Slide 1

Practice Time Slide 2 Practice Find a partner & take out a separate piece of paper per group Write both teammates names on the paper Give the paper to one teammate (Other teammate just hold your horses) Slide 3 Practice Teammate with paper... Make-up & write down a template strand of DNA (21 bases long) When finished, hand to teammate Slide 4 Practice Teammate holding horses... Complete the double helix by creating the complement strand of DNA Slide 5 Practice Next... Switch roles (other teammate is now holding horses) Next 2... Do a set with 15, 20, & 25 bases Challenge Level: Include start/stop codons of genes Slide 6 RNA 1 Slide 7 So far... DNA is the code for genes which are the instructions for proteins. All living things use the same code. Its the different orders/combinations of the code that create differences We know ribosomes are where proteins are made. Slide 8 Todays question... How do we get from gene to ribosome? We need a messenger from the nucleus to the cytoplasm We need a way to transfer the code into protein. Slide 9 RNA RNA = ribonucleic acid DNA = deoxyribonucleic acid The RNA chain is also a polymer, with similarities to DNA. RNA has: 1. a sugar portion (plain ribose) 2. a phosphate group 3. a nitrogen base (4 total, but one base is different from DNA). Slide 10 Deoxyribose vs Ribose DNA RNA Slide 11 DNA vs. RNA PartDNARNA Sugar Phosphate Nitrogen bases Shape Slide 12 DNA vs. RNA PartDNARNA Sugardeoxyriboseribose PhosphateYes Nitrogen basesATGC? Shapedouble helix? Slide 13 The four RNA bases are... Adenine Uracil Guanine Cytosine The pairing is different between RNA and DNA. Can you see it? Slide 14 DNA vs. RNA PartDNARNA Sugardeoxyriboseribose PhosphateYes Nitrogen basesATGCAUGC Shapedouble helix? Slide 15 Base pairing DNA Double Helix TemplateComplement AT TA GC CG DNA to RNA DNA TemplateRNA AU TA GC CG Slide 16 What is the relationship among DNA, a gene, and a chromosome? a) A chromosome contains hundreds of genes, which are composed of protein. b) A gene contains hundreds of chromosomes, which are composed of protein. c) A gene is composed of DNA, but there is no relationship to a chromosome. d) A gene contains hundreds of chromosomes, which are composed of DNA. Lecture Question b)A chromosome contains hundreds of genes, which are composed of DNA. Slide 17 Protein Synthesis Summary DNA unzips One strand of DNA is read to make a RNA strand 3-letter words on RNA code for amino acids Amino acids link together to create a protein Slide 18 What does it mean to transcribe something? What does a transcriptionist do? Slide 19 What does it mean to transcribe something? What does a transcriptionist do? Slide 20 To start the process, an RNA copy of the DNA strand is made This process is called transcription Transcription = creation of the message from nucleus to send to the cytoplasm. This message is called messenger RNA or mRNA. It is a form of RNA DNA copied to RNA Slide 21 A single strand of RNA Formed from the template of one DNA strand Process is completed by the enzyme RNA polymerase. How do you know RNA polymerase is an enzyme? polymerASE So What Is mRNA (messenger RNA) Slide 22 DNA vs. RNA PartDNARNA Sugardeoxyriboseribose PhosphateYes Nitrogen basesATGCAUGC Shapedouble helixsingle strand Slide 23 How do we make this RNA strand? Slide 24 Order of Protein Making Gene Transcription Translation Protein Slide 25 DNA template strand (the side of the DNA with the code) is read from the phosphate end. mRNA strand is also made from the phosphate end. DNA complement strand (DNA across from the template strand) is not used in making the mRNA. mRNA Synthesis Slide 26 An RNA copy of the DNA strand is made Copied from DNAs template strand Done by RNA Polymerase This message is called messenger RNA or mRNA. mRNA is single stranded Transcription Summary Slide 27 Disclaimer: You are not expected to know the details of Transcription, but it sometimes helps to see how the process works to better understand it. I will tell you what you should and should not know. Slide 28 Transcription: Step 1 1. Initiation RNA Polymerase attaches to DNA double helix and separates the double helix Slide 29 Transcription: Step 2 2. Elongation RNA Polymerase moves down the DNA template strand Base pairs RNA nucleotides to the DNA C with G G with C A with U T with A Slide 30 Close-Up: Elongation Slide 31 Transcription: Step 3 3. Termination RNA Polymerase reaches a stop codon on the DNA template strand RNA Polymerase releases the single strand of mRNA RNA Polymerase dissociates (leaves DNA) Slide 32 Transcription & Translation http://www.youtube.com/watch?v=983lhh20rGY http://www.youtube.com/watch?v=983lhh20rGY Real-time model of Transcription and Translation http://www.youtube.com/watch?v=41_Ne5mS2ls http://www.youtube.com/watch?v=41_Ne5mS2ls Slide 33 Transcription Practice Find a partner... Each of you summarize transcription in your own words Pick out/modify/choose the best summary Be prepared to share with the class Slide 34 RNA Polymerase attaches to DNA at the start codon and separates the double helix RNA Polymerase moves down the DNA template strand Base pairs RNA nucleotides to the DNA & adds the RNA nucleotides to the strand of (mRNA) RNA Polymerase reaches a stop codon (message) on the DNA template strand RNA Polymerase leaves and detaches mRNA strand Transcription Summary Slide 35 DNA is highly folded and tightly compact Always? REMEMBER: Slide 36 mRNA Synthesis Slide 37 Accessibility DNA must be accessible in order for its information to be read, copied, or modified (purposefully) So why would being highly folded and tightly compacted be beneficial? Needs to fit into nucleus Turn on/off genes Slide 38 Practice Write the following DNA strand on your same piece of practice paper: [leave a line space] TAC ATA CAC GGG AAA TTC CCC TAG ATT [leave a line space] Above this strand, make the opposite side of the DNA (complimentary strand) Below the template, make the mRNA strand Slide 39 Practice Answers DNA: TACATACACGGGAAATTCCCCTAGATT DNA: ATGTATGTGCCCTTTAAGGGGATCTAA mRNA: AUGUAUGUGCCCUUUAAGGGGAUCUAA Where does the mRNA strand go after its made? Where is the mRNA strand made? Slide 40 Creative Practice Write the following DNA strand on your same piece of practice paper:[leave a line space] [Make up your own DNA template strand] [leave a line space]Above this strand, make the opposite side of the DNA.Below the template, make the mRNA strand Slide 41 Practice Write down your DNA codons in the boxes Make mRNA codons using the correct complementary RNA bases. Check your answer with your neighbor for agreement. Slide 42 Order of Protein Making Gene Transcription Translation Protein Slide 43 Slide 44 DNA Art Project Take the RNA pieces and make a strand of mRNA for your left-side strand. Color pieces consistently with DNA except... Ribose is different Uracil is different Cut & color today Tape into a strand?