Prenylation of S. cerevisiae Mska*, Paula Magnelli, and ... · 12/1/2006 · modified by formation...
Transcript of Prenylation of S. cerevisiae Mska*, Paula Magnelli, and ... · 12/1/2006 · modified by formation...
-
Prenylation of S. cerevisiae Chs4p affects chitin synthase III activity and
chitin chain length
Kariona A. GrabiMska*, Paula Magnelli, and Phillips W. Robbins
Department of Molecular and Cell Biology, School of Dental Medicine,
Boston University, 715 Albany Street, Evans 408 Boston, MA 02118
Running title: Chitin synthesis in S. cerevisiae
Key Words: Saccharomyces cerevisiae, chitin synthase, cell wall, prenylation, farnesylation
*Corresponding author: Kariona A. GrabiMska, Department of Molecular and Cell Biology,
School of Dental Medicine, Boston University, 715 Albany Street, Evans 4 Boston, MA 02118
Telephone # (617) 414-1058. Fax #(617) 414-1041.E-mail: [email protected]
ACCE
PTED
Copyright © 2006, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Eukaryotic Cell doi:10.1128/EC.00203-06 EC Accepts, published online ahead of print on 1 December 2006
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
mailto:[email protected]://ec.asm.org/
-
ABSTRACT
Chs4p (Cal2/Csd4/Skt5) was identified as a protein factor physically interacting
with Chs3p, the catalytic subunit of chitin synthase III (CSIII), and is indispensable for its
enzymatic activity in vivo. Chs4p contains a putative farnesyl attachment site at the C-
terminal end (CVIM-motif) conserved in Chs4p of S. cerevisiae and other fungi. Several
previous reports questioned the role of Chs4p prenylation in chitin biosynthesis. In this
study we reinvestigated the function of Chs4p prenylation. We provide evidence that
Chs4p is farnesylated by showing that purified Chs4p is recognized by anti-farnesyl
antibody, is a substrate for farnesyl transferase (FTase) in vitro, and that inactivation of
FTase increases the amount of unmodified Chs4p in the yeast cells. We demonstrate that
abolishing Chs4p prenylation causes ~60 % decrease in CSIII activity which is correlated
with a ~30 % decrease in the chitin content, and with increased resistance to the chitin
binding compound, Calcofluor white. Furthermore, we show that lack of Chs4p
prenylation decreases the average chain length of the chitin polymer. Prenylation of
Chs4p, however, is not a factor which mediates plasma membrane association of the
protein. Our results provide evidence that the prenyl moiety attached to the Chs4p is a
factor modulating the activity of CSIII both in vivo and in vitro.
INTRODUCTION
Chitin, a linear N-acetylglucosamine (GlcNAc) polymer, is a minor but essential
structural component of the yeast cell wall - the organelle responsible for the maintaining
of cell shape and osmotic stability (5, 23). The majority (90 %) of chitin in the cell wall
including chitin in the bud scars, in the lateral wall, and the polymer converted to the
chitosan in spore walls is synthesized by chitin synthase III (CSIII) encoded by CHS3
2
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
gene (35). A number of proteins have been identified that are necessary for the proper
activity of Chs3p. Chs7p is required for export of Chs3p from ER, whereas Chs5p and
Chs6p are involved in the proper delivery of Chs3p to the plasma membrane (35).
Chs4p (Cal2/Csd4/Skt5) is a regulatory subunit of the CSIII complex,
indispensable for its enzymatic activity in vivo in vegetative cells (5, 32, 35, 37, 40). It
has been demonstrated that Chs4p interacts directly with Chs3p and is responsible for the
localization of Chs3p to the septin ring thorough the interaction with the scaffolding
protein Bni4p (11). Chs4p contains a possible farnesyl attachment site at the C-terminal
end (CaaX-motif) which is conserved between S. cerevisiae Chs4p and other fungi
including human pathogens Candida albicans (39) and Cryptococcus neoformans (1).
The possibility that Chs4p is prenylated is enhanced by the fact that the CVIM motif is
preceded by a lysine rich amino acid stretch (29). Thus, Chs4p is predicted to be
prenylated by the Prenylation Prediction Suite (http://mendel.imp.ac.at/sat/PrePS/).
However, the role of prenylation of Chs4p in chitin biosynthesis or even the occurrence
of this modification was questioned in several reports (5, 11, 32, 39, 40).
In yeast, 35 proteins, including many important for cell growth, differentiation,
morphology and stress response, require post-translational modification by covalent
attachment of an isoprenoid lipid (prenylation) for proper function (Proteome
Bioknowledge Library: www.incyte.com). Prenylated proteins are posttranslationally
modified by formation of cysteine thioethers with the isoprenoid lipids farnesol (C-15) or
geranylgeraniol (C-20) at or near to the carboxyl terminus. Prenylation is specified by the
amino acid sequence motifs CaaX, CC and CaC at the carboxyl end of the protein where
a is an aliphatic amino acid and X is any amino acid. The CaaX sequence is substrate for
3
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://mendel.imp.ac.at/sat/PrePS/http://www.inocyte.com/http://ec.asm.org/
-
farnesyl transferase (FTase) (the known biological substrates have X= S, M, A or Q)
unless X=L, which results in a substrate for geranylgeranyl transferase I (GGTase I). The
CC and CaC motifs, present in the Rab family of low molecular mass G-proteins, are
digeranylgeranylated. Typically, prenylation by CaaX protein prenyltransferases is
accompanied by further posttranslational processing, most often involving cleavage of
the carboxy-terminal tripeptide (-aaX) followed by carboxymethylation of the carboxy
terminus (9, 38).
Like other lipid modifications, prenylation has been viewed as a mechanism for
post-translational attachment of proteins to membranes. However, now it appears that
lipid modification by protein prenyltransferases has a more complex role: for example,
the farnesyl and geranylgeranyl moieties are directly involved in protein-protein
interactions as well as in protein-membrane interaction (28, 38).
Since clinical studies in progress are exploring the antitumor activity of FTase
inhibitors as potential therapeutic agents (2), prenylation attracts the attention of many
laboratories. In order to decrease the costs associated with de novo drug design and
accelerate the development of new chemotherapeutics, FTase inhibitors are currently
investigated as agents for protozoan pathogens (14). Since deletion of FTase catalytic
subunit (RAM1) is lethal in the pathogenic fungus Cryptococcus neoformans, in contrast
to the case in Saccharomyces cerevisiae (44), FT inhibitors may be suitable as antifungal
drugs.
In this study we have reinvestigated the function of Chs4p farnesylation and
shown that prenylation of Chs4p does not affect membrane anchoring of Chs4p; however
it does affect the catalytic properties of CSIII.
4
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
MATERIALS AND METHODS
Strains, plasmids, and growth conditions. Strains and plasmids used in this
study are listed in Table 1 and oligonucleotide primers in Table 2.
To generate the mutation leading to the abolition of Chs4p farnesylation (Cysteine
693 Serine substitution) directly at the chromosomal locus, we adapted the loxP/Cre
based disruption system (16). The homologous recombination cassette was amplified by
PCR using oligonucleotides comprising the 3’ region complementary to the sequence in
the template (pUG27 marker plasmid) flanking the disruption cassette and 50 5’
nucleotides that anneal to the STOP codon and the region upstream (CHS4CtoS primer)
and the region downstream of the STOP codon (CHS4DR primer) of the CHS4 gene. In
the forward primer the TGT codon for cysteine was replaced with AGT codon for serine.
After transformation of the linear cassette into yeast cells, selected transformants were
checked by PCR for correct integration of the cassette using CH4-1920 and KanB pairs
of primers. Introduction of mutation was verified by sequencing of the PCR product.
