM cells
(5×104 cells/mL) were plated into 6well plates in 1 mL RPMI medium (20% FBS)
containing 1% methylcellulose and maintained with DMSO control or the
indicated concentration of PRIMA-1met. Ten days after plating, the total number
of colonies was calculated and enumerated by morphologic assessment, as
previously described ( Trudet et al., 2007). Migration assays were conducted with
24-well Transwell insert chambers (8 µm insert; Costar, Corning
Inc.,Corning,NY,USA) according to the manufacturer’s instruction. In brief, WM
cells (5×104 cells/mL) in FBS media were added to the upper chamber in the
presence or absence of PRIMA-1met at the indicated concentrations and allowed
to migrate for 8 hours at 37ºC to the lower chamber containing media with 10%
FBS. The migration of control DMSO-treated cells on the Transwell was
normalized to 100%. All the readouts from viability, apoptosis, colony and
migration assays were from measurements of at least three experiments.
Immunoblotting
Western blot analysis was performed to evaluate several protein targets in whole
cell lysates obtained from the cells treated with PRIMA-1met in the absence or
presence of siRNAs. Whole cell lysates were prepared by lysing the cell pellets
for 10 min on ice in a buffer composed of 150 mM NaCl, 50 mM Tris-HCl (pH
-
33
8.0), 5 mM EDTA, 1% (v/v) Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride
(PMSF), 20 µg/ml aprotinin and 25 µg/ml leupeptin. Protein concentrations were
measured by using a Nano Drop 1000 spectrophotometer (ThermoFisher
Scientific Inc., San Diego, CA, USA). Equal amounts of protein were resolved
using 12% SDS-polyacrylamide gel electrophoresis and transferred to a
polyvinylidene diflouride (PVDF) membrane (Perkin Elmer Inc., Waltham, MA,
USA). After blocking for 1 h at room temperature with PBS containing 3%
bovine serum albumin (BSA), the membrane was incubated with specific
antibodies for at least 1 h at room temperature or overnight at 40C. After washing
the membrane 3×10 minutes, the membrane was incubated with a horseradish
peroxidase (HRP)-labeled secondary antibody for 1 h at room temperature. The
blots were washed again for 3×10 minutes and were developed using a
chemiluminescent detection system (ECL, Perkin Elmer). Primary antibodies
were from the following manufacturers: Santa Cruz Biotechnology (Santa Cruz,
CA,USA): MDM2, P73 (H-79) and β-actin; Biolegend (San Diego, CA,USA):
p53 (DO-7); Roche (Manheim, Germany) : PARP. Goat anti-mouse and anti-
rabbit secondary antibodies conjugated to horseradish peroxidase were purchased
from Cell Signaling Technology (Beverly, MA, USA).
Knockdown of selective target genes
BCWM-1 cells were transfected with target specific siRNAs for p53 (Invitrogen,
Carslbad, CA, USA) or p73 (Invitrogen) or control scrambled siRNA
(Invitrogen) using the Cell Line Solution Kit V (Amaxa, GmbH, Cologne,
Germany) according to the manufacturer's instruction with the Amaxa
Nucleofector II device (Amaxa) Program T-030. Following transfection, cells
were treated with PRIMA-1met using the same steps explained in cell viability
assay and analyzed for its effect on cell viability by MTT assay. These
experiments were done in triplicates. For qPCR analysis of knocked down p73,
cell lysate from knocked down and control scrambled siRNA cells were subjected
to RNeasy qiagen kit for RNA purification using company’s protocol. Resulted
-
34
RNA was then used to make cDNA using QuantiTect Rev. Transcription kit by
qiagen using their protocol. P73 primer set (Forward: 5′-CACGTTTGA-
GCACCTCTGGA and Reverse: 5′ GAACTGGGCCATGACAGATG) was used
in combination with promega (Madison, WI, USA) GoTaq real time PCR kit for
quantification. GAPDH and 18S are two primers used as the internal control in
these experiments. The resulted read outs were normalized using the internal
controls resulting in Δct. The Δcts were then used for ΔΔct and fold change (2^-
(ΔΔCT) calculations. qPCR experiments were done in triplicates.
Statistical analysis
The synergistic effect [combination index (CI)
-
35
in the range that was previously reported by our lab to be non-toxic to PBMNCs
and BMMNCs (Saha et al., 2013). To confirm the anti-WM potential of PRIMA-
1met, primary cells derived from two previously untreated WM patients with
more than 90% bone marrow involvement were treated with DMSO control or
increasing doses of PRIMA-1met for 48 hours. Cells were then examined for
viability by MTT assay. A significant decrease in the viability of WM primary
cells was observed with similar or even lower IC50 values as were observed in the
cell line (Figure1). To explore whether this reduction in cell survival in WM cells
was due to apoptosis, we performed Annexin V/PI staining to measure the
percentage of apoptotic cells. PRIMA-1met (25μM) induced more than 50%
apoptosis in BCWM-1 cells which is in complete accordance with the results
obtained from cell survival assay (Figure2).
