Press report may2016 - normalesup.orgvorgogoz/press-reports/Press_report_… · *Corresponding...

11

Transcript of Press report may2016 - normalesup.orgvorgogoz/press-reports/Press_report_… · *Corresponding...

  • Press report 2.VI.16Alex Peluffo - Orgogozo Lab

Computational aspects of ChIP-seq - Bioconductor · 2011-06-28 · Relationship to gene expression! Cain et al., 2011! • The results suggest that changes in H3K4me3 status could

Computational aspects of ChIP-seq - Bioconductor · 2011-06-28 · Relationship to gene expression! Cain et al., 2011! • The results suggest that changes in H3K4me3 status could

Nature Genetics: doi:10.1038/ng · PDF filePhase-contrast microscopy images of dissociated spermatogenic cells before StaPut and of sorted ... (compare to Fig ... and between H3K27me3

Nature Genetics: doi:10.1038/ng · PDF filePhase-contrast microscopy images of dissociated spermatogenic cells before StaPut and of sorted ... (compare to Fig ... and between H3K27me3

A) B) - Nature · A) B) ty ty Position along gene Position along gene H3K4me3 H3K27me3 Supplemental Figure 1. Enrichment of H3K4me3 and H3K27me3 islands near transcription start sites

A) B) - Nature · A) B) ty ty Position along gene Position along gene H3K4me3 H3K27me3 Supplemental Figure 1. Enrichment of H3K4me3 and H3K27me3 islands near transcription start sites

Dexamethasone Treatment Effects on H3k27me3 Chromatin ...

Dexamethasone Treatment Effects on H3k27me3 Chromatin ...

Nature Genetics: doi:10.1038/ng...5 Supplementary Figure 4 Profiles of H3K27ac, H3K4me3 and H3K4me1 over methylation haplotype blocks for 12 human adult tissue types. X -axis denote

Nature Genetics: doi:10.1038/ng...5 Supplementary Figure 4 Profiles of H3K27ac, H3K4me3 and H3K4me1 over methylation haplotype blocks for 12 human adult tissue types. X -axis denote

The effects of Alicine on ZNF703 Gene Expression in Gastric … · promoters with H3Kme1 or H3K4me3 labels suggesting Abstract—Cancer is the genetic disease of the somatic cells,

The effects of Alicine on ZNF703 Gene Expression in Gastric … · promoters with H3Kme1 or H3K4me3 labels suggesting Abstract—Cancer is the genetic disease of the somatic cells,

Coupling of H3K27me3 recognition with transcriptional repression … · 2020. 10. 15. · with CPL2, a plant-specific Pol II carboxyl terminal domain (CTD) phosphatase, to . 40 .

Coupling of H3K27me3 recognition with transcriptional repression … · 2020. 10. 15. · with CPL2, a plant-specific Pol II carboxyl terminal domain (CTD) phosphatase, to . 40 .

Cancer Research Review W4...ESR1 1, and the epigenome of histone H3 lysine 4 monomethylation (H3K4me1). The majority of the risk The majority of the risk- associated SNPs modulate

Cancer Research Review W4...ESR1 1, and the epigenome of histone H3 lysine 4 monomethylation (H3K4me1). The majority of the risk The majority of the risk- associated SNPs modulate

WDR5-H3K4me3 epigenetic axis regulates OPN expression to … · lentiCRISPRv2 (Genscript, Piscataway, NJ) plasmids containing scramble (GGAAGACTTAGTCGAATGAT) or Spp1- specific ( GCAAATCACTGCCAATCTCA)

WDR5-H3K4me3 epigenetic axis regulates OPN expression to … · lentiCRISPRv2 (Genscript, Piscataway, NJ) plasmids containing scramble (GGAAGACTTAGTCGAATGAT) or Spp1- specific ( GCAAATCACTGCCAATCTCA)

Chromatin flow cytometry based quantification of cell type ... · Mouse Peripheral Blood Staining & Gating Methyl-Mark in Mouse Peripheral Blood Poplulations Histone Western H3K27me3/H3

Chromatin flow cytometry based quantification of cell type ... · Mouse Peripheral Blood Staining & Gating Methyl-Mark in Mouse Peripheral Blood Poplulations Histone Western H3K27me3/H3

€¦ · XLS file · Web view · 2012-10-07H4K20me3 H3K36me3 H3K27me3 H3K9me3 H3K4me3 Protein.Names Gene.Names Protein.Descriptions Uniprot Peptides..seq. Unique.Sequence.Coverage....