Finally, the marker gene was removed by expression of recombinase Cre leaving behind
a single LoxP site. As a control strain we used a yeast strain with LoxP introduced site at
the chromosomal locus after the STOP codon of CHS4 gene. To obtain this strain, yeast
cells were transformed with the PCR cassette generated using CHS4wt and CHS4DR
primers and the pUG27 plasmid as a template. In order to change farnesylation of the
CVIM motif to the geranylgeranylation motif CVLL, we used a mutagenesis cassette
generated with primers: CHS4DR and CHS4LL. The CHS4LL forward primer last
codons ATT for isoleucine and ATG for methionine were replaced with TTG and TTA,
both coding for leucine. Comparison of growth rate, sensitivity to Calcofluor white
5
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
(CFW) and chitin content of parental BY4741 and KG103B yeast strain containing LoxP
sequence in terminator region of CHS4 gene did not reveal any difference.
In order to construct the trp1 auxotrophic KG101B yeast strain, we decided to
delete only the first 312 nucleotides of TRP1 ORF to leave intact the putative YDR008C
ORF located on the complementary strand of DNA. Deletion was accomplished by the
method described by Gueldner et al., (16). The deletion cassette was amplified with DF-
TRP1 and DR-TRP1 primers from the pUG27 plasmid used as a template, then
transformed into BY4741 yeast cells. Transformants able to grow on medium lacking
histidine and requiring tryptophan were isolated, and correct insertion of cassette was
verified by PCR with TRP1UP and KanB primers pair. Finally, the marker gene was
removed by expression of recombinase Cre.
In order to construct a yeast strain expressing TAP-Chs4p (33, 34), KG101B cells
were transformed with PCR cassette amplified with pBS1761 plasmid as a template and
TAP1-CHS4 and TAP2-CHS4 primers pair. Transformants able to grow on medium
lacking tryptophan were isolated, then correct insertion of cassette was verified by PCR
with primers: CHS4 –290R: and F1-CBP. Marker TRP1 gene was removed by expression
of recombinase Cre.
TAPCHS4B5 and TAPCHS4B6 were obtained by mating TAPCHS4B3 or
TAPCHS4B2 with BY4741ram1F0"Sporulation of the diploid cells and tetrad dissection
was done by standard yeast genetics methods. Yeast cells were cultured in 2% (w/v)
bactopeptone, 1% (w/v) yeast extract supplemented with 2% glucose (w/v) (YPD).
Synthetic minimal media (SD) were made of 0.67% (w/v) yeast nitrogen base 2% (w/v)
glucose, supplemented with auxotrophic requirements. For solid media, agar (Difco) was
6
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
added to YPD or SD at 2% (w/v) final concentration. Bacterial cells carrying pET30a
plasmid were grown in LB medium (1% [w/v] bactotryptone, 0.5% [w/v] yeast extract,
1% NaCl [w/v]) supplemented with kanamycin (25 mg/l) and chloramphenicol (34mg/l).
Heterologues expression and purification of Chs4p from Eschericha coli. WT
and mutated at prenylation box (C693S) CHS4 alleles were amplified by PCR using yeast
genomic DNA as a template and CHS4BamHF as a forward primer, and Chs4-R or Chs4-
C693S-R as a reverse primer. PCR products were cloned into pGEM Easy T vector
(Promega) and BamHI/NotI insert was subcloned into the pET30a vector (Novagen) in
such a way that a poly-His sequence and S-tag were added to the N-terminus of Chs4p.
pET30a-CHS4 and pET30a-chs4(C693S) were each transformed into The Rosetta™ 2
strain of E. coli. E coli cells in logarithmic growth phase were induced to express Chs4p
by incubation with 1mM IPTG (Isopropyl-ß-D-thiogalactopyranosid) for 4 h at 30 °C.
The harvested cells were lysed by sonication. WT and mutated Chs4p were purified by
means of N-terminal poly-His using a nickel-column according to the Invitrogen protocol
and checked on SDS-PAGE and Western Blot using monoclonal mouse IgG raised
against S-tag (Novagen).
Miscellaneous methods. Protein level was determined on microtiter plates by the
Bradford method (Bio-Rad Laboratories). Protein samples were resolved by SDS
NuPAGE-NOVEX Bis-Tris 4-12% gel or 8 % Precise SDS-PAGE (Pierce) under
reducing conditions and transferred to polyvinylidene difluoride (PVDF) membranes,
blocked in 5% milk and probed with antibodies. Chs3p was recognized with polyclonal
rabbit antibodies (25), plasma membrane marker Gas1p with polyclonal rabbit IgG (kind
gift of L. Popolo, Università degli Studi di Milano), cytoplasm marker Pgk1p with
7
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
monoclonal mouse antibodies 22C5 (Molecular Probes), ER membrane marker Dpm1p
with monoclonal 5C5 mouse antibodies (Molecular Probes), and TAPtag fused proteins
with Peroxidase-Anti-Peroxidase Soluble Complex (PAP) rabbit IgG coupled with HRP
(SIGMA) or anti-Chs3p IgG. Farnesylated purified CBP-Chs4p was detected with rabbit
anti-farnesyl antiserum (SIGMA). As secondary antibodies Horseradish peroxidase-
conjugated anti-mouse antibodies or anti-rabbit antibodies (Promega) were used. Binding
was visualized with the Western Lightning Chemiluminescence Reagent (PerkinElmer)
according to the manufacturer's instructions.
Prenylation of Chs4p in vivo. In order to purify Chs4p, a modified TAPtag
purification method was applied (33). Yeast cells expressing TAP-Chs4p (TAPCHS43B)
or TAP-Chs4pC693S
(TAPCHS4B) were grown overnight in YPD medium to late
logarithmic phase (2-3 OD600 units/ml). Cells were collected by centrifugation, washed
with water, and then disrupted in IPP1000 buffer (10 mM Tris HCl pH 8, 1M NaCl, 0.5
% Nonylphenyl-polyethylene glycol [NP 40, SIGMA], 2 mM phenylmethylsulfonyl
fluoride [PMSF], Protease Inhibitor Cocktail [SIGMA]) by Vortexing with glass beads.
Lysates were clarified by 15 min. centrifugation at 1500 g and centrifuged at 100,000 g
for 90 min at 4°C.
The supernatant was incubated overnight at 4flC on a rotating platform with 100 伊
ol of IgG Sepharose 6 FAST Flow (Amersham Biosciences). The IgG Sepharose beads
were collected by centrifugation, washed extensively with IPP buffer, equilibrated with
TEV cleavage buffer (10 mM Tris HCL pH 8, 150 mM NaCl, 0.1% NP40, 0.5 EDTA,
1mM DTT), and suspended in 50 ol of TEV cleavage buffer containing 3ol (30 units) of
TEV protease (Invitrogen). The mixture was incubated during 3 h at 16flC on a rotating
8
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
platform in order to cleave the CBP-Chs4p fusion protein from ProtA tag. The mixture
was centrifuged (20,000 g) in order to separate the upper phase eluate containing CBP-
Chs4 fusion protein from IgG sepharose beads. Protein samples were separated by
protein electorophoresis and analyzed by immunoblotting.
Farnesyl transferase activity. 1.5 og of Chs4p (wt or mutated at the
farnesylation box) purified from bacterial cells was incubated with 4 oM farnesyl
pyrophosphate-(1-3H (N) (15Ci/mmol, ARC) in 30 ol reaction mixture containing 10
mM TrisHCl pH7.5, 10 mM MgCl2, 5 oM ZnCl2, 0.1mM PMSF and 0.2 mg of
recombinant S. cerevisiae farnesyltransferase (SIGMA). The reaction mixture was
incubated at 30ºC for 60 min, stopped by addition 1ml of TEV buffer, concentrated using
Amicon ultra filter device (Millipore) and proteins were separated by SDS PAGE gel and
blotted onto PVDF membrane. Farnesylated protein was visualized by autoradiography.