PRIMA-1met inhibits colony formation and migration in WM cells
Having shown the effect of PRIMA-1met on viability and apoptosis, we next
examined the effects of PRIMA-1met on WM cells migration and colony
formation. PRIMA-1met significantly inhibited colony formation in BCWM-1
cells in a dose-dependent manner (Figure4A, P
-
36
in a significant decrease in cell survival compared with the single agents (P<
0.005) after 72h treatment (Figure5A and B). When combined with low
concentrations of these drugs, synergistic effects were observed (CI
-
37
Discussion:
In this report for the first time we demonstrated the anti-tumor activity of
PRIMA-1met in WM cell line and patient samples. Treatment of WM cells with
PRIMA-1met resulted in significant inhibition of viability associated with
apoptosis induction. PRIMA-1met also inhibited colony formation and migration
of WM cells in a dose-dependent manner. These observations pinpoint the
potential antiproliferative and apoptotic effects of PRIMA-1met on WM cells. It
also prompts us to speculate that it may antagonize WM cells viability and
migration in the context of bone marrow microenvironment which is known to
play an important role in WM pathogenesis (Agarwal and Ghobrial, 2013).
Importantly, similar effects of PRIMA-1met have also been observed in other
tumor cell types (Bao et al., 2011; Messina et al., 2012; Aryee et al., 2013)
We found that PRIMA-1met induced apoptosis in BCWM-1 cells was associated
with downregulation of Bcl-xL and cleavage of caspase 9 but not caspase 8 (Data
not shown), implying the activation of intrinsic/ mitochondrial pathway of
apoptosis. These findings are in accordance with previous reports in breast cancer
and melanoma cells treated with PRIMA-1met (Bao et al., 2011; Liang et al.,
2009; Supiot et al., 2008). Although PRIMA-1met was initially discovered as a
p53 reactivating agent (lambert et al., 2009), further studies especially in
hematological malignancies could not confirm the role of p53 in PRIMA-1met-
induced apoptosis (Nahi et al., 2004; Supiot et al., 2008; Ali et al., 2011; Saha et
al., 2013). Our initial western blot analysis did not show any significant change in
p53 level after PRIMA-1met treatment. Furthermore, selective knockdown of p53
may not have a direct role in PRIMA-1met- induced apoptosis of WM cells.
Additionally, the same p53-independent effects of PRIMA-1met was reported by
our group in MM and by others in AML, CLL and prostate cancer cell lines (Nahi
et al., 2004; Saha et al., 2013; Nahi et al., 2006). Interestingly, PRIMA-1met
treatment of WM cells resulted in activation of p73, another member of p53 super
family which shares structural and functional similarities with p53(levrero et al.,
-
38
2000). p73 is a well-known tumor suppressor which due to its non-mutated state
in most cancers has attracted much attention as a potential drug target. Our knock-
down study also demonstrated that p73-silenced cells did not undergo apoptosis in
response to PRIMA-1met treatment supporting the possible role of p73in PRIMA-
1met-induced appoptosis. Interestingly, the latter results are consistent with the
findings in our previous study in multiple myeloma (Saha et al., 2013). It should
be noted that other possible mediators of PRIMA-1met effects in WM couldn’t be
ruled out, especially in light of recent findings highlighting the significance of
ROS production in PRIMA-1met induced cell death25; thus it would be interesting
to analyze the oxidative stress pathways in PRIMA-1met-treated WM cells in
future studies.
Moreover, we also found down-regulation of anti-apoptotic marker Bcl-xL in
WM cells following PRIMA-1met treatment. This finding together with above-
mentioned cleavage of caspase 9 imply that mitochondrial/intrinsic pathway of
apoptosis may be involved in PRIMA-1met-induced apoptosis in WM cells. In
fact, involvement of latter pathway in PRIMA-1met-induced cell death has been
indicated in lung cancer and MM cells (Zandi et al, 2011;Lambert et al., 2010) .
Nonetheless, further investigation is required to decipher the mechanism of
PRIMA-1met-induced apoptosis in WM cells.
Finally, we showed that PRIMA-1met-induced cell death could be synergistically
enhanced in combination with dexamethasone or bortezomib. It is interesting to
note that both agents are known to inhibit NF-κB which in turn inhibits p53super
family (Mujtaba and Dou, 2011; Distelhorst, 2002) denoting a possible
mechanism underlying the synergistic effects of PRIMA-1met in combination
with dexamethasone or bortezomib.