€¦ · XLS file · Web view · 2012-10-07H4K20me3 H3K36me3 H3K27me3 H3K9me3 H3K4me3 Protein.Names Gene.Names Protein.Descriptions Uniprot Peptides..seq. Unique.Sequence.Coverage....

Neonatal monocytes exhibit a unique histone modification ......kine production, and antigen presentation. The O30 monocytes had less than 1 % (4 total) of H3K4me3 peaks associated

Neonatal monocytes exhibit a unique histone modification ......kine production, and antigen presentation. The O30 monocytes had less than 1 % (4 total) of H3K4me3 peaks associated

Research Paper Flow-dependent epigenetic regulation of ...inhibition of H3K27me3 by EZH2 siRNA or GSK126 (a specific EZH2 inhibitor) reduced H3K27me3 levels and monocyte adhesion to

Research Paper Flow-dependent epigenetic regulation of ...inhibition of H3K27me3 by EZH2 siRNA or GSK126 (a specific EZH2 inhibitor) reduced H3K27me3 levels and monocyte adhesion to

BIOCHEMISTRY Copyright © 2020 Coordinated regulation of ...BIOCHEMISTRY Coordinated regulation of cellular identity–associated H3K4me3 breadth by the COMPASS family Christie C.

BIOCHEMISTRY Copyright © 2020 Coordinated regulation of ...BIOCHEMISTRY Coordinated regulation of cellular identity–associated H3K4me3 breadth by the COMPASS family Christie C.

4000 2HGFigure 1 3000 Immortalized human astrocytes ...PAR02 PAR10 PAR40 MUT02 MUT10 MUT40 0 50 100 Enrichment of H3K4me3 peaks (%) P2 P10 P40 IDH1 R132H0 Parental H3K9me3 H3K36me3

4000 2HGFigure 1 3000 Immortalized human astrocytes ...PAR02 PAR10 PAR40 MUT02 MUT10 MUT40 0 50 100 Enrichment of H3K4me3 peaks (%) P2 P10 P40 IDH1 R132H0 Parental H3K9me3 H3K36me3

Sequential changes at differentiation gene promoters as they … · binding of Polycomb via its chromodomain to the trimethylated histone H3 Lys27 (H3K27me3) mark (Fischle et al.,

Sequential changes at differentiation gene promoters as they … · binding of Polycomb via its chromodomain to the trimethylated histone H3 Lys27 (H3K27me3) mark (Fischle et al.,

Single-molecule and in silico dissection of the interaction between … · nism: The EED subunit recognizes an existing H3K27me3 mark, which allosterically activates the methyltransferase

Single-molecule and in silico dissection of the interaction between … · nism: The EED subunit recognizes an existing H3K27me3 mark, which allosterically activates the methyltransferase

Multi-dimensional histone methylations for coordinated regulation … · 2019-03-20 · NucleicAcidsResearch,2017 5 A H3K4me3-N H3K4me3-H H3K9me3-N H3K9me3-H H3K27me3-N H3K27me3-H

Multi-dimensional histone methylations for coordinated regulation … · 2019-03-20 · NucleicAcidsResearch,2017 5 A H3K4me3-N H3K4me3-H H3K9me3-N H3K9me3-H H3K27me3-N H3K27me3-H

SU PPLEMENTAR Y INFORMATION10.1038... · Supplementary Figure 2. Genome browser representation of hESC ChIP-seq profiles at selected loci. Binding profiles for p300, H3K4me1, H3K27ac,

SU PPLEMENTAR Y INFORMATION10.1038... · Supplementary Figure 2. Genome browser representation of hESC ChIP-seq profiles at selected loci. Binding profiles for p300, H3K4me1, H3K27ac,

H3K4me3 is neither instructive for, nor informed by ... · H3K4me3 is neither instructive for, nor informed by, transcription. Struan C Murray1, Philipp Lorenz1, Françoise S Howe1,

H3K4me3 is neither instructive for, nor informed by ... · H3K4me3 is neither instructive for, nor informed by, transcription. Struan C Murray1, Philipp Lorenz1, Françoise S Howe1,