In order to asses the level of prenylation in wt background and in the cells lacking
the catalytic subunit of farnesyltransferase (Ram1p), yeast strains expressing TAP
versions of wt and mutated form of Chs4p in the RAM1 knockout genetic background
were constructed. Cells were disrupted in IPP1000 buffer and the protein extract (100 000
x g supernatant) was incubated for 3 hr with at 4flC on a rotating platform with IgG
Sepharose 6 FAST Flow (10ol of Sepharose was incubated with the extract made from
0.25 g of cells to ensure saturation of the resin with the protein). The IgG Sepharose
beads were collected by centrifugation, washed extensively with IPP buffer, equilibrated
with FTase buffer lacking farnesyl pyrophosphate and FTase and, 10 ol of resin with
immobilized protein was used for FTase assay in 60 ol reaction mixture as described
9
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
previously. After reaction, the resin was washed 5 times with 1ml of TEV buffer and the
radioactivity was measured by scintillation counting.
Subcellular fractionations. The analysis of organelles by differential
centrifugation was performed according to the methods described (21, 42) with
modifications.
To study membrane association of Chs4p, 0.6 gram of yeast cells in mid-log
phase (0.5-0.8 OD600) were harvested, washed with ice-cold 10 mM NaN3, 10 mM KF, 50
mM Tris-HCl pH 7.5 buffer and then with 50 mM Tris-HCl pH 7.5, 1 mM EDTA buffer.
The cells were suspended in 1.2 ml of hypoosmotic lysis buffer (HOB: 200 mM sorbitol,
1 mM EDTA, 50 mM Tris HCL pH 7.5, 2 mM PMSF, protease inhibitor cocktail
[SIGMA]) and broken by agitation with glass beads. Lysates were cleared by 5 min
centrifugation at 500 g. The cleared cell lysate was mixed with an equal volume of 200
mM sodium carbonate or HOB containing 1 M NaCl, 2 % Triton X100 or 2% SDS. After
incubation for 1 hour on ice, samples were centrifugated at 200,000 g for 1 hour to
separate soluble and particulate fraction. The pellet was then resuspended in HOB in the
same volume as the corresponding soluble fraction. 5 ol of each fraction was subjected to
protein electorophoresis and immunoblotting.
Chitin content measurement. Chitin content was measured by an assay adapted
for microtiter plates as described previously (6) with minor modifications. Chitin polymer
was digested with chitinase c (Interspex) in McIlvaine's Buffer, pH 6.0 during 3 h.
Chitin synthase III activity. Chitin synthase III activity was measured by the
colorimetric assay adapted for microtiter plates as described (25). The enzyme source
was prepared as follows: cells were harvested by centrifugation, washed once with water
10
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
and resuspended in 20 mM Tris HCl pH 8.0 buffer containing 2 mM PMSF and protease
inhibitor cocktail (SIGMA), and broken by Vortexing with 425-600 micron glass beads.
The cell free extract was clarified by 15 minutes centrifugation (1500 g) and then
centrifugated 1h for 100,000 g. The membrane fraction was dissolved in 20 mM Tris HCl
pH 8.0 buffer supplemented with protease inhibitors. Trypsin pretreatment of enzyme
source was done according to the method described for measurement of chitin synthase II
activity (25).
Degree of polymerization of chitin. Chain length was estimated according to
Kang et al. (22). To obtain pure chitin, d-1,3-glucan and mannan were removed by
digesting isolated cell walls with 2 mg/ml of Zymolyase X100 (Seikagaku). In order to
remove the remaining d-1,6-glucan attached to chitin chains, the washed pellet was later
digested with 4 units/ml of d-1,6 endoglucanase (27). The chitin pellet was reduced in
100 ol of 0.1M NaOH, with 500oCi of NaB3H4 (NEN, 100mCi/mmol) for 6h at 25ºC.
The reaction was stopped with 200ol 0.5M acetic acid. After extensive washing, the
reduced chitin was digested in 0.2 ml of 0.1M KPO4 pH 6.0 with 0.015 units of Serratia
chitinase (Sigma) for 16h at 37ºC. This crude endochitinase preparation, containing
hexosaminidase activity, digests chitin to free N-acetylglucosamine (GlcNAc) (27). After
digestion the total GlcNAc was estimated using the Morgan Elson assay, as described
above. To determine the amount of terminal residues, the supernatants were
chromatographed in a P4 Biogel column (1 x 120 cm). Three major species were present:
free N-acetylglucosamintol, and two oligosaccharides with an apparent mass of GlcNAc-
glucitol and GlcNAc-glucose-glucitol (residual glucan stubs attached to the chitin
reducing end). The molarity of these tritiated species was calculated according to the
11
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
radioactivity of 2.25 omol of GlcNAcOL isolated by P4 chromatography after reducing
GlcNAc under the same conditions described above. The degree of polymerization (DP)
was calculated as the omol of GlcNAc/omol of total alditols.
RESULTS
Chs4p is prenylated. Although Chs4p contains a possible farnesyl attachment
site at the C-terminal end (CVIM motif) which is conserved between Chs4p of S.
cerevisiae and a number of other fungi, the role of farnesylation of Chs4p in chitin
biosynthesis was questioned by several reports (5, 11, 32, 39, 40). Since previously wild
type or mutated Chs4p was expressed from a plasmid, we suspected that the effect of the
mutation might be masked by variation in the protein expression level; therefore in this
study we used only yeast strains expressing Chs4p from the genome. The lack of the
phenotype in previous studies may be also due to the fact that in some cases chitin level
was measured by CFW or Wheat Germ Agglutinin coupled with FITC binding assay (11,
40). These methods may be not accurate enough to observe small differences in chitin
level.
We confirmed that when purified from bacterial source, Chs4p is substrate for
yeast farnesyltransferase in vitro (1A). To reinvestigate whether Chs4p is prenylated in
vivo, we constructed yeast strains expressing Chs4p with N-terminal TAP (ProtA -
protease TEV cleavage site - CBP) -tag mutated at C-terminal CVIM farnesylation motif
(C693S substitution) (33). The affinity purification on IgG-Sepharose from yeast extracts
gave TAP-Chs4p and TAP-Chs4pC693S
with the same efficiency (Fig.1Bi). CBP-tagged
forms of the proteins were then released into solution from the ProtA bound to the IgG-
Sepharose by treatment with protease TEV. Antibodies raised against N-acetyl-S-
12
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
farnesyl-L-cysteine which recognizes farnesyl or with less specificity geranylgeranyl-
modified proteins (3, 24) were able to recognize wild type Chs4p but not the mutated
protein (Fig. 1Bii). The presence of wt and mutated CBP-Chs4p in the eluate was
confirmed by mass spectrometry analysis of the purified proteins (data not shown). This
result confirmed that Chs4p is prenylated in vivo.
Since prenylation is an irreversible process, we assume that if Chs4p is
preferentially farnesylated, inactivation of endogenous FTase will increase the amount of
unmodified Chs4p available as a substrate for reaction in vitro, even if cross-specificity
between FTase and GGTaseI are observed (29, 31, 41). To prove the involvement of
FTase in modification of Chs4p, we immobilized TAP-Chs4p expressed in wt yeast cells
or cells lacking the catalytic subunit of FTase (Ram1p) on IgG-Sepharose beads and used
the resin-Chs4p as substrates for FTase assays in vitro. As a negative control we used the
resin carrying Chs4p C693S mutant. Our results (1C) show that Chs4p isolated from wt
yeast cells is a poor substrate for FTase. On the other hand, inactivation of FTase
increases the amount of Chs4p in the cell available for reaction in vitro which indicates
that Chs4p under normal conditions is farnesylated, not geranylgeranylated.