Taken all together, our findings suggest that treatment of WM cells with PRIMA-
1met leads to induction of p73-mediated, p53-independent apoptosis by down-
regulation of Bcl-xL and possibly through the intrinsic pathway of apoptosis. Our
-
39
study provides a rationale for a future in-depth investigation into the molecular
mechanism of PRIMA-1met-induced cell death in WM and applying to
established WM xenograft models.
Figures:
Figure1: The effect of PRIMA-1met on WM cell lines and patient samples. The
growth suppressing effect of different concentrations of PRIMA-1met in BCWM
(IC50= 21µM), Patient sample 1 (IC50= 10), Patient sample 2 (IC50= 30) was
studied using MTT assay after 48hour incubation; n= 3, error bars show SEM.
-
40
Figure 2: The apoptotic effect of PRIMA-1met in BCWM-1 (wild type P53). The
apoptotic effect of different concentrations of PRIMA-1met in BCWM-1 was
studied using Annexin-V/PI Flowcytometry after 48 hour incubation; n= 3, error
bars show SEM. * P=
-
41
Figure3: The effect of PRIMA-1met in BCWM-1 cells. Total levels of the
indicated proteins were evaluated by Western blot analysis in BCWM-1 cells after
treatment with 50µM PRIMA-1met 1Met at several time points.
-
42
Figure 4: Anti-tumour activities of PRIMA-1met in WM cells. Dose dependent
decrease in BCWM-1 colony formation abilities was measured by colony assay
after 7 days. Dose dependent decrease in BCWM-1 cell migratory abilities was
measured by Boyden chamber assay after 8 hours of incubation.; n= 3, error
bars=SEM, * P=
-
43
Figure5: Effects of PRIMA-1met in combination with current WM therapeutics
(A) Synergism was assessed by (CI) combination index analysis for
dexamethasone and RIMA-1 after 72hrs, CI=0.63. (B)RIMA-1met has synergistic
B
-
44
effects with bortezomib(velcade) on BCWM-1 cells,72hrs,CI=0.85.Error
bars=SEM, ** P=
-
45
Figure7: PRIMA-1met cytotoxicity is P73 dependent. (A) si-p73 knock down
was confirmed by q-PCR analysis of p73 m-RNA (B) PRIMA-1met was unable to
reduce the cell survival measured by MTT assay in p73-silenced cells as much as
scrambled control. Error bars=SEM, * P=
-
46
Chapter 3
Discussion
Current standard treatment regimens for WM have been unable to cure the disease and drug
induced toxicities remain a major concern for clinicians in the field (Buske et al., 2013). The
most promising combinations so far for WM patients have been bortezomib combinations used
in clinical trials with ORR of 80-90% but few CRs and with long term third grade neurological
toxicities for many patients under the treatment (Treon, 2013). p53 is capable of induction of cell
cycle arrest, apoptosis and senescence as the major sensor of cellular stress. Given the mutated
status of p53 in more than 50% of all cancer types, in the past decade, considerable energy has
been focused on p53 apoptotic effects and developing p53 activating agents both at preclinical
and clinical level (Wang and Sun, 2010). Most of these compounds are only cytotoxic toward
cancer cells. PRIMA-1met is one of these therapeutics used in various cancer types, especially
hematological malignancies, that has shown great potential (Aryee et al., 2013; Bao et al., 2011;
Ali et al., 2011; Nahi et al., 2008). This thesis is focused on determining PRIMA-1met’s
therapeutic potential and mode of action in WM. Using various functional assays; our results
demonstrate that PRIMA-1met is a very potent therapeutic agent for WM.
In the first section of this thesis, I aimed to validate the anti-tumorigenic effects of PRIMA-1met
on WM cells using various functional assays which to our knowledge has never been
investigated before. In this study we used the BCWM-1 cell line, one of the two existing cell
lines of WM that bears wild type p53 the same as 95% of WM population (Kristinsson et al.,
2009). The first objective was pursued through studying the effects of PRIMA-1met on three
major aspects of WM pathogenesis: viability, clonogenecity and migration. Following subjection
of BCWM-1 cells to PRIMA-1met, we detected reduction in cell viability, an increase in cell
surface staining with Annexin V, and an induction of PARP cleavage which collectively point
out the induction of apoptosis in WM by PRIMA-1met. More importantly, a more significant
decrease in cell viability was discovered in primary WM samples grown in the presence of
PRIMA-1met. The rise in cell death in response to PRIMA-1met in BCWM-1 cells was observed
in dosage range previously reported to have no cytotoxicity toward Peripheral Blood
-
47
Mononuclear cell (PBMNCs) and Bone Marrow Mononuclear cells (BMMNCs) and was well
below 300 µM which is the in-vitro equivalent of the reported maximum tolerated dose set by a
recent phase I/II clinical trial for PRIMA-1met (Saha et al.,2013a; Lehmann et al., 2012). Earlier
reports also demonstrate reduction in cell viability and induction of cell cycle arrest in various
solid tumors such as breast, lung cancer, and hematological malignancies closely related to WM,
e.g. CLL and MM, in response to PRIMA-1met ((Aryee et al., 2013; Bao et al., 2011; Ali et al.,
2011; Nahi et al., 2008; Nahi et al., 2008; Saha et al., 2013a).