Prenylation of Chs4p is not essential for its plasma membrane localization or
membrane association. All known prenylated proteins are found, at least to some extent,
bound to cellular membranes, and prenylation has often been viewed as a mechanism for
post-translational attachment of proteins to membranes (38). Chs4p is also known to be a
membrane protein, so we determined whether farnesylation of Chs4p influenced its
membrane association or plasma membrane localization.
13
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
To test membrane association of Chs4p, cell free protein extracts from cells
expressing TAP-Chs4p and TAP-Chs4pC693S
were fractionated into supernatant (soluble)
and pellet (membrane-associated) portions by centrifugation. TAP-Chs4p and TAP-
Chs4pC693S
were found in the pellet fraction (Fig.2A). To test whether lack of prenylation
changes the membrane association of Chs4p, protein extracts were treated with sodium
chloride and sodium carbonate to disrupt peripheral or protein–protein associations,
or
with Triton X-100 or Sodium Dodecyl Sulfate (SDS) to disrupt integral membrane
association. TAP-Chs4p as well as TAP-Chs4pC693S
were solubilized to similar extents by
treatment with sodium chloride, sodium carbonate or SDS, but Triton X-100 (a widely
used non-ionic surfactant for recovery of membrane components under mild non-
denaturing condition) had no effect in either case, indicating that membrane association
of Chs4p is independent of farnesylation.
In order to determine whether prenylation affects Chs4p subcellular distribution,
the cells were converted to spheroplasts, lysed by osmotic shock, and
membranes were
separated by differential centrifugation (13,000 g for 10 min) to obtain a
Golgi/endosome-rich fraction (S) and a plasma membrane/ endoplasmic reticulum-rich
fraction (PM/ER) fraction (P). As can be seen, prenylation did not change distribution of
Chs4p between the S and P fractions. Chs4p populated both fractions. However, in
contrast to the catalytic subunit of CSIII (Chs3p) it is present to the greater extent in the
Golgi/endosome-rich fraction (Fig 2B).
We also did not observe a difference in sedimentation of wt and mutated Chs4p
on a step sucrose/EDTA density gradient (data not shown).These results confirm that
abolishing Chs4p prenylation does not prevent trafficking to the plasma membrane.
14
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
Mutation of the farnesylation site confers resistance to Calcofluor white.
Since Calcofluor white (CFW) is a fluorescent dye that intercalates with nascent chitin
chains, preventing microfibril assembly and inhibiting growth of yeast strains, the
sensitivity to CFW is often an indicator of changes in cellular chitin level (13, 36).
Expecting that prenylation of Chs4p could influence chitin biosynthesis, we compared the
growth rate of chs4 mutants and the corresponding wild type yeast strain on medium
supplemented with CFW. The results in Fig.3 show that chs4-C693S yeast cells harboring
the nonprenylated version of Chs4p are more resistant to CFW than wild type cells and
less resistant than chs4F yeast cells. To confirm the role of prenylation of Chs4p, we also
constructed yeast strain chs4-I695L,M696L expressing Chs4p with the C-terminal CVLL
motif (the CVLL motif present in yeast Rho1p was proven experimentally to be a
substrate for geranylgeranyl transferase Type I [31]). Geranylgeranylation of Chs4p only
partially restores the sensitivity to CFW.
Farnesylation of Chs4p affects chitin synthase III activity in vitro and chitin
content. Next, we examined the effect of mutagenesis of the Chs4p farnesylation site on
the cellular chitin content and CSIII activity in different growth conditions. As shown in
Table 3, abolishing farnesylation causes approximately a 30 - 40% decrease in chitin
content under various conditions of growth (CFW or glucosamine supplementation) or in
various genetic backgrounds, including those that induce the cell wall stress response
(deletion of FKS1 or GAS1 gene [15, 43]). However, the rate of increase in chitin levels
produced by CFW addition in wild type and mutated yeast cells was very similar. In both
cases maximal levels of chitin were achieved after 4-6 hours of exposure to CFW and
half of this value after ~2 hours (data not shown). Since the kinetics of response to CFW
15
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
treatment is similar in yeast strains bearing wild type or mutated CHS4 gene, we can
assume that prenylation of Chs4p does not contribute directly to the mechanism of the
cell wall stress response.
Reported here changes in the cellular chitin content are well correlated with the
observed 60% decrease in CSIII specific activity (Fig.4A). Restoring prenylation by
introducing the CVLL geranylgeranylation motif is able only to partially restore the wild
type phenotype. Treatment of the enzyme source with trypsin is able to increase CSIII in
chs4-C603S and chs4F mutants to the level measured in the parental strain (Fig.3B),
which indicates that proteolytic treatment activates CSIII in a way that is independent of
the Chs4p function.
Chs4p prenylation affects chitin chain length. We have noticed that cells
carrying nonprenylated Chs4p are much more resistant to CFW (Fig 3) than expected
from a 30 % reduction in chitin content (Table 3). CFW binds to the insoluble chitin
microfibrills in the cell wall. If Chs4p somehow determines chitin chain length, its
partial loss of function will affect not only total chitin content but the structure of the
microfribrills as well. To confirm our supposition, we measured average chitin chain
length. For chitin isolated from wild type cells the degree of polymerization was 60 units,
while from chs4-C693S it was 45 (Table 4). Mutations (fks1F and gas1F) inducing cell
wall stress response lead to a two to four-fold increase in length. Nevertheless, the effect
of chs4-C693S on chitin structure is observed in these genetic backgrounds as well. We
also observed that a CFW induced cell wall stress response leads to four-fold increase in
chitin length. However, treatment with glucosamine, which activates chitin synthesis
16
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
without induction of the cell wall integrity pathway (7) has only a minor effect on the
length of the polymer.
DISCUSSION
Previous studies suggested two roles for Chs4p in chitin synthesis. One of its
proposed functions is activation of Chs3p catalytic activity (5, 11, 32, 40). Two-hybrid
analysis indicates that this process depends on direct interaction between the catalytic
subunit, Chs3p, and Chs4p (5, 11, 32). DeMarini and coworkers (11) revealed the second
role of Chs4p, anchoring Chs3p to the septins via Bin4p, which confers septum
localization to CSIII. Two facts indicate that the two roles are separable: a) delocalized
chitin is present in bni4 but not in the double bni4, chs4 mutant, and b) it is known that a
truncated version of Chs4p allows chitin synthesis but does not localize Chs3p to the
septum (11). If Chs4p has other function than stimulation of CSIII activity at the lateral
wall (for example recruiting Chs3p to the specific scaffolding proteins) remains to
establish.
In previous reports no phenotype related to chitin synthesis was attributed to loss
of the potential prenylation site (CVIM) in Chs4p (5, 11, 32, 39, 40). Two reasons led us
to reinvestigate the role of Chs4p farnesylation. First, a prenylation motif is present in a
number of Chs4p homologues, and second, we also realized that C-terminal tagging of
CHS4 gene in the genomic locus affects chitin content (data not shown). For the first time
we demonstrate here that the intact prenylation motif of Chs4p is indispensable for full
activity of CSIII. Lack of the farnesylation consensus sequence causes approximately a
60% decrease in CSIII activity which leads to a substantial lowering in chitin content and
17
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
partial resistance to CFW. Reduction in CSIII activity is also correlated with an
approximately 20 % decrease in average chitin chain length.