I next examined the effects of PRIMA-1met on WM cologenicity through a methylcellulose
based colony assay. We observed a significant decline in the number of resulted colonies which
suggest a strong anti-clonogenic effect for PRIMA-1met. These results are supported by previous
reports of reduced clonogenicity in MM after PRIMA-1met treatment (Saha et al., 2013a). We
recognize the importance of a serial replating assay to further confirm our result but practical
limitations such as low number of resulted colonies and slow doubling time prevented us from
doing so. These results, however, lead us to speculate that PRIMA-1met not only affects general
WM cancer cells but it also affect the tumor initiating cells.
Bone marrow regulates the growth, proliferation and drug resistance in WM cells, therefore, their
homing to the bone marrow through migratory mechanism is essential for WM pathogenesis
(Ngo et al., 2008; Poulain et al., 2009). Moreover, in 20% of WM cases which are also more
aggressive in nature, WM cells use their migratory abilities to disseminate throughout the body
(Shaheen et al., 2012). Hence, in the next step, we noticed a declining trend in migration for
PRIMA-1met treated WM cells as evidence for yet another important anti-tumorigenic effect of
PRIMA-1met in WM. In their investigations of PRIMA-1met on MM, Saha et al. also described
similar results to our migration assay findings (Saha et al., 2013a). CXCR4 is a lymphocyte cell
surface adhesion molecule which is highly expressed in WM and is recently found to be one of
the drivers of WM tumor progression (Treon et al., 2014a; Hunter et al., 2014). Since
CXCR4/SDF1 is known to be the major player in MM migration and homing and in light of data
pertain to its importance in WM pathogenesis, we speculate that one of the mechanism through
-
48
which PRIMA-1met is inhibiting migration in WM is through regulating the levels of surface
CXCR4 (Alsayed et al., 2007).
To gain insight into the mechanism of PRIMA-1met induced apoptosis, we evaluated the
expression of number of apoptotic markers. First, we detected elevated levels of PARP and
caspase 9 cleavage which led us to believe that the mitochondrial pathway of apoptosis is
involved in PRIMA-1met-induced cell death. Changes in expression of various members of
mitochondrial pathway of apoptosis after PRIMA-1met treatment have previously been
demonstrated by several groups. Zandi et al. reported that Bax level was elevated while Bcl-2
was reduced in several small cell lung cancer cell lines following treatment with PRIMA-1met
(zandi et al., 2011). In another study, an si-RNA knock down of Noxa in MM render the cells
incapable of undergoing apoptosis in response to PRIMA-1met treatment leading to the author’s
conclusion that Noxa is a major player in causing apotosis in these cell lines (Saha et al., 2013a).
We on the other hand were unable to detect any changes in the levels of Noxa (data not shown)
and only came across decreasing levels of Bcl-xL after PRIMA-1met treatment. Therefore, it
seems that although PRIMA-1met exerts its apoptotic effects through intrinsic pathway of
apoptosis, the exact executioner in this pathway is cell type specific.
PRIMA-1 and its more potent form PRIMA-1met were initially discovered as activators of
mutant p53 in Saos-2 cells (Bykov et al, 2002; Bykov et al., 2005). In a later study, Bao et al.
discovered that PRIMA-1met was more effective in inducing apoptosis in wild type p53
melanoma cells (Bao et al., 2011); while, several recent studies have indicated the PRIMA-
1met’s potency in p53 null or knocked-down cell lines especially in hematological malignancies
(Ali et al., 2011; Supiot et al., 2008). To elucidate the role of p53, we evaluated the effects of
p53 knockdown in PRIMA-1met cytotoxicity towards WM. Following the knockdown in
BCWM-1 cells, they were able to undergo apoptosis in response to PRIMA-1met to the same
extent as before the knockdown, leading us to conclude that PRIMA-1met effects are p53
independent. P73 is another member of the p53 tumor suppressor superfamily which shares 80%
structural and some functional similarities with p