We used several approaches to prove that Chs4p is prenylated. We have shown
that unfarnesylated recombinant Chs4p is a substrate for FTase in vitro. The protein
isolated from yeast cells reacts with serum raised against N-acetyl-S-farnesyl-L-cysteine
which recognizes farnesyl or with less specificity geranylgeranyl-modified proteins. This
confirms the supposition that Chs4p is prenylated in vivo. The occurrence of
farnesylation but not geranylgeranylation is strongly supported by two facts. First,
deletion of the gene encoding the catalytic subunit of FTase increases the amount of
Chs4p which upon purification is the substrate for the enzyme in vitro. Second, changing
the farnesylation CVIM site to the known gernylgeranylation CVLL motif (31) corrects
only partially the phenotype caused by the mutation abolishing Chs4p prenylation. At this
point, however, we can not tell whether the phenotype induced by the CVIM to CVLL
motif substitution is due to the difference in structure of the attached prenyl group or
lower efficiency of prenylation by geranylgeranyl transferase I.
In almost all instances, prenylated proteins are membrane associated and protein
prenylation is often viewed as a modification which serves to increase protein
hydrophobicity, producing membrane association for proteins that otherwise lack
membrane affinity. Since Chs4p lacks any predicted transmembrane domain, one might
expect that membrane association of Chs4p would be at least to a certain extent
prenylation dependent. This prediction was not borne out, since wild type and
nonprenylated versions of Chs4p behave similarly in membrane association experiments,
and both are partially solubilized by 100 mM sodium carbonate or 0.5 NaCl as is typical
18
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
for peripheral membrane proteins. Further, similar to the catalytic subunit of CSIII,
Chs3p, Chs4p is not sensitive to Triton X100 treatment (Fig.2A). However, it is
completely solubilized by the anionic detergent SDS. This result is compatible with the
results of DeMarini and co-workers (11), which show that localization of the Chs4p to
the septum depends on interaction with Bni4p and Chs3p in a manner independent of the
presence of CaaX box. It also suggests that localization of Chs4p to the lateral wall
depends on the interaction with Chs3p, and perhaps also other proteins. Separation of
membranes by differential centrifugation (Fig.2B) or on sucrose density gradients 9data
not shown) indicates that prenylation of Chs4p does not affect its endomembrane
trafficking. Furthermore, staining of wild type and chs4-C693S yeast strains with the
chitin binding dye CFW did not reveal chitin delocalization in the mutant cells (not
shown). However, we could not exclude more subtle changes in Chs4p localization that
might be difficult to detect by standard molecular biology methods. For example,
prenylation may be involved in efficient loading of Chs4p to the plasma membrane.
Unfortunately, in contrast to Chs3p trafficking which has been subject of numerous
studies (35, 42, 43), little is known about Chs4p trafficking apart from the fact that both
Chs3p and Chs4p relocalize in response to stress conditions which leads to chitin
deposition in the lateral wall (8, 15). It will be of interest to study the route of Chs4p
trafficking in greater detail. Such information may be crucial in a final understanding the
role of Chs4p prenylation.
Although protein prenylation may facilitate anchoring of proteins to lipid
membrane, data suggesting its role in protein interaction and activation are accumulating
(12, 17, 19, 28, 30, 38). Our data support the proposition of Magee and Seabra (36) which
19
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
stresses the role of prenyl groups in protein-protein interaction in addition to its role in
membrane binding. Since prenylation does not affect membrane association of Chs4p but
clearly affects CSIII enzymatic activity and alters chitin chain length, is possible that the
farnesyl group attached to Chs4p interacts with a hydrophobic pocket in Chs3p,
modifying the structure of the CSIII complex, and in turn influencing the disengagement
of the nascent polymer from the enzymatic complex. This hypothesis is in good
agreement with the proposition that Chs4p is a direct activator of Chs3p (5, 11, 32, 40).
Other possible explanations of the described phenotype should be also taken in account.
The farnesyl group may be necessary, for example, for interactions with other protein
factors than Chs3p, or with the membrane bilayer during the assembly of the CSIII
complex. Here, one of the obvious candidates is Bni4p. However, we do not observe that
inactivation of BNI4 enhances or suppress CFW resistance of the chs4-C697S mutant in
comparison to the wild type background (data not shown).
There does not seem to be a specific role of farnesylation of Chs4p in the cell wall
stress response. As mentioned before, a defect in prenylation affects chitin synthesis in a
manner independent of the localization of chitin synthesis and the induction of the cell
wall integrity pathway. Also Chs3p requires Shc1p during sporulation as an alternative to
the Chs4p activating subunit (37). However, Shc1p does not posses a prenylation motif.
In spore cell walls, chitin is a substrate for chitin deacetylase, which forms chitosan (10).
Thus, the different structural requirement for the final product of Chs3p under different
conditions may not require prenylation of Shc1p.
Cell wall composition changes during growth, budding, mating, sporulation, and
stress response, and these dynamic processes require synthesis of new sets of proteins as
20
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
well as remodeling of the crosslinking of ß-1,3- and ß-1,6-glucans
(23). The CSIII
synthesized polymer is attached to different acceptors (d-1,3-glucan at the bud neck and
d-1,6- glucan in the lateral wall) depending on the deposition site. However, both types
have the same polydisperse size profile (7). In this study we observe a new characteristic
feature of cell wall remodeling during stress response, an increase in chitin content
coupled with an increase in average chitin chain length (Table 4). This increase in chain
length is clearly associated with an increase in the rate of chitin synthesis. Our suggestion
that changes in chitin chain length is one of the features of the cell wall stress response is
confirmed by the fact that treatment with glucosamine, which stimulates chitin synthesis
in the lateral wall without induction of the cell wall integrity pathway (6) has only a
minor effect on the length of the polymer. At this point we can only speculate on the
mechanism which leads to the changes in chitin chain length. One possibility involves
changes in the kinetic properties of CSIII and/or chain length termination mechanism, i.e.
the rate of the synthesis may increase without a change in the kinetics of chain
termination under some circumstances.
Several aspects of the present study are relevant to the regulation of Chs3p
activity in vivo. In the first place, it appears that while farnesylation of the enzyme may
not influence the extent of binding of Chs4p to Chs3p or to membranes, it has a major
effect on the catalytic activity of the holoenzyme. This can easily be envisioned as an
effect on the conformation of the catalytic domain of the protein. Prenylation of Chs4p
does not change the Km value with respect to UDP-N-acetyl-D-glucosamine
(approximately 1 mM), but it increases Vmax of the intact protein. Indeed, this may be
its only function. If this conclusion is true, how can one explain the observations that
21
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
increases in the level of Chs4p (but not Chs3p) increase chitin synthase activity (5, 40),
and that overproduction of the nonfarnesylated form of the enzyme is able to restore
chitin synthesis to wild type levels (5, 32)? The obvious answer would seem to be that
under normal circumstances Chs3p is not saturated with Chs4p, and that cellular levels of
Chs4p represent one of the factors that regulate the availability of active enzyme. Other
factors that may produce increased chitin synthesis include moderately increased
transcription of CHS4 and CHS3 (6, 18, 20, 40) and alteration in localization of the
enzyme (8, 15, 42). However, this attractive hypothesis needs to be proven. Our data
strongly encourage reconstruction in vitro of the active CSIII complex to finally
understand the role of Chs4p and explain the function of its prenylation.
ACKNOWLEDMENTS This work was supported by a grant from the National Institutes of Health GM31318 to PWR.
The authors are grateful to Dr. Laura Popolo form Università degli Studi di Milano for providing
anti Gas1p antibodies and to Dr. Martin Steffen from Boston University Medical School for
Mass Spectrometry analysis.
REFERENCES
1. Banks, I.R., C.A. Specht , M.J. Donlin, K.J. Gerik, S.M. Levitz, and J.K. Lodge.
2005. A chitin synthase and its regulator protein are critical for chitosan production
and growth of the fungal pathogen Cryptococcus neoformans. Eukaryot. Cell 4:1902-
1912.
2. Basso, A.D., P. Kirschmeier, and W.R. Bishop. 2006. Lipid posttranslational
modifications. Farnesyl transferase inhibitors. J. Lipid Res. 47:15-31.
22
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
3. Baron, R., E. Fourcade, I. Lajoie-Mazenc, C. Allal, B. Couderc, R. Barbaras, G.
Favre, J.C., Faye, and A. Pradines. 2000. RhoB prenylation is driven by the three
carboxyl-terminal amino acids of the protein: evidenced in vivo by an anti-farnesyl
cysteine antibody. Proc. Natl. Acad. Sci. USA 97: 11626-11631.
4. Brachmann, C.B., A. Davies, G.J. Cost, E. Caputo, J. Li, P. Hieter, and J.D.
Boeke. 1998. Designer deletion strains derived from Saccharomyces cerevisiae
S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and
other applications. Yeast. 14:115-132.
5. Bulawa, C. E. 1993 Genetics and molecular biology of chitin synthesis in fungi.
Annu Rev Microbiol. 47: 505-534.
6. Bulik, D.A., M. Olczak, H.A. Lucero, B.C.Osmond, P.W. Robbins, and C.A.
Specht. 2003 Chitin synthesis in Saccharomyces cerevisiae in response to
supplementation of growth medium with glucosamine and cell wall stress. Eukaryotic
Cell 2: 886-889
7. Cabib, E., and A. Duran. 2005. Synthase III-dependent chitin is bound to different
acceptors depending on location on the cell wall of budding yeast. J. Biol. Chem.
280:9170-9179.
8. Carotti, C., L. Ferrario, C. Roncero, M.H. Valdivieso, A. Duran, and L. Popolo.
2002. Maintenance of cell integrity in the gas1 mutant of Saccharomyces cerevisiae
requires the Chs3p-targeting and activation pathway and involves an unusual Chs3p
localization. Yeast 19: 1113-1124.
9. Casey, P.J., and M.C. Seabra. 1996. Protein prenyltransferases. J. Biol. Chem. 271:
5289–5292.
23
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
10. Christodoulidou, A., V. Bouriotis, and G. Thireos. 1996. Two sporulation-specific
chitin deacetylase-encoding genes are required for the ascospore wall rigidity of
Saccharomyces cerevisiae. J. Biol. Chem. 271: 31420-31425.
11. DeMarini, D.J., A.E. Adams, H. Fares, C. De Virgilio, G. Valle, J.S. Chuang, and
J.R. Pringle. 1997. A septin-based hierarchy of proteins required for localized
deposition of chitin in the Saccharomyces cerevisiae cell wall. J Cell Biol 139: 75-93.
12. Dietrich, A., A. Scheer, D. Illenberger, Y. Kloog, Y.I. Henis, and P. Gierschik.
2003. Studies on G-protein alpha.betagamma heterotrimer formation reveal a putative
S-prenyl-binding site in the alpha subunit. Biochem. J. 376: 449-456.
13. Elorza, M.V., H. Rico, and R. Sentandreu. 1983. Calcofluor white alters the
assembly of chitin fibrils in Saccharomyces cerevisae. Antimicrob. Agents.
Chemother. 39: 200–207.
14. Eastman, R.T., F.S. Buckner, K. Yokoyama, M.H. Gelb and, W.C. Voorhis.
2006. Thematic review series: lipid posttranslational modifications. Fighting parasitic
disease by blocking protein farnesylation. J. Lipid Res. 47:233-40
15. Garcia-Rodriguez, LJ., J.A.Trilla, C. Castro, M.H. Valdivieso, A. Duran, and C.
Roncero. 2000. Characterization of the chitin biosynthesis process as a compensatory
mechanism in the fks1 mutant of Saccharomyces cerevisiae. FEBS Lett. 478: 84-88.
16. Gueldener, U., J. Heinisch, G.J. Koehler, D. Voss, and J.H. Hegemann. 2002. A
second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in
budding yeast. Nucleic Acids Res. 30: e23.
24
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
17. Hoffman, G.R., N. Nassar, and R.A. Cerione. 2000. Structure of the Rho family
GTP-binding protein Cdc42 in complex with the multifunctional regulator RhoGDI.
Cell 100: 345-356.
18. Igual, J.C., A.L. Johnson, and L.H. Johnston. 1996. Coordinated regulation of
gene expression by the cell cycle transcription factor SWI4 and the protein kinase C
MAP kinase pathway for yeast cell integrity. EMBO J. 15: 5001-5013.
19. Inoue, S.B., H. Qadota, M. Arisawa, T. Watanabe, and Y. Ohya. 1999.
Prenylation of Rho1p is required for activation of yeast 1,3-beta-glucan synthase. J.
Biol. Chem. 274: 38119-38124.
20. Jung, U.S., and D.E. Levin.1999. Genome-wide analysis of gene expression
regulated by the yeast cell wall integrity signalling pathway. Mol Microbiol 34: 1049-
1057.
21. Kaiser, C.A., E.J. Chen, and S. Losko. 2002. Subcellular Fractionation of Secretory
Organelles. Methods Enzymol 351: 325-338.
22. Kang, M.S., N. Elango, E. Mattia, J. Au-Young, P.W. Robbins, and E. Cabib.
1984. Isolation of chitin synthetase from Saccharomyces cerevisiae. Purification of an
enzyme by entrapment in the reaction product. J. Biol. Chem. 259: 14966-14972.
23. Klis, F. M., P. Mol, K. Hellingwerf, and S. Brul. 2002. Dynamics of cell wall
structure in Saccharomyces cerevisiae. FEMS Microbiol. Rev. 26: 239-256.
24. Lin, H.P., S.C. Hsu, J.C. Wu, I.J. Sheen, B.S. Yan, and W.J. Syu. 1999.
Localization of isoprenylated antigen of hepatitis delta virus by anti-farnesyl
antibodies. J. Gen. Virol. 80: 91-96.
25
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
25. Lucero, H.A., M.J. Kuranda, and D.A. Bulik. 2002. A nonradioactive, high
throughput assay for chitin synthase activity. Anal. Biochem. 305: 97-105.
26. Magee, A.I., and M.C. Seabra. 2003. Are prenyl groups on proteins sticky fingers or
greasy handles? Biochem. J. 376: e3-4.
27. Magnelli, P., J.F. Cipollo, and C. Abeijon. 2002. A refined method for the
determination of Saccharomyces cerevisiae cell wall composition and beta-1,6-glucan
fine structure. Anal. Biochem. 301: 136-150.
28. Marshall, C.J. 1993. Protein prenylation: a mediator of protein-protein interactions.
Science 259: 1865-1866.
29. Maurer-Stroh, S., and F. Eisenhaber. 2005. Refinement and prediction of protein
prenylation motifs. Genome Biol. 6:R55.
30. Molnar, G., M.C. Dagher, M.Geiszt, J. Settleman, and E. Ligeti. 2001. Role of
prenylation in the interaction of Rho-family small GTPases with GTPase activating
proteins. Biochemistry 40:10542-10549.
31. Ohya, Y., H. Qadota, Y. Anraku, J.R. Pringle, and D. Botstein. 1993.
Suppression of yeast geranylgeranyl transferase I defect by alternative prenylation of
two target GTPases, Rho1p and Cdc42p. Mol. Biol. Cell. 4: 1017-1025.
32. Ono, N., T. Yabe, M. Sudoh, T. Nakajima, T. Yamada-Okabe, M. Arisawa, and
H. Yamada-Okabe. 2000. The yeast Chs4 protein stimulates the trypsin-sensitive
activity of chitin synthase 3 through an apparent protein-protein interaction.
Microbiology 146: 385-391.
26
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
33. Puig, O., F. Caspary, C. Rigaut, B. Rutz, E. Bouveret, E. Bragado-Nilsson, M.
Wilm, and B. Seraphin. 2001. The tandem affinity purification (TAP) method: a
general procedure of protein complex purification. Methods 24: 218-229.
34. Rigaut, G., A. Shevchenko, B. Rutz, M. Wilm, M. Mann, and B. Seraphin. 1999.
A generic protein purification method for protein complex characterization and
proteome exploration. Nat. Biotechnol. 17: 1030-1032.
35. Roncero, C. 2002. The genetic complexity of chitin synthesis in fungi. Curr. Genet
41:367-378.
36. Roncero, C., M.H. Valdivieso, J.C. Ribas, and A. Duran. 1988. Isolation and
characterization of Saccharomyces cerevisiae mutants resistant to Calcofluor white. J.
Bacteriol. 170:1950-1954.
37. Sanz, M., J.A. Trilla, A. Duran, and C. Roncero. 2002. Control of chitin synthesis
through Shc1p, a functional homologue of Chs4p specifically induced during
sporulation. Mol. Microbiol. 43: 1183-1195.
38. Sinensky, M. 2000. Functional aspects of polyisoprenoid protein substituents: roles
in protein-protein interaction and trafficking. Biochim. Biophys. Acta 1529: 203-209.
39. Sudoh, M., K. Tatsuno, N. Ono, H. Chibana, H. Yamada-Okabe, M. and
Arisawa. 1999. The Candida albicans CHS4 gene complements a Saccharomyces
cerevisiae skt5/chs4 mutation and is involved in chitin biosynthesis. Microbiology
145: 1613-1622.
40. Trilla, J.A., T. Cos, A. Duran, and C. Roncero. 1997. Characterization of CHS4
(CAL2), a gene of Saccharomyces cerevisiae involved in chitin biosynthesis and
allelic to SKT5 and CSD4. Yeast 13: 795-807.
27
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
41. Trueblood, C.E., Y. Ohya, and J. Rine. 1993. Genetic evidence for in vivo cross-
specificity of the CaaX-box protein prenyltransferases farnesyltransferase and
geranylgeranyltransferase-I in Saccharomyces cerevisiae. Mol Cell Biol.13:4260-
4275.
42. Valdivia, R.H., and R. Schekman. 2003. The yeasts Rho1p and Pkc1p regulate the
transport of chitin synthase III (Chs3p) from internal stores to the plasma membrane.
Proc. Natl. Acad. Sci. U S A 100: 10287-10292.
43. Valdivieso, M. H., L. Ferrario, M. Vai, A. Duran, and L. Popolo. 2000. Chitin
synthesis in a gas1 mutant of Saccharomyces cerevisiae. J. Bacteriol 182: 4752-4757.
44. Vallim, M.A., L. Fernandes, and J.A. Alspaugh. 2004. The RAM1 gene encoding a
protein-farnesyltransferase beta-subunit homologue is essential in Cryptococcus
neoformans. Microbiology. 150:1925-1935.
45. Winzeler, E.A., D.D. Shoemaker, A. Astromoff, H. Liang, K. Anderson, B.
Andre, R. Bangham, R. Benito, J.D. Boeke, H. Bussey, A.M. Chu, C. Connelly,
K. Davis, F. Dietrich, S.W. Dow, M. El Bakkoury, F. Foury, S.H. Friend, E.
Gentalen, G. Giaever, J.H. Hegemann, T. Jones, M. Laub, H. Liao, and R.W.
Davis. 1999. Functional characterization of the S. cerevisiae genome by gene deletion
and parallel analysis. Science. 285: 901-906.
28
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
FIGURE LEGENDS
FIG. 1. Chs4p is prenylated. (A) Chs4p is a substrate for farnesyl transferase in vitro.
Wt and mutated at CaaX prenylation box Chs4p purified from E. coli cells were used as
an acceptor for 3H labeled farnesyl group in an in vitro reaction with farnesyl transferase.
The proteins, after reaction, were separated by NuPAGE BisTris/SDS, blotted onto
PVDF membrane, and the position of prenylated protein was visualized by
autoradiography.
(B) Chs4p is prenylated in vivo. Wild type (left lane) or mutated at the farnesylation site
(right lane) Chs4p tagged with TAP (ProtA-TEV-CBP) epitope on the N-terminus was
purified from yeast cells and immobilized on the IgG sepharose beads. Then, CBP-Chs4p
(~82 kDa) was removed from TAP-Chs4p (~97 kDa) by cleavage with protease TEV.
IgG sepharose beads suspension samples (before [i] and after TEV cleavage) and a final
eluate containing purified wt or mutated CBP-Chs4p were analyzed by NuPAGE
BisTris/SDS and immunoblotting. TAP tagged proteins were recognized with PAP
antibodies (i) and prenylated CBP-Chs4p with anti-farnesyl antibodies (ii). (C)
Inactivation of FTase increases the level of unmodified Chs4p in cells. TAP-Chs4p
expressed in wt yeast cells or cells lacking the catalytic subunit of FTase (Ram1p) was
immobilized on IgG-Sepharose beads and used as a substrate for the FTase assay in vitro.
To measure background, the resin carrying TAP-Chs4pC693S mutant was used.
FIG.2. Prenylation does not affect subcellular distribution of Chs4p.
(A) Extraction of TAP-Chs4p. The total homogenate prepared in hypo-osmotic buffer
(HOB) was treated with 100 mM Na2CO3, 0.5 NaCl or 1% Triton X-100 (TX100) and
29
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
the soluble and insoluble fractions were separated by centrifugation at 200,000 g for 1 h.
Treatment with 4% Triton X 100 also does not solubilize Chs3p or Chs4p (not shown).
(B) Chs4p and Chs3p fractionation by differential centrifugation of membranes from wt
and mutated (Chs4pC693S
) cells. Total membranes from Con A coated spheroplasts were
separated by differential centrifugation (13,000 g for 10 min) into a PM/ER fraction (P)
and a Golgi/endosome-rich fraction (S). The protein composition of fractions obtained
from differential centrifugations and sucrose gradients were analyzed by SDS/nuPAGE
(PM marker: Gas1p, Chs3p; ER membrane marker Dpm1p, Soluble fraction marker:
Pgk1p)
FIG. 3. Mutation in the CVIM motif of Chs4p leads to resistance to Calcofluor
white. Substitution C693S blocks farnesylation of Chs4p. Substitution M696L and I695L
changes the farnesylation CVIM sequence to the gernylgeranylation CVLL (present in
Rho1p) motif. Cells grown overnight in liquid YPD medium were diluted to a final
concentration of 0.8 OD units per 1 ml in water, then 3 ol of each suspension and three
subsequent 10-fold serial dilutions were each spotted onto YPD, YPD +50 og/ml or 200
og/ml Calcofluor white plates. Cells were incubated at 30ºC for 3 days.
FIG. 4. Mutation of the CVIM motif of Chs4p affects chitin synthse III activity.
Substitution C693S blocks farnesylation of Chs4p. Substitution M696L and I695L
changes farnesylation CVIM to gernylgeranylation CVLL motif.
(A) Chitin synthase III activity was measured by the nonradioacive method as described
(25). As an enzyme source, the total membrane fractions from yeast cells grown 6 h at 30
ºC in YPD liquid medium, YPD supplemented with glucosamine (15 mmol) or with
30
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
Calcofluor white (25 og/ml) were used. Cultures for chitin synthase III assay were
inoculated with a saturated overnight culture and grown to midlog phase.
(B) Influence of trypsinzation on CSIII activity. As an enzyme source the total
membrane fractions from yeast cells grown 6 h at 30 ºC in YPD liquid medium, and
pretreated in the presence (+Trypsin) or absence of (-Trypsin) of protease were used.
31
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
Table 1. Strains and Plasmids
Strain/plasmid Genotype/Description
Yeast strains:
Source or
ref.
BY4741 Mat a his3F1; leu2F1; met15F01; ura3F1; 4
BY4742 Mat7c,his3F1; leu2FR= lys2F01; ura3F1; 4
KG101B As for BY4741, trp1F1-312::loxP This study
KG102B As for BY4742, chs4-C693S::loxP This study
KG103B As for BY4742,CHS4::loxP This study
KG109 As for BY4742, chs4-I695L,M696L::loxP This study
TAPCHS4B1 As for KG101B, TAP:: CHS4 This study
TAPCHS4B3 As for KG101B TAP:: CHS4::loxP This study
TAPCHS4B2 As for KG101B, TAP:: chs4-C693S::loxP This study
TAPCHS4B4 As for KG101B, TAP:: chs4-I695L,M696L::loxP This study
TAPCHS4B5 As for KG101B, TRP1 TAP::CHS4::loxP,ram1F::kanMX4 This study
TAPCHS4B6 As for KG101B, TAP:: chs4-C693S::loxP, ram1F::kanMX4 This study
BY741 gas1F As for BY4741, gas1F::kanMX4 45
BY4741 fks1F As for BY4741, fks1F
-
pUG27 Contains MX6HIS3 disruption cassette 16
pSH47 Expresses recombinase Cre 16
pBS1761 Contains N-terminal Tap tagging cassette 34
pET30a Bacterial Expression vector Novagen
pET30a-CHS4 Expresses Poly-His-Stag-Chs4 This study
pET30a-chs4-C693S Expresses Poly-His-Stag-Chs4-C693S This study
33
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
Table 2. Oligonucleotides Primers
Primer name Sequence
TAP1-CHS4
ACCAGGTTCTCGTCTTTTTTGGTGATAAAGTTAAAATAAAAGGATAAAA
AGAACAAAAGCTGGAGCTCAT
TAP2-CHS4 TGTGATTGCATTAAATGCTTCTTATATGGATGTACCTGCGGTGAACTTGC
CTTATCGTCATCATCAAGTG
CHS4 –290R AGGTACTGACGCAGCTCTAA
F1-CBP ATG GAA AAGAGAAGATGGAAAAAGAA
CHS4DR AGTGTAAACTGTTGCACCTATAAAGAATGAAAACAATCTAGTATGTGTA
CGCATAGGCCACTAGTGGATCTG
CHS4wt ACAAGAAGGATAAACAAGGTAAAAAAAAAAAAGACTGGTAATTATGTA
ACAGCTGAAGCTTCGTCTTCGTACGC
CHS4CtoS ACAAGAAGGATAAACAAGGTAAAAAAAAAAAAGACAGTGTAATTATGT
AACAGCTGAAGCTTCGTCTTCGTACGC
CHS4LL ACAAGAAGGATAAACAAGGTAAAAAAAAAAAAGACTGT GTATTG
TTATAACAGCTGAAGCTTCGTCTTCGTACGC
DF- TRP1 TATTGAGCACGTGAGTATACGTGATTAAGCACACAAAGGCAGCTTGGAG
TCAGCTGAAGCTTCGTCTTCGTACGC
DR-TRP1 CGAGTCTTTTAATAACTGGCAAACCGAGGAACTCTTGGTTTCTTGCCACG
CATAGGCCACTAGTGGATCTG
TRP1UP AGAGGGAGGGCATTGGTGA
CH4-1920 TGCTGAGCAGTCGATGGCAG
KanB GGATGTATGGGCTAAATG
CHS4BamHF
GGATCCATGGCAAGTTCACCGCAGGTAC
Chs4-R
GTACTTACATAATTACACAGTC
Chs4-C693S-R
GTACTTACATAATTACACTGTC
34
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
Table 3. Chitin content
Chitin content [nmol GlcNAc/ mg cells]
Growth conditions/ mutations affecting cell wall structure CHS4 allele
YPD YPD + GlcNH2 YPD+ CFW fks gas1
wt 5.47 (± 0.23) 12.99 (± 0.42) 22.23 (± 3.11) 18.37 (± 1.37) 17.03(± 1.01)
chs4-C693S 3.39 (± 0.28) 6.79 (± 0.40) 12.64 (± 2.14) 11.33 (± 1.31) 13.7 (±1.24)
chs4-I695,M696L 4.19 (± 0.40) 8.9 (± 0.8) 17.47 (± 1.77)
chs4 1.55 (± 0.15)
35
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
Table 4. Degree of Polymerization of Chitin.
Average chitin chain length CHS4 allele
Genetic background
Growth conditions
CHS4 chs4-C693S
Wt 59 (±6.1)* [KG103B] 46 (±1.7)* [KG102B]
Wt + Glucosamine 68 [KG103B]
Wt + CFW 206 [KG103B]
fks1F 114 [KG106B] 86 [KG104B]
gas1F 180 [KG107B] 151 [KG105B]
Chitin chain lengths were estimated as described in Experimental Procedures.
*Data point is an average of 4 independent experiments.
36
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
Figure 1
CA B
150 kDa
75 kDa
50 kDa
37 kDa
wt chs4-C693Swt chs4-C693S
98 kDa
64 kDa
98 kDa
64 kDa
i
ii
0
1000
2000
3000
4000
1 2
[cp
m/r
eact
ion
]wt ram1F
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
Figure 2
B
A
S P S P S P S P S P
HOB Na2CO3 NaCl TX100 SDS
wt
S P S P S P S P S P
chs4-C693S
HOB Na2CO3 NaCl TX100 SDS
Chs3p
TAP-Chs4p
Pgk1p
chs4-C693S
S PS P
wt
Chs3p
Gas1pTAP-Chs4pDpm1pAC
CEPT
ED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
Figure 3
0 og/ml 50 og/ml 200 og/ml 200 og/ml
2 days 3 days
chs4Fchs4-C693S
chs4-I695L,M696L
wt
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
-
Figure 4
AB
wt
chs4
C693
S
chs4
I695L
,M69
6L
wt
chs4
C693
S
chs4
I695L
,M69
6L
chs4
F
chit
in s
ynth
ase
III
activ
ity[n
mol
Glc
NA
c/h/
mg
prot
ein]
YPD YPD [GlcNH2] YPD [CFW]
0
5
10
15
20
25
30
35
40
wt
chs4
C693
S
chs4
I695L
,M69
6L
-Trypsin
0
5
10
15
20
25
chit
in s
ynth
ase
III
activ
ity[n
mol
Glc
NA
c/h/
mg
prot
ein]
wt
chs4
C693
Swt
chs4
C693
Sch
s4F
chs3
Fch
s4F
chs3
F
+Trypsin
ACCE
PTED
on April 3, 2021 by guest
http://ec.asm.org/
Dow
nloaded from
http://ec.asm.org/
Grabinska et al 2006.pdfDISCUSSIONPrevious studies suggested two roles for Chs4p in chitin synthesis. One of its proposed functions is activation of Chs3p catalytic activity (5, 11, 32, 40). Two-hybrid analysis indIn previous reports no phenotype related to chitin synthesisACKNOWLEDMENTSFIGURE LEGENDS